
==== Front
Transl Pediatr
Transl Pediatr
TP
Translational Pediatrics
2224-4336
2224-4344
AME Publishing Company

tp-13-08-1395
10.21037/tp-24-153
Original Article
Genetic association of GJA8 with long-segment Hirschsprung’s disease in southern Chinese children
Ma Zuyi #
Zhong Weiyong #
Song Kai #
Chen Jiazhang
Tian Bowen
Chen Yuqiong
Li Lin
Lan Chaoting
Zhong Wei
He Qiuming
Wu Yuxin
Provincial Key Laboratory of Research in Structure Birth Defect Disease and Department of Pediatric Surgery, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, Guangzhou, China
Contributions: (I) Conception and design: Z Ma, Y Wu; (II) Administrative support: W Zhong, Q He, Y Wu; (III) Provision of study materials or patients: J Chen, B Tian, Y Chen, C Lan, L Li; (IV) Collection and assembly of data: Z Ma, W Zhong; (V) Data analysis and interpretation: Z Ma, K Song; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

# These authors contributed equally to this work as co-first authors.

Correspondence to: Qiuming He, PhD, MD; Yuxin Wu, MD, PhD. Provincial Key Laboratory of Research in Structure Birth Defect Disease and Department of Pediatric Surgery, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, No. 9 Jinsui Road, Zhujiang New Town, Tianhe District, Guangzhou 510623, China. Email: qiuminghe@foxmail.com; wuyuxin.hugo@qq.com.
28 8 2024
31 8 2024
13 8 13951405
22 4 2024
12 8 2024
2024 Translational Pediatrics. All rights reserved.
2024
Translational Pediatrics.
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0.
Background

Hirschsprung’s disease (HSCR) is a complex congenital neurodevelopmental disorder affecting colons caused by both genetic and environmental factors. Although several genes have been identified as contributing factors in HSCR, the pathogenesis is still largely unclear, especially for the low prevalent long-segment HSCR (L-HSCR). Gap junction protein alpha 8 (GJA8) is involved in several physiological processes and has been implicated in several diseases. However, the relationship between GJA8 single nucleotide polymorphism (SNP) rs17160783 and HSCR in the southern Chinese population remains unknown. The study aimed to explore the association of genetic variants in GJA8 and HSCR susceptibility in southern Chinese.

Methods

SNP rs17160783 A>G in GJA8 was genotyped by TaqMan SNP Genotyping Assay in all samples, which included 1,329 HSCR children (cases) and 1,473 healthy children (controls). Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the association of GJA8 polymorphisms with HSCR susceptibility. The GTEx database and transcription factor binding site (TFBS) prediction were used to analyze the potential regulatory function of rs17160783.

Results

Genetic association analysis illustrated that rs17160783 could increase the risk of L-HSCR (Padj=0.04, ORadj =1.48, 95% CI: 1.02–2.14). We also found that GJA8 expression was increased in HSCR and neurodevelopmentally impaired animal models. External epigenetic data revealed that GJA8 rs17160783 may have the potential to regulate the expression of the GJA8, possibly by altering the binding of transcription factors for GJA8, and consequently impacting the PI3K-Akt signaling pathway during the enteric nervous system (ENS) development.

Conclusions

Our results suggested that rs17160783 might play a regulatory role in GJA8 expression and increase the susceptibility of L-HSCR in children from southern China.

Keywords:

Hirschsprung’s disease (HSCR)
gap junction protein alpha 8 (GJA8)
single nucleotide polymorphism (SNP)
genetics
the grant of the Research Foundation of Guangzhou Women and Children’s Medical Center for Clinical DoctorNo. 2023BS013 the China Postdoctor Science FoundationNo. 2023M730791 the Guangdong Basic and Applied Basic Research FoundationNo. 2024A1515013190 No. 202201010833 the National Natural Science Foundation of ChinaNo. 82301955 No. 82370526 the Science and Technology Project of GuangzhouNo. 2024A03J1238
==== Body
pmcHighlight box

Key findings

• Gap junction protein alpha 8 (GJA8) rs17160783 polymorphism is associated with increased long-segment Hirschsprung’s disease (L-HSCR) risk in the southern Chinese population.

• Single nucleotide polymorphism rs17160783 may have the potential to regulate the expression of the GJA8, possibly by altering the binding of transcription factors for GJA8, and consequently impacting the PI3K-Akt signaling pathway during the enteric nervous system development.

What is known and what is new?

• Hirschsprung’s disease (HSCR) is a congenital disorder of the colon in children and causes significant morbidity and even death without proper treatment.

• We found that GJA8 rs17160783 might increase the susceptibility of L-HSCR in the southern Chinese population.

What is the implication, and what should change now?

• Surgery is the main therapy for HSCR; however, the outcomes are often unsatisfactory. Our findings provide a new candidate gene for the exploration for the underlying pathology, which could be a potential target for the purpose of disease prevention and therapy.

Introduction

Hirschsprung’s disease (HSCR) is a common congenital malformation of the digestive tract. Abnormal development of the enteric nervous system (ENS) is known to be involved in its pathogenesis. The formation of the normal ENS requires the completion of migration, proliferation and differentiation of enteric neural crest cells (ENCCs) in the intestine, culminating in mature neurons and glial cells (1). Overall, the global prevalence of HSCR is approximately 1/5,000, whereas the incidence of HSCR in Asia is 1.4/5,000 (2). The male-to-female ratio in HSCR is 4:1 (3). According to the extent of pathological changes in the intestine, HSCR can be divided into several clinical classifications including short-segment HSCR (S-HSCR), long-segment HSCR (L-HSCR), total colonic aganglionosis (TCA) and total intestine aganglionosis (TIA) (4).

L-HSCR is characterized by aganglionosis affecting a longer segment extending to the transverse colon. The prevalence of L-HSCR in patients with HSCR is approximately 10%, but compared with S-HSCR, patients with L-HSCR have different clinical and histological presentations (5,6). Due to its atypical clinical manifestations, L-HSCR is often misdiagnosed and more often diagnosed by surgical operation (6). Consequently, L-HSCR is often linked to severe complications, and the prognosis, even with surgical treatment, remains poor (7-9). Previous research has found different symptoms among various subtypes of HSCR, suggesting that they may have different pathogenic mechanisms (10). However, the mechanism underlying L-HSCR is still largely unknown.

Current studies suggest that the abnormal proliferation, migration, and differentiation of the ENCCs during the development of the ENS lead to the absence of neurons in the colon (11). Genetic variations in genes such as RET (2,12), GDNF (13), PHOX2B (14), EDN3 (15,16), EDNRB (17,18), SOX10 (19) have been proven to be associated with HSCR. However, this is far from enough to represent the genetic background of all HSCR subtypes, and more research is still needed to discover other genetic markers.

Gap junction protein alpha 8 (GJA8), which encodes one of the transmembrane junction proteins (also known as connexins), is recognized for its pivotal role in the ocular lens, particularly in maintaining lens transparency and development (20,21). It is noteworthy that mutations in the GJA8 gene have been associated with a spectrum of ocular pathologies, including congenital cataracts (22-25). Recent research indicates that the effects of GJA8 mutations are not limited to the eyes and may be associated with certain pathological conditions in the nervous system. Connexin 50 encoded by GJA8 is an adhesion molecule (26), is believed to play a role in communication between nerve cells (27), potentially affecting how neural signals are transmitted and how cellular activities are coordinated within the nervous system. GJA8 is also thought to be involved in regulating oxidative stress and cell death, which could contribute to processes that protect the nervous system (23). Moreover, studies reveal that connexins play crucial roles in the growth, migration, and apoptosis of nerve cells (28,29). Studies have shown that overexpression of GJA8 inhibits cell migration and increases expression of the adhesion molecule N-cadherin (30-32). Overexpression of GJA8 increases expression of the astrocyte marker GFAP and decreases expression of the neuronal marker Tuj1, suggesting that GJA8 impairs neuronal differentiation (33).

Therefore, it is hypothesized that the GJA8 may play a role in the development of the ENS. Given that the single nucleotide polymorphism (SNP) rs17160783 is located at a regulatory genomic region of GJA8, we conducted a study to explore the genetic association between GJA8 and HSCR in children from southern China. We present this article in accordance with the MDAR reporting checklist (available at https://tp.amegroups.com/article/view/10.21037/tp-24-153/rc).

Methods

Study subjects

All participants’ data and samples in this study were obtained from Guangzhou Women and Children’s Medical Center. This study was approved by the ethics committee of Guangzhou Women and Children’s Medical Center (No. 2018052406). Informed consent was obtained from the participants’ legal guardians. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). In the case group, patients were diagnosed with HSCR by histological examination of colon biopsies after surgical resection and were classified into S-HSCR and L-HSCR according to the length of the aganglionosis colon by pathologists. There were 1,473 individuals without gastrointestinal diseases or other systemic diseases enrolled in the control group from the physical examination center. Demographic information, including age and gender, was obtained from the medical record system for both HSCR cases and controls (Table 1).

Table 1 Clinical characteristics of the subjects

Characteristics	HSCR (n=1,329)	Controls (n=1,473)	P	
Gender (female/male)	217/1,112	458/1,015	<0.001†	
Age (months), mean ± SD	8.37±20.50	18.61±19.75	<0.001‡	
Ethics	Chinese Han	Chinese Han		
Clinical characteristics	
   S-HSCR	1,034	N/A		
   L-HSCR	295	N/A		
†, χ2-test; ‡, Mann Whitney U test. SD, standard deviation; S-HSCR, short-segment Hirschsprung’s disease; L-HSCR, long-segment Hirschsprung’s disease; N/A, not available.

Gene function enrichment analysis

A microarray dataset of containing four pairs of Hmx1-KO and wild-type mice were downloaded from the Gene Expression Omnibus (GEO) database (GSE47002). The Hmx1-KO mouse model is a valuable tool in neuroscience research, with applications including the study of neural development, particularly in sensory organs and the central nervous system, as Hmx1 is a homeobox gene that plays a crucial role in the development of the nervous system (34).

The Gene Expression Omnibus 2R (GEO2R) was used to identify differentially expressed genes between the two groups using default parameters. The genes highly co-expressed with GJA8 were identified (r>0.9) and gene functional enrichment analysis was performed on these genes.

Transcription factor binding sites prediction

HumanTFDB (http://bioinfo.life.hust.edu.cn/HumanTFDB/) was used to check whether polymorphism would destroy the putative transcription factor motif. We included the highly linkage disequilibrium (LD)-linked SNPs (r2>0.8) to investigate the regulatory elements from the GTEx database (http://www.gtexportal.org/).

TaqMan genotyping

Genomic DNA was extracted from participants’ peripheral blood using a Blood DNA Kit (TIANGEN, Cat No. DP348-03). PCR was performed in a 5-µL reaction, and thermal cycling conditions were set according to the manufacturer’s protocol. Our primary investigation involved searching the dbSNP database and utilizing SNPinfo software to identify SNPs within the GJA8 gene that may have functional implications. Here, the minor allele frequency (MAF) of the selected polymorphism among Chinese Han individuals exceeds 5%. Finally, we selected SNP rs17160783 and it was genotyped by the TaqMan SNP Genotyping Assay (Applied Biosystem, Cat No. 4351379) on all samples, which included 1,329 HSCR children (cases) and 1,473 healthy children (controls). We analyzed repeated genotyping by randomly selecting 10% of samples from cases and controls. 100% consistency was achieved.

Cell culture

We used a method for reprogramming peripheral blood mononuclear cells (PBMCs) into human induced pluripotent stem cells (hiPSCs). PBMCs were obtained from healthy donors and transduced with a non-integrating Sendai virus vector carrying the reprogramming factors OCT4, SOX2, KLF4 and c-MYC, as previously described (35). The infected PBMCs were then cultured in StemPro-34 medium supplemented with the necessary growth factors to support the reprogramming process. Colonies with embryonic stem cell-like morphology were identified and selected for further expansion and characterization.

Neural crest differentiation of hiPSCs

When hiPSCs reached ~80% confluence, they were prepared to be dissociated into single cells using Accutase® and then seeded onto Matrigel-coated plates. To initiate induction (day 1), cells were incubated with day 1 medium for 24 hours and then cultured in N2 medium for 6 days (7 days in total) as previously described (36).

RNA extraction and real-time quantitative reverse transcription PCR (qRT-PCR)

Total RNA was extracted using TRIzol reagent (Invitrogen™, Cat. No. 15596018) according to the standard protocol. Following the manufacturer’s instructions, 1,000 ng of RNA was transcribed into complementary DNA using the HiScript II One Step qRT-PCR Probe Kit (Vazyme, Cat No. Q222-01). Target primers were amplified using ChamQTM Universal SYBR® qPCR Master Mix (Vazyme, Cat. No. q712).

Statistical analysis

In this study, the Chi-squared test was used to carry out the Hardy-Weinberg equilibrium (HWE) in the control group to understand whether there was heterogeneity in the sample. To verify the association between SNP and HSCR, MAF was compared between the case group and the control group under additive, dominant and recessive models, respectively. All this statistic calculation was explained by logistic regression with PLINK 1.9 software. The odds ratio (OR) and 95% confidence intervals (CIs) indicated the risk of allele for the disease. When the P value was less than 0.05, the results were considered statistically significant.

Results

GJA8 may be involved in ENS development

Studies have shown that GJA8 is expressed in ependymal stem progenitor cells and several neurons, such as several groups of neurons in the cerebellum and related areas at the midbrain-hindbrain boundary, and in neurons in the ganglion cell layers (33,37). It was reported when GJA8 is overexpressed, GFAP expression is increased, while TUJ1 expression is decreased, suggesting that GJA8 may facilitate the differentiation of neural precursor cells into glial cells and impair neuronal differentiation (33). Additionally, overexpression of GJA8 stimulated autophagy (38). In neurodevelopmentally impaired animal models (39), we found that GJA8 expression was increased (Figure 1A). We further identified the genes highly co-expressed with GJA8 expression (r>0.9) and performed Gene Ontology (GO) enrichment analysis. We found that the gene set was significantly enriched in GO/KEGG terms, including PI3K-Akt signaling pathway, neurogenesis, generation of neurons, and neuronal differentiation (Figure 1B). The PI3K-Akt signaling pathway has been reported as a key signaling pathway for regulating cell survival, autophagy, neurogenesis, neuron proliferation, and differentiation (40,41). In HSCR, the PI3K/AKT pathway is thought to be involved in the migration, proliferation, and differentiation of ENCCs, which are essential for the formation of the ENS (42). Moreover, studies have shown that RET can affect the proliferation and survival, apoptosis, migration, and differentiation of ENCCs by activating the PI3K-Akt pathway (43,44). Hence, we hypothesized that GJA8 may play a role in the ENS development by affecting the PI3K-Akt pathway. To test our hypothesis, we first collected both the ganglionic and aganglionic colons from the patients to check the expression of GJA8 in HSCR colons. Compared to normal colons, GJA8 expression was increased and the PI3K-Akt pathway was activated in aganglionic colons (Figure 1C). Using hiPSCs-derived ENCCs, we also found that the expression of GJA8 was increased in HSCR patients-derived ENCCs (Figure 1D). Taken together, these findings suggested that the GJA8 may be involved in the ENS development.

Figure 1 GJA8 may be involved in ENS development. (A) GJA8 expression was increased in neurodevelopmentally impaired animal models. (B) Functional enrichment of genes co-expressed with GJA8 associated with neural development. (C) Expression of GJA8 and the PI3K-Akt signaling pathway in HSCR patients and controls, respectively. n=10/group. (D) Expression of GJA8 in ENCCs induced from control and HSCR patient-derived hiPSCs, respectively (n=3 biological replicates). FC, fold change; KO, Hmx1-KO mice; WT, wild-type mice; HSCR, Hirschsprung’s disease; GJA8, gap junction protein alpha 8; ENS, enteric nervous system; ENCCs, enteric neural crest cells; hiPSCs, human induced pluripotent stem cells.

Association of GJA8 rs17160783 with L-HSCR susceptibility

We used 1,329 HSCR cases and 1,473 controls to assess the association between GJA8 rs17160783 and HSCR. The clinical information of the participants was summarized in Table 1. The genotype frequency of rs17160783 and the association analysis between rs17160783 and HSCR were calculated, as shown in Table 2 and Table S1. As shown, a total of 1,292 cases and 1,458 controls were successfully genotyped. HWE test showed no obvious heterogeneity for rs17160783 (P>0.05). The frequency of rs17160783-G was close to the frequency in East Asians from gnomAD (gnomad.broadinstitute.org). Subsequently, logistic regression tests were conducted using the additive, dominant, and recessive models respectively. We found that rs117160783-G was significantly associated with an increased L-HSCR risk in the dominant model (Padj=0.04, ORadj =1.48, 95% CI: 1.02–2.14, Table 2). Evidence of association between rs17160783 and S-HSCR is insufficient (Padj=0.54, OR =1.08, 95% CI: 0.86–1.36, Table S1).

Table 2 Association between SNP rs17160783 and L-HSCR

SNP	A1/A2	MAF (gnomAD)	AFF	UNAFF	Model	OR (95% CI)	P	OR.adj	P.adj	
rs17160783	G/A	0.07 (0.08)	1/51/234	7/189/1,262	DOM	1.43 (1.02–2.00)	0.04	1.48 (1.02–2.14)	0.04	
REC	0.73 (0.09–5.92)	0.77	0.60 (0.07–5.24)	0.64	
ADD	1.37 (0.99–1.88)	0.055	1.40 (0.99–1.98)	0.059	
SNP, single nucleotide polymorphism; L-HSCR, long-segment Hirschsprung’s disease; A1/A2, risk/non-risk allele; MAF, minor allele frequency in the control group; gnomAD, minor allele frequency in gnomAD East Asians; AFF, allele frequency in case group; UNAFF, allele frequency in the control group; DOM, REC, ADD, the association test following dominant, recessive and additive models; OR, odds ratio; CI, confidence interval; OR.adj, odds ratio after adjusting the genders of all the samples; P.adj, P values adjusted for gender and age by logistic regression.

Regulatory potential of rs17160783

CCCTC binding factor (CTCF), a binding protein that influences the regulation of transcription, has been shown to play a key role in neural development (45), mainly by regulating chromatin structure and gene expression (46,47). Studies have shown that CTCF maintains the survival of neural progenitor cells, contributing to a delicate balance between neural progenitor cell proliferation and differentiation (48). Moreover, loss of the CTCF induces neuronal death (49). We found that rs17160783 had high LD (r2=0.91) with two SNPs (rs17160763 and rs28575808), both of which are located at CTCF binding sites (Figure 2), indicating that they may regulate the transcription factor binding in this region. According to the prediction results from HumanTFDB (http://bioinfo.life.hust.edu.cn/HumanTFDB/), we found the rs17160783-G could change the binding scores of SPIB, while rs17160763-A could increase the binding of STAT5A (P=3.58e−5), PPARG (P=6.35e−5) and RARA (P=8.34e−5) (Table 3). Studies have shown that SPIB and PPARG mediate apoptosis through the PI3K-Akt signaling pathway (50,51). Moreover, SPIB (52,53), STAT5A (53), PPARG (54) and RARA (55) are related to cell differentiation respectively.

Figure 2 rs17160783 had a high linkage disequilibrium (r2=0.91) with two SNPs (rs17160763 and rs28575808), both of which are located at CTCF binding sites. LD, linkage disequilibrium; SNP, single nucleotide polymorphism; CTCF, CCCTC binding factor.

Table 3 Prediction of transcription factor binding sites

SNP	Allele	TF	Start	Stop	Strand	Score	P value	Q value	Matched sequence	
rs17160783	G (risk)	SPIB	12	27	−	12.1579	3.28E−05	0.00236	ACCCAGTGCTTCCTTT	
A (protective)	SPIB	12	27	−	11.2105	6.05E−05	0.00435	ATCCAGTGCTTCCTTT	
rs17160763	A (risk)	STAT5A	23	30	−	8.34211	3.58E−05	0.00315	CACTTCTA	
PPARG	25	44	+	7.24444	6.35E−05	0.00406	GAAGTGCAGCATGACTCCAA	
RARA	26	41	−	9.82895	8.34E−05	0.00601	GAGTCATGCTGCACTT	
‘+’ indicates the positive DNA strand, while the ‘−’ indicates the negative DNA strand. SNP, single nucleotide polymorphism; TF, transcription factor; SPIB, Spi-B Transcription Factor; STAT5A, Signal Transducer And Activator Of Transcription; PPARG, Peroxisome Proliferator-Activated Receptor Gamma; RARA, Retinoic Acid Receptor Alpha.

Discussion

As a condition characterized by a lack of intestinal ganglionic cells, children with HSCR are prone to several symptoms, including chronic constipation, abdominal distention, diarrhea and vomiting, which can be life-threatening in severe cases (56,57). The current treatment is surgical management, but serious complications such as enterocolitis may occur after surgery (58). However, the understanding of the pathogenesis of HSCR remains considerably limited.

In this study, we mainly focused on the HSCR susceptibility of the GJA8 gene. As previously described, GJA8 encodes a gap junction protein that functions in intercellular communication and affects the exchange of ions and small molecules between different cells. Recent studies have shed light on the potential mechanisms by which GJA8 mutations contribute to congenital cataracts, these mutations often result in amino acid substitutions that may affect the protein’s function and are located in hotspot mutation regions, suggesting potential pathogenicity (27,59,60). Although current research focuses mainly on its role in ocular pathologies, GJA8 may also have latent functions in the nervous system. Previous studies have revealed that GJA8 is crucial for the differentiation of nerve cells (33). The proteins encoded by GJA8 control the migration of neural crest cells in vivo by regulating the transcription of N-cadherin (28,32). Furthermore, studies have shown that GJA8 regulates oxidative stress and cell death, potentially contributing to neuroprotective mechanisms (23). We also found that the expression of GJA8 was increased in HSCR and neurodevelopmentally impaired animal models, and further GO analysis revealed that GJA8 is involved in the PI3K/AKT signaling pathway. The PI3K/AKT pathway is activated by various extracellular stimuli and this activation is critical for regulating cell survival, proliferation, autophagy, neurogenesis, and synaptic plasticity in the nervous system (61,62). In neurodegenerative diseases such as Alzheimer’s and Parkinson’s, the PI3K/AKT signaling pathway is over-activated, leading to autophagy imbalance, pathological protein accumulation, and neuron loss (63,64). In HSCR, the PI3K/AKT pathway is thought to be involved in the migration, proliferation, and differentiation of ENCCs, which are essential for the formation of the ENS (42). Moreover, this signaling pathway has been reported as a key signaling pathway for neurogenesis and neuroprotection and is associated with RET and RET-regulating pathways in HSCR (40,43). In addition, we found that the PI3K-Akt pathway was activated in aganglionic colons by qRT-PCR analysis.

Our investigation revealed that rs17160783 in the GJA8 locus was associated with L-HSCR in southern Chinese. However, the association with S-HSCR was not significant. Previous studies have demonstrated that mutations in RET, GDNF, and SOX10 are associated with L-HSCR and syndromic HSCR, but they do not explain the susceptibility to S-HSCR, which is the predominant subtype of HSCR. The genetic mechanisms underlying the differential susceptibility to HSCR subtypes still need to be elucidated. rs17160783 is in high LD with two SNPs which have the potential to affect CTCF binding, suggesting that these genetic variants may regulate the expression of GJA8 by changing the binding affinity of transcription factors. Next, we predicted the changes in binding transcription factors between the risk and non-risk alleles. The prediction results indicate that the HSCR-associated SNP may increase the binding of SPIB, STAT5A, RARA, and PPARG. SPIB and PPARG are important regulators of cell differentiation and can mediate apoptosis through the PI3K-Akt pathway (50,51,53), whereas, RARA plays a key role in neuronal differentiation (65). A balance between STAT5A and PI3K-Akt is essential for T-cell viability (66) and determines neurotrophic or neuroprotective effects in neurons (67,68). Together, SNPs in GJA8 may regulate the expression of GJA8 possibly by altering the binding of transcription factors for GJA8, and consequently impacting the PI3K-Akt signaling pathway during the ENS development (Figure 3).

Figure 3 Hypothesis of rs17160783 risk on L-HSCR. rs17160783 may regulate the expression of GJA8, which further causes abnormal development of ENS through the PI3K-Akt signaling pathway. GJA8, gap junction protein alpha 8; L-HSCR, long-segment Hirschsprung’s disease; ENS, enteric nervous system.

In addition, the association of GJA8 with L-HSCR suggests that genetic variations in this gene may influence disease risk, potentially offering a new avenue for early detection and personalized medicine approaches. However, the translation of this genetic insight into clinical practice is not without challenges. The biological function of GJA8 in the context of HSCR and the specific role of its SNPs in disease pathogenesis requires further elucidation. Current limitations include the need for comprehensive functional studies to understand the mechanistic link between GJA8 variants and disease phenotypes. Additionally, the clinical utility of GJA8 SNPs as diagnostic or therapeutic targets must be validated through rigorous epidemiological and clinical studies, ensuring their predictive value and therapeutic relevance. To advance our understanding of GJA8 in HSCR, future research should focus on interdisciplinary collaboration among experts in genetics, molecular biology, clinical medicine, and other fields.

Although our study is the first discovery of association between GJA8 rs17160783 and L-HSCR, there are still some limitations in this study. Firstly, all participants were recruited from the same hospital, raising the possibility of selection bias. Multi-center studies in the future would help to reduce the incidence of this bias. Secondly, the sample size of L-HSCR in our study was small and there is an urgent need for multi-center studies with larger sample sizes to better understand this rare disease. Thirdly, the molecular mechanism relating GJA8 to the PI3K-Akt signaling pathway needs validation. We hope that future studies will pay more attention to this gene and confirm it with more experiments.

Conclusions

In conclusion, in our study, we found an association between L-HSCR and rs17160783 in southern Chinese. This SNP may have the potential to regulate the expression of the GJA8, possibly by altering the binding of transcription factors for GJA8, and consequently impacting the PI3K-Akt signaling pathway during the ENS development.

Supplementary

The article’s supplementary files as

10.21037/tp-24-153 10.21037/tp-24-153 10.21037/tp-24-153

Acknowledgments

We thank the Clinical Biological Resource Bank of Guangzhou Women and Children’s Medical Center for providing the clinical samples.

Funding: This work was supported by the grant of the Research Foundation of Guangzhou Women and Children’s Medical Center for Clinical Doctor (No. 2023BS013 , to Y.W.); the China Postdoctor Science Foundation (No. 2023M730791 , to C.L.); the Guangdong Basic and Applied Basic Research Foundation (No. 2024A1515013190 to C.L., No. 202201010833 to W.Z.); the National Natural Science Foundation of China (No. 82301955 to C.L., No. 82370526 to W.Z.); the Science and Technology Project of Guangzhou (No. 2024A03J1238 , to C.L.).

Data Sharing Statement

Available at https://tp.amegroups.com/article/view/10.21037/tp-24-153/dss 10.21037/tp-24-153

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). This study was approved by the ethics committee of Guangzhou Women and Children’s Medical Center (No. 2018052406). Informed consent was obtained from the participants’ legal guardians.

Peer Review File
Available at https://tp.amegroups.com/article/view/10.21037/tp-24-153/prf

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tp.amegroups.com/article/view/10.21037/tp-24-153/rc

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tp.amegroups.com/article/view/10.21037/tp-24-153/coif). Y.W. reports support from the grant of the Research Foundation of Guangzhou Women and Children’s Medical Center for Clinical Doctor (No. 2023BS013). C.L. reports support from the Guangdong Basic and Applied Basic Research Foundation (No. 2024A1515013190), National Natural Science Foundation of China (No. 82301955), Science and Technology Project of Guangzhou (No. 2024A03J1238), and the China Postdoctor Science Foundation (No. 2023M730791). W.Z. reports support from the Guangdong Basic and Applied Basic Research Foundation (No. 202201010833) and the National Natural Science Foundation of China (No. 82370526). The other authors have no conflicts of interest to declare.
==== Refs
References

1 Heuckeroth RO . Hirschsprung disease - integrating basic science and clinical medicine to improve outcomes. Nat Rev Gastroenterol Hepatol 2018;15 :152-67. 10.1038/nrgastro.2017.149 29300049
2 Amiel J Sproat-Emison E Garcia-Barcelo M Hirschsprung disease, associated syndromes and genetics: a review. J Med Genet 2008;45 :1-14. 10.1136/jmg.2007.053959 17965226
3 Bahrami A Joodi M Moetamani-Ahmadi M Genetic Background of Hirschsprung Disease: A Bridge Between Basic Science and Clinical Application. J Cell Biochem 2018;119 :28-33. 10.1002/jcb.26149 28543993
4 Wang XJ Camilleri M . Hirschsprung disease: Insights on genes, penetrance, and prenatal diagnosis. Neurogastroenterol Motil 2019;31 :e13732. 10.1111/nmo.13732 31609069
5 Knowles CH De Giorgio R Kapur RP Gastrointestinal neuromuscular pathology: guidelines for histological techniques and reporting on behalf of the Gastro 2009 International Working Group. Acta Neuropathol 2009;118 :271-301. 10.1007/s00401-009-0527-y 19360428
6 Alnajar H Murro D Alsadi A Spectrum of Clinicopathological Deviations in Long-Segment Hirschsprung Disease Compared With Short-Segment Hirschsprung Disease: A Single-Institution Study. Int J Surg Pathol 2017;25 :216-21. 10.1177/1066896916675729 27784831
7 Reding R de Ville de Goyet J Gosseye S Hirschsprung's disease: a 20-year experience. J Pediatr Surg 1997;32 :1221-5. 10.1016/s0022-3468(97)90686-2 9269974
8 Rintala RJ Pakarinen MP . Long-term outcomes of Hirschsprung's disease. Semin Pediatr Surg 2012;21 :336-43. 10.1053/j.sempedsurg.2012.07.008 22985839
9 Huerta CT Ramsey WA Davis JK Nationwide Outcomes of Immediate Versus Staged Surgery for Newborns with Rectosigmoid Hirschsprung Disease. J Pediatr Surg 2023;58 :1101-6. 10.1016/j.jpedsurg.2023.02.014 36959060
10 Kawaguchi AL Guner YS Sømme S Management and outcomes for long-segment Hirschsprung disease: A systematic review from the APSA Outcomes and Evidence Based Practice Committee. J Pediatr Surg 2021;56 :1513-23. 10.1016/j.jpedsurg.2021.03.046 33993978
11 Mueller JL Goldstein AM . The science of Hirschsprung disease: What we know and where we are headed. Semin Pediatr Surg 2022;31 :151157. 10.1016/j.sempedsurg.2022.151157 35690468
12 Emison ES McCallion AS Kashuk CS A common sex-dependent mutation in a RET enhancer underlies Hirschsprung disease risk. Nature 2005;434 :857-63. 10.1038/nature03467 15829955
13 Salomon R Attié T Pelet A Germline mutations of the RET ligand GDNF are not sufficient to cause Hirschsprung disease. Nat Genet 1996;14 :345-7. 10.1038/ng1196-345 8896569
14 Bachetti T Ceccherini I. Causative and common PHOX2B variants define a broad phenotypic spectrum. Clin Genet 2020;97 :103-13. 10.1111/cge.13633 31444792
15 Baynash AG Hosoda K Giaid A Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons. Cell 1994;79 :1277-85. 10.1016/0092-8674(94)90018-3 8001160
16 Sánchez-Mejías A Fernández RM López-Alonso M New roles of EDNRB and EDN3 in the pathogenesis of Hirschsprung disease. Genet Med 2010;12 :39-43. 10.1097/GIM.0b013e3181c371b0 20009762
17 Nagy N Goldstein AM . Endothelin-3 regulates neural crest cell proliferation and differentiation in the hindgut enteric nervous system. Dev Biol 2006;293 :203-17. 10.1016/j.ydbio.2006.01.032 16519884
18 Vohra BP Planer W Armon J Reduced endothelin converting enzyme-1 and endothelin-3 mRNA in the developing bowel of male mice may increase expressivity and penetrance of Hirschsprung disease-like distal intestinal aganglionosis. Dev Dyn 2007;236 :106-17. 10.1002/dvdy.21028 17131407
19 Rao M Gershon MD . Enteric nervous system development: what could possibly go wrong? Nat Rev Neurosci 2018;19 :552-65. 10.1038/s41583-018-0041-0 30046054
20 Chen C Sun Q Gu M A novel Cx50 (GJA8) p.H277Y mutation associated with autosomal dominant congenital cataract identified with targeted next-generation sequencing. Graefes Arch Clin Exp Ophthalmol 2015;253 :915-24. 10.1007/s00417-015-3019-x 25947639
21 Yan M Xiong C Ye SQ A novel connexin 50 (GJA8) mutation in a Chinese family with a dominant congenital pulverulent nuclear cataract. Mol Vis 2008;14 :418-24.18334966
22 Li L Fan DB Zhao YT GJA8 missense mutation disrupts hemichannels and induces cell apoptosis in human lens epithelial cells. Sci Rep 2019;9 :19157. 10.1038/s41598-019-55549-1 31844091
23 Ceroni F Aguilera-Garcia D Chassaing N New GJA8 variants and phenotypes highlight its critical role in a broad spectrum of eye anomalies. Hum Genet 2019;138 :1027-42. 10.1007/s00439-018-1875-2 29464339
24 Yu X Ping X Zhang X The impact of GJA8 SNPs on susceptibility to age-related cataract. Hum Genet 2018;137 :897-904. 10.1007/s00439-018-1945-5 30349978
25 Dang FT Yang FY Yang YQ A novel mutation of p.F32I in GJA8 in human dominant congenital cataracts. Int J Ophthalmol 2016;9 :1561-7. 10.18240/ijo.2016.11.05 27990357
26 Hu Z Shi W Riquelme MA Connexin 50 Functions as an Adhesive Molecule and Promotes Lens Cell Differentiation. Sci Rep 2017;7 :5298. 10.1038/s41598-017-05647-9 28706245
27 Shen J Wu Q You J Characterization of a Novel Gja8 (Cx50) Mutation in a New Cataract Rat Model. Invest Ophthalmol Vis Sci 2023;64 :18. 10.1167/iovs.64.7.18 37294706
28 Xu X Francis R Wei CJ Connexin 43-mediated modulation of polarized cell movement and the directional migration of cardiac neural crest cells. Development 2006;133 :3629-39. 10.1242/dev.02543 16914489
29 Freidin M Asche S Bargiello TA Connexin 32 increases the proliferative response of Schwann cells to neuregulin-1 (Nrg1). Proc Natl Acad Sci U S A 2009;106 :3567-72. 10.1073/pnas.0813413106 19218461
30 Jin A Zhao Q Liu S Identification of a New Mutation p.P88L in Connexin 50 Associated with Dominant Congenital Cataract. Front Cell Dev Biol 2022;10 :794837. 10.3389/fcell.2022.794837 35531093
31 Li Z Quan Y Wang G The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. J Biol Chem 2023;299 :102965. 10.1016/j.jbc.2023.102965 36736424
32 Kotini M Barriga EH Leslie J Gap junction protein Connexin-43 is a direct transcriptional regulator of N-cadherin in vivo. Nat Commun 2018;9 :3846. 10.1038/s41467-018-06368-x 30242148
33 Rodriguez-Jimenez FJ Alastrue-Agudo A Stojkovic M Connexin 50 Expression in Ependymal Stem Progenitor Cells after Spinal Cord Injury Activation. Int J Mol Sci 2015;16 :26608-18. 10.3390/ijms161125981 26561800
34 Wang W Lufkin T . Hmx homeobox gene function in inner ear and nervous system cell-type specification and development. Exp Cell Res 2005;306 :373-9. 10.1016/j.yexcr.2005.03.016 15925593
35 Okumura T Horie Y Lai CY Robust and highly efficient hiPSC generation from patient non-mobilized peripheral blood-derived CD34(+) cells using the auto-erasable Sendai virus vector. Stem Cell Res Ther 2019;10 :185. 10.1186/s13287-019-1273-2 31234949
36 Lee G Chambers SM Tomishima MJ Derivation of neural crest cells from human pluripotent stem cells. Nat Protoc 2010;5 :688-701. 10.1038/nprot.2010.35 20360764
37 Yoshikawa S Vila A Segelken J Zebrafish connexin 79.8 (Gja8a): A lens connexin used as an electrical synapse in some neurons. Dev Neurobiol 2017;77 :548-61. 10.1002/dneu.22418 27402207
38 Ping X Liang J Shi K Rapamycin relieves the cataract caused by ablation of Gja8b through stimulating autophagy in zebrafish. Autophagy 2021;17 :3323-37. 10.1080/15548627.2021.1872188 33472493
39 Boulling A Wicht L Schorderet DF . Identification of HMX1 target genes: a predictive promoter model approach. Mol Vis 2013;19 :1779-94.23946633
40 Nakano N Matsuda S Ichimura M PI3K/AKT signaling mediated by G protein-coupled receptors is involved in neurodegenerative Parkinson's disease (Review). Int J Mol Med 2017;39 :253-60. 10.3892/ijmm.2016.2833 28000847
41 Akhmetzyanova E Kletenkov K Mukhamedshina Y Different Approaches to Modulation of Microglia Phenotypes After Spinal Cord Injury. Front Syst Neurosci 2019;13 :37. 10.3389/fnsys.2019.00037 31507384
42 Ji CY Yuan MX Chen LJ miR-92a represses the viability and migration of nerve cells in Hirschsprung's disease by regulating the KLF4/PI3K/AKT pathway. Acta Neurobiol Exp (Wars) 2022;82 :336-46. 10.55782/ane-2022-032 36214716
43 Li S Wang S Guo Z miRNA Profiling Reveals Dysregulation of RET and RET-Regulating Pathways in Hirschsprung's Disease. PLoS One 2016;11 :e0150222. 10.1371/journal.pone.0150222 26933947
44 Jain S Naughton CK Yang M Mice expressing a dominant-negative Ret mutation phenocopy human Hirschsprung disease and delineate a direct role of Ret in spermatogenesis. Development 2004;131 :5503-13. 10.1242/dev.01421 15469971
45 Zhang J Hu G Lu Y CTCF mutation at R567 causes developmental disorders via 3D genome rearrangement and abnormal neurodevelopment. Nat Commun 2024;15 :5524. 10.1038/s41467-024-49684-1 38951485
46 Sams DS Nardone S Getselter D Neuronal CTCF Is Necessary for Basal and Experience-Dependent Gene Regulation, Memory Formation, and Genomic Structure of BDNF and Arc. Cell Rep 2016;17 :2418-30. 10.1016/j.celrep.2016.11.004 27880914
47 Hirayama T Tarusawa E Yoshimura Y CTCF is required for neural development and stochastic expression of clustered Pcdh genes in neurons. Cell Rep 2012;2 :345-57. 10.1016/j.celrep.2012.06.014 22854024
48 Watson LA Wang X Elbert A Dual effect of CTCF loss on neuroprogenitor differentiation and survival. J Neurosci 2014;34 :2860-70. 10.1523/JNEUROSCI.3769-13.2014 24553927
49 Kwak JH Kim S Yu NK Loss of the neuronal genome organizer and transcription factor CTCF induces neuronal death and reactive gliosis in the anterior cingulate cortex. Genes Brain Behav 2021;20 :e12701. 10.1111/gbb.12701 32909350
50 Takagi Y Shimada K Shimada S SPIB is a novel prognostic factor in diffuse large B-cell lymphoma that mediates apoptosis via the PI3K-AKT pathway. Cancer Sci 2016;107 :1270-80. 10.1111/cas.13001 27348272
51 Deng H Jiang J Shu J Bavachinin Ameliorates Rheumatoid Arthritis Inflammation via PPARG/PI3K/AKT Signaling Pathway. Inflammation 2023;46 :1981-96. 10.1007/s10753-023-01855-w 37358659
52 Alexandre YO Schienstock D Lee HJ A diverse fibroblastic stromal cell landscape in the spleen directs tissue homeostasis and immunity. Sci Immunol 2022;7 :eabj0641. 10.1126/sciimmunol.abj0641 34995096
53 Potts MA Mizutani S Garnham AL Deletion of the transcriptional regulator TFAP4 accelerates c-MYC-driven lymphomagenesis. Cell Death Differ 2023;30 :1447-56. 10.1038/s41418-023-01145-w 36894688
54 Celi FS Shuldiner AR . The role of peroxisome proliferator-activated receptor gamma in diabetes and obesity. Curr Diab Rep 2002;2 :179-85. 10.1007/s11892-002-0078-2 12643137
55 Su G Wang W Zhao X Enhancer architecture-dependent multilayered transcriptional regulation orchestrates RA signaling-induced early lineage differentiation of ESCs. Nucleic Acids Res 2021;49 :11575-95. 10.1093/nar/gkab1001 34723340
56 Ahmad H Yacob D Halleran DR Evaluation and treatment of the post pull-through Hirschsprung patient who is not doing well; Update for 2022. Semin Pediatr Surg 2022;31 :151164. 10.1016/j.sempedsurg.2022.151164 35690463
57 Kapur RP . Practical pathology and genetics of Hirschsprung's disease. Semin Pediatr Surg 2009;18 :212-23. 10.1053/j.sempedsurg.2009.07.003 19782303
58 Tham SW Rollins MD Reeder RW Health-related quality of life in children with Hirschsprung disease and children with functional constipation: Parent-child variability. J Pediatr Surg 2022;57 :1694-700. 10.1016/j.jpedsurg.2022.04.009 35491270
59 Dong S Zou T Zhen F Association of variants in GJA8 with familial acorea-microphthalmia-cataract syndrome. Eur J Hum Genet 2024;32 :413-20. 10.1038/s41431-023-01503-9 38052906
60 Zhou L Sun X Wang X Identification and functional analysis of two GJA8 variants in Chinese families with eye anomalies. Mol Genet Genomics 2022;297 :1553-64. 10.1007/s00438-022-01939-6 35980487
61 Hers I Vincent EE Tavaré JM . Akt signalling in health and disease. Cell Signal 2011;23 :1515-27. 10.1016/j.cellsig.2011.05.004 21620960
62 Manning BD Toker A . AKT/PKB Signaling: Navigating the Network. Cell 2017;169 :381-405. 10.1016/j.cell.2017.04.001 28431241
63 Li Q Liu Y Sun M. Autophagy and Alzheimer's Disease. Cell Mol Neurobiol 2017;37 :377-88. 10.1007/s10571-016-0386-8 27260250
64 Zott B Simon MM Hong W A vicious cycle of β amyloid-dependent neuronal hyperactivation. Science 2019;365 :559-65. 10.1126/science.aay0198 31395777
65 Kunz D Walker G Bedoucha M Expression profiling and Ingenuity biological function analyses of interleukin-6- versus nerve growth factor-stimulated PC12 cells. BMC Genomics 2009;10 :90. 10.1186/1471-2164-10-90 19239705
66 Hand TW Cui W Jung YW Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc Natl Acad Sci U S A 2010;107 :16601-6. 10.1073/pnas.1003457107 20823247
67 Dorritie KA McCubrey JA Johnson DE . STAT transcription factors in hematopoiesis and leukemogenesis: opportunities for therapeutic intervention. Leukemia 2014;28 :248-57. 10.1038/leu.2013.192 23797472
68 Byts N Samoylenko A Fasshauer T Essential role for Stat5 in the neurotrophic but not in the neuroprotective effect of erythropoietin. Cell Death Differ 2008;15 :783-92. 10.1038/cdd.2008.1 18259195
