
==== Front
J Mater Sci Mater Med
J Mater Sci Mater Med
Journal of Materials Science. Materials in Medicine
0957-4530
1573-4838
Springer US New York

39251504
6825
10.1007/s10856-024-06825-8
Biomaterials Synthesis and Characterization
Si and Zn dual ions upregulate the osteogenic differentiation of mBMSCs: mRNA transcriptomic sequencing analysis
Yuan Xinyuan 12
Wu Tingting 3
Lu Teliang 12
http://orcid.org/0000-0002-5366-2054
Ye Jiandong jdye@scut.edu.cn

12
1 https://ror.org/0530pts50 grid.79703.3a 0000 0004 1764 3838 School of Materials Science and Engineering and Key Laboratory of Biomedical Materials of Ministry of Education, South China University of Technology, Guangzhou, PR China
2 grid.79703.3a 0000 0004 1764 3838 National Engineering Research Center for Tissue Restoration and Reconstruction, Guangzhou, PR China
3 https://ror.org/01g9hkj35 grid.464309.c 0000 0004 6431 5677 National Engineering Research Center for Healthcare Devices, Guangdong Key Lab of Medical Electronic Instruments and Polymer Material Products, Institute of Biological and Medical Engineering, Guangdong Academy of Sciences, Guangzhou, PR China
10 9 2024
10 9 2024
2024
35 1 5429 4 2024
10 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Both silicon (Si) and zinc (Zn) ions are essential elements to bone health and their mechanisms for promoting osteogenesis have aroused the extensive attention of researchers. Thereinto, the mechanism by which dual ions promote osteogenic differentiation remains to be elucidated. Herein, the effects of Si and Zn ions on the cytological behaviors of mBMSCs were firstly studied. Then, the molecular mechanism of Si-Zn dual ions regulating the osteogenic differentiation of mBMSCs was investigated via transcriptome sequencing technology. In the single-ion system, Si ion at the concentration of 1.5 mM (Si-1.5) had better comprehensive effects of cell proliferation, ALP activity and osteogenesis-related gene expression levels (ALP, Runx2, OCN, Col-I and BSP); Zn ion at the concentration of 50 μM (Zn-50) demonstrated better combining effects of cell proliferation, ALP activity and same osteogenic genes expression levels. In the dual-ion system, the Si (1.5 mM)-Zn (50 μM) group (Si1.5-Zn50) synthetically enhanced ALP activity and osteogenesis genes compared with single-ion groups. Analysis of the transcriptome sequencing results showed that Si ion had a certain effect on promoting the osteogenic differentiation of mBMSCs; Zn ion had a stronger effect of contributing to a better osteogenic differentiation of mBMSCs than that of Si ion; the Si-Zn dual ions had a synergistic enhancement on conducting to the osteogenic differentiation of mBMSCs compared to single ion (Si or Zn). This study offers a blueprint for exploring the regulation mechanism of osteogenic differentiation by dual ions.

Graphical Abstract

https://doi.org/10.13039/http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 52172280 Ye Jiandong https://doi.org/10.13039/ Guangzhou Science and Technology Program 2024A04J3423 Wu Tingting https://doi.org/10.13039/http://dx.doi.org/10.13039/501100003453 Natural Science Foundation of Guangdong Province 2024A1515010571 Wu Tingting issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Silicon (Si) is one of the essential trace elements in human body, which is involved in many important physiological processes such as osteogenesis and bone calcification, and plays a critical role in the maintenance of bone metabolism and bone homeostasis [1, 2]. In recent years, a variety of silicon-containing bioactive materials (silica, bioactive glasses, silicate bioceramics, etc.) have been widely used in the field of bone tissue regeneration and repair [3–7]. Some studies suggest that the silanol group at the active site of biomineralization contributes to the bone tissue regeneration promoted by silicon-containing bioactive materials [8–10]. Other studies have found that Si is closely related to the synthesis of extracellular matrix and collagen in the early stage of bone tissue regeneration [11, 12]. A lack of Si would lead to bone defects and deformed bones. For example, animal study showed that chicks on a silicon-deficient diet had significantly delayed growth and development, while those supplemented with silicon grew normally and had a 50% higher growth rate [13]. Dong’s research [14] reported that silicon could upregulate the expression of Col-I and OCN by activating the BMP/Smad/RUNX2 signaling pathway of cells, thus promoting the osteogenic differentiation of cells. Liu et al. [15] found that silicon nanowire could activate the Ras-Raf-MEK-ERK cascade to stimulate osteogenesis and chondrogenesis. Zhou’s study [16] revealed that orthosilicic acid played a positive role in promoting osteogenesis through the PI3K-Akt-mTOR pathway.

Zinc (Zn) is also one of the essential trace elements in human body. It has been reported to be a component of more than 50 metalloenzymes, which are involved in important physiological processes such as enzyme catalysis, cell growth, metabolism and differentiation, intracellular signal transduction, and nucleic acid structure regulation [17–20]. At the molecular level, Zn is also involved in the synthesis of proteins, receptors, hormones, etc [19, 21, 22]. The animal experiment by Qi et al. [23] found that bone density increased, bone tissue morphology improved, and bone loss decreased in diabetic rats supplied Zn. As for the molecular mechanism of Zn regulating the osteogenic differentiation, a wealth of literature has documented that Zn could regulate the osteogenic differentiation of BMSCs via various signaling pathways, such as MAPK signaling pathway, Wnt signaling pathway, BMP/TGF-β signaling pathway, cAMP signaling pathway, etc [19, 24, 25].

In our previous study, it was found that the introduction of zinc silicate (ZS) could significantly improve the in vitro osteogenic differentiation and in vivo bone repair effect of β-TCP ceramic scaffolds, and also revealed that the activation of p38 signaling pathway played a direct role in enhancing the osteogenic differentiation of stem cells with compositing zinc silicate [26]. However, this study could not clearly clarify that the promoting effect of osteogenic differentiation brought by compositing zinc silicate is from the overall effect of ZS/β-TCP ceramic scaffold material, or silicon domination, or zinc domination, or silicon and zinc synergistic enhancement. Meanwhile, no literature has found that the molecular mechanism by which the simultaneous regulation of dual ions on the osteogenic differentiation of mBMSCs. Based on previous study and literature research, a single-ion system of Si and Zn was firstly set to evaluate the effects of single ion (Si and Zn) on the cytological behaviors of mBMSCs, and the ion concentrations of Si and Zn conducing to the proliferation and osteogenic differentiation were screened out. Afterward, a dual-ion system of Si and Zn was set up to evaluate the effects of Si and Zn dual ions on the cytological responses of mBMSCs. Finally, the molecular mechanism of Si and Zn dual-ion system on the osteogenic differentiation of mBMSCs was further explored by virtue of transcriptome sequencing technology.

Materials and methods

Raw materials

The Si source and Zn source were Na2SiO3 ∙ 9H2O (Bioreagent, ≥98%) and ZnSO4 ∙ 7H2O (Bioreagent, ≥99%), which were purchased from Sigma-Aldrich (USA). Ultrapure water was prepared by PURELAB Classic DI ultra-pure polishing system with Starter Kit (CLXXXDIM2, ELGA LabWater, UK).

Preparation of ionic mediums

First, 0.1 M Na2SiO3 ∙ 9H2O and 0.01 M ZnSO4 ∙ 7H2O stock solutions were prepared with ultrapure water and filtered with 0.22 μm filter membrane, respectively. Then, the filtered stocks were stored in a 4 °C refrigerator for future use. According to the previous study [26], Si and Zn ion concentrations released from ceramic scaffolds in the culture medium were 0.12–2.15 mM and 16.9–204.4 μM, individually. Combined with the reported ion concentration ranges in the literatures: the optimal concentration of Si ion for stimulating osteogenic differentiation was 0.625 mM while the inhibitory concentration of Si ion was 5 mM or more [27]; the optimal concentration of Zn ion for promoting osteogenic differentiation was 100 μM while the inhibitory concentration was 200 μM [28]. The ionic mediums with different concentrations are shown in Table 1.Table 1 The different concentration of ionic mediums

Group	Ion mode	Concentration	
Blank	-	-	
Si	Si-3	3 mM	
Si-1.5	1.5 mM	
Si-0.75	0.75 mM	
Si-0.38	0.38 mM	
Si-0.094	0.094 mM	
Zn	Zn-200	200 μM	
Zn-100	100 μM	
Zn-50	50 μM	
Zn-25	25 μM	
Zn-6.25	6.25 μM	

Cell culture

The mouse bone mesenchymal stem cells (mBMSCs; ATCC CRL-12424, USA) at passage 4-7 were utilized to assess the cytological responses of the different concentration of ionic mediums. The cell culture medium was composed of 90 vol.% high-glucose Dulbecco’s Modified Eagle’s Medium (H-DMEM; Gibco, USA) and 10 vol.% fetal bovine serum (FBS; Gibco, USA). The mBMSCs were incubated in an incubator (at 5% CO2, 95% humidity and 37 °C) and the culture medium was changed every other day.

Cell proliferation

The Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Japan) was in use for assessing the cell proliferation in accordance with the specifications. At the predetermined time points (1, 3, and 5 d), the optical density (OD) values at 450 nm reflecting the proliferation were detected by an enzyme-linked immunosorbent assay reader (ELISA; Thermo 3001, Thermo Fisher Scientific, USA).

ALP activity and staining

Osteogenic induction medium (90 vol.% H-DMEM, 10 vol.% FBS, 10 mM sodium β-glycerophosphate, 10 nM dexamethasone and 50 μM vitamin C) was harnessed to evaluate the osteogenic differentiation activity of mBMSCs in different concentrations of ionic mediums. The enzyme activity unit per milligram of total protein content was considered as the alkaline phosphatase (ALP) activity. Specifically, the total protein content was determined by a BCA Protein Assay Kit (Thermo Fisher Scientific, USA). The enzyme activity was detected by p-nitrophenyl phosphate reagent (pNPP, Sigma-Aldrich, USA). After the reaction terminator (1 M NaOH solution; Aladdin Industrial Corporation, China) was added, the ELISA reader was exploited to read the absorbances at 562 nm (the total protein content) and 405 nm (the enzyme activity) at the preset time point (10 d). In addition, a BCIP/NBT alkaline phosphatase color development kit (C3206, Beyotime, China) was employed to conduct the ALP staining and the ALP staining was observed by a stereo microscope (SMZ25, Nikon, Japan).

Osteogenesis-related gene expression of mBMSCs

After mBMSCs were incubated for preset time points, the expression levels of osteogenesis markers (Runx2, ALP, OCN, Col-I, and BSP) were determined. In brief, a HiPure Total RNA micro kit (Magen, China) was utilized to extract RNA. Thereafter, an iScript cDNA Synthesis Kit (Roche, Germany) was used to transcribe RNA into complementary DNA (cDNA) following the instructions. Finally, the expression levels of osteogenic genes were detected by an Applied Biosystems QuantStudio 6 Flex (Life Technologies, USA). Gene expression levels were calculated by the following formulas: 2−ΔCt for Zn (ΔCt = Ct (target gene) − Ct (GAPDH)) and 2−ΔΔCt for Si and Si-Zn dual ion system (ΔΔCt = ΔCt (Target group) −Δ Ct (Blank)). Ct value could be obtained from the melting curve and the primer sequences of osteogenic genes (Runx2, ALP, OCN, Col-I, and BSP) were displayed in Table 2.Table 2 The primer sequences used for the RT-qPCR analysis

Gene	Forward primer (5′-3′)	Reverse primer (3′-5′)	
GAPDH	TGTGTCCGTCGTGGATCTGA	TTGCTGTTGAAGTCGCAGGAG	
Runx2	CACTGGCGGTGCAACAAGA	TTTCATAACAGCGGAGGCATTTC	
ALP	TGCCTACTTGTGTGGCGTGAA	TCACCCGAGTGGTAGTCACAATG	
OCN	AGCAGCTTGGCCCAGACCTA	TAGCGCCGGAGTCTGTTCACTAC	
Col-I	ATGCCGCCACCTCAAGATG	TGAGGCACAGACGGCTGAGTA	
BSP	AGAACAATCCGTGCCACTCACTC	AGTAGCGTGGCCGGTACTTAAAGA	

The transcriptome sequencing analysis

After mBMSCs were cultured in ionic mediums for the preset time point (7 d), the mediums were sucked out and the cells were washed with phosphate buffer solution (PBS), which followed by being cleaved with RL + DTT lysate at room temperature for 10 min. Then, the lysates were blown, collected, frozen in liquid nitrogen for 30 min and preserved at −80 °C. The cell lysates were used for the gene expression analysis through Novaseq 4000 (illumina, USA), and the screening criterion for the differentially expressed genes (DEGs) was p < 0.05 or FC (fold change) >2. GO (Gene Ontology) analysis of all DEGs were carried out and the osteogenesis-related gene expressions of mBMSCs were illustrated in heat map.

Statistical analysis

All data were presented as mean ± standard deviation and one-way analysis of variance (ANOVA) was adopted to analyze the significant difference. Among them, p < 0.05 (*) means a significant difference between the experimental group and the blank group, p < 0.01 (@) and p < 0.001 (&) indicate very significant difference between the experimental group and the blank group.

Results and discussion

Cytological performance of single-ion system

CCK-8 results (Fig. 1A, B) displayed that all ionic mediums (Si and Zn) had good cell activity. The mBMSCs could grow well with the extension of incubation time. By the 5th day, it could be seen that the concentration range of Si-0.38 to Si-3 significantly promoted cell proliferation, and the concentration range of Zn-6.25 to Zn-100 unequivocally stimulated cell proliferation. The results of ALP activity experiment of mBMSCs cultured in different concentration of ionic solutions for 10 days (Fig. 1C, D) presented that when the ionic concentration was too high (such as Si-3 and Zn-200), the ALP activity would be suppressed conspicuously. As for Si ionic mediums, the highest ALP activity of mBMSCs appeared in Si-1.5. For Zn ionic mediums, Zn-6.25 to Zn-50 apparently enhanced the ALP activity. The results of ALP staining for 10 days (Fig. 1E) were consistent with the results of ALP quantitative calculation (Fig. 1C, D). Almost no blue-purple staining was observed in Si-3 and Zn-200.Fig. 1 Proliferation (A, B), ALP activity (C, D) and ALP staining (E) of mBMSCs cultured with different concentration of Si and Zn mediums (*p < 0.05, @p < 0.01, &p < 0.001)

In RT-qPCR experiment, the expression levels of 5 osteogenic genes (Runt-associated transcription factor 2, Runx2; Alkaline phosphatase, ALP; Type I collagen, Col-I; Osteocalcin, OCN; and Bone sialoprotein, BSP) were detected. Among them, Runx2 was reported as a multifunctional transcription regulator that regulated the osteogenic differentiation of stem cells and was expressed early in osteogenic differentiation [29]; ALP was considered to be an early marker of osteogenic differentiation [30]; Col-I was regarded as the main component of bone matrix and the marker of osteogenic differentiation and maturation of stem cells [31, 32]; OCN began to be expressed at the end of osteogenic differentiation, but did not represent the degree of mineralization [30]; BSP was viewed as a major nucleating agent for hydroxyapatite crystal formation, associated with the initial stage of mineralization, and a marker gene for late osteogenic differentiation of stem cells [33]. The expression levels of osteogenesis-related genes of mBMSCs cultured in Si and Zn ionic mediums with different concentrations were shown in Fig. 2. After being cultured for 5 days (Fig. 2A), the optimal comprehensive group upregulating the expression levels of osteogenic genes was Si-1.5 in Si concentration groups. At day 10 (Fig. 2B), the highest expression levels of ALP, OCN and Col-I genes appeared in Si-0.75, and Si-1.5 also visibly stimulated the expressions of ALP and OCN. In addition, it could be seen from the experimental results (Fig. 2) that the experimental group with a higher concentration (Si-1.5) was beneficial to initiate the process of osteogenic differentiation (early stage); when mBMSCs entered the middle and late stages of osteogenic differentiation, the lower concentration group (Si-0.75) was more conducive to the expression of osteogenesis-related genes.Fig. 2 The expression of osteogenesis-related genes (Runx2, ALP, OCN, Col-I and BSP) in mBMSCs cultured with different concentration of Si mediums for 5 days (A) and 10 days (B) (*p < 0.05, @p < 0.01, &p < 0.001)

The upregulation effects of the expression levels of various osteogenesis-related genes (Runx2, ALP, OCN, Col-I and BSP) in Zn-6.25 were prominently enhanced at day 5 (Fig. 3A). In addition, Zn-6.25-Zn-100 promoted the expression levels of Runx2 and Col-I osteogenic gene markers significantly. After 10 days (Fig. 3B), the optimum effect of upregulating the expression levels of osteogenesis-related genes was seen in Zn-50. Based on the experimental results of the single-ion system, the Si-1.5 concentration group together with the Zn-50 experimental group were selected for the cytological evaluation of Si and Zn dual-ion system.Fig. 3 The expression of osteogenesis-related genes (Runx2, ALP, OCN, Col-I and BSP) in mBMSCs cultured with different concentration of Zn mediums for 5 days (A) and 10 days (B) (*p < 0.05, @p < 0.01, &p < 0.001)

Cytological performance of dual-ion system

As can be seen from Fig. 4A, the single ion and dual ion experimental groups had no obvious cytotoxicity, which showed that the number of cells increased with the prolongation of culture time. Among them, the Si-1.5 and Zn-50 groups significantly promoted the cell proliferation and the dual-ion experimental group (Si1.5-Zn50) had noticeable impact on promoting cell proliferation. Figure 4B, C shows the ALP activity results. Si-1.5 had no apparent difference compared with the blank group, Zn-50 significantly up-regulated ALP activity expression, and Si1.5-Zn50 upregulated ALP activity remarkably. It was reported that the proliferative performance was negatively correlated with the osteogenic differentiation property [34]. The experimental result in this study presented the consistence with the above conclusion. Based on the ALP activity of Si1.5-Zn50, mBMSCs were cultured in blank, Si-1.5, Zn-50 and Si1.5-Zn50 for 10 days before conducting ALP staining. It could be observed that the ALP staining results (Fig. 4C) displayed the same trend with the quantitative calculation results of ALP activity (Fig. 4B).Fig. 4 Proliferation (A), ALP activity (B) and ALP staining (C) of mBMSCs cultured with Si and Zn dual-ion system (*p < 0.05, @p < 0.01, &p < 0.001)

Subsequently, the mBMSCs were cultured in blank, Si-1.5, Zn-50 and Si1.5-Zn50 for 5, 7, 10 and 14 days, and the expression levels of osteogenic genes (Runx2, ALP, OCN, Col-I, and BSP) were determined. As shown in Fig. 5, the expression levels of osteogenesis-related genes were significantly upregulated or no conspicuous inhibition in all experimental groups only at 7 days. Therefore, blank, Si-1.5, Zn-50, Si1.5-Zn50 were chosen as the experimental groups, and the culture time point was set at 7 days to explore the mechanism of Si and Zn double ions regulating the osteogenic differentiation of mBMSCs.Fig. 5 The expression of osteogenesis-related genes (Runx2, ALP, OCN, Col-I, and BSP) in mBMSCs cultured with Si and Zn dual-ion system for 5 days (A),7 days (B), 10 days (C) and 14 days (D) (*p < 0.05, @p < 0.01, &p < 0.001)

Results and analysis of transcriptome sequencing

The mBMSCs were incubated with blank, Si-1.5, Zn-50 and Si1.5-Zn50 for 7 days before carrying out the transcriptomic sequencing experiment. The number of differentially expressed genes (DEGs) in each experimental group was shown in Venn diagram (Fig. 6A). It could be seen that there were differences in the number of specific DEGs expressed by mBMSCs in each experimental group (non-overlapping regions) and the number of common DEGs between experimental groups (overlapping regions). Among them, Si-1.5 had 44 unique DEGs, Zn-50 had 159 unique DEGs, Si1.5-Zn50 had 317 unique DEGs, and the number of common differential genes among the three groups was 99. Osteogenic functional enrichment analysis (GO analysis) was performed for all DEGs and the analysis results were presented in Fig. 6B. In osteogenesis-related functions (bone remolding, positive regulation of cell proliferation, bone mineralization, bone development, bone morphogenesis and osteogenic differentiation), Si had a certain effect of promoting osteogenesis differentiation compared with the blank group, and Zn had a significantly greater effect of promoting osteogenic differentiation than that of Si. Moreover, Si-Zn dual ions manifested a synergistic enhancement effect of the osteogenesis-related functions of mBMSCs. Figure 6C is the heat map of osteogenesis-related genes (Gdpd2, Spp1, Sfrp4, Osmr, Pdgfra, Dhh, Cxcl10, Sulf1, Esr1, Tgm2, and Adgrv1[35–44]) shared by the four experimental groups in the above osteogenesis-related functions. It could be intuitively seen, Si had certain promoting and regulating effects on the osteogenic differentiation of mBMSCs compared to the blank group, but the promoting and regulating effects were not striking. Zn had better promoting and regulating effects of osteogenic differentiation than those of Si. Moreover, the promoting and regulating effects of Si-Zn dual ions on osteogenesis differentiation were synergically enhanced. These phenomena were line with the results of the previous experimental results.Fig. 6 Venn diagram of the number of differential genes (A), GO analysis diagram of all differential genes (B) and heatmap of osteogenesis-related genes (C) in mBMSCs cultured with Blank, Si-1.5, Zn-50 and Si1.5-Zn50 mediums for 7 days

Conclusion

In this study, CCK-8, ALP activity assay and PCR were utilized to study the regulation of osteogenic differentiation of mBMSCs by Si and Zn single-ion system and Si-Zn dual-ion system. Then transcriptional sequencing technology was used to explore the mechanism regulating the osteogenic differentiation of mBMSCs by Si-Zn dual ions. In the single-ion system, a concentration of 1.5 mM Si showed positive effects on cell proliferation and osteogenic differentiation, while a concentration of 50 μM Zn effectively stimulated cell proliferation and osteogenic differentiation. In the dual-ion system, the combination of Si (1.5 mM) and Zn (50 μM) produced the most comprehensive enhancement of osteogenic differentiation in mBMSCs. Transcriptional sequencing confirmed that the presence of both Si and Zn ions simultaneously promoted osteogenic differentiation, and indicated that Zn ions had a more substantial effect on upregulating osteogenic differentiation in mBMSCs when compared to Si ions. The combined effects of Si and Zn ions synergistically enhanced the osteogenic differentiation of mBMSCs. This work not only offered a strategy for investigating the regulation mechanism on promoting the osteogenic differentiation of mBMSCs by dual ions, but also enriched the theory of ion regulating osteogenic differentiation.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant 52172280), Guangzhou Science and Technology Program (Grant 2024A04J3423), and Natural Science Foundation of Guangdong Province (Grant 2024A1515010571).

Compliance with ethical standards

Conflict of interest

We declare on behalf of our co-authors that the work described here is original, which has never been submitted for publication, and it is not under consideration for publication elsewhere, in whole or in part. No conflict of interest exits in the submission of this manuscript, and the manuscript is approved by all authors for publication.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Jugdaohsingh R Tucker KL Qiao N Cupples LA Kiel DP Powell JJ Dietary silicon intake is positively associated with bone mineral density in men and premenopausal women of the Framingham Offspring cohort J Bone Miner Res 2004 19 297 307 10.1359/JBMR.0301225 14969400
Jugdaohsingh R, Tucker KL, Qiao N, Cupples LA, Kiel DP, Powell JJ. Dietary silicon intake is positively associated with bone mineral density in men and premenopausal women of the Framingham Offspring cohort. J Bone Miner Res. 2004;19:297–307.14969400 10.1359/JBMR.0301225
2. Rodella LF Bonazza V Labanca M Lonati C Rezzani R A review of the effects of dietary silicon intake on bone homeostasis and regeneration J Nutr Health Aging 2014 18 820 6 10.1007/s12603-014-0555-8 25389960
Rodella LF, Bonazza V, Labanca M, Lonati C, Rezzani R. A review of the effects of dietary silicon intake on bone homeostasis and regeneration. J Nutr Health Aging. 2014;18:820–6.25389960 10.1007/s12603-014-0555-8
3. Wang X Xue J Ma B Wu J Chang J Gelinsky M Wu C Black bioceramics: combining regeneration with therapy Adv Mater 2020 32 2005140 10.1002/adma.202005140
Wang X, Xue J, Ma B, Wu J, Chang J, Gelinsky M, Wu C. Black bioceramics: combining regeneration with therapy. Adv Mater. 2020;32:2005140.10.1002/adma.202005140
4. Huang Y Wu C Zhang X Chang J Dai K Regulation of immune response by bioactive ions released from silicate bioceramics for bone regeneration Acta Biomater 2018 66 81 92 10.1016/j.actbio.2017.08.044 28864248
Huang Y, Wu C, Zhang X, Chang J, Dai K. Regulation of immune response by bioactive ions released from silicate bioceramics for bone regeneration. Acta Biomater. 2018;66:81–92.28864248 10.1016/j.actbio.2017.08.044
5. Hua S Su J Deng Z Wu J Cheng L Yuan X Chen F Zhu H Qi D Xiao J Shi Y Microstructures and properties of 45S5 bioglass® & BCP bioceramic scaffolds fabricated by digital light processing Addit Manuf 2021 45 102074
Hua S, Su J, Deng Z, Wu J, Cheng L, Yuan X, Chen F, Zhu H, Qi D, Xiao J, Shi Y. Microstructures and properties of 45S5 bioglass® & BCP bioceramic scaffolds fabricated by digital light processing. Addit Manuf. 2021;45:102074.
6. Cheng Y Cheng G Xie C Yin C Dong X Li Z Zhou X Wang Q Deng H Li Z Biomimetic silk fibroin hydrogels strengthened by silica nanoparticles distributed nanofibers facilitate bone repair Adv Healthcare Mater 2021 10 2001646 10.1002/adhm.202001646
Cheng Y, Cheng G, Xie C, Yin C, Dong X, Li Z, Zhou X, Wang Q, Deng H, Li Z. Biomimetic silk fibroin hydrogels strengthened by silica nanoparticles distributed nanofibers facilitate bone repair. Adv Healthcare Mater. 2021;10:2001646.10.1002/adhm.202001646
7. Liu M Shafiq M Sun B Wu J Wang W EL-Newehy M EL-Hamshary H Morsi Y Ali O Khan AUR Mo X Composite superelastic aerogel scaffolds containing flexible SiO2 nanofibers promote bone regeneration Adv Healthcare Mater 2022 11 2200499 10.1002/adhm.202200499
Liu M, Shafiq M, Sun B, Wu J, Wang W, EL-Newehy M, EL-Hamshary H, Morsi Y, Ali O, Khan AUR, Mo X. Composite superelastic aerogel scaffolds containing flexible SiO2 nanofibers promote bone regeneration. Adv Healthcare Mater. 2022;11:2200499.10.1002/adhm.202200499
8. Carlisle EM Silicon a possible factor in bone calcification Science 1970 167 279 80 10.1126/science.167.3916.279 5410261
Carlisle EM. Silicon a possible factor in bone calcification. Science. 1970;167:279–80.5410261 10.1126/science.167.3916.279
9. Obata A Iwanaga N Terada A Jell G Kasuga T Osteoblast-like cell responses to silicate ions released from 45S5-type bioactive glass and siloxane-doped vaterite J Mater Sci 2017 52 8942 56 10.1007/s10853-017-1057-y
Obata A, Iwanaga N, Terada A, Jell G, Kasuga T. Osteoblast-like cell responses to silicate ions released from 45S5-type bioactive glass and siloxane-doped vaterite. J Mater Sci. 2017;52:8942–56.10.1007/s10853-017-1057-y
10. Schwarz K Milne DB Growth-promoting effects of silicon in rats Nature 1972 239 333 4 10.1038/239333a0 12635226
Schwarz K, Milne DB. Growth-promoting effects of silicon in rats. Nature. 1972;239:333–4.12635226 10.1038/239333a0
11. Reffitt DM Ogston N Jugdaohsingh R Cheung HFJ Evans BAJ Thompson RPH Powell JJ Hampson GN Orthosilicic acid stimulates collagen type 1 synthesis and osteoblastic differentiation in human osteoblast-like cells in vitro Bone 2003 32 127 35 10.1016/S8756-3282(02)00950-X 12633784
Reffitt DM, Ogston N, Jugdaohsingh R, Cheung HFJ, Evans BAJ, Thompson RPH, Powell JJ, Hampson GN. Orthosilicic acid stimulates collagen type 1 synthesis and osteoblastic differentiation in human osteoblast-like cells in vitro. Bone. 2003;32:127–35.12633784 10.1016/S8756-3282(02)00950-X
12. Kim MH Bae YJ Choi MK Chung YS Silicon supplementation improves the bone mineral density of calcium-deficient ovariectomized rats by reducing bone resorption Biol Trace Elem Res 2009 128 239 247 10.1007/s12011-008-8273-x 19034393
Kim MH, Bae YJ, Choi MK, Chung YS. Silicon supplementation improves the bone mineral density of calcium-deficient ovariectomized rats by reducing bone resorption. Biol Trace Elem Res. 2009;128:239–247.19034393 10.1007/s12011-008-8273-x
13. Carlisle EM Silicon: an essential element for the chick Science 1972 178 619 621 10.1126/science.178.4061.619 5086395
Carlisle EM. Silicon: an essential element for the chick. Science. 1972;178:619–621.5086395 10.1126/science.178.4061.619
14. Dong M Jiao G Liu H Wu W Li S Wang Q Xu D Li X Liu H Chen Y Biological silicon stimulates collagen type 1 and osteocalcin synthesis in human osteoblast-Like cells through the BMP-2/Smad/RUNX2 signaling pathway Biol Trace Elem Res 2016 173 306 15 10.1007/s12011-016-0686-3 27025722
Dong M, Jiao G, Liu H, Wu W, Li S, Wang Q, Xu D, Li X, Liu H, Chen Y. Biological silicon stimulates collagen type 1 and osteocalcin synthesis in human osteoblast-Like cells through the BMP-2/Smad/RUNX2 signaling pathway. Biol Trace Elem Res. 2016;173:306–15.27025722 10.1007/s12011-016-0686-3
15. Liu D Yi C Fong CC Jin Q Wang Z Yu WK Sun D Zhao J Yang M Activation of multiple signaling pathways during the differentiation of mesenchymal stem cells cultured in a silicon nanowire microenvironment Nanomedicine 2014 10 1153 63 10.1016/j.nano.2014.02.003 24566272
Liu D, Yi C, Fong CC, Jin Q, Wang Z, Yu WK, Sun D, Zhao J, Yang M. Activation of multiple signaling pathways during the differentiation of mesenchymal stem cells cultured in a silicon nanowire microenvironment. Nanomedicine. 2014;10:1153–63.24566272 10.1016/j.nano.2014.02.003
16. Zhou H Jiao G Dong M Chi H Wang H Wu W Liu H Ren S Kong M Li C Zhang L Chen Y Orthosilicic acid accelerates bone formation in human osteoblast-like cells through the PI3K-Akt-mTOR pathway Biol Trace Elem Res 2019 190 327 35 10.1007/s12011-018-1574-9 30421162
Zhou H, Jiao G, Dong M, Chi H, Wang H, Wu W, Liu H, Ren S, Kong M, Li C, Zhang L, Chen Y. Orthosilicic acid accelerates bone formation in human osteoblast-like cells through the PI3K-Akt-mTOR pathway. Biol Trace Elem Res. 2019;190:327–35.30421162 10.1007/s12011-018-1574-9
17. Chen Z Zhang W Wang M Backman LJ Chen J Effects of zinc, magnesium, and iron ions on bone tissue engineering ACS Biomater Sci Eng 2022 8 2321 35 10.1021/acsbiomaterials.2c00368 35638755
Chen Z, Zhang W, Wang M, Backman LJ, Chen J. Effects of zinc, magnesium, and iron ions on bone tissue engineering. ACS Biomater Sci Eng. 2022;8:2321–35.35638755 10.1021/acsbiomaterials.2c00368
18. Wang M Yao J Shen S Heng C Zhang Y Yang T Zheng X A scaffold with zinc-whitlockite nanoparticles accelerates bone reconstruction by promoting bone differentiation and angiogenesis Nano Res 2023 16 757 70 10.1007/s12274-022-4644-4
Wang M, Yao J, Shen S, Heng C, Zhang Y, Yang T, Zheng X. A scaffold with zinc-whitlockite nanoparticles accelerates bone reconstruction by promoting bone differentiation and angiogenesis. Nano Res. 2023;16:757–70.10.1007/s12274-022-4644-4
19. Li H Li M Ran X Cui J Wei F Yi G Chen W Luo X Chen Z The role of zinc in bone mesenchymal stem cell differentiation Cell Reprogram 2022 24 80 94 10.1089/cell.2021.0137 35172118
Li H, Li M, Ran X, Cui J, Wei F, Yi G, Chen W, Luo X, Chen Z. The role of zinc in bone mesenchymal stem cell differentiation. Cell Reprogram. 2022;24:80–94.35172118 10.1089/cell.2021.0137
20. Khader A Arinzeh TL Biodegradable zinc oxide composite scaffolds promote osteochondral differentiation of mesenchymal stem cells Biotechnol Bioeng 2020 117 194 209 10.1002/bit.27173 31544962
Khader A, Arinzeh TL. Biodegradable zinc oxide composite scaffolds promote osteochondral differentiation of mesenchymal stem cells. Biotechnol Bioeng. 2020;117:194–209.31544962 10.1002/bit.27173
21. Narayanan SE Rehuman NA Harilal S Vincent A Rajamma RG Behl T Uddin MS Ashraf GM Mathew B Molecular mechanism of zinc neurotoxicity in Alzheimer’s disease Environ Sci Pollut Res Int 2020 27 43542 52 10.1007/s11356-020-10477-w 32909132
Narayanan SE, Rehuman NA, Harilal S, Vincent A, Rajamma RG, Behl T, Uddin MS, Ashraf GM, Mathew B. Molecular mechanism of zinc neurotoxicity in Alzheimer’s disease. Environ Sci Pollut Res Int. 2020;27:43542–52.32909132 10.1007/s11356-020-10477-w
22. Barroso I Farinha R Guimaraes JT Proper zinc evaluation in clinical practice: effect of sample type and it’s stability Clin Biochem 2018 59 93 5 10.1016/j.clinbiochem.2018.07.001 30111511
Barroso I, Farinha R, Guimaraes JT. Proper zinc evaluation in clinical practice: effect of sample type and it’s stability. Clin Biochem. 2018;59:93–5.30111511 10.1016/j.clinbiochem.2018.07.001
23. Qi S He J Zheng H Chen C Jiang H Lan S Zinc supplementation increased bone mineral density, improves bone histomorphology, and prevents bone loss in diabetic rat Biol Trace Elem Res 2020 194 493 501 10.1007/s12011-019-01810-7 31363990
Qi S, He J, Zheng H, Chen C, Jiang H, Lan S. Zinc supplementation increased bone mineral density, improves bone histomorphology, and prevents bone loss in diabetic rat. Biol Trace Elem Res. 2020;194:493–501.31363990 10.1007/s12011-019-01810-7
24. Yu J Xu L Li K Xie N Xi Y Wang Y Zheng X Chen X Wang M Ye X Zinc-modified calcium silicate coatings promote osteogenic differentiation through TGF-beta/Smad pathway and osseointegration in osteopenic rabbits Sci Rep 2017 7 3440 10.1038/s41598-017-03661-5 28611362
Yu J, Xu L, Li K, Xie N, Xi Y, Wang Y, Zheng X, Chen X, Wang M, Ye X. Zinc-modified calcium silicate coatings promote osteogenic differentiation through TGF-beta/Smad pathway and osseointegration in osteopenic rabbits. Sci Rep. 2017;7:3440.28611362 10.1038/s41598-017-03661-5
25. Song Y Wu H Gao Y Li J Lin K Liu B Lei X Cheng P Zhang S Wang Y Sun J Bi L Pei G Zinc silicate/nano-hydroxyapatite/collagen scaffolds promote angiogenesis and bone regeneration via the p38 MAPK pathway in activated monocytes ACS Appl Mater Interfaces 2020 12 16058 75 10.1021/acsami.0c00470 32182418
Song Y, Wu H, Gao Y, Li J, Lin K, Liu B, Lei X, Cheng P, Zhang S, Wang Y, Sun J, Bi L, Pei G. Zinc silicate/nano-hydroxyapatite/collagen scaffolds promote angiogenesis and bone regeneration via the p38 MAPK pathway in activated monocytes. ACS Appl Mater Interfaces. 2020;12:16058–75.32182418 10.1021/acsami.0c00470
26. Yuan X Lu T He F Wu T Wang X Ye J 3D-plotted zinc silicate/beta-tricalcium phosphate ceramic scaffolds enable fast osteogenesis by activating the p38 signaling pathway J Mater Chem B 2022 10 9639 53 10.1039/D2TB01868C 36377518
Yuan X, Lu T, He F, Wu T, Wang X, Ye J. 3D-plotted zinc silicate/beta-tricalcium phosphate ceramic scaffolds enable fast osteogenesis by activating the p38 signaling pathway. J Mater Chem B. 2022;10:9639–53.36377518 10.1039/D2TB01868C
27. Han P Wu C Xiao Y The effect of silicate ions on proliferation, osteogenic differentiation and cell signalling pathways (WNT and SHH) of bone marrow stromal cells Biomater Sci 2013 1 379 92 10.1039/C2BM00108J 32481903
Han P, Wu C, Xiao Y. The effect of silicate ions on proliferation, osteogenic differentiation and cell signalling pathways (WNT and SHH) of bone marrow stromal cells. Biomater Sci. 2013;1:379–92.32481903 10.1039/C2BM00108J
28. Park KH Choi Y Yoon DS Lee KM Kim D Lee JW Zinc promotes osteoblast differentiation in human mesenchymal stem cells via activation of the cAMP-PKA-CREB signaling pathway Stem Cells Dev 2018 27 1125 35 10.1089/scd.2018.0023 29848179
Park KH, Choi Y, Yoon DS, Lee KM, Kim D, Lee JW. Zinc promotes osteoblast differentiation in human mesenchymal stem cells via activation of the cAMP-PKA-CREB signaling pathway. Stem Cells Dev. 2018;27:1125–35.29848179 10.1089/scd.2018.0023
29. Komori T Regulation of bone development and extracellular matrix protein genes by RUNX2 Cell Tissue Res 2010 339 189 95 10.1007/s00441-009-0832-8 19649655
Komori T. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res. 2010;339:189–95.19649655 10.1007/s00441-009-0832-8
30. An J Yang H Zhang Q Liu C Zhao J Zhang L Chen B Natural products for treatment of osteoporosis: The effects and mechanisms on promoting osteoblast-mediated bone formation Life Sci 2016 147 46 58 10.1016/j.lfs.2016.01.024 26796578
An J, Yang H, Zhang Q, Liu C, Zhao J, Zhang L, Chen B. Natural products for treatment of osteoporosis: The effects and mechanisms on promoting osteoblast-mediated bone formation. Life Sci. 2016;147:46–58.26796578 10.1016/j.lfs.2016.01.024
31. Zhou C Lin Y Osteogenic differentiation of adipose-derived stem cells promoted by quercetin Cell Prolif 2014 47 124 32 10.1111/cpr.12097 24617900
Zhou C, Lin Y. Osteogenic differentiation of adipose-derived stem cells promoted by quercetin. Cell Prolif. 2014;47:124–32.24617900 10.1111/cpr.12097
32. Chen Z Yan X Yin S Liu L Liu X Zhao G Ma W Qi W Ren Z Liao H Liu M Cai D Fang H Influence of the pore size and porosity of selective laser melted Ti6Al4V ELI porous scaffold on cell proliferation, osteogenesis and bone ingrowth Mater Sci Eng C 2020 106 110289 10.1016/j.msec.2019.110289
Chen Z, Yan X, Yin S, Liu L, Liu X, Zhao G, Ma W, Qi W, Ren Z, Liao H, Liu M, Cai D, Fang H. Influence of the pore size and porosity of selective laser melted Ti6Al4V ELI porous scaffold on cell proliferation, osteogenesis and bone ingrowth. Mater Sci Eng C. 2020;106:110289.10.1016/j.msec.2019.110289
33. Frank O Heim M Jakob M Barbero A Schafer D Bendik I Dick W Heberer M Martin I Real-time quantitative RT-PCR analysis of human bone marrow stromal cells during osteogenic differentiation in vitro J Cell Biochem 2002 85 737 46 10.1002/jcb.10174 11968014
Frank O, Heim M, Jakob M, Barbero A, Schafer D, Bendik I, Dick W, Heberer M, Martin I. Real-time quantitative RT-PCR analysis of human bone marrow stromal cells during osteogenic differentiation in vitro. J Cell Biochem. 2002;85:737–46.11968014 10.1002/jcb.10174
34. Nijweide PJ Burger EH Feyen JH Cells of bone: proliferation, differentiation, and hormonal regulation Physil Rev 1986 66 855 86 10.1152/physrev.1986.66.4.855
Nijweide PJ, Burger EH, Feyen JH. Cells of bone: proliferation, differentiation, and hormonal regulation. Physil Rev. 1986;66:855–86.10.1152/physrev.1986.66.4.855
35. Chen H Zhang X Peng Z Xing Z Zhang Y Li Y The circular RNA circSlc7a11 promotes bone cancer pain pathogenesis in rats by modulating LLC-WRC 256 cell proliferation and apoptosis Mol Cell Biochem 2021 476 1751 63 10.1007/s11010-020-04020-1 33433832
Chen H, Zhang X, Peng Z, Xing Z, Zhang Y, Li Y. The circular RNA circSlc7a11 promotes bone cancer pain pathogenesis in rats by modulating LLC-WRC 256 cell proliferation and apoptosis. Mol Cell Biochem. 2021;476:1751–63.33433832 10.1007/s11010-020-04020-1
36. Hui T Lai X Dong X Jing H Liu Z Fei E Chen W Wang S Ren D Zou S Wu H Pan B Ablation of Lrp4 in Schwann cells promotes peripheral nerve regeneration in mice Biology (Basel) 2021 10 452 34063992
Hui T, Lai X, Dong X, Jing H, Liu Z, Fei E, Chen W, Wang S, Ren D, Zou S, Wu H, Pan B. Ablation of Lrp4 in Schwann cells promotes peripheral nerve regeneration in mice. Biology (Basel). 2021;10:452.34063992
37. Cooke PS Nanjappa MK Ko C Prins GS Hess RA Estrogens in male physiology Physiol Rev 2017 97 995 1043 10.1152/physrev.00018.2016 28539434
Cooke PS, Nanjappa MK, Ko C, Prins GS, Hess RA. Estrogens in male physiology. Physiol Rev. 2017;97:995–1043.28539434 10.1152/physrev.00018.2016
38. Tsutsumi T Matsuda R Morito K Kawabata K Yokota M Nikawadori M Inoue-Fujiwara M Kawashima S Hidaka M Yamamoto T Yamazaki N Tanaka T Shinohara Y Nishi H Tokumura A Identification of human glycerophosphodiesterase 3 as an ecto phospholipase C that converts the G protein-coupled receptor 55 agonist lysophosphatidylinositol to bioactive monoacylglycerols in cultured mammalian cells Biochim Biophys Acta-Mol Cell Biol Lipids 2020 1865 158761 10.1016/j.bbalip.2020.158761 32629025
Tsutsumi T, Matsuda R, Morito K, Kawabata K, Yokota M, Nikawadori M, Inoue-Fujiwara M, Kawashima S, Hidaka M, Yamamoto T, Yamazaki N, Tanaka T, Shinohara Y, Nishi H, Tokumura A. Identification of human glycerophosphodiesterase 3 as an ecto phospholipase C that converts the G protein-coupled receptor 55 agonist lysophosphatidylinositol to bioactive monoacylglycerols in cultured mammalian cells. Biochim Biophys Acta-Mol Cell Biol Lipids. 2020;1865:158761.32629025 10.1016/j.bbalip.2020.158761
39. de Souza PPC Henning P Lerner UH Stimulation of osteoclast formation by oncostatin M and the role of WNT16 as a negative feedback regulator Int J Mol Sci 2022 23 3287 10.3390/ijms23063287 35328707
de Souza PPC, Henning P, Lerner UH. Stimulation of osteoclast formation by oncostatin M and the role of WNT16 as a negative feedback regulator. Int J Mol Sci. 2022;23:3287.35328707 10.3390/ijms23063287
40. Zhang P Dong J Fan X Yong J Yang M Liu Y Zhang X Lv L Wen L Qiao J Tang F Zhou Y Characterization of mesenchymal stem cells in human fetal bone marrow by single-cell transcriptomic and functional analysis Signal Transduct Target Ther 2023 8 126 10.1038/s41392-023-01338-2 36997513
Zhang P, Dong J, Fan X, Yong J, Yang M, Liu Y, Zhang X, Lv L, Wen L, Qiao J, Tang F, Zhou Y. Characterization of mesenchymal stem cells in human fetal bone marrow by single-cell transcriptomic and functional analysis. Signal Transduct Target Ther. 2023;8:126.36997513 10.1038/s41392-023-01338-2
41. Brommage R Liu J Powell DR Skeletal phenotypes in secreted frizzled-related protein 4 gene knockout mice mimic skeletal architectural abnormalities in subjects with Pyle’s disease from SFRP4 mutations Bone Res 2023 11 9 10.1038/s41413-022-00242-9 36808149
Brommage R, Liu J, Powell DR. Skeletal phenotypes in secreted frizzled-related protein 4 gene knockout mice mimic skeletal architectural abnormalities in subjects with Pyle’s disease from SFRP4 mutations. Bone Res. 2023;11:9.36808149 10.1038/s41413-022-00242-9
42. Pang X Gong K Zhang X Wu S Cui Y Qian B Osteopontin as a multifaceted driver of bone metastasis and drug resistance Pharmacol Res 2019 144 235 44 10.1016/j.phrs.2019.04.030 31028902
Pang X, Gong K, Zhang X, Wu S, Cui Y, Qian B. Osteopontin as a multifaceted driver of bone metastasis and drug resistance. Pharmacol Res. 2019;144:235–44.31028902 10.1016/j.phrs.2019.04.030
43. Korf-Klingebiel M Reboll MR Grote K Schleiner H Wang Y Wu X Klede S Mikhed Y Bauersachs J Klintschar M Rudat C Kispert A Niessen HW Lubke T Dierks T Wollert KC Heparan sulfate-editing extracellular sulfatases enhance VEGF bioavailability for ischemic heart repair Circ Res 2019 125 787 801 10.1161/CIRCRESAHA.119.315023 31434553
Korf-Klingebiel M, Reboll MR, Grote K, Schleiner H, Wang Y, Wu X, Klede S, Mikhed Y, Bauersachs J, Klintschar M, Rudat C, Kispert A, Niessen HW, Lubke T, Dierks T, Wollert KC. Heparan sulfate-editing extracellular sulfatases enhance VEGF bioavailability for ischemic heart repair. Circ Res. 2019;125:787–801.31434553 10.1161/CIRCRESAHA.119.315023
44. Wang J Xu H Cheng X Yang J Yan Z Ma H Zhao Y Ommati MM Manthari RK Wang J Calcium relieves fluoride-induced bone damage through the PI3K/AKT pathway Food Funct 2020 11 1155 64 10.1039/C9FO02491C 31872845
Wang J, Xu H, Cheng X, Yang J, Yan Z, Ma H, Zhao Y, Ommati MM, Manthari RK, Wang J. Calcium relieves fluoride-induced bone damage through the PI3K/AKT pathway. Food Funct. 2020;11:1155–64.31872845 10.1039/C9FO02491C
