
==== Front
RNA Biol
RNA Biol
RNA Biology
1547-6286
1555-8584
Taylor & Francis

39233564
10.1080/15476286.2024.2399310
2399310
Version of Record
Research Article
Research Paper
Poly(G)7 box: a functional element of mammalian 18S rRNA involved in translation
D. WEI ET AL.
RNA BIOLOGY
Wei Dahao a
Mai Zhangyu b
Li Xinan c
Yu Tianli d
https://orcid.org/0000-0002-0947-7580
Li Jiangchao d
a School of Life Sciences and Biopharmaceuticals, Guangdong Pharmaceutical University , Guangzhou, China
b School of Pharmacy, Guangdong Pharmaceutical University , Guangzhou, China
c Laboratory of Oncology and Immunology, School of Basic Medical Sciences, Guangzhou Medical University , Guangzhou, China
d Laboratory of Oncology and Immunology, School of Basic Medical Sciences, Guangdong Pharmaceutical University , Guangzhou, China
CONTACT Jiangchao Li lijiangchao@gdpu.edu.cn Laboratory of Oncology and Immunology, School of Basic Medical Sciences, Guangdong Pharmaceutical University, No. 280 Waihuan Rd. E, Higher Education Mega Center, Guangzhou 510006, China
5 9 2024
2024
5 9 2024
21 1 818
Integra04 9 2024
Integra04 9 2024
20 8 2024
26 8 2024
© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
2024
The Author(s)
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent.

ABSTRACT

In eukaryotes, the ribosomal small subunit (40S) is composed of 18S rRNA and 33 ribosomal proteins. 18S rRNA has a special secondary structure and is an indispensable part of the translation process. Herein, a special sequence located in mammalian 18S rRNA named Poly(G)7box, which is composed of seven guanines, was found. Poly(G)7 can form a special and stable secondary structure by binding to the translation elongation factor subunit eEF1D and the ribosomal protein RPL32. Poly(G)7box was transfected into cells, and the translation efficiency of cells was inhibited. We believe that Poly(G)7box is an important translation-related functional element located on mammalian 18S rRNA, meanwhile the Poly(G)7 located on mRNA 5’ and 3’ box does not affect mRNA translation.

KEYWORDS

Poly(G)7box
18S rRNA
Translation regulatory elements
Ribosome
Conserved sequence
National Key R&D Program 2021YFF0702600 Science and Technology Planning Project of Guangdong Province 10.13039/501100012245 2023A0505050153 This work was supported by the National Key R&D Program, China [2021YFF0702600] and Science and Technology Planning Project of Guangdong Province, China [2023A0505050153].
==== Body
pmc1. Introduction

The ribosome is an important structure in the process of protein translation and is composed of large and small subunits. In eukaryotes, the small subunits of ribosomes are composed of 18S rRNA and 33 small subunit-associated proteins (RPSs) [1,2].

Ribosomal RNA can form secondary structures through complementary base pairing and bind to proteins through these secondary structures [3,4]. Specialized ribosomal proteins bind to the structural domains of ribosomal RNAs to perform the appropriate functions. For example, in prokaryotes, the complex between ribosomal protein L11 and the 23S rRNA structural domain is a key region of the ribosomal GTPase [5,6]. L3 binds to the 3′ end of 23S rRNA and leads to rRNA folding [7]. In addition to interacting with ribosomal proteins, ribosomal RNA can interact with neighbouring ribosomal RNA [8]. In Escherichia coli, interactions between terminal ribosomal RNA helices stabilize the structure of the large subunit of the E. coli ribosome [9].

The main functions of small subunits are usually related to mRNA decoding and translation regulation. 18S rRNA plays an important role in translation because it can pair with mRNAs and thus facilitate translation [10–13]. Complementary 18S rRNA-mRNA base pairing has been demonstrated to inhibit the translation of 18S rRNA, as well as the positive regulation of mRNA [14]. In addition to exerting its corresponding function through base complementarity with mRNA, 18S rRNA can regulate translation through interactions with proteins. In 2015, Galina G. Karpova et al. showed that some fragments of 18S rRNA could bind to 40S small subunit proteins [15]. Alan G Hinnebusch’s study showed that residues of Saccharomyces cerevisiae 18S rRNA are important for Met-tRNA binding and for AUG selection [16].

In this study, we identified a conserved sequence located on mammalian ribosomal 18S rRNA and named it Poly(G)7box. By electrophoresis, we found that Poly(G)7box has a special and stable secondary structure. Moreover, Poly(G)7box can bind to the proteins RPL32 and eEF1-D. By transfection, we found that the overexpression of Poly(G)7box in cells inhibited cell translation. Moreover, we verified that Poly(G)7box localization in mRNA does not have a regulatory effect on mRNA translation.

2. Results

2.1. Poly(G)7box is present in most mammalian 18S rRNA

First, we checked the presence of Poly(G)7box sequences in mammalian 18S rRNA. So we analysed the 18S rRNA sequences using the NCBI database [17] and the SILVA database [18] and compared the 18S rRNA sequences of several mammal models. It was found that in mouse 18S rRNA, Poly(G)7box is present at 203–209 nt. In human 18S rRNA, Poly(G)7box is present at 202–208 nt. In rabbit 18S rRNA, there are two Poly(G)7boxs, which are present in the 18S rRNA at 202–208 nt and 265–271 nt. In rhesus macaque 18S rRNA, the Poly(G)7box is present at 202–208 nt. In pig 18S rRNA, there are two Poly(G)7boxs present at 529–535 nt and 592–598 nt. In rat 18S rRNA, Poly(G)7box is present at 205–211 nt. In goat 18S rRNA, Poly(G)7box was present at 202–208 nt (Figure 1A). The Poly(G)7box of pig is located at 529 nt instead of 202 nt site, possibly because the 18S rRNA of pigs is longer than that of other mammals (porcine 18S rRNA is 2302 nt long), which results in a different location of the Poly(G)7box compared to that of other mammals. Figure 1. Localization of Poly(G)7box in mammalian 18S rRNA. A. Analysis of Poly(G)7box localization in the 18S rRNA sequences of seven mammals model. One Poly(G)7box was present in mouse, human, rhesus monkey, rat and goat 18S rRNA; two Poly(G)7box structures were present in pig and rabbit 18S rRNA. B. Analysis of the bases around the Poly(G)7box structures in the 18S rRNA sequences of seven model mammals. The bases at the 5’ and 3’ ends of the Poly(G)7box differed between model mammals. C. Colocalization of Poly(G)7box and ribosomal 18S rRNA using in situ hybridization.

Poly(G)7box is located on the 18S rRNA at a relatively fixed position, demonstrating that Poly(G)7box may perform the same function in different mammals. Most mammals have only one Poly(G)7box on 18S rRNA, pigs and rabbits have two Poly(G)7boxs in 18S rRNA; however, the common feature is that the Poly(G)7boxs of these mammals are more centrally located at the 5’ end of 18S rRNA.

Subsequently, we attempted to explore whether there were other base of the repeats in the sequence. However, we found that Poly(G)7box on 18S rRNA is present in different mammalian species (Figure 1B). Above data clearly indicate that the Poly(G)7box is relatively conserved in mammalian 18S rRNA, suggesting that the Poly(G)7box is the smallest unit that performs a function involving mammalian 18S rRNA. Next, we designed FISH probes for Poly(G)7box and 18S rRNA then performed in situ hybridization to determine the location of Poly(G)7box in the cell. Poly(G)7box is widely present in the cytoplasm and has the same localization as 18S rRNA (Figure 1C).

2.2. Poly(G)7box has a stable secondary structure

18S rRNA with Poly(G)7box may exhibit special secondary structures. To investigate whether the secondary structure is stable, we designed and synthesized single-stranded DNA sequences. To mimic the Poly(G)7box state in ribosomal RNA, we added five bases at the 5’ end and five bases at the 3’ end of Poly(G)7box. To prevent surrounding sequences on the structure of Poly(G)7box from influencing the results, we designed eight sets of randomized sequences to exclude this effect. As a control, we inserted a nonguanine deoxyribonucleotide between the third and fourth guanine deoxyribonucleotides of the Poly(G)7box sequence to disrupt the Poly(G)7box structure (Figure 2A). Polyacrylamide gel electrophoresis was then performed to analyse the Poly(G)7 box for the presence of a secondary structure. We dissolved Poly(G)7 in TE buffer. To restore the secondary structure formed by adding Poly(G)7box under natural conditions, we performed gel electrophoresis on the synthesized Poly(G)7box sequence after denaturation at 95°C and keep at room temperature for 30 min. The results revealed that compared with the control group, the Poly(G)7box group exhibited a hysteresis band during electrophoresis, and this hysteresis band did not differ with changes in the sequence at either end of Poly(G)7box (Figure 2B). We designed a set of sequences by inserting a nonguanine deoxyribonucleotide between the first and second guanine deoxyribonucleotides of the sequence from the 5’ end and individually toward the 3’ end (Figure 2C). Polyacrylamide gel electrophoresis was carried out to demonstrate how many guanines were linked to each other, and a hysteresis band appeared. The results show that when six linked guanine deoxyribonucleotides are present, electrophoresis appears in lagging bands (Figure 2D). Figure 2. Gel electrophoretic verification of Poly(G)7box secondary structure. A. Sequence composition of the Poly(G)7box used for electrophoretic analysis. Two random bases centred on the Poly(G)7box were added at each end. In the control, a nonguanine deoxyribonucleotide was inserted between the third and fourth guanine deoxyribonucleotides to disrupt the Poly(G)7box structure. B. Polyacrylamide gel electrophoresis was performed with the synthesized Poly(G)7 box single-stranded DNA sequences to analyse the Poly(G)7box secondary structure. Compared to the control, the Poly(G)7box band significantly decreased in intensity. C. Analysis of whether secondary structure occurs with different amounts of consecutively linked Gs using nonguanine deoxyribonucleotides (red N) inserted into the sequence with a gradual backward shift. D. Polyacrylamide gel electrophoresis analysis revealed that lag bands were present in both Poly(G)6 and Poly(G)7. E. PBS buffer of the Poly(G)7 box was used to analyse its secondary structure, and analysis via agarose gel electrophoresis revealed the appearance of hysteresis bands. F. SSC buffer was used to solubilize Poly(G)7box to analyse its secondary structure, and a lag band was detected via agarose gel electrophoresis. G. The secondary structure of G4-DNA buffer-dissolved Poly(G)7box was analysed, and a hysteresis band was detected via agarose gel electrophoresis analysis. H. ddH2O-dissolved Poly(G)7box was analysed for its secondary structure, and a hysteresis band was detected via agarose gel electrophoresis analysis.

All the above solubilization of oligonucleotide chains was performed in TE buffer. Next, we used phosphate buffer solution (PBS) to solubilize the synthesized Poly(G)7box and analysed it using agarose gel electrophoresis. We found that the Poly(G)7box still formed a special secondary structure in PBS (Figure 2E). Also we used saline sodium citrate buffer (1×SSC buffer), G4-DNA buffer (a G-quadruplex buffer solution) and ddH2O to dissolve Poly(G)7box to investigate whether Poly(G)7box is stable in different solution environments. The mixture was denatured at 95°C for 2 min and kept at room temperature for 30 min before electrophoresis to restore its structure. It showed that Poly(G)7box produced electrophoretic lagging bands in a variety of solutions (Figure 2F–H).

We believe that the presence of this electrophoretic lag band indicates that Poly(G)7 may form a secondary structure and that the special structure of Poly(G)7box is different from that of the conventional G quadruples; the formation of the G quadruples requires the presence of salt ions in the solution and a specific pH. However, in our electrophoresis results, even in ddH2O, the Poly(G)7box still formed a special secondary structure (Figure 2H).

2.3. Poly(G)7box specifically binds the ribosomal protein RPL32 and the translation elongation factor eEF1-D

For Poly(G)7box, which is present in 18S rRNA, we analysed the relationship between Poly(G)7box and proteins by RNA pulldown. We designed a set of RNA sequences for RNA pulldown and modified biotin at the 3’ end. Three thymine deoxyribonucleotides were used in this sequence as hinges to space the Poly(G)7box. In the controls, an adenine nucleotide was inserted between the third and fourth guanine nucleotides to disrupt the Poly(G)7box structure (Figure 3A). After affinity-modified magnetic beads were used to bind the Poly(G)7box sequence, cultured cells were washed and lysed, incubated with magnetic beads bound to the Poly(G)7box and subsequently washed. At the end of the step, the Poly(G)7box sequence was eluted from the magnetic beads, and the eluted solution was subjected to mass spectrometry and WB to analyse binding between the proteins and Poly(G)7box (Figure 3A). The pulled-down proteins were analysed by SDS‒PAGE, followed by gel staining using Coomassie blue solution. Proteins pulled down by Poly(G)7box clearly differed from those pulled down by the control (Figure 3B). Figure 3. Analysis and validation of Poly(G)7box binding protein. A. Flowchart of the RNA pull-down experiment and Poly(G)7box RNA pull-down RNA sequence. The Poly(G)7box RNA sequence 3’ end-modified biotin was combined with affinity-modified magnetic beads to isolate the binding sequence to the Poly(G)7box. B. SDS-PAGE electrophoretic analysis of Poly(G)7box-binding proteins and Coomassie Blue staining. C. Poly(G)7box-binding protein profiles were analysed to identify two specific proteins, RPL32 and eEF1-D. D. WB verification of eEF1-D and RPL32 binding after Poly(G)7box RNA pulldown in the MDA-MB-231 cell line. E. WB verification of eEF1-D and RPL32 binding after Poly(G)7box RNA pulldown in the HDMEC cell line.

We performed RNA pull-down experiments using three cell lines, namely, MDA-MB-231 (human breast cancer cells), MLE12 (murine lung epithelial cells) and HUVECs (human umbilical vein endothelial cells), and established a control group. Then, mass spectrometry analysis was performed. All non-specific proteins in the control group were removed between the groups, and comparison of the results for the three groups revealed that two proteins, RPL32 and eEF1-D, were common proteins in the three experimental groups according to the RNA pulldown results (Figure 3C). To further verify whether Poly(G)7box binds to RPL32 and eEF1-D using WB, the results demonstrated that RPL32 and eEF1-D were present among the Poly(G)7box pulldown proteins (Figure 3D,E). RPL32 is a subunit protein of the large ribosomal subunit and is an important structure that constitutes the large ribosomal subunit. We found that this Poly(G)7box sequence was also present in 28S rRNA (Supplementary Figure S1C), but its presence in 28S rRNA varied among different species of mammals. The Poly(G)7box was not present in rabbit and goat 28S rRNA. The relationship between the Poly(G)7box and mammalian large subunits needs to be further explored. eEF1-D is a subunit protein of the translation elongation factor eEF1, which is an indispensable facilitator of the eukaryotic ribosome translation process; in addition, this protein can promote the entry of aminoacyl-tRNAs into the ribosomal A site and extend peptide chains, suggesting that the Poly(G)7box is related to the promotion of ribosome translation by eEF1 and/or eEF1-D.

2.4. Poly(G)7box inhibits protein translation efficiency

The Poly(G)7box is present in 18S rRNA and can bind to translation elongation factors. To investigate whether the Poly(G)7box is a key component of translation elongation factors bound to the small subunit of ribosomes, we increased the amount of synthesized Poly(G)7box in cells to verify that the Poly(G)7box plays a role in translation in ribosomal small subunit 18S rRNA. Exogenous Poly(G)7box competes with the Poly(G)7box of the ribosomal small subunit 18S rRNA for binding to the relevant translation elongation factors, thus verifying that the Poly(G)7box plays a role in the ribosomal small subunit 18S rRNA for translation.

The Poly(G)7box RNA sequence was synthesized and modified with thiolate to prevent its degradation, and the amount of synthetic Poly(G)7box in cells was increased by transfection. Forty-eight hours after transfection, the transfected cells were subjected to protein extraction and bicinchoninic acid (BCA) protein quantification. Compared to control group, the total protein content of cells transfected with Poly(G)7box was significantly lower (Figure 4A). To further confirm that Poly(G)7box plays an inhibitory role in the translation process of cells, we performed WB analysis of GAPDH, β-Tubulin and eEF1-D. The results showed that the protein levels of GAPDH and eEF1-D in the Poly(G)7box-transfected group were lower than those in the control group, while there was no statistically significant difference in β-Tubulin levels (Figure 4B–E). Increasing the content of synthetic Poly(G)7box in cells inhibited the translation of some cellular proteins. Figure 4. Poly(G)7box transfection inhibits cellular protein translation.

A. BCA protein quantification was performed to analyse the effect of Poly(G)7box transfection on protein translation. The sequence of the Poly(G)7 box was GGGGGGG, and the sequence of the control was GGGAGGGG. The total protein content of Poly(G)7 box-transfected cells was significantly different from that of the control cells (p value = 0.0006, p value <0.001). B. WB analysis of protein inhibition by Poly(G)7box transfection. GAPDH, β-Tubulin and eEF1-D protein expressions were analysed by WB. C. The transfection of GADPH by Poly(G)7box-was significantly different from that of the control (p value = 0.0362, p value <0.05). D. The transfection of β-tubulin by Poly(G)7box was statistically different from that of the control (p value = 0.3146; no statistically significant difference). E. The transfection of eEF1-D Poly(G)7box was statistically different from control (statistical difference was observed; p value = 0.0356). A p value <0.05 indicated statistically difference.

Furthermore, we attempted to silence the Poly(G)7box sequence on ribosomal small subunit 18S rRNA to confirm the importance of the Poly(G)7box in protein translation. The CCCCCCC sequence (Poly(C)7) contains dimethoxy modification to prevent its degradation and binds intracellularly to the Poly(G)7box located on the ribosomal small subunit 18S rRNA, thereby affecting the Poly(G)7box structure and inhibiting the binding of the Poly(G)7box to translation elongation factors. After transfection, proteins were extracted and subjected to bicinchoninic acid (BCA) protein quantification; compared to that of the experimental group, the protein content of the Poly(C)7-transfected group did not significantly change than that of the control group (Supplementary Figure S1A, B). It is possible that the transfected Poly(C)7 could not enter the assembled ribosomal small subunit and could not bind to the Poly(C)7 box on the 18S rRNA, resulting in unaffected protein translation in the experiment.

2.5. The 5’ and 3’ UTRs of Poly(G)7box in mRNA have no effect on mRNA translation

In addition to the presence of Poly(G)7box in ribosomal RNA, we detected Poly(G)7boxes in the mRNAs of different species; these Poly(G)7boxes were mainly distributed in the noncoding regions of mRNAs, the 5’ UTR (5’ end noncoding region) and the 3’ UTR (3’ end noncoding region). Using the NCBI database, we searched for mRNA sequences containing Poly(G)7 in humans, mice and Arabidopsis thaliana. The position of the Poly(G)7box in these mRNAs by randomly selecting 100 from each organism was analysed in the mRNA sequences. After counting, we found that the Poly(G)7box mainly existed in the noncoding regions of the mRNAs (Figure 5A–C). The noncoding regions of mRNAs play a regulatory role in the translation of mRNAs. To investigate whether the Poly(G)7box has a regulatory effect on mRNA, we designed plasmids expressing eGFP and inserted Poly(G)7box adjacent to the 5’ UTR and 3’ UTR of the eGFP (Figure 5D). Subsequently, we transfected these plasmids into two cell lines, KYSE-30 and NCM460, and analysed whether the expression of eGFP was changed by WB. Two cell lines were transfected with three plasmids. After transfection, we performed eGFP quantification experiments. It was found that there was no statistically significant difference in eGFP expression between the group with Poly(G)7 inserted at the 5’ UTR or 3’ UTR and the plasmid-transfected group without Poly(G)7 insertion. The results revealed that there was no significant effect on the expression of eGFP, regardless of whether the Poly(G)7box was inserted into the 5’ UTR or the 3’ UTR (Figure 5E,F). Figure 5. Poly(G)7box has no effect on mRNA translation.

A. For humans, 100 randomly selected mRNAs containing 32% Poly(G)7boxes occur in the 5’ UTR, 16% in the coding region and 52% in the 3’ UTR. B. For mice, 33% were in the 5’ UTR, 21% were in the coding region and 46% were in the 3’ UTR. C. Arabidopsis: 23% in the 5’ UTR, 30% in the coding region and 47% in the 3’ UTR. D. Structural diagram of the eGFP plasmid. The Poly(G)7box was inserted into the eGFP 5’ UTR and 3’ UTR. E. Western blot of eGFP expression in the KYSE-30 cell line transfected with two inserted Poly(G)7box expression eGFP sequences and control group. C. eGFP expression analysis of WB in NCM460 cell lines transfected with two inserted Poly(G)7box sequences. Compared to control group.

3. Discussion

Here, we identified a conserved sequence that contained seven guanine nucleotides and is located on mammalian 18S rRNA, and named this sequence Poly(G)7box. We analysed Poly(G)7box by polyacrylamide gel electrophoresis and agarose gel electrophoresis and found that it exhibits a specific and stable secondary structure. Subsequently, we performed RNA pulldown, mass spectrometry and WB, and found that the Poly(G)7box could bind specifically to RPL32 and eEF1-D. This finding might imply that there is a relationship between the Poly(G)7box and the ribosomal translation process. The synthesized Poly(G)7box was transfected into cells to investigate its effect on cellular translation. By protein quantification, we found that the protein expression of transfected Poly(G)7box cells was significantly decreased. The presence of excessive Poly(G)7box in the cells inhibited protein translation. And plasmid transfection and WB revealed that the Poly(G)7box did not play a regulatory role in mRNA translation. There are several points worth discussing in this study.

3.1. Electron microscopy analysis revealed that the Poly(G)7box is complementary to Poly(C)7 at the 5’ end

Electron microscopy analysis of the structural resolution of human ribosomes available in the PBD [19] revealed that Poly(G)7box combines with Poly(C)7 at the 5’ end (Supplementary Figure S2), forming a double helix. We believe that the ribosome, as a complex protein translation machine, is a constantly changing process throughout the translation process, and the structure of ribosomal rRNA changes simultaneously. Therefore, we think that in the process of ribosome translation, this double-stranded structure is likely to transform into a single-stranded structure, Poly(G)7 and its Ploy(C)X (X= C number in different species), turn on or turn off in the translation process in 18S rRNA (Figure 1B).

3.2. Secondary structure formed by Poly(G)7box

Using polyacrylamide gel electrophoresis, we observed that Poly(G)7box can form specific secondary structures. Previous studies have well established that guanineich nucleic acid sequences are very prone to form secondary structures, such as G quadruplex. Therefore, does Poly(G)7box form a secondary structure such as G quadruplex? We believe that Poly(G)7box does not form a G quadruplex structure for the following reasons. First, the formation of G-quadruplexes has certain sequence requirements, and G-quadruplexes are usually composed of repetitive G rich sequences [20]. For example, the human telomere G-quadruplex structure (TTAGGG)n composition [21] is quite different from that of the Poly(G)7box sequence.

Second, the formation of G quadruplexes usually also requires cations, such as K+ or Na+ [22–24]; In contrast, ions are not needed for the formation of secondary structures by Poly(G)7box (Figure 2H), and the electrophoresis of Poly(G)7box still shows lagging bands after dissolution in pure water [25–27]. Thus, it was demonstrated that Poly(G)7box forms a distinct structure compared to the G quadruplex. However, the specific structure formed by Poly(G)7box should be further analysed. In polyacrylamide gel electrophoresis, we found that a lagging band similar to that of Poly(G)7box also appeared when six neighbouring Gs connect (Figure 2C,D). In this regard, further investigations should be performed to determine whether the six consecutive G proteins form a secondary structure that is identical or similar to that of Poly(G)7box. It is difficult to analyse these structures by electrophoresis.

3.3. Poly(G)7box is located in 28S rRNA and is present in prokaryotic ribosomal RNA

By analysing the presence and distribution of Poly(G)7 box using databases, we found that Poly(G)7box is also present in mammalian 28S rRNA (Supplementary Figure S1C). After analysing the sequences, we found that the presence of Poly(G)7 box in 28S rRNA was not regular and relatively fixed, which was also observed in 18S rRNA and 28S rRNA. We did not detect Poly(G)7boxes in 28S rRNA from rabbits or goats. However, six consecutive guanine nucleotides were present. It suggests that the Poly(G)7box is relatively more conserved in mammalian 18S rRNA and relatively more variable in 28S rRNA. However, the ability of Poly(G)7box to bind to RPL32 (ribosomal large subunit-associated protein 32) suggests that Poly(G)7box functions in 28S rRNA, but further verification is needed to do so.

3.4. The interaction of RPL32 and eEF1-D with Poly(G)7box

By RNA pulldown, mass spectrometry and WB, we determined that Poly(G)7box could bind to RPL32 and eEF1-D (Figure 3); simultaneously, we demonstrated that Poly(G)7box has an accessory structure (Figure 2A). Therefore, we believe that the binding of Poly(G)7box to these two proteins occurs through the three-dimensional structure formed by each protein, which allows the structures to bind. The sequence of Poly(G)7box is known, as are the identical peptides in RPL32 and eEF1-D that form a structure that binds to Poly(G)7box. In this regard, we compared the protein primary structures of human eEF1-D and human RPL32 but did not find significantly identical fragments.

3.5. Analysis of the biological function of Poly(G)7box

We transfected Poly(G)7 to increase the amount of Poly(G)7box in the cells. The results confirmed that the transfection of Poly(G)7box reduced the amount of total protein in response to the inhibition of protein translation by Poly(G)7box transfection. Therefore, we attempted to determine if the deletion of Poly(G)7box affected the ribosomal function by knocking down Poly(G)7box from 18S rRNA; however, since 18S rRNA is a multichromosomal repetitive sequence, it is more difficult to knockdown Poly(G)7box at the DNA level. Disrupting Poly(G)7box by siRNA is more difficult. Mature 18S rRNA is encapsulated by ribosomal small subunit proteins, and interference is also difficult to achieve. Moreover, the consecutive occurrence of guanines leads to great challenges in the design of interference strands. Therefore, a better method for knocking down the Poly(G)7box on 18S rRNA has not been identified.

We attempted to use seven cytosine nucleotides to block the Poly(G)7box, thereby inhibiting its binding to related translation elongation factors. However, after protein quantification in the transfected cell lines, there is no significant effect.

We also verified that Poly(G)7box is not regulated by mRNA translation; however, we only verified that Poly(G)7box adjacent to the reading frame has no effect on mRNA translation. We did not specifically analyse the effect of Poly(G)7box, which is located away from the reading frame, on the mRNA response. It was only verified that the effect of a Poly(G)7box neighbouring the reading frame of mRNA on mRNA translation.

Overall, we suggest that Poly(G)7box is a functional progenitor related to translation located in mammalian 18S rRNA, which facilitates ribosomal function by binding to proteins such as translation elongation factors.

4. Materials and methods

4.1. Agarose gel electrophoresis

The nucleic acid (Sangon Biotech synthesis) was dissolved in TE buffer, concentration was 100 μM. Then, the sample was heated at 95°C for 2 min for denaturation. Afterward, the nucleic acid solution was cooled for 30 min at room temperature. Then, 10× DNA loading buffer (TaKaRa CA3001A) and the nucleic acid solution were mixed 1:9. A total of 2 μl of ethidium bromide (10 mg/ml) was added to the agarose gel solution. Each solution was combined with 20 μl of nucleic acid mixing solution. The electrophoresis mixture was run for 1 h at 150 mA. After electrophoresis, the gel was developed under a developing machine.

4.2. Polyacrylamide gel electrophoresis analysis

The oligos (Sangon Biotech synthesis) were dissolved in TE buffer. The nucleic acid concentration was 100 μM. The sample was then heated at 95°C for 2 min for denaturation. Afterward, the nucleic acid solution was cooled for 30 min at room temperature for renaturation. Then, 10× DNA loading buffer and the nucleic acid solution were mixed 1:9 in an EP tube. A 12%polyacrylamide gel (29% (w/v) acrylamide plus 1% N, 20 ml of N’methylenebisacrylamide, 19.65 ml of H2O, 0.35 ml of 5×TBE buffer, 10% (w/v) ammonium persulphate and 17.5 μl of TEMED) was added to each combination in 20 μl of nucleic acid mixing solution. Electrophoresis was performed under 35 mA. To prevent structural changes in nucleic acids due to overheating during electrophoresis, electrophoresis (PowerPac Basic) was performed on ice.

4.3. Poly(G)7box oligos sequence in different solution systems

The nucleic acid (Sangon Biotech) was centrifuged and dissolved in PBS (0.20 g of KCl, 8.00 g of NaCl, 0.24 g of KH2PO4, 3.36 g of NaH2PO4, pH adjusted to 7.35–7.45 through HCl, diluted to 1 L with ddH2O), 1× SSC (20× SSC buffer: 175.3 g of NaCl, 88.2 g of sodium citrate, pH adjusted to 7 with HCl, diluted to 1 L with ddH2O). G4-DNA buffer (600 mM of NaCl, 50 mM of KCl, 10 mM of HEPES, pH adjusted to 5.5 through HCl) and ddH2O. The nucleic acid concentration was 100 μM. Then, the samples were subjected to heat denaturation for 2 min. Afterward, the nucleic acid solution was cooled for 30 min at room temperature. Then, 10× DNA loading buffer (TaKaRa CA3001A) and the nucleic acid solution were mixed 1:9. Agarose gel electrophoresis analysis was performed.

4.4. Cell culture

HUVEC cell, MBA-MD-231 cell, HDMEC cell, MLE 12 cell, KYSE-30 cell, and NCM460 cell preserved at the Institute of Basic Medicine, Guangdong Pharmaceutical University were used in this experiment. After cell recovery, the cells were cultured in complete DMEM at 37°C in a 5% CO2 constant temperature incubator. DMEM (GIBCO 6,123,009) complete culture medium was composed of 90% DMEM high glucose medium, 10% inactivated FBS (EVERY GREEN 11,011–8611), foetal bovine serum and 1% two antibiotics (penicillin and streptomycin) (GIBCO 15,140–122).

4.5. RNA pulldown

Six groups, namely, the MDA-MB-231 cell-line treatment group, MDA-MB-231 cell-line control group, HUEVC cell-line treatment group and HUEVC cell-line control group, MLE12 cell-line treatment group and MLE12 cell-line control group. A complete RNA-magnetic bead complex with Poly(G)7box sequence was added to the treatment group for the pull-down experiment, and a control group sequence of the RNA-bead complex was added to the control group for the pull-down experiment. The synthetic RNA used were GGGGGGG(dT) (dT) (dT)GGGGGGG(dT) (dT) (dT) and modified biotin (Sangon Biotech), and the sequences used for the control group were GGGAGGGG(dT) (dT) (dT)GGGAGGGG(dT) (dT) (dT) and modified biotin (Sangon Biotech). Three micrograms of RNA sequence (Sangon Biotech) were dissolved in TE buffer. Then, the samples were subjected to heat denaturation (95 °C) for 2 min. Afterward, the nucleic acid solution was cooled for 30 min at room temperature. 50 μl of avidin-modified magnetic nanobeads were added to an enzyme-free EP tube. The magnetic beads were cleared by using a magnetic stand.

The avidin-modified magnetic nanobeads (Blolinkedin, L- 1012/L- 1012A) were cleaned with 500 μl of binding buffer (8×binding buffer: 23.376 g of NaCl, 1.9376 g of Tris base, 0.2723 g of MgCl2, 100 ml of 0.1% DEPC H2O was added). 500 μl of binding buffer was added to resuspend the cells on ice. The RNA solution and avidin-modified magnetic nanobeads were mixed and incubated at 4°C for 2 h. The cells (medium dish, cell density of 90%–95% confluent) were removed from the incubator, the culture medium was removed, and the cells were washed three times with ice-cold PBS. Then, 200 μl of RIPA cell lysate with protease inhibitor was added to the medium dish. The cells were extracted with a cell scraper. The cells were lysed at 4°C for 40 min. The extracted proteins were centrifuged, and the supernatant was collected and incubated with magnetic beads. The magnetic beads were briefly centrifuged after an 8-h incubation, and the supernatant was removed with a magnetic stirrer. Then, 500 μl of binding buffer containing the RNA-magnetic beads was added three times. The RNA magnetic beads were mixed with 1 ml of binding buffer, 5 μl of RNase Inhibiter (GLPBIO, GK120014) and 500 μl of cell lysates. The samples were incubated overnight at 4°C. Then, magnetic beads were cleared with magnetic buffer, and the protein–RNA–magnetic beads were cleaned eight times with binding buffer.

4.6. Protein mass spectrometry

We commissioned APPLIED PROTEIN TECHNOLOGY for protein mass spectrometry.

4.7. Bioinformatics analysis

The mRNA and rRNA data were obtained from the NCBI database and Silva database.

4.8. Plasmid construction

General Biological Company constructed the vectors and synthesized the DNA. The Poly(G)7box was inserted into the Afl2 and BbsI sites of the pcDNA3.1-eGFP vector to construct the upstream and downstream insertion eGFP plasmids of Poly(G)7box. The primers G02545851/G0254585-2 were amplified by PCR to obtain the fragment product, which was subsequently recombined into the target vector pcDNA3. 1-eGFP (AflII-HindIII digestion vector) was generated by multi segment recombination to obtain the full-length G0254585–1/G0254585-2 construct.

4.9. Cell transfection

The cells were transfected using a Lipofectamine 3000 transfection kit (Thermo 1984732) to establish control group without plasmids. The cells were transfected as follows: the serum was removed from the six-well plate, the cells were washed with prewarmed PBS. The medium was replaced with serum-free and two antibiotics basal medium (6-well plates, 2 ml/well), and the plates were placed in a 37°C incubator for culture. Transfection reagent preparation: Plasmids were diluted in 95 μl of Opti-MEM (Thermo 2042333) optimized medium. Then, 5 μl of Lipo3000 was added to 100 μl of Opti-MEM optimization medium and incubated for 5 min. The diluted plasmid and the mixed Lipo3000 were mixed and keep for 20 min. The medium in the 6-well plate was replaced with 1.8 ml of serum-free medium containing two antibiotics, and 200 μl of transfection reagent was added to the cells and shaken so that the transfection complex was distributed. After culture for 8 h, the medium was replaced with complete medium, and the cells were cultured for 48 h.

The Poly(G)7box transfection procedure was similar to the plasmid transfection procedure described above. Poly(G)7box RNA sequences (Sangon Biotech) were used at a concentration of 20 μM per well in a six-well plate, and three negative wells were used for control group.

For analysis of PKR phosphorylation, Poly(I:C) (HY-107202)-treated cells were used as a positive control. Poly(I:C) was added to the complete medium to a final concentration of 1 μg/ml. Proteins were extracted after 48 h.

4.10. Western blot (WB)

WB was performed using the following antibodies: anti-EIF2S1 (HUABIO PSH04–29); anti-phospho-EIF2S1 (S51) (HUABIO SZ01–06); anti-phospho-PKR (T446) (HUABIO SY230); anti-PKR (HUABIO SC06–37); RPL32 (abs143506); eEF1-D (Affinit DF6974); eGFP (Thermo XF345372); and β-actin (ZENBIO KK0705).

After the cells were washed three times with PBS after transfection 48 h, 150 μl of RIPA buffer (Beyotime P0013B) and 5 μl of protease inhibitor (Beyotime P1051–1) were added to each well, and the cells were lysed at 4°C for 40 min and centrifuged at 15,000 rpm for 10 min. The precipitated supernatant was removed, and the supernatant was transferred to a new enzyme-free EP tube. Protein concentrations were quantified using the BCA (Bicinchoninic Acid) Protein Quantification Kit (Thermo RE232694), and after quantification, 5× loading buffer (GENERAL 1203G31) was added to the protein sample, which was mixed well and heated at 100°C for 10 min. A 12% polyacrylamide gel was used for separation, and the lower separation gel was prepared. The marker (Thermo 91,227,189) and 30 μg of total protein solution were added to each well. Electrophoresis was performed in electrophoresis solution (28.8 g glycine, 2 g SDS, 6.06 g Tris, ddH2O 2 L). Following electrophoresis, the proteins were subjected to WB analysis in transfer solution (5.8 g glycine, 0.74 g SDS, 11.6 g Tris, ddH2O added to 1600 ml, methanol added to 400 ml) using PVDF (Millipore 0000188914). Then, the PVDF membranes were washed and blocked by incubation with 10% non-fat dry milk (Sengon Biotech FA12BA0003). The antibodies were diluted, added to PVDE membranes and incubated overnight at 4°C. The incubated PVDF membranes was developed using ECL kit.

4.11. Coomassie blue staining

After electrophoresis. The gel was washed twice with ddH2O and subsequently stained for 1 h at room temperature with the addition of Coomassie Blue Stain (Beyotime P0017FFT). Then, the gel was washed with ddH2O until a clear band was observed.

4.12. Ribosomal RNA analysis

For sequence analysis of ribosomes, we used the Silva and NCBI databases for searching and analysis.

4.13. Poly(G)7box in situ hybridization

The FISH probe sequence used to localize the Poly(G)7 sequence was acgcatcccccccccgcgaagg, with FAM modifications (Exonbio, Guangzhou, China). The probe to localize the 18S rRNA gene was ggggctgaccgggttggttttgatctg, with TAMRA modification (Sangon Biotech). The MDA-MB-231 cell line was washed two times with PBS for 5 min each. Then, proteinase K solution was added and incubated at 37°C for 3 min. The samples were washed three times with PBS for 5 min each, and one drop 0.1% Triton was added for 5 min. The samples were washed three times with PBS and drop 0.1 M HCl for 10 min. The samples were washed three times with PBS for 5 min each. The probe hybridization solution was added at a concentration of 1 μM, 20 μl was added to cover with coverslips, and the mixture was incubated at 37°C overnight. The probe hybridization solution: formamide, 30%; 5× SSC; 0.1% Tween-20; 50 µg/mL heparin; 1× Denhardt’s solution; and 10% dextran sulphate. The samples were washed three times for 10 min each with 2× SSC solution. Nuclear staining was performed with DAPI solution and then observed under a fluorescence microscope.

Supplementary Material

Supplementary data 2024_07_05.docx

Acknowledgments

We would like to thank Prof. Chan Yoke Fun and Prof. Zhou Lin for his guidance on this article. The authors thank Xiaobing Mai and Sishuo Chen for advice on our manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Authors’ contributions

Conception idea and scheme design: WDH and LJC. Acquisition of experimental data: WDH, MZY, LXA and YTL. Statistics and analysis: WDH, YTL and MZY. Writing and revision of the manuscript: WDH, LXA and LJC. Supervision and Funding: LJC. All the authors have read and approved the final manuscript.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author upon reasonable request.

Consent for publication

Consent for publication from all the authors was obtained.

Ethics declarations

Research not involving human participants and/or animals.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15476286.2024.2399310
==== Refs
References

[1] Korostelev AA. A deeper look into translation initiation. Cell. 2014;159 (3 ):475–476. doi: 10.1016/j.cell.2014.10.005 25417100
[2] Nieto B, Gaspar SG, Moriggi G, et al. Identification of distinct maturation steps involved in human 40S ribosomal subunit biosynthesis. Nat Commun. 2020;11 (1 ):156. doi: 10.1038/s41467-019-13990-w 31919354
[3] Wu JC, Gardner DP, Ozer S, et al. Correlation of RNA secondary structure statistics with thermodynamic stability and applications to folding. J Mol Biol. 2009;391 (4 ):769–783. doi: 10.1016/j.jmb.2009.06.036 19540243
[4] Draper DE, Reynaldo LP. RNA binding strategies of ribosomal proteins. Nucleic Acids Res. 1999;27 (2 ):381–388. doi: 10.1093/nar/27.2.381 9862955
[5] Schmidt FJ, Thompson J, Lee K, et al. The binding site for ribosomal protein L11 within 23 S ribosomal RNA of Escherichia coli. J Biol Chem. 1981;256 (23 ):12301–12305. doi: 10.1016/S0021-9258(18)43270-X 6271782
[6] Thompson J, Cundliffe E, Stark M. Binding of thiostrepton to a complex of 23-S rRNA with ribosomal protein L11. Eur J Biochem. 1979;98 (1 ):261–265. doi: 10.1111/j.1432-1033.1979.tb13184.x 111931
[7] Herold M, Nierhaus KH. Incorporation of six additional proteins to complete the assembly map of the 50 S subunit from Escherichia coli ribosomes. J Biol Chem. 1987;262 (18 ):8826–8833. doi: 10.1016/S0021-9258(18)47489-3 3298242
[8] Noller HF. RNA structure: reading the ribosome. Science. 2005;309 (5740 ):1508–1514. doi: 10.1126/science.1111771 16141058
[9] Nissley AJ, Kamal TS, Cate JHD. Interactions between terminal ribosomal RNA helices stabilize the E. coli large ribosomal subunit. RNA. 2023;29 (10 ):1500–1508. doi: 10.1261/rna.079690.123 37419664
[10] Martin F, Ménétret JF, Simonetti A, et al. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation. Nat Commun. 2016;7 (1 ):12622. doi: 10.1038/ncomms12622 27554013
[11] Mauro VP, Chappell SA, Dresios J. Analysis of ribosomal shunting during translation initiation in eukaryotic mRNAs. Methods Enzymol. 2007;429 :323–354.17913630
[12] Chappell SA, Dresios J, Edelman GM, et al. Ribosomal shunting mediated by a translational enhancer element that base pairs to 18S rRNA. Proc Natl Acad Sci USA. 2006;103 (25 ):9488–9493. doi: 10.1073/pnas.0603597103 16769881
[13] Panopoulos P, Mauro VP. Antisense masking reveals contributions of mRNA-rRNA base pairing to translation of gtx and FGF2 mRNAs. J Biol Chem. 2008;283 (48 ):33087–33093. doi: 10.1074/jbc.M804904200 18832380
[14] Verrier SB, Jean-Jean O. Complementarity between the mRNA 5’ untranslated region and 18S ribosomal RNA can inhibit translation. RNA. 2000;6 (4 ):584–597. doi: 10.1017/S1355838200992239 10786849
[15] Gopanenko AV, Malygin AA, Karpova GG. Exploring human 40S ribosomal proteins binding to the 18S rRNA fragment containing major 3’-terminal domain. Biochim Biophys Acta. 2015;1854 (2 ):101–109. doi: 10.1016/j.bbapap.2014.11.001 25462191
[16] Dong J, Nanda JS, Rahman H, et al. Genetic identification of yeast 18S rRNA residues required for efficient recruitment of initiator tRNA(Met) and AUG selection. Genes Devel. 2008;22 (16 ):2242–2255. doi: 10.1101/gad.1696608 18708582
[17] Sayers EW, Bolton EE, Brister JR, et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2022;50 (D1 ):D20–d26. doi: 10.1093/nar/gkab1112 34850941
[18] Quast C, Pruesse E, Yilmaz P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Research. 2013;41 (D1 ):D590–D596. doi: 10.1093/nar/gks1219 23193283
[19] Berman H, Henrick K, Nakamura H. Announcing the worldwide protein data bank. Nat Struct Biol. 2003;10 (12 ):980. doi: 10.1038/nsb1203-980 14634627
[20] Zarudnaya MI, Kolomiets IM, Potyahaylo AL, et al. Structural transitions in poly(a), poly(c), poly(u), and poly(g) and their possible biological roles. J Biomol Struct Dyn. 2019;37 (11 ):2837–2866. doi: 10.1080/07391102.2018.1503972 30052138
[21] Dai J, Carver M, Yang D. Polymorphism of human telomeric quadruplex structures. Biochimie. 2008;90 (8 ):1172–1183. doi: 10.1016/j.biochi.2008.02.026 18373984
[22] Ambrus A, Chen D, Dai J, et al. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 2006;34 (9 ):2723–2735. doi: 10.1093/nar/gkl348 16714449
[23] Armas P, Calcaterra NB. G-quadruplex in animal development: contribution to gene expression and genomic heterogeneity. Mech Dev. 2018;154 :64–72. doi: 10.1016/j.mod.2018.05.004 29758269
[24] Yang D. G-Quadruplex DNA and RNA. Methods Mol Biol. 2019;2035 :1–24.31444741
[25] Sundquist WI, Klug A. Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature. 1989;342 (6251 ):825–829. doi: 10.1038/342825a0 2601741
[26] Chen Y, Yang D. Sequence, stability, and structure of G-quadruplexes and their interactions with drugs. Curr Protoc Nucleic Acid Chem. 2012. 50 (1 ). Chapter 17:Unit17.15. doi: 10.1002/0471142700.nc1705s50
[27] Gellert M, Lipsett MN, Davies DR. Helix formation by guanylic acid. Proc Natl Acad Sci USA. 1962;48 (12 ):2013–2018. doi: 10.1073/pnas.48.12.2013 13947099
