
==== Front
Cancer Cell Int
Cancer Cell Int
Cancer Cell International
1475-2867
BioMed Central London

39245709
3492
10.1186/s12935-024-03492-1
Research
GALNT6 promotes bladder cancer malignancy and immune escape by epithelial-mesenchymal transition and CD8+ T cells
Sun Xiaoxin 12
Wu Haotian 1
Tang Ling 1
Al-Danakh Abdullah 3
Jian Yuli 1
Gong Li 1
Li Congchen 1
Yu Xiao 4
Zeng Guang 2
Chen Qiwei chenqiwei@dmu.edu.cn

35
Yang Deyong yangdeyong@dmu.edu.cn

3
Wang Shujing wangshujing@dmu.edu.cn

1
1 https://ror.org/04c8eg608 grid.411971.b 0000 0000 9558 1426 Liaoning Provincial Core Lab of Glycobiology and Glycoengineering, College of Basic Medical Sciences, Dalian Medical University, Dalian, 116044 China
2 https://ror.org/04c8eg608 grid.411971.b 0000 0000 9558 1426 College of Integrative Medicine, Dalian Medical University, Dalian, 116044 China
3 https://ror.org/055w74b96 grid.452435.1 0000 0004 1798 9070 Department of Urology, First Affiliated Hospital of Dalian Medical University, Dalian, 116000 China
4 https://ror.org/04c8eg608 grid.411971.b 0000 0000 9558 1426 Department of Pathology and Forensic Medicine, College of Basic Medical Sciences, Dalian Medical University, Dalian, 116044 China
5 https://ror.org/04ct4d772 grid.263826.b 0000 0004 1761 0489 Zhongda Hospital, Medical School, Advanced Institute for Life and Health, Southeast University, 210096 Nanjing, China
8 9 2024
8 9 2024
2024
24 3089 5 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Bladder cancer (BC) ranks as the sixth cancer in males and the ninth most common cancer worldwide. Conventional treatment modalities, including surgery, radiation, chemotherapy, and immunotherapy, have limited efficacy in certain advanced instances. The involvement of GALNT6-mediated aberrant O-glycosylation modification in several malignancies and immune evasion is a subject of speculation. However, its significance in BC has not been investigated. Through the integration of bioinformatics analysis and laboratory experimentation, we have successfully clarified the role of GALNT6 in BC. Our investigation revealed that GALNT6 has significant expression in BC, and its high expression level correlates with advanced stage and high grade, leading to poor overall survival. Moreover, both in vitro and in vivo experiments demonstrate a strong correlation between elevated levels of GALNT6 and tumor growth, migration, and invasion. Furthermore, there is a negative correlation between elevated GALNT6 levels, the extent of CD8+ T cell infiltration in the tumor microenvironment, and the prognosis of patients. Functional experiments have shown that the increased expression of GALNT6 could enhance the malignant characteristics of cancer cells by activating the epithelial-mesenchymal transition (EMT) pathway. In brief, this study examined the impact of GALNT6-mediated abnormal O-glycosylation on the occurrence and progression of bladder cancer and its influence on immune evasion. It also explored the possible molecular mechanism underlying the interaction between tumor cells and immune cells, as well as the bidirectional signaling involved. These findings offer a novel theoretical foundation rooted in glycobiology for the clinical application of immunotherapy in BC.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12935-024-03492-1.

Keywords

GALNT6
O-glycosylation
Epithelial-mesenchymal transition
Tumor immune escape
Bladder cancer
This work was supported by Dalian Medical University Interdisciplinary Research Cooperation Project Team FundingJCHZ2023021 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Bladder cancer (BC) is a malignant tumor that develops in the epithelial tissue of the bladder mucosa. According to the latest global cancer statistics, BC has the sixth highest incidence rate among male malignancies [1], and it ranks as the ninth most common disease worldwide. Men have a greater incidence rate and fatality rate compared to women globally. BC is one of the most deadly types of cancer around the world, and bladder urothelial carcinoma (BLCA) makes up 90% of all occurrences of BC [2, 3]. Transurethral resection of BC and radical total cystectomy have emerged as significant surgical techniques for managing BC [4]. However, despite these advancements, many individuals remain susceptible to post-surgical recurrence and distant metastases. Therefore, understanding the causes and mechanisms that lead to the malignant advancement of BLCA is extremely important in developing more effective treatment strategies.

Glycosylation represents the most prevalent post-translational modification in proteins, which enhances their structural and functional diversity [5, 6]. This process can be classified into four main types based on the core regions where glycans bind to proteins: N-glycans, O-glycans, glycosaminoglycans, and glycosphingolipids [7, 8]. Among these, O-glycosylation is notably prevalent in animals, involving the attachment of glycans through O-linked N-acetylgalactosamine (GalNAc) to serine and threonine residues [9]. In oncology, abnormal expressions of Tn (GalNAcα1-Ser/Thr), T (Galβ1-3GalNAcα1-Ser/Thr), and s-Tn (Neu5Acα2,6GalNAcα1-Ser/Thr) antigens, commonly observed in various cancers, are utilized as biomarkers for cancer detection [10]. Additionally, aberrant O-GlcNAcylation is linked with a spectrum of diseases, including neurodegenerative disorders, diabetes, and cancer [11]. Specifically, the sTn antigen, which often correlates with the early stages of tumorigenesis, is highly expressed in several cancers, including bladder, ovarian, colon, lung, gastric, and prostate [12, 13]. The process of O-Glycosylation, which is regulated by a large family of enzymes known as UDP-GalNAc: polypeptide GalNAc-transferase (GALNT), has different roles in tumors [9]. Research has demonstrated that members of the GALNT family are implicated in the onset and progression of various cancers, with their roles potentially tied to the modifications they induce in protein structures through O-glycosylation [14]. For instance, elevated expression of GALNT1 in hepatocellular carcinoma (HCC) has been linked to enhanced tumor migration and invasion, facilitated by increased O-glycan modifications on the epidermal growth factor receptor (EGFR) [15]. Conversely, reduced levels of GALNT2 have been associated with increased proliferation, migration, invasion, and metastasis in gastric adenocarcinoma [16]. Additionally, GALNT3 has been identified as an independent prognostic marker for high-grade tumors and adverse outcomes in renal cell carcinoma (RCC) [17]. GALNT6, encoded by the GALNT6 gene and predominantly located in the Golgi apparatus, has been identified as a pro-tumorigenic factor in various human cancers [17–20]. However, in the context of gastrointestinal cancer, some studies suggest that GALNT6 may function as a tumor suppressor [21–23]. Despite these findings, the precise molecular mechanisms underlying the role of GALNT6 in the pathogenesis and progression of bladder cancer remain elusive.

Epithelial-mesenchymal transition (EMT) is a critical cellular process where epithelial cells transform into mesenchymal phenotype. This process plays a pivotal role in developmental biology and wound healing [24, 25]. Initially identified during embryonic development, EMT has since been recognized in various pathological states [26]. Recent research has demonstrated that GALNT6, a specific enzyme within the UDP-GalNAc: polypeptide GalNAc-transferase family, facilitates the progression of EMT in several cancers, including breast, prostate, and lung adenocarcinoma [18, 27, 28]. Furthermore, in pancreatic cancer, GALNT6 has been shown to promote EMT by the glycosylation and stabilization of the mucin MUC4 [29]. Similarly, EMT is enhanced in lung adenocarcinoma through the O-glycosylation and stabilization of the protein GPR78 [18]. The present study extends these findings by demonstrating that GALNT6 also augments tumor migration and invasion capabilities in bladder cancer, thereby enhancing the EMT process. This suggests a broader, possibly conserved role of GALNT6 in promoting EMT across different tumor types, highlighting its potential as a target for therapeutic intervention in oncology.

Tumor immune escape is a critical survival strategy employed by tumors, involving the development of multiple immunosuppressive mechanisms to counteract the host’s immune response [30]. Glycosylation, particularly of tumor antigens, plays a significant role in facilitating tumor immune escape. Studies have shown that various glycoforms, such as Tn antigens, Lewis antigens, and lectins binding sialic acids or galactoses, are prevalent in the tumor microenvironment. For example, enhanced sialylation of tumor cells leads to the increased expression of ligands for lectin receptors, many of which perform immunosuppressive functions. Specifically, the sialylated Tn antigen (sTn) is widely expressed in various cancers and is associated with the induction of immune tolerance [31]. Thus, tumor antigens’ glycosylation patterns critically influence tumor-infiltrating immune cells’ behavior, contributing to the establishment and maintenance of immunosuppressive circuits within tumors. This underscores the complex interplay between tumor glycosylation and immune evasion, highlighting potential targets for therapeutic intervention to enhance anti-tumor immunity.

In this study, we investigated the association of GALNT6 with clinical outcomes in BC patients. Our findings indicate a positive correlation between GALNT6 expression and both the pathological grade and stage of BC, suggesting that GALNT6 expression is linked to poor prognosis. Experimentally, we demonstrated that overexpression of GALNT6 significantly enhanced migration and invasion in J82 human BC cells. Conversely, silencing GALNT6 markedly inhibited proliferation, migration, and invasion in 5637 and T24 BC cell lines. Further analysis revealed that GALNT6 influences the development and progression of BC through the EMT signaling pathway. Additionally, using bioinformatics analysis and immunohistochemical experiments, we found that the level of GALNT6 expression in BC tissues was inversely correlated with CD8+ T cell infiltration. It also showed a correlation with the expression of multiple immune checkpoint molecules. Therefore, GALNT6 could potentially function as an innovative therapeutic target, contribute significantly to developing immunotherapeutic strategies, and serve as a prognostic biomarker for BC.

Materials and methods

Online database analysis

The GALNT6 mRNA expression profile in pan-carcinoma was investigated using the online TIMER database (http://timer.cistrome.org/) [32]. Prognostic and clinical features analysis used UALCAN online databases (https://ualcan.path.uab.edu/). The RNAseq data was obtained from The Cancer Genome Atlas (TCGA: https://cancergenome.nih.gov/) with a total of 433 samples, including 19 normal and 414 bladder urothelial carcinoma samples. TCGA combined with GTEx analysis of differentially expressed genes used Gene Expression Profiling Interactive Analysis database (GEPIA: http://gepia.cancer-pku.cn/). To explore the correlation between GALNT6 and immune cell infiltration, we used the integrated repository portal for tumor-immune system interactions online analysis database TISIDB (http://cis.hku.hk/TISIDB/). The Cancer Immunome Atlas (TCIA: https://tcia.at/home) was used to analyze the correlation of GALNT6 expression and IPS of CTLA4 and PD-1. The “edgeR” package in R software was utilized to identify the differentially expressed mRNAs of glycosyltransferases in bladder cancer compared to normal bladder tissues. The significative threshold parameters were set as follows: FDR < 0.05 and |log2Fold Change|>1. A total of 214 glycosyltransferase genes were obtained from HGNC (https://www.genenames.org/).

Enrichment analysis of genes co-expressed with GALNT6

Zhengcun Wu et al. [33] previously described the process of enrichment analysis for these genes, so we downloaded the GSE3167 data set including 51 cases of tumor samples from the Gene Expression Omnibus database (GEO: http://www.ncbi.nlm.nih.gov/geo/) and divided it into two groups based on the GALNT6 expression level (median value) for subsequent functional and pathway enrichment analysis. GSEA and KEGG were used to analyze the differentially expressed gene enrichment signaling. Ingenuity Pathway Analysis (IPA) was used to generate a gene-co-expressed network.

Clinical patient tissue samples and cell culture

Human BC tissue and paracancerous tissue were collected from 40 patients who underwent surgical resection in the First Affiliated Hospital of Dalian Medical University (Dalian, China) from January 2016 to December 2018. Two urology professional pathologists confirmed the tumor grading of these tissues. This study was conducted with the informed consent of all patients and approval from the Medical Ethics Committee of the First Affiliated Hospital of Dalian Medical University (LCKY2015-08).

SV-HUC-1 normal bladder epithelial cell, RT4, SCaBER, 5637, T24, J82, and UMUC3 BC cell lines were obtained from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. All cell culture media contain 10% fetal bovine serum and 1% penicillin/streptomycin and are incubated at a CO2 concentration of 5% at 37℃. All cell lines used in this study were identified by STR.

Generation of GALNT6-overexpression cell line and ShGALNT6-mediated genome editing

To establish a GALNT6-overexpressing J82 cell line, a vector containing a sequence targeting the human GALNT6 gene, pLenti-GII-CMVCBH-GFP-2 A-Puro (Amp), was constructed. Following confirmation of the insert sequences via DNA sequencing, lentiviral particles were used to transfect J82 cells. Forty-eight hours post-transfection, cells expressing the transgene were selected with puromycin (5 µg/ml) for seven days. Subsequently, single cells were isolated using a limited dilution method in a 96-well plate.

Conversely, GALNT6 expression was knocked out in T24 and 5637 cell lines using short hairpin RNA (shRNA) mediated gene editing. For this purpose, a vector pCDH-U6-shRNA-EF1-Puro containing a GALNT6-specific shRNA sequence was introduced into these cells via nucleofection. Following transfection, cells successfully incorporating the shRNA were selected with puromycin (2 µg/ml) for seven days. Single-cell isolation was again performed using the limited dilution technique in 96-well plates. The resultant cell clones were expanded, and their knockdown efficiency was assessed using RT-qPCR and Western blotting analysis.

Immunohistochemistry

Immunohistochemistry (IHC) was performed as described by Xiaorong Ding et al. [34]. The primary antibodies used in IHC are described as follows: GALNT6 (1:250, abcam, ab151329), CD8 (MXB Biotechnologies, RMA-0514), CD83 (1:200, ABclonal, A2040), CD68 (1:100, ABclonal, A13286), CD56 (1:10000, Proteintech, 14255-1-AP), CD4 (1:100, ABclonal, A19018), PD-L1(1:10000, Proteintech, 66248-1). Tissue samples were fixed overnight in 4% paraformaldehyde to obtain paraffin-embedded sections. The sections were deparaffinized using xylene and rehydrated using gradient alcohol. Antigen retrieval was performed using citrate buffer, followed by the application of a 3% endogenous catalase blocker to eliminate endogenous peroxidase activity. The next day, it was incubated with the biotinylated secondary antibody at 37℃, washed with PBS, incubated with HRP conjugated streptavidin, and finally treated with DAB, stained with hematoxylin and dehydrated with gradient alcohol and observed under the microscope. Three pathologists evaluated GALNT6 staining in paraffin sections by integrating cell percentage, staining intensity, and immunoreactivity score (IRS) according to the TMAs IHC assessment technique.

Immunocytochemistry

Immunocytochemistry (ICC) was performed on the coverslips obtained from each of the experimental groups. The primary antibodies used in ICC is PD-L1 (1:10000, Proteintech, 66248-1) according to the manufacturer’s instruction. Briefly, the coverslips were washed with phosphate-buffered solution (PBS, pH 7.4), incubated for 10 min in 3% H2O2 and then with the appropriately diluted first antibody at 37 °C for 60 min in a humid chamber, followed by the treatments with reagent A containing polymer enhancer for 20 min and with reagent B containing polymerized horseradish peroxidase (HRP) anti-mouse/rabbit IgG for 30 min (Zymed Lab, Inc, San Francisco, CA). Color reaction was developed using 3,3′-diaminobenzidine tetrahydrochloride.

Xenograft tumor model

At the end of the experiment, following euthanasia, the tumors were excised and photographed. All animal experiments were approved by the Animal Care&Welfare Committee of Dalian Medical University (Number: AEE22047).Animals were maintained under constant temperature (23–25℃) and humidity (45–65%) with controlled light/dark cycles (12 h/12 h). Nude mice aged 5 weeks with thymus removed were obtained from the Animal Experimental Center of Dalian Medical University and randomly divided into T24 and sh1-GALNT6-T24 groups, with 4 mice per group. After mixing 1 × 107 cells with 100 µl PBS, they were injected subcutaneously into the right back of the mice. Tumor diameter was measured with a Vernier calliper every 7 days beginning on the 7th day until the 28th day. Tumor volumes were calculated using the formula 1/2 (length×width2).

Western blotting analysis

Cells and tissues were lysed using a lysis buffer to obtain proteins and quantified with BCA protein quantitative kit (Beyotime, China). Proteins were separated by SDS-PAGE and blotted onto the polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% DifcoTM Skim milk (BD, USA), incubated overnight at 4℃ with specific primary antibodies, and then incubated with HRP-conjugated secondary antibodies. The following antibodies were used: GALNT6 (1:1000, abcam, ab151329), N-Cadherin (1:1000, cell signaling technology, #13116), E-Cadherin (1:1000, cell signaling technology, #3195), Vimentin (1:5000, proteintech, 10366-1-AP). β-Catenin (1:1000, cell signaling technology, #8480), Phospho-β-Catenin (1:1000, cell signaling technology, #4176), Phospho-GSK-3β (1:1000, cell signaling technology, #5558), GSK-3β (1:1000, cell signaling technology, #12456), and GAPDH (1:10000, Proteintech, 10494-1-AP).

Real-time quantitative PCR (RT-qPCR)

Total RNA from tissues and cells was extracted with RNAiso Plus (TAKARA BIOINC), followed by cDNA synthesis with TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China). Real-time quantitative PCR was conducted with SYBR Select Master Mix (Applied Biosystems). Expression was normalized to the expression of the human housekeeping gene GAPDH. Primers used were:

GALNT6: F1: CCTTGGCGCTTACGAGATGA, R1: ATGATTGGCCCTGGATGCAA.

GAPDH: F1: AATGGGCAGCCGTTAGGAAA, R1: GCGCCCAATACGACCAAATC.

Cell counting Kit-8 (CCK-8) and colony formation assay

Cells were plated in 96-well plates at a density of 2.5 × 103 cells (T24 cell line) or 2 × 103 cells (5637 cell line) per well in triplicate, and 10 µl of CCK-8 reagent was added into each well, then incubated at 37℃ with 5% CO2 for two hours. The microplate reader (Thermo Fisher Scientific, United States) was used to measure the absorbance at 450 nm. In addition, 0.5 × 103 cells (T24 cell line) or 0.2 × 103 cells (5637 cell line) per well were added in 6-well plates and incubated for 14 days or 10 days separately. Cells were fixed with 4% paraformaldehyde and stained with 1% crystal violet. The cell colonies were more than 50 cells.

Cell scratch assay

Four lines were evenly marked on the back of each well of each six-well plate to ensure that the same areas were photographed at every time point. Then, approximately 3 × 105 cells were plated to each well. After these cells reached confluence, a 200 µl sterile pipette tip made a gap in the monolayer. Then, the cells were washed with PBS and photographed immediately with a microscope at 100× magnification. The same areas were photographed again after the cells were cultured for 12–24 h in medium without FBS.

Transwell assay

About 3 × 104 cells (T24 cell lines) or 2 × 104 (5637 cell lines) cells in 200 µl of medium without FBS were added to the upper compartment of a 24-well transwell chamber (8 μm pore size polycarbonate membrane, BIOFIL, China), and 550 µl medium with 10% FBS was added to the lower compartment. After incubating 24–48 h at 37℃ with 5% CO2, the upper compartment was washed with PBS, fixed in 4% paraformaldehyde, and then stained with 1% crystal violet. Subsequently, the chambers were washed with PBS and photographed with a microscope at 100× magnification. For invasion assay, the upper compartment was added 40 µl Matrigel and incubated for 2 h at 37℃, and about 3 × 104 cells in 200 µl of medium without FBS were added to the upper compartment of a 24-well transwell chamber. Other procedures were the same as migration.

Immunofluorescence

After the preparation of J82 and T24 cells with knockdown of the GALNT6 gene, the primary antibody (GALNT6, 1:200, Abcam, ab151329), Biotinylated-(B-1235-2)) was incubated overnight at 4 °C. Finally, secondary fluorescent antibodies were purchased from zsbio to capture images using a fluorescence microscope (Leica, TCS SP8).

Statistical analysis

All statistical analyses were done with GraphPad Prism 8.0.1, SPSS 26.0 and R 4.2.2 software. For sample size choice, the majority of the assays performed used either ≥ 3 donors to overcome donor variability. In all figures with histograms, data are represented using the mean ± SD. The unpaired or paired two-tailed Student’s t test was used for comparison between two groups. The one-way ANOVA test and two-way ANOVA test were used for three or more groups. The log-rank test was used for survival analysis. p < 0.05 was considered a significant value.

Results

Identification of GALNT6 as a key biomarker in bladder cancer

To examine the expression of GALNT6, the R programming language was employed to analyze expression profile data from the TCGA database. This analysis included 19 samples of normal adjacent tissues and 414 bladder cancer tissue samples, focusing on differentially expressed glycosyltransferase genes. The initial results indicated that six members of the GALNT family exhibited differential expression in bladder cancer tissues (Fig. 1A). Further analysis, incorporating data from the GTEx database, narrowed the findings to four glycosyltransferases—GALNT6, GALNT14, GALNT15, and GALNT16—showing significant differential expression (Fig. 1B). Prognostic relevance was assessed using clinical data from the TCGA database, where only GALNT6 showed significant prognostic implications (Fig. 1C). Additionally, comparative analysis of GALNT6 expression between normal adjacent tissues and a pan-cancer cohort revealed elevated expression of GALNT6 across various tumor types, including BC (Fig. 1D). This expression was also associated with multiple clinical features (Fig. 1E). Consequently, this analysis supports the potential role of GALNT6 as a significant biological marker in patients with BLCA.

Fig. 1 GALNT6 is a potential prognostic marker of bladder cancer. A. The expression of glycosyltransferase in bladder cancer was analyzed based on TCGA expression profile data; B. TCGA combined with the GTEx database to analyze the mRNA expression of differentially expressed genes in the GALNT family; C. The prognosis of GALNT family differential genes in bladder cancer was analyzed based on the TCGA database; D. Analyzing the expression profile data of GALNT6 in pan-cancer based on the TCGA database; E. Analysis of the correlation between GALNT6 and various clinical features based on clinical data from TCGA database. Data are presented as mean ± SD of three independent experiments. *p < 0.05, ***p < 0.001

High expression of GALNT6 in bladder cancer and its correlation with pathological grading and staging

Previous research has suggested that the abnormal expression of GALNT6 may be implicated in the formation, progression, metastasis, and prognosis of cancer. To investigate the expression levels of GALNT6 in bladder cancer, we assessed both mRNA and protein expressions in various bladder cancer cell lines. Relative to the SV-HUC-1 cell line, a normal bladder urothelial cell line, we observed that GALNT6 expression was significantly upregulated in the 5637 and T24 cell lines, and downregulated in the J82 and UMUC3 cell lines (Fig. 2A-C). To further explore the expression of GALNT6 in bladder cancer at the tissue level and its correlation with clinical characteristics, we combined 6 cases of paracancerous tissues, 5 cases of paracancerous microarray tissues, 40 cases of bladder cancer tissues, and 88 cases of bladder cancer microarray tissues for immunohistochemical analysis, and found that GALNT6 expressed highly in bladder cancer tissues (Fig. 2D, G).

Fig. 2 GALNT6 expression in bladder cancer and its correlation with clinical characteristics. A. The mRNA expression of GALNT6 in the bladder cancer cell line was detected by qPCR; B-C. Western blotting was used to detect the protein expression of GALNT6 in bladder cancer cell lines; D. Immunohistochemistry was used to detect the expression of GALNT6 in bladder cancer tissues and paired paracancerous tissues; E. The expression of GALNT6 in bladder cancer tissue was detected by immunohistochemistry and correlated with clinical grading; F. The expression of GALNT6 in bladder cancer tissue was detected by immunohistochemistry and correlated with T stage. G. Immunohistochemical analysis of the difference of GALNT6 expression between normal adjacent tissues and bladder cancer. Data are presented as mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ****p < 0.0001

Additionally, a detailed analysis of the correlation between GALNT6 expression and clinical features revealed associations with grade, tumor stage (T stage), and nodal involvement (N stage) (Fig. 2E-F and Table 1). Collectively, these findings indicate that GALNT6 is not only highly expressed in bladder cancer cells and tissues but also exhibits a positive correlation with clinical grade and tumor stage, reinforcing its potential role in the pathophysiology of bladder cancer.

Table 1 Correlation between GALNT6 expression and clinical characteristics of bladder cancer

Clinicopathologic characteristics	Group	No. of cases	GALNT6 expression	p-value	
High	Low	
Age (years)	<60	41	22	19	0.0534	
≥60	87	31	56		
Gender	Male	109	45	64	0.9466	
Female	19	8	11		
Grade	Low	58	49	9	<0.0001	
High	70	4	66		
T Stage	Ta/T1	35	26	9	<0.0001	
T2/T3/T4	93	27	66		
N Stage	NX/N0	113	53	60	0.0005	
N1/N2/N3	15	0	15		

Down-regulation of GALNT6 inhibits bladder cancer’s growth, proliferation, migration, and invasion

To investigate the influence of GALNT6 on the biological behavior of bladder cancer cells, we utilized molecular cloning techniques to develop a lentiviral transfection vector aimed at downregulating GALNT6. This vector was employed to establish a stable GALNT6-knockdown in 5637 bladder cancer cells. The expression efficiency of GALNT6 in cells transfected with three different vectors was assessed via qPCR and Western blotting, revealing that sh1-GALNT6 exhibited the lowest expression and was subsequently selected for further experiments (Supplementary Fig. 1A-C). A stable 5637 cell line with reduced GALNT6 expression was successfully established, and the vector map of sh1-GALNT6 was analyzed (Supplementary Fig. 1D). The sh1-GALNT6 vector was also transfected into T24 cells, with transfection efficiency confirmed through qPCR, Western blotting and immunofluorescence (Supplementary Fig. 1E-H).

Functional assays conducted on 5637 and T24 cells demonstrated that GALNT6 downregulation significantly inhibited cell growth, proliferation, migration, and invasion compared to control and negative control (NC) groups (Fig. 3A-E and Supplementary Fig. 3). This suggests that GALNT6 downregulation can effectively suppress these tumorigenic capabilities in vitro.

Fig. 3 Down-regulation of GALNT6 inhibits bladder cancer’s growth, proliferation, migration, and invasion on T24 cellsin vivoandintro. A. CCK-8 experiment was used to detect the downregulation of GALNT6 and its ability to inhibit the growth and proliferation of T24 cells; B-C. Plate cloning experiment was used to detect the ability of GALNT6 downregulation to inhibit the clone formation of T24 cells; D. Scratch assay was used to detect the ability of GALNT6 downregulation to inhibit the migration of T24 cells; E. Transwell assay was used to detect the ability of GALNT6 downregulation to inhibit the migration and invasion of T24 cells; F. Representative images of solid tumors isolated from nude mice. G-H. Average tumor weights and volumes were measured in shGALNT6 and scrambled groups. Data are presented as mean ± SD of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

To assess the effects of GALNT6 downregulation in vivo, a tumorigenesis experiment was conducted using nude mice injected with sh1-GALNT6 transfected T24 cells. The results showed a substantial reduction in tumor volume and mass in the mice (Fig. 3F-H), indicating that GALNT6 downregulation not only impacts bladder cancer cell behavior in vitro but also reduces tumor growth and aggressiveness in vivo. Overall, these findings support the potential therapeutic value of targeting GALNT6 in the treatment of bladder cancer.

Overexpression of GALNT6 enhances migration and invasion of bladder cancer cells

In an effort to further elucidate the role of GALNT6 in modulating the biological behavior of bladder cancer cells, we employed molecular cloning techniques to generate a lentiviral vector for GALNT6 overexpression (Supplementary Fig. 2A). This vector was utilized to create a stable cell line (OE-GALNT6-J82) that overexpresses GALNT6. J82 bladder cancer cells were infected with this lentivirus, and following drug selection, a stable cell line exhibiting GALNT6 overexpression was established. The transfection efficiency was confirmed via quantitative PCR (qPCR) and Western blotting analyses, which demonstrated a significant upregulation of GALNT6 in the OE-GALNT6-J82 cells, confirming the successful establishment of the overexpressing cell line (Supplementary Fig. 2B-D). Additionally, the incorporation of the GFP tag from the lentiviral vector into the cells was visually confirmed using fluorescence microscopy (Supplementary Fig. 2E).

Furthermore, we investigated the influence of GALNT6 overexprssion on the biological behavior of bladder cancer cells. In the functional experiments of J82 cells, we found that the growth and proliferation characteristics of J82 cells with different expression levels of GALNT6 were not statistically significant (Fig. 4A-C). However, the impact of GALNT6 overexpression on the migratory and invasive capabilities of J82 cells showed a significant difference. We conducted wound healing (scratch) assays and transwell migration and invasion assays. The results indicated that, compared to the control and mock-transfected groups, the OE-GALNT6 group displayed a significantly enhanced rate of cell migration at 24 h (Fig. 4D). Correspondingly, the transwell assays demonstrated a notable increase in the number of cells migrating and invading through the membrane in the OE-GALNT6 group after 24 h (Fig. 4E). These findings suggest that the overexpression of GALNT6 significantly enhances the migration and invasion of bladder cancer cells, thereby promoting a more aggressive and malignant cellular phenotype.

Fig. 4 Overexpression of GALNT6 promoted the migration and invasion ability of bladder cancer cells. A. CCK-8 experiment was used to detect the effect of GALNT6 upregulation on the growth and proliferation ability of J82 cells; B-C. Plate cloning experiment was used to detect the clone formation of GALNT6 upregulation J82 cells; D. The wound healing test revealed that overexpression of GALNT6 exhibited a higher wound closure rate than that in the control group; E. The transwell assay demonstrated that overexpression of GALNT6 showed higher migration and invasion ability than the control group. Data are presented as mean ± SD of three independent experiments. **p < 0.01, ***p < 0.001

GALNT6 mediated O-glycosylation promotes the malignant phenotype of bladder cancer

To delve deeper into the internal molecular mechanisms by which GALNT6-mediated abnormal O-glycosylation affects the malignant phenotype of bladder cancer, we conducted a differential gene expression analysis between the high and low GALNT6 expression groups in bladder cancer. mRNA data from 414 bladder cancer cases were categorized into high and low expression groups based on GALNT6 levels, with each group comprising 50% of the sample size (Fig. 5A). GSEA and KEGG pathway enrichment analysis revealed that genes differentially expressed between the high and low GALNT6 expression groups were significantly enriched in multiple immune-related pathways (Fig. 5B). Further analysis using the GEO database confirmed that the differentially expressed genes associated with GALNT6 were enriched in various immune-related pathways (Fig. 5C-D).

Fig. 5 Screening differential gene enrichment pathway of GALNT6 high and low expression groups in bladder cancer. A. Based on the mRNA expression profile data of the TCGA database, the differential genes between high and low expression groups of GALNT6 in bladder cancer were analyzed by R language; B. KEGG and GSEA methods were used to analyze the differential gene enrichment pathway of GALNT6 high and low expression groups based on the TCGA database bladder cancer expression profile data; C. Based on the expression profile data of bladder cancer in GEO database, the differential genes of GALNT6 high and low expression groups were analyzed; D. GSEA analyzed the differential gene enrichment pathway of bladder cancer expression profile in GEO database; E. IPA analysis of GALNT6 co-expressed gene network; F. The correlation between high and low expression of GALNT6 and EMT score was analyzed based on the expression profile data of bladder cancer in TCGA database; G. Based on the expression profile data of bladder cancer in TCGA database, the correlation between high and low expression of GALNT6 and immune characteristic score was analyzed

Additionally, using the IPA molecular docking software to analyze the GALNT6 co-expression network indicated enrichment in pathways associated with EMT, PI3K/AKT, Wnt/β-catenin, and multiple immune-related pathways (Fig. 5E). Expanding on these findings, we computed EMT scores for the 408 bladder cancer samples from the TCGA database according to A. Gordon Robertson et al [35] using the R language, and analyzed differences of these scores between the high and low GALNT6 expression groups. Additionally, the “estimate” Package in R language was runned for analyzing the immune microenvironment of 414 cases bladder cancer mRNA profile data downloaded by TCGA, and generated the corresponding immune scores of 414 cases of bladder cancer samples. The immune scores were used to assess the immune microenvironment. We also analyzed the differences in immune scores between high and low expression groups of GALNT6. The analysis revealed significant disparities in both EMT and immune scores between these groups (Fig. 5F-G). These results suggest that the abnormal O-glycosylation mediated by GALNT6 may promote the malignant phenotype through the cancer cells’ own EMT signaling pathway and facilitate immune escape by activating immunosuppressive signals. This dual mechanism likely influences the biological function of cancer cells and contributes to a pro-cancer effect.

GALNT6 upregulation mediates the malignant phenotype of bladder cancer through EMT signaling pathway

To validate the findings from our bioinformatics analysis, we examined the impact of GALNT6 upregulation on the expression of key molecules within the EMT and Wnt/β-catenin signaling pathways in bladder cancer cells via Western blotting. The results indicated that, in J82 cells overexpressing GALNT6 (OE-GALNT6-J82), there was a complete absence of E-Cadherin expression compared to the mock and control groups. Conversely, the protein expression levels of N-cadherin and Vimentin were elevated (Fig. 6A-B). However, within the Wnt/β-catenin pathway, no significant changes in protein expression were observed (Fig. 6C-D). These findings suggest that the abnormal O-glycosylation modifications mediated by GALNT6 may primarily promote the malignant behavior of bladder cancer cells through alterations in the EMT signaling pathway.

Fig. 6 EMT pathway mediates GALNT6 expression in bladder cancer. A-B. Western blotting analysis of the expression of EMT signaling pathway-related proteins in J82 cells; C-D. Western blotting analysis of the expression of Wnt/β-Catenin signaling pathway-related proteins in J82 cells. Data are presented as mean ± SD of three independent experiments. ****p < 0.0001

GALNT6 and immune microenvironment dynamic in bladder cancer

Multiple bioinformatics techniques were employed to elucidate the relationship between GALNT6 expression and immune cell infiltration within the bladder cancer tumor microenvironment. The CIBERSORT algorithm was utilized to calculate the infiltration scores of 22 immune cell types based on mRNA expression profiles from 414 bladder cancer cases. Scores with a significance level of p < 0.05 were selected for further analysis, yielding 186 cases with valid CIBERSORT scores. A differential analysis between these scores, stratified by high and low GALNT6 expression groups, revealed significant variations in the infiltration levels of several immune cells, including naive B cells, regulatory T cells (Tregs), activated NK cells, macrophages (M0/M1), and neutrophils (Fig. 7A). Subsequent analyses using the Timer and TISIDB databases investigated the correlations between GALNT6 expression and immune cell infiltration, identifying significant associations with multiple key immune cells in bladder cancer (Fig. 7B-C). Specifically, our findings indicate correlations between GALNT6 expression and the infiltration of CD8+ T cells, macrophages, dendritic cells, CD4+ T cells, and natural killer cells based on multiple analysis methods (Fig. 7F).

Fig. 7 GALNT6 and immune microenvironment dynamic in bladder cancer. A. CIBERSORT score analysis showed the infiltration of 22 immune cells in the high and low expression groups of GALNT6; B. Timer database analysis shows the correlation between GALNT6 expression and immune cell infiltration; C. TISIDB database analysis of the correlation between GALNT6 expression and immune cell infiltration; D-E. Immunohistochemical analysis was performed on 40 consecutive pathological sections from bladder cancer patients, detecting the correlation between GALNT6 and major immune cell markers; F. Wenn diagram shows the correlation between GALNT6 and immune cell infiltration in bladder cancer based on multiple analysis methods; G. Analysis of the correlation between GALNT6 and the expression of major immune checkpoints in bladder cancer based on the GEPIA database; H-I. Immunohistochemical analysis was performed on 40 consecutive pathological sections from bladder cancer patients, detecting the correlation between GALNT6 and PD-L1; J. Immunocytochemistry analysis for the expression of PD-L1 was conducted on T24 and sh1-GALNT6-T24 (Sh1) cells; K. Immunocytochemistry analysis for the expression of PD-L1 was conducted on J82 and OE-GALNT6-J82 (OE) cells. xy axis refered to the scores of IHC for each marker in E and I. Data are presented as mean ± SD of three independent experiments

To further validate these correlations, immunohistochemical analysis was performed on 40 consecutive pathological sections from bladder cancer patients, focusing on the infiltration of key immune cells predicted by bioinformatics methods (Fig. 7D). The results demonstrated a negative correlation between GALNT6 expression and CD8+ T cell infiltration (Fig. 7E), highlighting GALNT6 as a potentially crucial immune-related biomarker.

Additionally, to explore the implications of GALNT6 expression for immunotherapy, the GEPIA database was used to analyze its correlation with major immune checkpoint molecules, including CTLA-4, PD-1 (PDCD1), LAG3, and PD-L1 (CD274). The analysis showed that GALNT6 expression was positively correlated with the expression of these immune checkpoint molecules in bladder cancer (Fig. 7G). In summary, these results indicate that GALNT6 expression in bladder cancer is negatively correlated with CD8+ T cell infiltration and is associated with the expression of various immune checkpoint molecules, suggesting its involvement in modulating immune escape mechanisms in the tumor microenvironment.

Furthermore, to explore the potential role of GALNT6 in clinical immunotherapy, we predicted the correlation between GALNT6 and immune responses such as CTLA-4 and PD-1. There is a significant correlation between the ctla4_pos_pd1_pos group (CTLA-4 positive & PD-1 positive) and GALNT6, and the ips_ctla4_neg_pd1_pos guoup (CTLA-4 negative & PD-1 positive) correlation is higher than other two groups (Table 2). Therefore, we speculate that GALNT6 may serve as a potential target for clinical immunotherapy.

Table 2 Correlation between GALNT6 expression and CTLA4 and PD-1 immunophenoscore (IPS) based on TCIA database

			Correlations	
GALNT6	ips_ctla4_neg_pd1_pos	ips_ctla4_neg_pd1_neg	ips_ctla4_pos_pd1_neg	ips_ctla4_pos_pd1_pos	
Spearman’s rho	GALNT6	Correlation Coefficient	1	0.144**	-0.107-*	-0.05	0.164**	
(N = 408)	Sig. (2-tailed)		0.004	0.031	0.316	0.001	
ips_ctla4_neg_pd1_pos	Correlation Coefficient	0.144**	1	0.665**	0.781**	0.923**	
Sig. (2-tailed)	0.004		0	0	0	
ips_ctla4_neg_pd1_neg	Correlation Coefficient	-0.107-*	0.665**	1	0.871**	0.586**	
Sig. (2-tailed)	0.031	0		0	0	
ips_ctla4_pos_pd1_neg	Correlation Coefficient	-0.05	0.781**	0.871**	1	0.742**	
Sig. (2-tailed)	0.316	0	0		0	
ips_ctla4_pos_pd1_pos	Correlation Coefficient	0.164**	0.923**	0.586**	0.742**	1	
Sig. (2-tailed)	0.001	0	0	0		
*Correlation is significant at the 0.05 level (2-tailed).

**Correlation is significant at the 0.01 level (2-tailed).

In view of the relevance between GALNT6 promoting the malignant phenotype of bladder cancer and immune cells and immune response, we further explored the correlation between GALNT6 and PD-L1 expression in consecutive pathological sections from bladder cancer patients, and found a positive correlation between GALNT6 and PD-L1 expression in bladder cancer (Fig. 7H-I). Additionally, the expression of PD-L1 was evaluated on T24 cell line under the GALNT6 knocked down condition by immunocytochemistry (Fig. 7J). Similarly, PD-L1 expression was lower in J82 than that in OE-GALNT6-J82 (OE) cells (Fig. 7K). Based on these results, we speculate that GALNT6 may affect the function of CD8+ T cells through its interaction with PD-L1, thereby evading immune surveillance and promoting tumor development.

Discussion

Bladder cancer is the most prevalent malignant tumor within the urinary system, exhibiting rising incidence and mortality rates in recent years [36]. Approximately one-fourth of patients present with muscle-invasive bladder cancer (MIBC) or metastatic disease at their initial diagnosis. Moreover, bladder cancer is characterized by a high recurrence rate, with about half of the patient’s experiencing recurrence or metastasis post-radical surgery [37]. Currently, the management of bladder cancer primarily involves surgery supplemented by postoperative treatments [4]. Due to the heterogeneity among bladder cancer patients, outcomes following treatment can vary significantly. In an effort to enhance patient prognosis and alleviate the economic burden on patients, there is a critical need for researchers to develop novel biomarkers. These biomarkers could facilitate early diagnosis and treatment, thereby improving outcomes and enabling the early prediction of adverse reactions. However, a comprehensive understanding of the pathogenesis and progression of bladder cancer remains elusive, and there is a significant shortage of sensitive diagnostic and prognostic biomarkers. This gap in knowledge underscores the urgent need for intensified research efforts aimed at uncovering the underlying mechanisms of bladder cancer and identifying reliable biomarkers that can guide more effective clinical interventions.

GALNT6 is abnormally expressed in various tumors and affects the occurrence and development of tumors. In pancreatic ductal adenocarcinoma (PDAC), GALNT6 is highly expressed in pancreatic cancer and plays a carcinogenic role [38]. In addition, the high expression level of GALNT6 was significantly associated with the low expression levels of E-cadherin and β-catenin and the high expression levels of MMP9, these findings indicated that GALNT6 could provide a insight into the characterization of gastric cancer (GC) as well as contribute to the development of an efficient prognostic indicator for GC [39]. Additionally, studies have shown that loss of GALNT6 enzyme in early-stage colorectal cancer predicts poor clinical outcomes in colorectal cancer [40]. In lung cancer, GALNT6 promotes the invasion and metastasis of by enhancing the MEK1/2/ERK1/2 pathway through the glycosylated chaperone protein GRP78 [18]. However, GALNT6 also affects the EMT process in endometrial cancer (EOC) by regulating adhesion molecules, thereby inhibiting the progression of EOC [41]. In summary, it can be seen that GALNT6 plays an important role in various tumors, directly or indirectly affecting the occurrence and development of tumors.

We have demonstrated that GALNT6 is highly expressed across various tumor tissues, including bladder cancer, where its expression correlates with clinical parameters such as grade, T stage, and N stage. Confirmatory IHC staining aligned with bioinformatics analyses, indicating that higher malignancy levels in bladder cancer are associated with elevated GALNT6 expression. To further investigate, we employed RT-qPCR and Western blotting techniques to assess GALNT6 levels in bladder cancer cell lines. Notably, J82 cells exhibited low GALNT6 expression, whereas T24 and 5637 cells showed high expression, making them suitable for the construction of recombinant lentiviral vectors to modulate GALNT6 expression. Subsequent experiments, including CCK-8, plate cloning, scratch tests, and transwell assays, were conducted to evaluate the impact of GALNT6 modulation on bladder cancer cell growth, proliferation, metastasis, and invasion. Our findings revealed that GALNT6 overexpression enhances these cells’ migratory and invasive capabilities, whereas its suppression inhibits these oncogenic traits. To determine the in vivo relevance of these findings, BALB/c-nude mice with immunodeficiency were utilized for experimental validation. In vivo, results showed that a T24 cell line engineered to under express GALNT6 resulted in reduced tumor volume and mass. These observations suggest that GALNT6 promotes the malignant phenotype of bladder cancer both in vitro and in vivo, underscoring its potential as a therapeutic target.

Abnormal O-glycosylation, often induced by the GALNT family of enzymes, has been implicated in numerous cancers [42]. GALNT6, a critical enzyme within this family, has been identified as a key promoter of tumor invasion and metastasis. To investigate the role of GALNT6 in bladder cancer more deeply, we utilized bioinformatics tools, including GSEA, R language, and IPA software, combined with expression profile data from TCGA and GEO databases. Our analysis aimed to elucidate how variations in GALNT6 expression impact the pathogenesis of bladder cancer. Our findings suggest that GALNT6-mediated abnormal O-glycosylation may enhance the malignant phenotype of bladder cancer cells through several mechanisms. Primarily, it appears to activate the EMT and Wnt/β-catenin signaling pathways, crucial for the aggressive behavior of cancer cells. Additionally, GALNT6 may facilitate immune escape by triggering immunosuppressive signals, thereby further influencing the biological functions of cancer cells and exerting a pro-cancerous effect. These insights highlight the complex role of GALNT6 in the modulation of cellular mechanisms contributing to cancer progression.

EMT has been a focal point in cancer research for over two decades. Numerous studies across various human cancer cell lines, mouse tumor models, and human tumor samples have demonstrated that EMT induction enables cancer cells to disrupt cell-to-cell adhesion and degrade local basement membranes by upregulating enzymes that break down the extracellular matrix. Research has identified that epithelial-mesenchymal transformation, a critical mechanism in tumor metastasis, can be influenced by glycosyltransferases [43]. In the context of mucin O-glycosylation, GALNT6 plays a pivotal role in initiating this process, which is vital for the post-translational modification and stability of glycoproteins [44]. Western blotting results corroborate this function of GALNT6. Typically, EMT is biochemically characterized by a reduction in the epithelial marker E-cadherin and an increase in mesenchymal markers such as Vimentin and N-cadherin [45]. Our study reveals that GALNT6 facilitates EMT in bladder cancer cells. Mechanistically, overexpression of GALNT6 upregulates N-Cadherin and Vimentin, thus promoting the EMT process. However, there was a complete absence of E-Cadherin in J82 cells with different GALNT6 expression groups. The absence of E-Cadherin expression in J82 bladder cancer cell also appeared in the results from Yang et al. [46], which revealed that no expression of E-Cadherin was found in J82 and T24 cells. Due to the poor differentiation and high malignancy of J82 and T24 cells [47, 48], loss of E-cadherin expression might correlate with loss of intercellular adhesion, tight junction formation and enhanced paracellular transport. Absent expression of E-cadherin in J82 bladder cancer cells with high malignangy reduced the endothelial properties of the cells, thereby weakening intercellular adhesion and making the cells more aggressive. By influencing the expression of matrix metalloproteinases (MMPs) and the transition from E-cadherin to N-cadherin, GALNT6 likely enhances the migratory and invasive capabilities of bladder cancer cells, further endorsing its role in cancer progression.

Glycosylation plays a pivotal role in tumor immune evasion. Studies have identified various glyco-antigens such as Tn and Lewis antigens, and lectins like sialic acid or galactose in the tumor microenvironment. For instance, increased sialylation of tumor cells enhances the expression of ligands for lectin receptors, which predominantly exert immunosuppressive effects. The sialylated Tn antigen (sTn) is commonly expressed in cancers and is linked to immune tolerance [31]. Therefore, glycosylation of tumor antigens significantly influences tumor-infiltrating immune cells and fosters immunosuppressive pathways. In colon cancer, O-GlcNAc glycosylation enhances cell proliferation and metastasis, helping the cells evade immune detection [49].

Glycan-binding receptors such as sialic acid binding immunoglobulin-like lectins (SIGLECs), macrophage galactose-specific lectins (MGLs), and dendritic cell-specific ICAM-3 grabbing non-integrins (DC-SIGN) are expressed on immune cells. These receptors mediate immune suppression by interacting with tumor-associated glycan motifs. Enrichment of Lewis structures, for instance, is known to promote innate immune suppression within the tumor microenvironment [50, 51]. Additionally, molecules like MUC1, CD43, CD45, which are rich in Tn, GM2 or GD2, which carry N-acetylgalactosamine, interact with MGLs on macrophages, driving effector T cells to produce immunosuppressive programs characterized by IL-10 elevation and induction of apoptosis [52, 53]. Thus, glycosylation plays an important role in immune escape in tumors.

To explore the relationship between glycosylation and immune evasion in bladder cancer, we utilized bioinformatics tools such as CIBERSORT, Timer, TISIDB, and R language to analyze the correlation between GALNT6 expression and immune cell infiltration. Immunohistochemical analyses confirmed a negative correlation between GALNT6 expression and CD8+ T cell infiltration in bladder cancer, along with an association with several immune checkpoint molecules. These findings suggest that GALNT6-mediated O-glycosylation might facilitate immune escape in bladder cancer by impairing CD8+ T cell functionality. However, further investigation is necessary to elucidate the specific molecular mechanisms through which GALNT6-mediated glycosylation promotes immune evasion in bladder cancer.

Our results of IHC detection revealed the positive correlation between GALNT6 and PD-L1 in pathology specimens. Besides, it was found that PD-L1 expression was higher in T24 than that in GALNT6 downregulation T24 cells. Similarly, PD-L1 expression was lower in J82 than that in OE-GALNT6-J82 (OE) cells. The high expression of PD-L1 might promote the activation of PD-1/PD-L1 axis to suppress the CD8+ T cell effect and facilitate the immune escape of cancer cells. As we know, the tumor microenvironment plays a crucial role in EMT. Inflammatory cytokines and immune suppressive cells are considered key factors in EMT and distant metastasis [54]. In this context, tumor cells have developed several strategies to evade the host immune system, including overexpression of programmed death ligand 1 (PD-L1), which induces immune cell apoptosis by binding to PD-1 [55]. Therefore, we analyzed that GALNT6 promotes the malignant phenotypes of bladder cancer, on the one hand, through EMT pathway activation, on the other hand, EMT activation probably upregulated the expression of PD-L1 on the tumor surface and promoted the activation of PD-1/PD-L1 axis. Thus, this process inhibited the immune function of CD8+ T cells and promoted immune escape. Meanwhile, we attributed the elevated expression of immune checkpoint molecules in GALNT6-high expressing tumors to CD8+ T cells present in the TME. The checkpoint molecules such as PD-1, LAG3 and CTLA-4 all expressed on the surface of activated CD8+ T cells, impairing immune cells function and antitumor immune response, and their activation might inhibit CD8+ T cell immune function and promote tumor immune escape. Taken together, the high GALNT6 expression promoted the activation of EMT and PD-1/PD-L1 axis, and enhanced the expression of inhibitory immune checkpoints, thereby inhibiting the CD8+ T cells function and escaping of immune surveillance.

While our study has elucidated the role of GALNT6 in bladder cancer progression, metastasis, and immune evasion through EMT transition, it also presents several limitations. Firstly, the detailed molecular mechanisms by which GALNT6 affects CD8+ T cells via O-glycosylation require further exploration. Additionally, the impact of downstream substrates influenced by this regulation remains unclear. Identifying new substrates of GALNT6 is expected to be pivotal in fully understanding its contributions to bladder cancer’s metastasis and progression. Secondly, there is a critical need for additional in vivo experiments to evaluate the effects of GALNT6 in immunogenic mouse models, which we plan to address in our future research endeavors.

Conclusion

Overall, this study demonstrated that GALNT6-mediated abnormal O-glycosylation might enhance the occurrence and development of bladder cancer and immune escape, which was related to the activation of the EMT signal of tumor cells and the failure or low function of CD8+ T cells infiltrated in the tumor microenvironment. Besides, bladder cancer cells could regulate the infiltration of CD8+ T cells through GALNT6 mediated O-glycosylation, enhance the inhibitory signals of immune cells such as PD-1, CTLA4, LAG3, inhibit immune-related signaling pathways, reduce the function and number of CD8+ T cells, and promote the secretion of immunosuppressive molecules. All of this is to form an immunosuppressive tumor microenvironment as well as promote tumor immune escape and development. It is suggested that GALNT6 might be a potential therapeutic target for clinical bladder cancer.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Author contributions

XS and SW conducted laboratory tests and participated in the writing of the manuscript. XS, HW, QC, DY and SW designed the study. YJ, LG, CL, LT and GZ provided analysis and interpretation of data. XY provided help for immunohistochemistry experiments and improved the experimental protocol. AA polished the language of the article. XS and LT revised the writing of the manuscript. All authors were involved in the conception, preparation of the manuscript, and the final version of the manuscript has been read and approved by all the authors before its submission.

Funding

This work was supported by Dalian Medical University Interdisciplinary Research Cooperation Project Team Funding (JCHZ2023021).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was conducted with the informed consent of all patients and the approval of the Medical Ethics Committee of the First Affiliated Hospital of Dalian Medical University (LCKY2015-08). All animal experiments were approved by the Animal Care&Welfare Committee of Dalian Medical University (AEE22047).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xiaoxin Sun, Haotian Wu and Ling Tang contributed equally to this work.
==== Refs
References

1. Bray F Laversanne M Sung H Ferlay J Siegel RL Soerjomataram I Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J Clin 2024 74 229 263 10.3322/caac.21834 38572751
Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229–263.38572751 10.3322/caac.21834
2. Saginala K, Barsouk A, Aluru JS, Rawla P, Padala SA, Barsouk A. Epidemiology of Bladder Cancer. Med Sci (Basel) 2020, 8.
3. Guo C, Trivedi R, Tripathi AK, Nandy RR, Wagner DC, Narra K et al. Higher expression of annexin A2 in metastatic bladder urothelial carcinoma promotes migration and invasion. Cancers (Basel) 2022;4.
4. Zheng Y Ye Y Chen J Wei Z Liu Z Yu K Prevalence and outcomes of transurethral resection versus radical cystectomy for muscle-infiltrating bladder cancer in the United States: a population-based cohort study Int J Surg 2022 103 106693 10.1016/j.ijsu.2022.106693 35690361
Zheng Y, Ye Y, Chen J, Wei Z, Liu Z, Yu K, et al. Prevalence and outcomes of transurethral resection versus radical cystectomy for muscle-infiltrating bladder cancer in the United States: a population-based cohort study. Int J Surg. 2022;103:106693.35690361 10.1016/j.ijsu.2022.106693
5. Schjoldager KT Narimatsu Y Joshi HJ Clausen H Global view of human protein glycosylation pathways and functions Nat Rev Mol Cell Biol 2020 21 729 49 10.1038/s41580-020-00294-x 33087899
Schjoldager KT, Narimatsu Y, Joshi HJ, Clausen H. Global view of human protein glycosylation pathways and functions. Nat Rev Mol Cell Biol. 2020;21:729–49.33087899 10.1038/s41580-020-00294-x
6. Zhu X, Al-Danakh A, Zhang L, Sun X, Jian Y, Wu H et al. Glycosylation in renal cell carcinoma: mechanisms and clinical Implica tions. Cells, 11, 2598.
7. Pang X, Li H, Guan F, Li X. Multiple Roles of Glycans in Hematological Malignancies. Frontiers in Oncology 2018, 8.
8. Li X Wang X Tan Z Chen S Guan F Role of glycans in Cancer cells undergoing epithelial-mesenchymal transition Front Oncol 2016 6 33 10.3389/fonc.2016.00033 26925388
Li X, Wang X, Tan Z, Chen S, Guan F. Role of glycans in Cancer cells undergoing epithelial-mesenchymal transition. Front Oncol. 2016;6:33.26925388 10.3389/fonc.2016.00033
9. Bennett EP Mandel U Clausen H Gerken TA Fritz TA Tabak LA Control of mucin-type O-glycosylation: a classification of the polypeptide GalNAc-transferase gene family Glycobiology 2012 22 736 56 10.1093/glycob/cwr182 22183981
Bennett EP, Mandel U, Clausen H, Gerken TA, Fritz TA, Tabak LA. Control of mucin-type O-glycosylation: a classification of the polypeptide GalNAc-transferase gene family. Glycobiology. 2012;22:736–56.22183981 10.1093/glycob/cwr182
10. Andergassen U, Liesche F, Kolbl AC, Ilmer M, Hutter S, Friese K et al. Glycosyltransferases as markers for early tumorigenesis. Biomed Res Int 2015;2015:792672.
11. Chang YH Weng CL Lin KI O-GlcNAcylation and its role in the immune system J Biomed Sci 2020 27 57 10.1186/s12929-020-00648-9 32349769
Chang YH, Weng CL, Lin KI. O-GlcNAcylation and its role in the immune system. J Biomed Sci. 2020;27:57.32349769 10.1186/s12929-020-00648-9
12. Lima L Neves M Oliveira MI Dieguez L Freitas R Azevedo R Sialyl-Tn identifies muscle-invasive bladder cancer basal and luminal subtypes facing decreased survival, being expressed by circulating tumor cells and metastases Urol Oncol 2017 35 e675671 8 10.1016/j.urolonc.2017.08.012
Lima L, Neves M, Oliveira MI, Dieguez L, Freitas R, Azevedo R, et al. Sialyl-Tn identifies muscle-invasive bladder cancer basal and luminal subtypes facing decreased survival, being expressed by circulating tumor cells and metastases. Urol Oncol. 2017;35:e675671–8.10.1016/j.urolonc.2017.08.012
13. Eavarone DA Al-Alem L Lugovskoy A Prendergast JM Nazer RI Stein JN Humanized anti-sialyl-tn antibodies for the treatment of ovarian carcinoma PLoS ONE 2018 13 e0201314 10.1371/journal.pone.0201314 30052649
Eavarone DA, Al-Alem L, Lugovskoy A, Prendergast JM, Nazer RI, Stein JN, et al. Humanized anti-sialyl-tn antibodies for the treatment of ovarian carcinoma. PLoS ONE. 2018;13:e0201314.30052649 10.1371/journal.pone.0201314
14. Hussain MR Hoessli DC Fang M N-acetylgalactosaminyltransferases in cancer Oncotarget 2016 7 54067 81 10.18632/oncotarget.10042 27322213
Hussain MR, Hoessli DC, Fang M. N-acetylgalactosaminyltransferases in cancer. Oncotarget. 2016;7:54067–81.27322213 10.18632/oncotarget.10042
15. Huang MJ Hu RH Chou CH Hsu CL Liu YW Huang J Knockdown of GALNT1 suppresses malignant phenotype of hepatocellular carcinoma by suppressing EGFR signaling Oncotarget 2015 6 5650 65 10.18632/oncotarget.3117 25730904
Huang MJ, Hu RH, Chou CH, Hsu CL, Liu YW, Huang J, et al. Knockdown of GALNT1 suppresses malignant phenotype of hepatocellular carcinoma by suppressing EGFR signaling. Oncotarget. 2015;6:5650–65.25730904 10.18632/oncotarget.3117
16. Liu SY Shun CT Hung KY Juan HF Hsu CL Huang MC Mucin glycosylating enzyme GALNT2 suppresses malignancy in gastric adenocarcinoma by reducing MET phosphorylation Oncotarget 2016 7 11251 62 10.18632/oncotarget.7081 26848976
Liu SY, Shun CT, Hung KY, Juan HF, Hsu CL, Huang MC, et al. Mucin glycosylating enzyme GALNT2 suppresses malignancy in gastric adenocarcinoma by reducing MET phosphorylation. Oncotarget. 2016;7:11251–62.26848976 10.18632/oncotarget.7081
17. Kitada S Yamada S Kuma A Ouchi S Tasaki T Nabeshima A Polypeptide N-acetylgalactosaminyl transferase 3 independently predicts high-grade tumours and poor prognosis in patients with renal cell carcinomas Br J Cancer 2013 109 472 81 10.1038/bjc.2013.331 23799843
Kitada S, Yamada S, Kuma A, Ouchi S, Tasaki T, Nabeshima A, et al. Polypeptide N-acetylgalactosaminyl transferase 3 independently predicts high-grade tumours and poor prognosis in patients with renal cell carcinomas. Br J Cancer. 2013;109:472–81.23799843 10.1038/bjc.2013.331
18. Song J Liu W Wang J Hao J Wang Y You X GALNT6 promotes invasion and metastasis of human lung adenocarcinoma cells through O-glycosylating chaperone protein GRP78 Cell Death Dis 2020 11 352 10.1038/s41419-020-2537-6 32393740
Song J, Liu W, Wang J, Hao J, Wang Y, You X, et al. GALNT6 promotes invasion and metastasis of human lung adenocarcinoma cells through O-glycosylating chaperone protein GRP78. Cell Death Dis. 2020;11:352.32393740 10.1038/s41419-020-2537-6
19. Deng B Tarhan YE Ueda K Ren L Katagiri T Park JH Critical role of estrogen receptor alpha O-Glycosylation by N-Acetylgalactosaminyltransferase 6 (GALNT6) in its Nuclear localization in breast Cancer cells Neoplasia 2018 20 1038 44 10.1016/j.neo.2018.08.006 30208353
Deng B, Tarhan YE, Ueda K, Ren L, Katagiri T, Park JH, et al. Critical role of estrogen receptor alpha O-Glycosylation by N-Acetylgalactosaminyltransferase 6 (GALNT6) in its Nuclear localization in breast Cancer cells. Neoplasia. 2018;20:1038–44.30208353 10.1016/j.neo.2018.08.006
20. Ward FJ Dahal LN Wijesekera SK Abdul-Jawad SK Kaewarpai T Xu H The soluble isoform of CTLA-4 as a regulator of T-cell responses Eur J Immunol 2013 43 1274 85 10.1002/eji.201242529 23400950
Ward FJ, Dahal LN, Wijesekera SK, Abdul-Jawad SK, Kaewarpai T, Xu H, et al. The soluble isoform of CTLA-4 as a regulator of T-cell responses. Eur J Immunol. 2013;43:1274–85.23400950 10.1002/eji.201242529
21. Li Z Yamada S Inenaga S Imamura T Wu Y Wang KY Polypeptide N-acetylgalactosaminyltransferase 6 expression in pancreatic cancer is an independent prognostic factor indicating better overall survival Br J Cancer 2011 104 1882 9 10.1038/bjc.2011.166 21587259
Li Z, Yamada S, Inenaga S, Imamura T, Wu Y, Wang KY, et al. Polypeptide N-acetylgalactosaminyltransferase 6 expression in pancreatic cancer is an independent prognostic factor indicating better overall survival. Br J Cancer. 2011;104:1882–9.21587259 10.1038/bjc.2011.166
22. Gomes J Marcos NT Berois N Osinaga E Magalhães A Pinto-de-Sousa J Expression of UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-6 in gastric mucosa, intestinal metaplasia, and gastric carcinoma J Histochem Cytochem 2009 57 79 86 10.1369/jhc.2008.952283 18854599
Gomes J, Marcos NT, Berois N, Osinaga E, Magalhães A, Pinto-de-Sousa J, et al. Expression of UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-6 in gastric mucosa, intestinal metaplasia, and gastric carcinoma. J Histochem Cytochem. 2009;57:79–86.18854599 10.1369/jhc.2008.952283
23. Duan J Chen L Gao H Zhen T Li H Liang J GALNT6 suppresses progression of colorectal cancer Am J Cancer Res 2018 8 2419 35 30662801
Duan J, Chen L, Gao H, Zhen T, Li H, Liang J, et al. GALNT6 suppresses progression of colorectal cancer. Am J Cancer Res. 2018;8:2419–35.30662801
24. Lamouille S Xu J Derynck R Molecular mechanisms of epithelial-mesenchymal transition Nat Rev Mol Cell Biol 2014 15 178 96 10.1038/nrm3758 24556840
Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178–96.24556840 10.1038/nrm3758
25. Pastushenko I Blanpain CEMT Transition States during Tumor Progression and Metastasis Trends Cell Biol 2019 29 212 26 10.1016/j.tcb.2018.12.001 30594349
Pastushenko I, Blanpain CEMT. Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019;29:212–26.30594349 10.1016/j.tcb.2018.12.001
26. Kalluri R Weinberg RA The basics of epithelial-mesenchymal transition J Clin Invest 2009 119 1420 8 10.1172/JCI39104 19487818
Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119:1420–8.19487818 10.1172/JCI39104
27. Park JH Nishidate T Kijima K Ohashi T Takegawa K Fujikane T Critical roles of mucin 1 glycosylation by transactivated polypeptide N-acetylgalactosaminyltransferase 6 in mammary carcinogenesis Cancer Res 2010 70 2759 69 10.1158/0008-5472.CAN-09-3911 20215525
Park JH, Nishidate T, Kijima K, Ohashi T, Takegawa K, Fujikane T, et al. Critical roles of mucin 1 glycosylation by transactivated polypeptide N-acetylgalactosaminyltransferase 6 in mammary carcinogenesis. Cancer Res. 2010;70:2759–69.20215525 10.1158/0008-5472.CAN-09-3911
28. Freire-de-Lima L Gelfenbeyn K Ding Y Mandel U Clausen H Handa K Involvement of O-glycosylation defining oncofetal fibronectin in epithelial-mesenchymal transition process Proc Natl Acad Sci U S A 2011 108 17690 5 10.1073/pnas.1115191108 22006308
Freire-de-Lima L, Gelfenbeyn K, Ding Y, Mandel U, Clausen H, Handa K, et al. Involvement of O-glycosylation defining oncofetal fibronectin in epithelial-mesenchymal transition process. Proc Natl Acad Sci U S A. 2011;108:17690–5.22006308 10.1073/pnas.1115191108
29. Tarhan YE Kato T Jang M Haga Y Ueda K Nakamura Y Morphological changes, cadherin switching, and growth suppression in pancreatic Cancer by GALNT6 knockdown Neoplasia 2016 18 265 72 10.1016/j.neo.2016.03.005 27237318
Tarhan YE, Kato T, Jang M, Haga Y, Ueda K, Nakamura Y, et al. Morphological changes, cadherin switching, and growth suppression in pancreatic Cancer by GALNT6 knockdown. Neoplasia. 2016;18:265–72.27237318 10.1016/j.neo.2016.03.005
30. Jiang X Wang J Deng X Xiong F Ge J Xiang B Role of the tumor microenvironment in PD-L1/PD-1-mediated tumor immune escape Mol Cancer 2019 18 10 10.1186/s12943-018-0928-4 30646912
Jiang X, Wang J, Deng X, Xiong F, Ge J, Xiang B, et al. Role of the tumor microenvironment in PD-L1/PD-1-mediated tumor immune escape. Mol Cancer. 2019;18:10.30646912 10.1186/s12943-018-0928-4
31. Julien S, Videira PA, Delannoy P. Sialyl-tn in cancer: (how) did we miss the target? Biomolecules 2012, 2, 435–66.
32. Hu X Zhou J Zhang Y Zeng Y Jie G Wang S Identifying potential prognosis markers in hepatocellular carcinoma via integrated bioinformatics analysis and biological experiments Front Genet 2022 13 942454 10.3389/fgene.2022.942454 35928445
Hu X, Zhou J, Zhang Y, Zeng Y, Jie G, Wang S, et al. Identifying potential prognosis markers in hepatocellular carcinoma via integrated bioinformatics analysis and biological experiments. Front Genet. 2022;13:942454.35928445 10.3389/fgene.2022.942454
33. Wu Z Xia C Zhang C Yang D Ma K Prognostic significance of SNCA and its methylation in bladder cancer BMC Cancer 2022 22 330 10.1186/s12885-022-09411-9 35346107
Wu Z, Xia C, Zhang C, Yang D, Ma K. Prognostic significance of SNCA and its methylation in bladder cancer. BMC Cancer. 2022;22:330.35346107 10.1186/s12885-022-09411-9
34. Ding X Liu H Yuan Y Zhong Q Zhong X Roles of GFPT2 expression levels on the prognosis and tumor microenvironment of Colon cancer Front Oncol 2022 12 811559 10.3389/fonc.2022.811559 35330716
Ding X, Liu H, Yuan Y, Zhong Q, Zhong X. Roles of GFPT2 expression levels on the prognosis and tumor microenvironment of Colon cancer. Front Oncol. 2022;12:811559.35330716 10.3389/fonc.2022.811559
35. Robertson AG Kim J Al-Ahmadie H Bellmunt J Guo G Cherniack AD Comprehensive molecular characterization of muscle-invasive bladder Cancer Cell 2017 171 540 e556525 10.1016/j.cell.2017.09.007 28988769
Robertson AG, Kim J, Al-Ahmadie H, Bellmunt J, Guo G, Cherniack AD, et al. Comprehensive molecular characterization of muscle-invasive bladder Cancer. Cell. 2017;171:540–e556525.28988769 10.1016/j.cell.2017.09.007
36. Chavan S Bray F Lortet-Tieulent J Goodman M Jemal A International variations in bladder cancer incidence and mortality Eur Urol 2014 66 59 73 10.1016/j.eururo.2013.10.001 24451595
Chavan S, Bray F, Lortet-Tieulent J, Goodman M, Jemal A. International variations in bladder cancer incidence and mortality. Eur Urol. 2014;66:59–73.24451595 10.1016/j.eururo.2013.10.001
37. Cambier S Sylvester RJ Collette L Gontero P Brausi MA van Andel G EORTC nomograms and Risk groups for Predicting recurrence, progression, and Disease-specific and overall survival in Non-muscle-invasive Stage Ta-T1 urothelial bladder Cancer patients treated with 1–3 years of maintenance Bacillus Calmette-Guerin Eur Urol 2016 69 60 9 10.1016/j.eururo.2015.06.045 26210894
Cambier S, Sylvester RJ, Collette L, Gontero P, Brausi MA, van Andel G, et al. EORTC nomograms and Risk groups for Predicting recurrence, progression, and Disease-specific and overall survival in Non-muscle-invasive Stage Ta-T1 urothelial bladder Cancer patients treated with 1–3 years of maintenance Bacillus Calmette-Guerin. Eur Urol. 2016;69:60–9.26210894 10.1016/j.eururo.2015.06.045
38. Ding M Liu J Lv H Zhu Y Chen Y Peng H Knocking down GALNT6 promotes pyroptosis of pancreatic ductal adenocarcinoma cells through NF-κB/NLRP3/GSDMD and GSDME signaling pathway Front Oncol 2023 13 1097772 10.3389/fonc.2023.1097772 36925932
Ding M, Liu J, Lv H, Zhu Y, Chen Y, Peng H, et al. Knocking down GALNT6 promotes pyroptosis of pancreatic ductal adenocarcinoma cells through NF-κB/NLRP3/GSDMD and GSDME signaling pathway. Front Oncol. 2023;13:1097772.36925932 10.3389/fonc.2023.1097772
39. Guo Y Shi J Zhang J Li H Liu B Guo H Polypeptide N-acetylgalactosaminyltransferase-6 expression in gastric cancer Onco Targets Ther 2017 10 3337 44 10.2147/OTT.S138590 28744137
Guo Y, Shi J, Zhang J, Li H, Liu B, Guo H. Polypeptide N-acetylgalactosaminyltransferase-6 expression in gastric cancer. Onco Targets Ther. 2017;10:3337–44.28744137 10.2147/OTT.S138590
40. Ogawa M Tanaka A Namba K Shia J Wang JY Roehrl MH Early-stage loss of GALNT6 predicts poor clinical outcome in Colorectal Cancer Front Oncol 2022 12 802548 10.3389/fonc.2022.802548 35692787
Ogawa M, Tanaka A, Namba K, Shia J, Wang JY, Roehrl MH. Early-stage loss of GALNT6 predicts poor clinical outcome in Colorectal Cancer. Front Oncol. 2022;12:802548.35692787 10.3389/fonc.2022.802548
41. Kurita T Thi TN Koi C Murakami M Kagami S Izumi H Expression of N-Acetylgalactosaminyltransferase-6 is related to expression of cell adhesion molecules in Endometrial Cancer Anticancer Res 2017 37 3905 10 28668893
Kurita T, Thi TN, Koi C, Murakami M, Kagami S, Izumi H, et al. Expression of N-Acetylgalactosaminyltransferase-6 is related to expression of cell adhesion molecules in Endometrial Cancer. Anticancer Res. 2017;37:3905–10.28668893
42. Radhakrishnan P Dabelsteen S Madsen FB Francavilla C Kopp KL Steentoft C Immature truncated O-glycophenotype of cancer directly induces oncogenic features Proc Natl Acad Sci U S A 2014 111 E4066 4075 10.1073/pnas.1406619111 25118277
Radhakrishnan P, Dabelsteen S, Madsen FB, Francavilla C, Kopp KL, Steentoft C, et al. Immature truncated O-glycophenotype of cancer directly induces oncogenic features. Proc Natl Acad Sci U S A. 2014;111:E4066–4075.25118277 10.1073/pnas.1406619111
43. Rhim AD Mirek ET Aiello NM Maitra A Bailey JM McAllister F EMT and dissemination precede pancreatic tumor formation Cell 2012 148 349 61 10.1016/j.cell.2011.11.025 22265420
Rhim AD, Mirek ET, Aiello NM, Maitra A, Bailey JM, McAllister F, et al. EMT and dissemination precede pancreatic tumor formation. Cell. 2012;148:349–61.22265420 10.1016/j.cell.2011.11.025
44. Chia J Goh G Bard F Short O-GalNAc glycans: regulation and role in tumor development and clinical perspectives Biochim Biophys Acta 2016 1860 1623 39 10.1016/j.bbagen.2016.03.008 26968459
Chia J, Goh G, Bard F. Short O-GalNAc glycans: regulation and role in tumor development and clinical perspectives. Biochim Biophys Acta. 2016;1860:1623–39.26968459 10.1016/j.bbagen.2016.03.008
45. Lim WC Kim H Kim YJ Jeon BN Kang HB Ko H Catechol inhibits epidermal growth factor-induced epithelial-to-mesenchymal transition and stem cell-like properties in hepatocellular carcinoma cells Sci Rep 2020 10 7620 10.1038/s41598-020-64603-2 32376896
Lim WC, Kim H, Kim YJ, Jeon BN, Kang HB, Ko H. Catechol inhibits epidermal growth factor-induced epithelial-to-mesenchymal transition and stem cell-like properties in hepatocellular carcinoma cells. Sci Rep. 2020;10:7620.32376896 10.1038/s41598-020-64603-2
46. Yang HJ Liu GL Liu B Liu T GP73 promotes invasion and metastasis of bladder cancer by regulating the epithelial-mesenchymal transition through the TGF-β1/Smad2 signalling pathway J Cell Mol Med 2018 22 1650 65 10.1111/jcmm.13442 29349903
Yang HJ, Liu GL, Liu B, Liu T. GP73 promotes invasion and metastasis of bladder cancer by regulating the epithelial-mesenchymal transition through the TGF-β1/Smad2 signalling pathway. J Cell Mol Med. 2018;22:1650–65.29349903 10.1111/jcmm.13442
47. Mialhe A Levacher G Champelovier P Martel V Serres M Knudsen K Expression of E-, P-, n-cadherins and catenins in human bladder carcinoma cell lines J Urol 2000 164 826 35 10.1016/S0022-5347(05)67322-3 10953163
Mialhe A, Levacher G, Champelovier P, Martel V, Serres M, Knudsen K, et al. Expression of E-, P-, n-cadherins and catenins in human bladder carcinoma cell lines. J Urol. 2000;164:826–35.10953163 10.1016/S0022-5347(05)67322-3
48. Fujiyama C Jones A Fuggle S Bicknell R Cranston D Harris AL Human bladder cancer invasion model using rat bladder in vitro and its use to test mechanisms and therapeutic inhibitors of invasion Br J Cancer 2001 84 558 64 10.1054/bjoc.2000.1641 11207054
Fujiyama C, Jones A, Fuggle S, Bicknell R, Cranston D, Harris AL. Human bladder cancer invasion model using rat bladder in vitro and its use to test mechanisms and therapeutic inhibitors of invasion. Br J Cancer. 2001;84:558–64.11207054 10.1054/bjoc.2000.1641
49. RodrÍguez E Schetters STT van Kooyk Y The tumour glyco-code as a novel immune checkpoint for immunotherapy Nat Rev Immunol 2018 18 204 11 10.1038/nri.2018.3 29398707
RodrÍguez E, Schetters STT, van Kooyk Y. The tumour glyco-code as a novel immune checkpoint for immunotherapy. Nat Rev Immunol. 2018;18:204–11.29398707 10.1038/nri.2018.3
50. Gringhuis SI Kaptein TM Wevers BA van der Vlist M Klaver EJ van Die I Fucose-based PAMPs prime dendritic cells for follicular T helper cell polarization via DC-SIGN-dependent IL-27 production Nat Commun 2014 5 5074 10.1038/ncomms6074 25278262
Gringhuis SI, Kaptein TM, Wevers BA, van der Vlist M, Klaver EJ, van Die I, et al. Fucose-based PAMPs prime dendritic cells for follicular T helper cell polarization via DC-SIGN-dependent IL-27 production. Nat Commun. 2014;5:5074.25278262 10.1038/ncomms6074
51. García-Vallejo JJ Ilarregui JM Kalay H Chamorro S Koning N Unger WW CNS myelin induces regulatory functions of DC-SIGN-expressing, antigen-presenting cells via cognate interaction with MOG J Exp Med 2014 211 1465 83 10.1084/jem.20122192 24935259
García-Vallejo JJ, Ilarregui JM, Kalay H, Chamorro S, Koning N, Unger WW, et al. CNS myelin induces regulatory functions of DC-SIGN-expressing, antigen-presenting cells via cognate interaction with MOG. J Exp Med. 2014;211:1465–83.24935259 10.1084/jem.20122192
52. van Vliet SJ Bay S Vuist IM Kalay H García-Vallejo JJ Leclerc C MGL signaling augments TLR2-mediated responses for enhanced IL-10 and TNF-α secretion J Leukoc Biol 2013 94 315 23 10.1189/jlb.1012520 23744646
van Vliet SJ, Bay S, Vuist IM, Kalay H, García-Vallejo JJ, Leclerc C, et al. MGL signaling augments TLR2-mediated responses for enhanced IL-10 and TNF-α secretion. J Leukoc Biol. 2013;94:315–23.23744646 10.1189/jlb.1012520
53. van Vliet SJ Gringhuis SI Geijtenbeek TB van Kooyk Y Regulation of effector T cells by antigen-presenting cells via interaction of the C-type lectin MGL with CD45 Nat Immunol 2006 7 1200 8 10.1038/ni1390 16998493
van Vliet SJ, Gringhuis SI, Geijtenbeek TB, van Kooyk Y. Regulation of effector T cells by antigen-presenting cells via interaction of the C-type lectin MGL with CD45. Nat Immunol. 2006;7:1200–8.16998493 10.1038/ni1390
54. Zhang H Qin G Zhang C Yang H Liu J Hu H TRAIL promotes epithelial-to-mesenchymal transition by inducing PD-L1 expression in esophageal squamous cell carcinomas J Exp Clin Cancer Res 2021 40 209 10.1186/s13046-021-01972-0 34167551
Zhang H, Qin G, Zhang C, Yang H, Liu J, Hu H, et al. TRAIL promotes epithelial-to-mesenchymal transition by inducing PD-L1 expression in esophageal squamous cell carcinomas. J Exp Clin Cancer Res. 2021;40:209.34167551 10.1186/s13046-021-01972-0
55. Hirai M Kitahara H Kobayashi Y Kato K Bou-Gharios G Nakamura H Regulation of PD-L1 expression in a high-grade invasive human oral squamous cell carcinoma microenvironment Int J Oncol 2017 50 41 8 10.3892/ijo.2016.3785 27922697
Hirai M, Kitahara H, Kobayashi Y, Kato K, Bou-Gharios G, Nakamura H, et al. Regulation of PD-L1 expression in a high-grade invasive human oral squamous cell carcinoma microenvironment. Int J Oncol. 2017;50:41–8.27922697 10.3892/ijo.2016.3785
