
==== Front
Cancer Cell Int
Cancer Cell Int
Cancer Cell International
1475-2867
BioMed Central London

39245739
3494
10.1186/s12935-024-03494-z
Research
Hypoxia-induced BAP1 enhances erastin-induced ferroptosis in nasopharyngeal carcinoma by stabilizing H2A
Cai Weisong 1
Wu Sa 2
Lin Zehua 1
Ming Xiaoping 1
Yang Xiuping 1
Yang Minlan yangml@whu.edu.cn

1
Chen Xiong zn_chenxiong@whu.edu.cn

1
1 https://ror.org/01v5mqw79 grid.413247.7 0000 0004 1808 0969 Department of Otorhinolaryngology, Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan, China
2 grid.33199.31 0000 0004 0368 7223 Department of Gynaecology II, Maternal and Child Health Hospital of Hubei Province, TongjiMedical College, Huazhong University of Science and Technology, Wuhan, China
8 9 2024
8 9 2024
2024
24 30726 6 2023
30 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Hypoxia plays an important role in the chemotherapy resistance of nasopharyngeal carcinoma (NPC). Ferroptosis is a newly discovered form of programmed cell death and ferroptosis inducers showed promising therapeutic effects in some cancers. However, the sensibility of NPC cells to ferroptosis under the hypoxic microenvironment is still unclear, and this study was designed to clarify it.

Methods

NPC cells, treated with erastin, were placed in a normoxia or hypoxic environment (5% CO2, 94% N2 and 1% O2) at 37℃for 24 h. After exposed to hypoxia, ferroptosis-associated phenotypes were detected by CCK8, MDA, GSH, lipid ROS and Fe. The gene expression profiles of head and neck squamous cell carcinoma (HNSCC) tissues were downloaded from the TCGA database to screen construction molecule. BAP1 was screened out and its functions on erastin-induced ferroptosis in NPC cells were detected by knockdown of BAP1. Luciferase reporter assay and co-IP experiment were performed to explore the molecular mechanism. Finally, the tumour xenograft model was applied to further verify these results in vivo.

Results

CCK8 assay showed that IC50 of NPC cells treated with erastin under hypoxia was significantly lower than that under normoxia. Hypoxia significantly increased the levels of lipid ROS and MDA, and decreased GSH content induced by erastin. A prognostic risk model for HNSCC with six ferroptosis-related genes was constructed and validated based on TCGA database. BAP1 was significantly up-regulated under hypoxia, and luciferase reporter assay showed that HIF-1α was an upstream transcription regulator of BAP1. Knockdown of BAP1 in NPC cells significantly increased the IC50 value of erastin under hypoxia and significantly ameliorated erastin-induced ferroptosis under hypoxia in aspect of lipid ROS, MDA content and GSH. Co-IP results showed that BAP1 mediated deubiquitination of H2A and decreased SLC7A11 expression. Finally, knockdown of BAP1 reduced sensitivity to erastin-induced ferroptosis in a tumour xenograft model. And the level of H2A was significantly decreased in xenograft tumors of BAP1 knockdown cells.

Conclusion

Hypoxia-induced BAP1 enhances erastin-induced ferroptosis in NPC by stabilizing H2A. Ferroptosis inducers targeting BAP1 may be an effective way to improve chemotherapy resistance in NPC, especially in the hypoxic microenvironment.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12935-024-03494-z.

Keywords

Hypoxia
Ferroptosis
Nasopharyngeal carcinoma cells
BAP1
H2A
SLC7A11
Zhongnan Hospital of Wuhan University Science, Technology and Innovation Seed Fundznpy2019082 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

NPC, a type of head and neck squamous cell carcinoma (HNSCC), is a malignant disease that originated from the epithelium and glands of the nasopharyngeal mucosa [1]. Although NPC is sensitive to radiation therapy, the early signs and symptoms of patients with NPC are less obvious than those of other head and neck malignancies and thus are usually diagnosed at a later stage. It is difficult to detect early because of its hidden site [2]. As the nasopharynx is rich in lymphatic reflux, early lymphatic metastasis usually happened. 65% of patients with locally advanced NPC have a low 5-year overall survival (OS) [3, 4]. 20 ∽ 30% of NPC patients died of distant metastasis and treatment options for these patients are often limited, hence the chemoradiotherapy resistance in NPC treatment is a major clinical challenge. Concomitant chemotherapy (cisplatin/5-fluorouracil) and radiotherapy (RT) moderately improved OS but resulted in significant toxicity and death [5, 6]. Therefore, it is necessary to find new chemotherapeutic drugs with high efficiency and safety.

Ferroptosis is a newly discovered form of programmed cell death and inducing ferroptosis of cancer cells is also becoming a promising treatment strategy for some tumors [7]. With the development of various ferroptosis inducers and inhibitors, the mechanism of ferroptosis and chemotherapy sensitization was studied [8]. Some ferroptosis inducers such as erastin have been found to increase chemotherapeutic sensitivity in a variety of tumors [9, 10]. But whether ferroptosis inducers are applicable to NPC remains to be studied.

Hypoxia, a common feature of most rapidly growing malignancies, is an important cause of chemotherapy resistance in NPC [10–12]. However, sensitivity of ferroptosis inducer showed cellular difference in hypoxia environment [14, 15]. The study aimed to investigate the sensitivity of NPC cells to erastin in a hypoxic environment, with the expectation of providing a new approach for addressing chemotherapy resistance in NPC treatment.

Materials and methods

Cell culture

Human NPC cell lines HNE1 and 6-10B were purchased from Medical Science Research Center, Zhongnan Hospital of Wuhan University and was maintained in high glucose DMEM (Gibco, USA) or RPMI 1640 (Gibco, USA) complemented with 10% fetal bovine serum (Cellmax, China). All mediums were complemented with penicillin and streptomycin (100 U/L penicillin and 100 mg/L streptomycin, Beyotime, China). Cells were cultured in a humidified incubator in a 5% CO2 atmosphere at 37 ℃. The hypoxia model was achieved with a hypoxia chamber flushed with a gas mixture of 1% O2, 5% CO2, and 94% N2 for 24 h.

Construction of BAP1 or HIF-1α knockdown NPC cell lines

The short hairpin RNAs (shRNAs) targeting the mRNA sequence of BAP1 (shBAP1) or HIF-1α (shHIF-1α) were generated into a pLKO.1 puromycin vector and the pLKO.1 puromycin vector was used as a negative control shRNA (shNC). The targeting sequence of shRNA was GCCTTTCTAGACAATCACAAT (shBAP1) or CCAGTTATGATTGTGAAGTTA (shHIF-1α). The shRNAs were packaged to lentivirus. Cells successfully transfected the lentiviral shRNAs were selected by puromycin (Beyotime, China) and verified by western blotting.

RNA extraction and quantitative RT-PCR

Total RNA was isolated by using the TRIzol reagent (Thermo, USA). The RNA quality and amount were evaluated by NanoDrop 3300 spectrophotometer (Thermo, USA). Reverse transcriptase (Vazyme, China) was utilized to perform reverse transcription. SYBR Green qPCR SuperMix-UDG (Thermo, USA) was utilized to conduct Quantitative real-time PCR. GAPDH was used as the normalization control. Each sample was tested at least in triplicate. The primers used were listed in Supplementary Files (Table S1-Primers).

Western blotting

Total protein was extracted using RIPA lysis buffer (Beyotime, China) containing phosphatase and protease inhibitors. BCA Protein Assay Kit (Thermo, USA) was used to quantify the protein concentration. An equal amount of protein (20 µg) was loaded and separated onto 10% SDS-PAGE and then transferred to PVDF membranes (Sigma, USA). All membranes were then blocked for 1 h with 5% skim milk. The primary antibodies were incubated at 4℃ overnight. The next day, the membranes were incubated at room temperature for 2 h with HRP-conjugated secondary antibodies (CST, USA). Protein bands were visualized with ECL detection kit (Beyotime, China). The relative protein levels were analyzed by Image J software. GAPDH was used as the internal control. Primary antibodies include BAP1 (Proteintech, China) and H2A (CST, USA).

CCK8

Cells were seeded at 8000 cells into 96-well plates per well. After treated with erastin (MCE, China) for 24 h, each well was added 10µL CCK-8 reagent (Biosharp, China) for 2 h. Absorbance at 450 nm was detected to reflect the cell viability.

Determination of mitochondrial membrane potential, ROS, GSH, malondialdehyde (MDA), and Fe level

The levels of mitochondria membrane potential and cellular ROS were determined by flow cytometer (Beckman, USA) using Reactive Oxygen Species (ROS) Assay Kit (Beyotime, China). The MDA concentration, GSH concentration, and Fe concentration in cell lysates were tested using the MDA Assay Kit (Solarbio, China), GSH Assay kit (Solarbio, China), and Iron Colorimetric Assay Kit (Applygen, China) according to the manufacturer’s instructions.

Lipid ROS assay

Molecular Probes BODIPY 581/591 C11 (Thermo, USA) was used to measure lipid ROS. The HNE1 cells and 6-10B cells were seeded in 24-well plates and pretreated with erastin under hypoxia as previously described, and incubated with the kit reagent at a working concentration of 5 µM for 30 min in the dark. Images were acquired under a fluorescence microscope (Olympus, Japan). A quantitative analysis of mean fluorescent intensity was performed using Image J (Bethesda, USA).

Luciferase reporter assay

0.5 µg pGL3 vector expressing BAP1 along with 0.5 µg pHAGE-HIF-1α, 20 ng Renilla luciferase reporter was co-transfected in triplicates into 293T cells using Lipofectamine 3000 (Thermo, USA). Luciferase activities were measured 24 h later using Dual Luciferase Reporter Assay System (Beyotime, China). Firefly luciferase activities were normalized to Renilla luciferase control values and shown as an average of triplicates.

Co-immunoprecipitation (co-IP) assay and ubiquitination analysis

6-10B cells were collected and lysised by using cell lysis buffer for Western blotting and IP (Beyotime, China) supplemented with a protease inhibitor cocktail (Beyotime, China). Then, protein G (MCE, China) and normal IgG antibody (Proteintech, China) were used to block the lysate. Next, the lysate was incubated with BAP1 antibody or normal IgG antibody overnight at 4 °C, and then incubated with protein G Sepharose (GE Healthcare, UK) at 4 °C for 3 h to conduct the co-IP assay. The IP was denature at 100 °C for 5 min in sample buffer. For ubiquitination analysis, 6-10B cells were treated with 20µM MG132 (A proteasome inhibitor, MCE, China) for 3 h. Then cells were collected and co-IP assay was performed. Finally, The ubiquitinated proteins were detected using UB antibody (ABclonal, China).

Bioinformatics analysis

Gene expression profiles of HNSCC were downloaded from TCGA (https://portal.gdc.cancer.gov/). Ferroptosis-related genes set was downloaded from FerrDb(http://www.zhounan.org/ferrdb/). R software (version 3.4.0; https://www.r-project.org/) and Bioconductor packages (http://www.bioconductor.org/) were used in the data analysis. The computer codes used in this study can be found in the Supplemental Files. Gene signature was established by using the survival package. The survminer package, survival ROC package and pheatmap package were performed to confirm the prognosis risk model. All code is available as Supplementary Files (Table S2-code).

Tumour xenograft model

Animal studies were approved by Zhongnan Hospital animal ethics committee (Wuhan, China). NPC cells (6-10B-shNC and 6-10B-shBAP1) were resuspended at 3 × 106 cells/mL in 200ul saline and injected into the right anterior flank of male BABL/c nude mice (4 weeks old, Gempharmatech, China). After 7 days, the mice were randomly divided into the treatment group and the control group (10 mice per group). The treatment group was treated with erastin (30 mg/kg, intraperitoneally, every day) and the control group was treated with saline (equal volume per weight, intraperitoneally, every day) (MCE, China). Tumor volume was measured using a caliper every other day, and volumes were calculated using the standard formula: V = 0.5*length*width2. Finally, mice were euthanized, and tumors were removed, photographed, weighed and collected for immunohistochemistry (IHC).

IHC staining

Tumor tissues were deparaffinized in 4% paraformaldehyde fix solution (Biosharp, China). Antigen retrieval was performed by using 0.1 M sodium citrate buffer. Then, the sections were blocked according to the manufacturer’s instructions of IHC kit (Maixin, China). Subsequently, they were incubated with primary antibodies overnight at 4℃ temperature. The next day, slides were incubated with biotin-labeled secondary antibody for 1 h at room temperature, after which sections were counterstained with haematoxylin. Finally, images were acquired with a polarized light microscope (Olympus, Japan).

Statistical analysis

GraphPad Prism 9.12 (GraphPad, USA) was used for statistical analysis. All the data were presented as means ± standard deviation (Mean ± SD) for at least three independent experiments. Statistical significance was determined by Student’s t test between two groups, and one-way ANOVA when therewere more than two groups. Differences were considered statistically significant with P < 0.05 (*P < 0.05, ** P < 0.01,*** P < 0.001).

Results

Hypoxia enhanced erastin-induced ferroptosis in nasopharyngeal carcinoma cells

To explore the drug sensitivity, HNE1 cells and 6-10B cells were treated with erastin at different concentrations, and their viabilities were determined by CCK-8 assay. Erastin significantly reduced viabilities of HNE1 and 6-10B cells in a dose dependent manner (Fig. 1A). The microscopic observation also illustrated that erastin induced apparent cell floating and death for HNE1 and 6-10B cells (Fig. 1B). Erastin significantly increased the ROS level (Fig. 1C). These findings confirmed that NPC cells were susceptible to ferroptosis inducer. The half maximal inhibitory concentration (IC50) values of erastin in HNE1 and 6-10B cells in hypoxia environment were significantly lower than that in normoxia condition (Fig. 1A). Meanwhile, hypoxia significantly increased the erastin-induced cells floating and death (Fig. 1B) and the ROS level (Fig. 1C). To further clarify that ferroptosis is the primary pathway of death in this experiment, we examined intracellular lipid ROS using an imaging probe. The results showed that erastin significantly increased intracellular lipid ROS and hypoxia further aggravated it (Fig. 1D). Similar results were obtained by MDA test (Fig. 1E). These effects may be related to the reduced GSH (Fig. 1F), but not the Fe content (Fig. 1G). These data suggested that hypoxia enhanced erastin-induced ferroptosis in NPC cells.

Fig. 1 Hypoxia enhances erastin-induced ferroptosis in nasopharyngeal carcinoma cells. (A) HNE1 and 6-10B cells were treated with 0, 2.5, 5, 10, 20 µM erastin for 24 h under hypoxia or normal control culture environment, cell viability was assessed by CCK-8 assay. (B-G) HNE1 and 6-10B cells were treated with 10 µM erastin under hypoxia or normoxia 24 h. (B) Cell floating and death were evaluated via observation using a microscope. (C) ROS concentration was assessed by flow cytometer presented by MEAN FITC. (D) Intracellular lipid ROS was measured by using an imaging probe that becomes green fluorescent upon activation by lipid ROS. (E) MDA concentration was assessed by MDA assay. (F) GSH concentration was assessed by GSH assay. (G) Fe concentration was assessed by Fe assay. The data are presented as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001

Screening for ferroptosis-related prognostic genes in HNSCC

The bioinformatics analysis was applied to screen the key genes regulating ferroptosis in NPC. The forest plot showed 12 ferroptosis-related genes associated with survival prognosis in HNSCC from TCGA database (Fig. 2A). A prognostic risk model with six genes (ASNS, PRDX6, FLT3, ATG5, MAP1LC3A and BAP1) was constructed and validated (Table 1). Figure 2B showed the nomogram prognostic model containing the 6 genes in HNSCC. Using univariate and multivariate Cox regression analyses, we found that the risk score was an independent prognostic factor of HNSCC patients and the high risk score group had lower overall survival (Fig. 2C). Based on receiver operating characteristic (ROC) curve analyses, we found that the prognostic model represents good estimation; at 1 year (AUC = 0.675), 2 year (AUC = 0.667), 3 year (AUC = 0.711) (Fig. 2D). Principal Component Analysis (PCA) showed the significant differences between the distribution of patients based on risk scores (Fig. 2E). The risk plot with the distribution of patients based on risk scores, and the survival status of individual HNSCC patients was displayed in Fig. 2F.

Table 1 The prognosis risk model with six ferroptosis-related genes

GENE ID	COEF	HR	
ASNS	0.134425475	1.143879409	
PRDX6	0.270253714	1.31029685	
FLT3	-1.336838979	0.262674678	
ATG5	0.407272551	1.502713616	
MAP1LC3A	-0.184729722	0.831328944	
BAP1	-0.506785513	0.60242897	
COEF, risk coefficient of each gene. HR, hazard ratio

Fig. 2 Screening for ferroptosis-related prognostic genes in HNSCC. (A) Twelve genes (ASNS, TRIB3, ATP5MC3, FTH1, NQO1, HSPA5, OTUB1, PRDX6, FLT3, ATG5, MAP1LC3A and BAP1) were constructed in the forest plot. (B) Nomogram prognostic model containing ASNS, PRDX6, FLT3, ATG5, MAP1LC3A and BAP1 in HNSCC. (C) Survivorship curve of the distribution of patients based on risk scores. (D) ROC curves at 1, 2 or 3 years. (E) Principal components analyses were performed on all samples. The first two principal components which explain most of the data variation are shown. (F) Survival status of individual HNSCC patients with the distribution of patients based on risk scores

BAP1 was up-regulated in nasopharyngeal carcinoma cells under hypoxia

To investigate which ferroptosis-related gene plays a central role in erastin-induced ferroptosis of NPC under hypoxia, we performed RT-PCR and western blotting experiments. We found that hypoxia significantly increased the mRNA and protein expression levels of BAP1 in both HNE1 and 6-10B cells after exposed to hypoxia for 24 h, whereas other 5 ferroptosis-related genes showed no significant difference (Fig. 3A and B). In addition, luciferase reporter assays showed that the transcription factor HIF-1α is an upstream regulator of BAP1 (Fig. 3C). Knocking down HIF-1α mitigated hypoxia-induced upregulation of BAP1 expression (Fig. 3D). Therefore, we speculated that BAP1 may play a role in ferroptosis in NPC cells under hypoxia.

Fig. 3 BAP1 was upregulated in nasopharyngeal carcinoma cells under hypoxia. HNE1 and 6-10B cells were cultured under hypoxia or normoxia control for 24 h. (A) Six genes (BAP1, ASNS, ATG5, PRDX6, MAP1LC3A and FLT3) mRNA levels were assessed by qRT-PCR. (B) Protein level of BAP1 were assessed by western blot. (C) Luciferase reporter assay detected that HIF-1α bound to the promoter region of BAP1. (D) Protein level of HIF-1α and BAP1 were assessed by western blot. The data are presented as mean ± SD. *P < 0.05; ***P < 0.001

Knockdown of BAP1 attenuated erastin-induced ferroptosis in nasopharyngeal carcinoma cells under hypoxia

To explore the role of BAP1 in ferroptosis under hypoxia, the BAP1 shRNA plasmid was constructed. The negative control vector (shNC) and the BAP1 knockdown vector (shBAP1) were transfected into HNE1 and 6-10B cells, and western bloting results confirmed that BAP1 knockdown cells were constructed (Fig. 4A). Treated with erastin for 24 h, cell viability was determined with CCK-8 assay. We found that BAP1 knockdown significantly increased IC50 value of erastin in hypoxia and reduced erastin-induced cell death and ROS (Fig. 4B-D). Notably, knockdown of BAP1 significantly ameliorated ferroptosis induced by hypoxia in aspect of lipid ROS, MDA and GSH content (Fig. 4E-G). These results suggested that hypoxia enhanced erastin-induced ferroptosis in NPC cells by upregulating BAP1.

Fig. 4 Knockdown of BAP1 attenuated erastin-induced ferroptosis in nasopharyngeal carcinoma cells under hypoxia. (A) Western blot results confirmed BAP1 knockdown cells were constructed. (B) Above cells were treated with 0, 2.5, 5, 10, 20 µM erastin for 24 h under hypoxia culture environment, cell viability was assessed by CCK-8 assay. (C-G) HNE1 cells and 6-10B cells transfected with BAP1 knockdown or Negative control(NC) were treated with 10 µM erastin under hypoxiaor normal control culture environment. (C) Cell floating and death were evaluated via observation using a microscope. (D) ROS concentration was assessed by flow cytometer presented by MEAN FITC. (E) Intracellular lipid ROS was measured by using an imaging probe that becomes green fluorescent upon activation by lipid ROS. (F) MDA concentration was assessed by MDA assay. (G) GSH concentration was assessed by GSH assay. The data are presented as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001

Hypoxia-induced BAP1 decreased SLC7A11 expression by stabilizing H2A

To explore the underlying mechanisms involved in BAP1 attenuating the sensibility of NPC cells to erastin-induced ferroptosis, we examined the expression levels of its downstream target ferroptosis-related gene. Western blotting showed that hypoxia upregulated the expression of BAP1 and downstream target ferroptosis-related gene H2A. BAP1 knockdown abrogated the upregulation of H2A (Fig. 5A). As BAP1 is a deubiquitinase, we speculated that it mediated H2A deubiquitination. Therefore, MG132 (proteasome inhibitor) was used to test its effect on H2A. It showed that MG132 reversed the reduced-H2A protein expression level induced by BAP1 knockdown (Fig. 5B). To further investigate whether BAP1 deubiquitinated H2A, Co-IP assay was applied. The results showed that BAP1 interacted and deubiquitinated H2A (Fig. 5C, D). Finally, we tested H2A target ferroptosis-related gene SLC7A11 mRNA levels (Fig. 5E). It showed that hypoxia decreased SLC7A11 transcript levels, and BAP1 knockdown reversed its down-regulation. The down-regulation SLC7A11 might cause the decreased GSH level, increased lipid hydroperoxides induced by erastin and induced ferroptosis in NPC cells.

Fig. 5 Hypoxia-induced BAP1 decreased SLC7A11 expression by stabilizing H2A. (A) BAP1 knockdown 6-10B cells were subjected to hypoxia or normal stimulation. BAP1 and H2A expression was detected by representative immunoblotting analysis. (B) 6-10B cells (shBAP1 or shNC) were subjected to MG132 or solvent 3 h before harvest, BAP1 and H2A expression was detected by representative immunoblotting analysis. (C) 6-10B cells were subjected to hypoxia 24 h. And BAP1 antibody or normal rabbit IgG antibody were subjected to co-IP, then the indicated antibodies were used for immunoblotting analysis. (D) 6-10B cells transfected with BAP1 knockdown lentiviruses or empty virus were subjected to hypoxia 24 h and treated with MG132 3 h before harvest. And H2A antibody or normal rabbit IgG antibody were subjected to co-IP, then the UB antibody was used for immunoblotting analysis. (E) 6-10B cells transfected with BAP1 knockdown lentiviruses or empty virus were subjected to hypoxia or normal stimulation. SLC7A11 transcription level was detected by qRT-PCR. The data are presented as mean ± SD. *P < 0.05; **P < 0.01

Knockdown of BAP1 reduced tumoricidal capacity of erastin in vivo

In order to investigate whether BAP1 affected the sensitivity of xenograft tumours to erastin in vivo, 6-10B cells with stably BAP1 knockdown were injected into the subcutaneous space of mice. After 7 days, the mice were treated with erastin to explore tumoricidal capacity. The tumours of mice treated without erastin grew significantly faster and larger than that treated with erastin (Fig. 6A-C). While the knockdown of BAP1 alone had no significant anti-tumor effects, BAP1 knockdown attenuated the effects of erastin on tumor regression (Fig. 6A-C). In addition, we performed IHC staining to explore related protein levels in tumour xenograft samples. Consistent with the previous findings, IHC analysis indicated a decreased level of BAP1 and H2A but an increased level of SLC7A11 in the shBAP1 group (Fig. 6D). All the above results indicated that knockdown of BAP1 attenuated tumoricidal capacity of erastin in vivo.

Fig. 6 Knockdown of BAP1 reduced tumoricidal capacity of erastin in vivo. NPC cells(6-10B-shNC and 6-10B-shBAP1) were resuspended at 3 × 106 cells/mL in 200ul saline and injected into right anterior flank of male BABL/c nude mice. After 7 days, the mice were randomly divided into treatment group and control group(10 mice per group). The treatment group was treated with erastin(30 mg/kg, intraperitoneally, every day) and the control group was treated with saline(equal volume per weight, intraperitoneally, every day). (A) The tumor growth curves after erastin treatment in vivo. (B) Picture of isolated tumors. (C) Weight of isolated tumors. (D) Tumor IHC results of BAP1, H2A and SLC7A11. The data are presented as mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001

Discussion

For those advanced and recurrent NPC, multi-drug chemotherapy with platinum is the standard treatment. However, chemotherapy resistance is a big barrier to curing advanced and recurrent NPC patients [15–17]. As hypoxia plays an important role in chemotherapy resistance and metastasis of NPC [11, 12], it is of great significance to explore the mechanisms of NPC chemo-resistance and the discovery of new effective and safe chemotherapy drugs under the hypoxic microenvironment. In this study, we found that hypoxia-induced BAP1 enhances erastin-induced ferroptosis in NPC by stabilizing H2A.

Studies have shown that many tumor cells under a hypoxic microenvironment are less sensitive to chemotherapeutic agents because these agents typically require oxygen for maximum activity [12]. Regardless of oxygen concentrations required for anticancer drug activity, researches have also revealed that the preculture of some cell lines under hypoxia changes their phenotypes thereby temporarily increasing their resistance to drugs such as etoposide and doxorubicin [19, 20]. Some mechanisms for this form of chemotherapy resistance include upregulation of glucose and oxygen-regulated protein expression, DNA over replication, cell cycle arrest, altered cell metabolism, increased drug efflux pumps and greater genetic instability [21, 22]. Studies have suggested that hypoxia is an independent marker of a poor prognosis for various types of cancers. In some studies, patients with tumors with a median pO2 value less than 10 mmHg had significantly lower disease-free survival than those with a higher pO2 value [23, 24]. Moreover, clinical studies showed that low tumor oxygen levels were associated with increased tumor growth and metastasis. However, hypoxia can also induce ROS production which may induce the death of tumor cells, which is consistent with our study, hypoxia could increase the sensitivity of NPC cells to ferroptosis inducers.

Traditionally, cell death was classified into three categories including apoptosis, autophagy, and necrosis [25]. Among which the caspase-dependent apoptosis has long been considered as the only form of regulated cell death (RCD) and is adopted for the development of anticancer drugs [26, 27]. However, the therapeutic outcomes of those drugs are far from satisfactory due to the intrinsic or acquired apoptosis resistance of cancer cells. For instance, as a self-defense response, drug resistance occurs frequently in cancer cells upon the induction of apoptosis by chemotherapeutics. Ferroptosis has received considerable attention due to its involvement in development, immunity, senescence and a variety of pathological scenarios. Ferroptosis is defined as an oxidative, iron-dependent form of RCD that is characterized by the accumulation of ROS and lipid peroxidation products to lethal levels [27–29]. Recent studies have shown that ferroptosis was closely related to chemotherapy resistance [31, 32]. The Nrf2-ARE pathway plays an important role in the cellular response to oxidative stress. However, the overactivation of Nrf2 is associated with tumor drug resistance [33]. At the same time, Nrf2 is closely related to ferroptosis. Activation of the Keap1-Nrf2 pathway could suppress ferroptosis by regulating the expression of downstream target gene SLC7A11[34, 35]. Currently, there are attempts to carry erastin exosomes labeled with folic acid for the treatment of triple-negative breast cancer with folic acid receptor overexpression to enhance erastin’s inhibition on Xc− System, eventually induced ferroptosis in MDA-MB-231 cells [36]. Ferroptosis can be enhanced by exosomes and nanosystems loaded with ferroptosis to reverse chemotherapy resistance [36]. Moreover, it was found that many non-coding RNAs including microRNAs (miRNAs) and long non-coding RNAs (LncRNAs) were involved in the regulation of ferroptosis thus mediating tumor drug resistance. The aforementioned IncRNA P53RRA participates in ferroptosis by regulating P53 expression, thus mediating tumor drug resistance [37]. SLC7A11 is considered as one of the most critical upstream regulators of ferroptosis. MiRNA-27a can reverse drug resistance in cisplatin-resistant bladder cancer by targeting SLC7A11 [38], and miRNA-375 can directly target SLC7A11 and regulate the viability and proliferation of oral squamous cell carcinoma cells [39]. Given the great potential of ferroptosis in cancer therapy, the rapid development of ferroptosis inducers had a rapid great development in recent years [40, 41]. However, the mechanism of ferroptosis is not fully understood, especially in a hypoxia environment. Our study preliminarily suggested that hypoxia enhanced erastin-induced ferroptosis in NPC cells by activating the BAP1/H2A/SLC7A11 pathway.

Cysteine is a synthetic rate-limiting precursor of glutathione, a tripeptide composed of three amino acids (cysteine, glutamate and glycine), which is the most abundant antioxidant in cells. Cysteine can be recovered from the extracellular environment by de novo biosynthesis (through the sulfur conversion pathway) or protein degradation [42]. Most cancer cells rely primarily on the cystine transporter system Xc− (composed of the catalytic subunit SLC7A11 and the chaperone subunit SLC3A2) to obtain cysteine from the extracellular environment. It is then converted to cysteine in the cytoplasm through the reduction reaction of NADPH consumption; cysteine is then used in the synthesis of glutathione (and other biological molecules) [43, 44]. Accumulating studies have shown that SLC7A11-mediated cystine uptake plays a key role in inhibiting oxidative response and maintaining cell survival under oxidative stress[45, 46]. Recent studies have demonstrated that the lack of BAP1, a nuclear deubiquitinase (DUB), leads to the upregulation of SLC7A11 and ferroptosis resistance in cancer cells [47, 48]. In our study, hypoxia could upregulate BAP1 expression. The increased BAP1 mediated H2A deubiquitination leading to the repression of SLC7A11 transcription. And by reducing cystine uptake, NPC cells were sensitized to erastin, a ferroptosis inducer. In order to reflect the properties of EBV-associated NPC, the C666-1 NPC cell line containing EBV was also used in this study. And the C666-1 cell line was in good agreement with the above two cell line studies (Supplementary Fig.S1 and S2). Remarkably, the BAP1 level in HNSCC is positively associated with a better prognosis. Ferroptosis inducers targeting BAP1 may be an effective way to reduce drug resistance in NPC, especially in the hypoxic microenvironment.

In conclusion, our study initially validated that hypoxia-induced BAP1 enhanced erastin-induced ferroptosis in NPC by stabilizing H2A (Fig. 7). These results suggested that erastin and its targeted BAP1 may be an effective approach to reducing drug resistance under hypoxia. However, further study is still needed to verify the regulation of BAP1 under a hypoxia environment.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Supplementary Material 4

Abbreviations

NPC Nasopharyngeal carcinoma

HNSCC Head and neck squamous cell carcinoma

OS Overall survival

IC50 Half maximal inhibitory concentration

RCD Regulated cell death

Acknowledgements

We thank Mr. Weimin Chen and Mr. Xing Gao from Zhongnan Hospital animal laboratory center for their generous help and valuable advice.

Author contributions

Weisong Cai: Conceptualization, Methodology, Formal analysis, Investigation, Data Curation, Writing-Original Draft. Sa Wu: Conceptualization, Methodology, Formal analysis, Investigation, Data Curation, Writing-Original Draft. Zehua Lin: Methodology, Formal analysis, Investigation, Data Curation, Writing-Original Draft. Xiaoping Ming: Methodology, Software, Formal analysis, Investigation, Data Curation, Writing-Original Draft. Xiuping Yang: Resources, Data Curation. Minlan Yang and Xiong Chen: Writing- Review & Editing, Funding acquisition, Supervision.

Funding

This work was partly supported by the Zhongnan Hospital of Wuhan University Science, Technology and Innovation Seed Fund (znpy2019082).

Data availability

The following information was supplied regarding data availability: The gene expression profiles containing the clinical follow-up information is available at TCGA website(https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga). The code and the primers are available as Supplementary Files. The other data used to support the findings of this study are available from the corresponding author upon request.

Declarations

Ethics approval and consent to participate

The animal study was reviewed and approved by the Ethics Committee of Zhongnan Hospital of Wuhan University (NO. ZN2022031).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Weisong Cai, Sa Wu and Zehua Lin contributed equally to this work.
==== Refs
References

1. Campion NJ, Ally M, Jank BJ, Ahmed J, Alusi G. The molecular march of primary and recurrent nasopharyngeal carcinoma. Oncogene. 2021.
2. Siak PY Khoo SB Leong CO Hoh BP Cheah SC Current status and future perspectives about molecular biomarkers of nasopharyngeal carcinoma CANCERS 2021 13 3490 10.3390/cancers13143490 34298701
Siak PY, Khoo SB, Leong CO, Hoh BP, Cheah SC. Current status and future perspectives about molecular biomarkers of nasopharyngeal carcinoma. CANCERS. 2021;13:3490.34298701 10.3390/cancers13143490
3. Su L She L Shen L The current role of adjuvant chemotherapy in locally advanced nasopharyngeal carcinoma FRONT ONCOL 2021 10 585046 10.3389/fonc.2020.585046 33747895
Su L, She L, Shen L. The current role of adjuvant chemotherapy in locally advanced nasopharyngeal carcinoma. FRONT ONCOL. 2021;10:585046.33747895 10.3389/fonc.2020.585046
4. Yongfeng P, Chuner J, Lei W, Fengqin Y, Zhimin Y, Zhenfu F et al. The usefulness of pre-treatment MR-based radiomics on early response of neoadjuvant chemotherapy in patients with locally advanced nasopharyngeal carcinoma. Oncol Res Featuring Preclinical Clin Cancer Ther. 2020.
5. Isaradisaikul SK Chowsilpa S Ototoxicity after chemoradiotherapy for nasopharyngeal carcinoma Annals Nasopharynx Cancer 2020 4 9 10.21037/anpc-20-16
Isaradisaikul SK, Chowsilpa S. Ototoxicity after chemoradiotherapy for nasopharyngeal carcinoma. Annals Nasopharynx Cancer. 2020;4:9.10.21037/anpc-20-16
6. Li N, Li P. Effects of Different Chemoradiotherapy Regimens on Early Survival Outcomes in Patients with Locally Advanced Nasopharyngeal Carcinoma. Sichuan Da Xue Xue Bao Yi Xue Ban. 2020;51: 702-7.
7. Lei G, Mao C, Yan Y, Zhuang L, Gan B. Ferroptosis, radiotherapy, and combination therapeutic strategies. Protein Cell. 2021.
8. Elgendy SM Alyammahi SK Alhamad DW Abdin SM Omar HA Ferroptosis: an emerging approach for targeting cancer stem cells and drug resistance Crit Rev Oncol/Hematol 2020 155 103095 10.1016/j.critrevonc.2020.103095 32927333
Elgendy SM, Alyammahi SK, Alhamad DW, Abdin SM, Omar HA. Ferroptosis: an emerging approach for targeting cancer stem cells and drug resistance. Crit Rev Oncol/Hematol. 2020;155:103095.32927333 10.1016/j.critrevonc.2020.103095
9. Kim H, Jin HL, Park JW. Down-regulation of IDH2 sensitizes cancer cells to erastin-induced ferroptosis. BIOCHEM BIOPH RES CO. 2020;525.
10. Takenaka M Suzuki N Mori M Aoki H Morishige KI Abstract 2322: Ferroptosis induced by erastin in RAS mutant ovarian cancer cells CANCER RES 2018 78 2322 10.1158/1538-7445.AM2018-2322
Takenaka M, Suzuki N, Mori M, Aoki H, Morishige KI. Abstract 2322: Ferroptosis induced by erastin in RAS mutant ovarian cancer cells. CANCER RES. 2018;78:2322.10.1158/1538-7445.AM2018-2322
11. Van Sébastien, Marx, Mégane Aurélie et al. Potentialization of anticancer agents by identification of new chemosensitizers active under hypoxia. Biochem Pharmacol. 2019.
12. Minassian LM, Cotechini T, Huitema E, Graham CH. Hypoxia-Induced Resistance to Chemotherapy in Cancer. 2019.
13. Jing SW Zhao ZJ Jing SH Wei J Wang J Relationship between hypoxia inducible factor-1α and clinicopathological features of nasopharyngeal carcinoma:a Meta analysis Chin J Cancer Prev Treat 2015 22 548 54
Jing SW, Zhao ZJ, Jing SH, Wei J, Wang J. Relationship between hypoxia inducible factor-1α and clinicopathological features of nasopharyngeal carcinoma:a Meta analysis. Chin J Cancer Prev Treat. 2015;22:548–54.
14. Sn A Yin YB Zhi QA Zz A Tao LA Yk C Hypoxia inhibits RANKL-induced ferritinophagy and protects osteoclasts from ferroptosis Free Radical Bio Med 2021 169 271 82 10.1016/j.freeradbiomed.2021.04.027 33895289
Sn A, Yin YB, Zhi QA, Zz A, Tao LA, Yk C, et al. Hypoxia inhibits RANKL-induced ferritinophagy and protects osteoclasts from ferroptosis. Free Radical Bio Med. 2021;169:271–82.33895289 10.1016/j.freeradbiomed.2021.04.027
15. Dcf A, Am B, Jb A, Mj A, Bbacd E. Hypoxia inhibits ferritinophagy, increases mitochondrial ferritin, and protects from ferroptosis. Redox Biol.;36.
16. Guan S, Wei J, Huang L, Wu L. Chemotherapy and chemo-resistance in nasopharyngeal carcinoma. Eur J Med Chem. 2020: 112758.
17. Aga T, Endo K, Tsuji A, Aga M, Moriyama-Kita M, Ueno T et al. Inhibition of autophagy by chloroquine makes chemotherapy in nasopharyngeal carcinoma more efficient. Auris Nasus Larynx. 2018.
18. Hennessy MA Morris PG Induction treatment prior to chemoradiotherapy in nasopharyngeal carcinoma: triplet or doublet chemotherapy? Anti-Cancer Drug 2019 31 1
Hennessy MA, Morris PG. Induction treatment prior to chemoradiotherapy in nasopharyngeal carcinoma: triplet or doublet chemotherapy? Anti-Cancer Drug. 2019;31:1.
19. Fahy L, Calvo J, Chabi S, Renou L, Maout CL, Poglio S et al. Hypoxia favors chemoresistance in T-ALL through an HIF1α-mediated mTORC1 inhibition loop - ScienceDirect. Blood Adv. 2021.
20. Gilkes DM. Hypoxia and Cancer metastasis. Adv Exp Med Biol. 2019.
21. Däster S Amatruda N Calabrese D Ivanek R Muraro MG Induction of hypoxia and necrosis in multicellular tumor spheroids is associated with resistance to chemotherapy treatment Oncotarget 2017 8 1725 36 10.18632/oncotarget.13857 27965457
Däster S, Amatruda N, Calabrese D, Ivanek R, Muraro MG. Induction of hypoxia and necrosis in multicellular tumor spheroids is associated with resistance to chemotherapy treatment. Oncotarget. 2017;8:1725–36.27965457 10.18632/oncotarget.13857
22. Yu HK Lee HJ Zhang F Wu Q Fidler IJ Sun JK Abstract 2943: hypoxia induced resistance to chemotherapy is regulated by the endothelin receptor axis Cancer Res 2016 76 2943 10.1158/1538-7445.AM2016-2943
Yu HK, Lee HJ, Zhang F, Wu Q, Fidler IJ, Sun JK. Abstract 2943: hypoxia induced resistance to chemotherapy is regulated by the endothelin receptor axis. Cancer Res. 2016;76:2943.10.1158/1538-7445.AM2016-2943
23. Jing X, Yang F, Shao C, Wei K, Shu Y. Role of hypoxia in cancer therapy by regulating the tumor microenvironment. Mol Cancer. 2019;18.
24. Abu-Jamous B Buffa FM Harris AL Nandi AK In vitro downregulated hypoxia transcriptome is associated with poor prognosis in breast cancer Mol Cancer 2017 16 1 19 10.1186/s12943-017-0673-0 28093071
Abu-Jamous B, Buffa FM, Harris AL, Nandi AK. In vitro downregulated hypoxia transcriptome is associated with poor prognosis in breast cancer. Mol Cancer. 2017;16:1–19.28093071 10.1186/s12943-017-0673-0
25. Ntuli TM. Cell Death - Apoptosis, Autophagy and Necrosis. 2015.
26. Brenner C Kroemer G Apoptosis. Mitochondria–the death signal integrators Science 2000 289 1150 1 10.1126/science.289.5482.1150 10970229
Brenner C, Kroemer G. Apoptosis. Mitochondria–the death signal integrators. Science. 2000;289:1150–1.10970229 10.1126/science.289.5482.1150
27. Pistritto G Trisciuoglio D Ceci C Garufi A D Orazi G Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies Aging 2016 8 603 19 10.18632/aging.100934 27019364
Pistritto G, Trisciuoglio D, Ceci C, Garufi A, D Orazi G. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging. 2016;8:603–19.27019364 10.18632/aging.100934
28. Wang Y, Wei Z, Pan K, Li J, Chen Q. The function and mechanism of ferroptosis in cancer. Apoptosis. 2020;25.
29. Yanhua, Mou J, Wang, Jinchun W et al. Ferroptosis, a new form of cell death: opportunities and challenges in cancer. J Hematol Oncol. 2019.
30. Ysab C Bzab C Lzab C Zzab C Ying S Hlab C Ferroptosis, a novel pharmacological mechanism of anti-cancer drugs Cancer Lett 2020 483 127 36 10.1016/j.canlet.2020.02.015 32067993
Ysab C, Bzab C, Lzab C, Zzab C, Ying S, Hlab C, et al. Ferroptosis, a novel pharmacological mechanism of anti-cancer drugs. Cancer Lett. 2020;483:127–36.32067993 10.1016/j.canlet.2020.02.015
31. Li B Yang L Peng X Fan Q Li H Emerging mechanisms and applications of ferroptosis in the treatment of resistant cancers Biomed Pharmacother 2020 130 110710 10.1016/j.biopha.2020.110710 33568263
Li B, Yang L, Peng X, Fan Q, Li H. Emerging mechanisms and applications of ferroptosis in the treatment of resistant cancers. Biomed Pharmacother. 2020;130:110710.33568263 10.1016/j.biopha.2020.110710
32. Roh JL Kim EH Jang H Shin D Nrf2 inhibition reverses the resistance of cisplatin-resistant head and neck cancer cells to artesunate-induced ferroptosis Redox Biol 2017 11 254 62 10.1016/j.redox.2016.12.010 28012440
Roh JL, Kim EH, Jang H, Shin D. Nrf2 inhibition reverses the resistance of cisplatin-resistant head and neck cancer cells to artesunate-induced ferroptosis. Redox Biol. 2017;11:254–62.28012440 10.1016/j.redox.2016.12.010
33. Shen J, Unni E, Brodie A, Jaiswal A. Abstract #4719: Nrf2 and drug resistance in breast cancer cells. Cancer Res. 2009;69.
34. Daiha, Shin, Eun H, Kim J et al. Nrf2 inhibition reverses resistance to GPX4 inhibitor-induced ferroptosis in head and neck cancer. Free Radical Biology & Medicine. 2018.
35. Hybertson BM Gao B Role of the Nrf2 signaling system in health and disease Clin Genet 2015 86 447 52 10.1111/cge.12474
Hybertson BM, Gao B. Role of the Nrf2 signaling system in health and disease. Clin Genet. 2015;86:447–52.10.1111/cge.12474
36. Yu M, Gai C, Li Z, Ding D, Li W. Targeted exosome-encapsulated erastin induced ferroptosis in triple negative breast cancer cells. Cancer Sci. 2019;110.
37. Mao C, Wang X, Liu Y et al. A G3BP1-Interacting lncRNA promotes ferroptosis and apoptosis in Cancer via Nuclear sequestration of p53[J]. Cancer Research, 2018_3484.
38. Drayton RM, Dudziec E, Peter S, Bertz S, Catto JWF. Reduced Expression of miRNA-27a Modulates Cisplatin Resistance in Bladder Cancer by Targeting the Cystine/Glutamate Exchanger SLC7A11. Clinical Cancer Research An Official Journal of the American Association for Cancer Research. 2014;20: 1990.
39. Wu Y, Sun X, Song B, Qiu X, Zhao J. MiR-375/SLC7A11 axis regulates oral squamous cell carcinoma proliferation and invasion. Cancer Med-Us. 2017.
40. Hassannia B, Berghe TV. Ferroptosis in Cancer Disease. 2019.
41. Ghoochani A Hsu EC Aslan M Rice MA Stoyanova T Ferroptosis Inducers are a Novel Therapeutic Approach for Advanced prostate Cancer Cancer Res 2021 81 2020 3477 10.1158/0008-5472.CAN-20-3477
Ghoochani A, Hsu EC, Aslan M, Rice MA, Stoyanova T. Ferroptosis Inducers are a Novel Therapeutic Approach for Advanced prostate Cancer. Cancer Res. 2021;81:2020–3477.10.1158/0008-5472.CAN-20-3477
42. Gethin MB Cysteine, glutathione, and Thiol Redox Balance in astrocytes Antioxidants 2017 6 62 10.3390/antiox6030062 28771170
Gethin MB. Cysteine, glutathione, and Thiol Redox Balance in astrocytes. Antioxidants. 2017;6:62.28771170 10.3390/antiox6030062
43. Lara, Cobler, Hui, Zhang, Poojan, Suri et al. xCT inhibition sensitizes tumors to γ-radiation via glutathione reduction. Oncotarget. 2018.
44. Sanskriti I, Upadhyay KK. Cysteine, homocysteine and glutathione guided hierarchical self-assemblies of spherical silver nanoparticles paving the way for their naked eye discrimination in human serum. New J Chem. 2017;41.
45. Ge C Cao B Feng D Zhou F Zhang J Yang N The down-regulation of SLC7A11 enhances ROS induced P-gp over-expression and drug resistance in MCF-7 breast cancer cells Sci Rep-UK 2017 7 3791 10.1038/s41598-017-03881-9
Ge C, Cao B, Feng D, Zhou F, Zhang J, Yang N, et al. The down-regulation of SLC7A11 enhances ROS induced P-gp over-expression and drug resistance in MCF-7 breast cancer cells. Sci Rep-UK. 2017;7:3791.10.1038/s41598-017-03881-9
46. Colemonts-Vroninks H Neuckermans J Marcelis L Claes P Kock JD Oxidative stress, glutathione metabolism, and Liver Regeneration pathways are activated in Hereditary Tyrosinemia Type 1 mice upon short-term nitisinone discontinuation Genes-Basel 2020 12 3 10.3390/genes12010003 33375092
Colemonts-Vroninks H, Neuckermans J, Marcelis L, Claes P, Kock JD. Oxidative stress, glutathione metabolism, and Liver Regeneration pathways are activated in Hereditary Tyrosinemia Type 1 mice upon short-term nitisinone discontinuation. Genes-Basel. 2020;12:3.33375092 10.3390/genes12010003
47. Zhang Y, Shi J, Liu X, Li F, Gong Z, Pranavi K et al. BAP1 links metabolic regulation of ferroptosis to tumor suppression. Nat Cell Biol. 2018;20.
48. Zhang Y, Zhuang L, Gan B. BAP1 suppresses tumor development by inducing ferroptosis upon SLC7A11 repression. Mol Cell Oncol. 2018: 1–3.
