
==== Front
J Orthop Surg Res
J Orthop Surg Res
Journal of Orthopaedic Surgery and Research
1749-799X
BioMed Central London

5029
10.1186/s13018-024-05029-8
Research Article
Effect of lyophilized exosomes derived from umbilical cord stem cells on chronic anterior cruciate ligament cell injury
Lo Hon Lok 12
Lin Sung-Yen 1345
Ho Cheng-Jung 17
Ming-kung Yeh 6
Lu Cheng-Chang cclu0880330@gmail.com

14578
1 grid.412027.2 0000 0004 0620 9374 Department of Orthopedics, Kaohsiung Medical University Hospital, No.482, Shanming Rd., Siaogang Dist., Kaohsiung City, 812 Taiwan
2 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Ph.D. Program in Biomedical Engineering, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
3 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Department of Orthopedics, School of Post-Baccalaureate Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
4 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Regenerative Medicine and Cell Therapy Research Center, Kaohsiung Medical University, Kaohsiung, Taiwan
5 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Orthopaedic Research Center, Kaohsiung Medical University, Kaohsiung, Taiwan
6 https://ror.org/02bn97g32 grid.260565.2 0000 0004 0634 0356 School of Pharmacy, Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan
7 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Department of Orthopedics, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
8 https://ror.org/03gk81f96 grid.412019.f 0000 0000 9476 5696 Department of Orthopedics, Kaohsiung Municipal Siaogang Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan
9 9 2024
9 9 2024
2024
19 55428 1 2024
23 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Facilitating the healing process of injured anterior cruciate ligament (ACL) tissue is crucial for patients to safely return to sports. Stem cell derived exosomes have shown positive effects on enhancing the regeneration of injured tendons/ligaments. However, clinical application of exosomes in terms of storage and pre-assembly is challenging. We hypothesized that lyophilized exosomes derived from human umbilical cord stem cells (hUSC-EX) could enhance the cell activity of chronically injured ACL cells.

Materials and methods

We harvested the 8 weeks injured ACL cells from rabbit under IACUC (No. 110232) approval. The studied exosomes were purified from the culture medium of human umbilical cord stem cells (IRB approval No. A202205014), lyophilized to store, and hydrated for use. We compared exosome treated cells with non-exosome treated cells (control group) from the same rabbits. We examined the cell viability, proliferation, migration capability and gene expression of type I and III collagen, TGFβ, VEGF, and tenogenesis in the 8 weeks injured ACL cells after hUSC-EX treatment.

Results

After hydration, the average size of hUSC-EX was 84.5 ± 70.6 nm, and the cells tested positive for the Alix, TSG101, CD9, CD63, and CD81 proteins but negative for the α-Tubulin protein. After 24 h of treatment, hUSC-EX significantly improved the cell viability, proliferation and migration capability of 8 weeks injured ACL cells compared to that of no exosome treatment group. In addition, the expression of collagen synthesis, TGFβ, VEGF, and tenogenesis gene were all significantly increased in the 8 weeks injured ACL cells after 24 h hUSC-EX delivery.

Discussion

Lyophilized exosomes are easily stored and readily usable after hydration, thereby preserving their characteristic properties. Treatment with lyophilized hUSC-EX improved the activity and gene expression of 8 weeks injured ACL cells.

Conclusion

Lyophilized hUSC-EX preserve the characteristics of exosomes and can improve chronically injured (8 weeks) ACL cells. Lyophilized hUSC-EX could serve as effective and safe biomaterials that are ready to use at room temperature to enhance cell activity in patients with partial ACL tears and after remnant preservation ACL reconstruction.

Keywords

Chronic injured ACL cells
Anterior cruciate ligament
Human umbilical cord stem cells
Exosome
Lyophilization
Kaohsiung Medical University HospitalKMUH108-8M50 Regenerative Medicine and Cell Therapy Research 303 Center, Kaohsiung Medical University, TaiwanKMU-TC112A02 KMU-TC112A02 http://dx.doi.org/10.13039/100019756 Kaohsiung Municipal Siaogang Hospital H-109-007 the Ministry of Science and Technology, TaiwanNSTC 112-2314-B-037-100-MY2 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Anterior cruciate ligament (ACL) injury is the most common sports injury around the knee joint [1–3]. Partial tears in the ACL occur in 10–28% of all ACL injuries [4, 5]. Two major concerns for the treatment of partial ACL tears are the extent of preserved knee stability and the quality of the injured ACL tissue, as these factors play pivotal roles in determining whether patients should undergo conservative treatment or surgical reconstruction. Increased activity in chronically injured ACL cells is crucial for healing partial ACL tears and improving remnant tissue during ACL reconstruction. ACL reconstruction with autografts or allografts is recommended for individuals who have experienced a complete tear of the ACL, especially when there is concomitant injury to other knee ligaments or when conservative treatment has proven unsuccessful. After undergoing ACL reconstruction, the implanted graft undergoes a graft maturation process that involves stages such as graft necrosis, revascularization, recellularization, and remodeling [6, 7]. If the implanted graft does not mature promptly, it may sustain microtears, leading to retear or graft loosening. Several remnant preservation techniques have been proposed to enhance graft maturation after ACL reconstruction [8–10]. However, the quality and healing capability of injured ACL tissue, particularly during chronic injury, remain questionable. [11]

Biologics such as growth factors, PRP, stem cell, and bio-scaffolds, have been proposed to enhance the regeneration of injured ACL cells in partial tears and after remnant preservation ACL reconstruction [12]. Exosomes, ranging in size from 50 to 200 nm, contain mRNAs, proteins and lipids and are secreted for intercellular communication [13, 14]. Exosome treatment, as a “cell-free” therapy, offers advantages such as avoiding the risk of uncontrolled differentiation or reaction of implanted cells, the ability to target specific tissues, a higher safety profile, and lower immunogenicity [15]. Recently, stem cell derived exosome treatment has been applied to enhance the activity of injured tendon/ligament tissue [16–18].

Among the various types of exosomes derived from various cell sources, human umbilical cord stem cell-derived exosomes (hUSC-EX) have gained popularity in recent years [19, 20]. Umbilical cord stem cells possess high proliferation and differentiation capabilities, as well as the ability to prevent immune rejection, and involve less ethical and moral controversy [21–23]. The anti-inflammatory effects of hUSC-EX have been demonstrated in osteoarthritic chondrocytes, and the ability of these cells to enhance the healing of injured tendons/ligaments has also been demonstrated [19, 20, 24]. However, storing exosomes for clinical applications can be challenging, and an effective preservation method is crucial for allowing exosomes to be stored at room temperature while maintaining their biological capabilities and readiness to use. Presently, the suggested techniques for exosome storage primarily involve cryopreservation, spray drying, and freeze drying (lyophilization) [25]. Lyophilized exosomes undergo dehydration and drying under low temperature and vacuum conditions, enabling storage and handling at room temperature while preserving their original activity [25, 26]. In recent years, the lyophilized exosomes have presented their potential clinical relevance to enhance tendon and ligament healing process in animal studies [27–29].

In this study, we hypothesized that after hydration, lyophilized hUSC-EX could maintain the biological characteristics of exosomes and enhance the cell activity of chronically injured ACL cells, subsequently improving the regeneration capability of ACL cells.

Materials and methods

Harvesting of injured ACL tissue and cell culture

In this study, we aimed to investigate the effect of hUSC-EX treatment on chronically injured ACL cells. The injured ACL tissues were harvested from skeletally mature New Zealand male rabbits (n = 6) weighing 2.5–3.0 kg 8 weeks after ACL resection. The whole process was approved by the IACUC (KMU No.110233).

In brief, the rabbits were anesthetized via intramuscular injections of 40 mg/kg ketamine and 10 mg/kg xylocaine and maintained under gaseous anaesthesia with isoflurane (2%)/O2 [30, 31]. After the knee joint was exposed via a medial parapatellar approach, the ACL was detached from the femoral insertion [11]. The subcutaneous layer and skin were closed with Nylon 4 − 0 suture. After the operation, these rabbits were kept in the cage without activity restriction. The injured ACL tissues were harvested 8 weeks after the initial surgery under anaesthesia. Subsequently, the ACL tissues were digested overnight using 5 mg/ml type I collagenase (Sigma-Aldrich, St. Louis, MO, USA) in low glucose Dulbecco’s modified Eagle’s medium (DMEM) (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) in a 5% CO2 incubator at 37 °C and sub-cultured to obtain injured ACL cells [32, 33]. Passage three injured ACL cells were used for subsequent experiments.

Preparation and lyophilization exosomes derived from umbilical stem cells

In the present study, the applied exosomes were derived from the culture medium of human umbilical stem cells. Human umbilical cord harvest, stem cell culture, exosome isolation, and lyophilization were conducted by “Precision Biotech Taiwan Corp” (product no. 1110817001).

Harvest of human umbilical cords stem cells (hUSC)

Human umbilical cords were obtained from healthy mothers with full-term fetuses at Tri-Service General Hospital, Taiwan, with all donors providing informed consent before delivery. This study was approved by the Ethics Committee of Tri-Service General Hospital (approval no. A202205014). The method used for hUSC isolation and qualification were described in previous papers [34, 35].

Prepare the lyophilized hUSC exosomes (hUSC-EX)

The hUSC-EX were obtained as described previously, with modifications [36]. Briefly, we cultured hUSCs in conditioned medium (Dulbecco’s modified Eagle medium (DMEM) containing nutrient mixture F-12 (F-12; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific), 1% P/S, and 10 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Cranbury, NJ, USA)) [36], seeded them in a Nunc™ Cell Factory™ System (Thermo Fisher) at a density of 3000 cells/cm2, and incubated at 37 °C with humidified 5% CO2. When the cells reached 90% confluence, the culture suspension was collected for exosome isolation by serial centrifugation. The culture suspension was transferred to conical tubes for centrifugation at 300 ×g for 10 min at 4 °C to obtain the pellet. The supernatant was centrifuged at 2,000 ×g for 10 min at 4 °C for the second time to remove cell debris, followed by centrifugation at 10,000 ×g for 30 min at 4 °C for the third time to remove apoptotic bodies and other organelles. Finally, the supernatant was centrifuged at 120,000 ×g for 90 min at 4 °C to obtain the exosome pellet.

The pellet was then resuspended in PBS and centrifuged again at 120,000 ×g for 90 min at 4 °C for lyophilization preparation [26]. The lyophilization process was carried out as follows: the exosomes were prepared in distilled water and then frozen at -50 °C to allow for the conversion to ice. Subsequently, over a period of 3 days, the pressure was reduced, and heat was applied to prevent sublimation of the frozen water in the material, resulting in a dry, structurally intact powder product. The final products were aseptically aliquoted into bottles and stored at 2 °C ∼ 30 °C (Fig. 1).

Fig. 1 The hUSC-EX was lyophilized and aseptically stored in the bottle. hUSC-EX: human umbilical cord stem cells derived exosome

Qualification of the lyophilized hUSC-EX

The hUSC-EX powder was resuspended in PBS and subsequently quantified for size distribution and exosome markers.

Size distributions

Particle size measurements and data analysis were performed with a particle analyzer (qNano platform, iZON® Science) and Control Suite software v2.2 (iZON® Science), respectively, according to the manufacturer’s protocol.

Exosome markers

We investigated the presence of exosomes positive for the markers Alix, TSG101, CD9, CD63, and CD81 and negative for the marker α-Tubulin [37–40]. The primary antibodies used in this study included CD9 (cat#60232-1-1AP), CD63(cat# 25682-1-AP), CD81 (cat# 66866-1-AP), Alix (cat# 12422-1-AP), TSG101 (cat #14497-1-AP), and α-Tubulin (cat# 66031-1-Ig) and all were obtained from Proteintech (Chicago, IL, USA). The labeled proteins were visualized using a ChemiDoc™ XRS imaging system (Bio-Rad, Hercules, Cal, USA). Western blotting was performed using a standard protocol.

In addition, we used the flow cytometry to examine the expression of specific exosomes markers. First, we labeled the hUSC-EX using magnetic beads PS Capture™ Exosome Flow Cytometry Kit (cat no: 297-79701, FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) according to the manufacturer’s instructions. In brief, we added 30 µL of Exosome Capture Beads to 100 µL of the exosome solution, and 1 µL of Exosome Binding Enhancer (100×) was added subsequently. The mixture was incubated at room temperature for 1 h, with vortexing every 20 min. Following the incubation, the exosome-bound beads were washed and resuspended in 300 µL of washing buffer. For immunofluorescence staining analysis, 3 µL of CD9, CD63, or CD81 antibodies (cat no: 60232-1-IG, 25682-1-AP, 66866-1-Ig, Proteintech, China) were added to the EV solution. The samples were incubated at room temperature for 1 h, with gentle stirring every 20 min. After incubation, the beads were washed and resuspended in 300 µL of washing buffer for flow cytometry analysis using a BD FACSLyric Biosciences instrument.

Investigation of the change in cell activities of 8 weeks injured ACL cells after hUSC-EX uptake

Confirming the hUSC-EX uptake and internalization by injured ACL cells

hUSC-EX were added to the 8 weeks injured ACL cells (1010 EVs particles/104 cells) in culture medium for 6 h. The treated cells were washed with PBS and fixed in 4% paraformaldehyde for 10 min. After washing with PBS twice, 100 µL of 1X Phalloidin conjugate working solution (cat# ab176753; Abcam Cambridge, MA, USA) was added to stain the cytoskeleton of the treated cells. The cell slides were mounted, counterstained with Hoechst 33,342 (Sigma-Aldrich, St. Louis, MO) and observed via confocal microscopy (Olympus IX-81-FV100, Olympus, Tokyo, Japan).

Changes in cell activity (viability, proliferation, migration, and gene expression) after 8 weeks of injury in ACL cells after hUSC-EX uptake

Cell viability

The cell viability of 8 weeks injured ACL cells was assessed in two groups: those treated with hUSC-EX (n = 6) and those not treated with exosomes (control group; n = 6). The evaluation was performed using the Cell Counting Kit-8 (CCK-8) (Cat. No. KTA1020, Abbkine) according to the manufacturer’s instructions [32]. Cells were cultured in 96-well plates at a density of 5 × 103 cells/well containing 100 µL medium (low-glucose DMEM supplemented with 10% FBS and 1% penicillin/streptomycin) at 37 °C with 5% CO2 overnight. The next day, hUSC-EX 1010 particles per 104 cells were added, and the final total volume of each well was 180 µL. After hUSC-EX treatment for 24 h, 20 µl CCK8 was added into each well and incubated 2 h. Absorbance was measured at 450 nm using a Bio-Rad Microplate Manager Benchmark Plus Reader (Bio-Rad Laboratories, Hercules, CA, USA).

Cell proliferation: EdU, Ki67 gene expression

The cell proliferation rate was measured with a Click-iT EdU (cell proliferation) assay kit (Thermo Fisher Scientific, Waltham, MA, USA) and the expression of the Ki67 gene, was assessed following the manufacturer’s instructions. Plate 2 × 104 cells/well cells in 12-well plates incubate overnight. Subsequently, added hUSC-EX (1010 particles per 104 cells) and 2 µl of 10mM EdU stock solution in 2 mL of prewarmed culture medium to make a 10 µM EdU labeling solution incubated at 37 °C with 5% CO2. After hUSC-EX treatments for 24 h, 1 mL of 4% formaldehyde in PBS was added to each well and fixed for 15 min at room temperature. Removed formaldehyde and wash twice with 1 mL of 3% BSA in PBS. Removed wash solution and added 1 mL of 0.5% Triton® X-100 in PBS to each well incubated for 20 min at room temperature. Washed twice with 1 mL of 3% BSA in PBS and then added 0.5 mL of Click-iT® reaction cocktail to each well. The plate was incubated and protected from light for 30 min at room temperature. Each well was washed once with 1 mL of 3% BSA in PBS, and added 1 mL of 1X Hoechst® 33,342 solution per well incubate for 30 min at room temperature. After washing each well twice with 1 mL of PBS, the cell slides were mounted and counterstained with Hoechst 33,342 (Sigma-Aldrich, St. Louis, MO, USA). The cell proliferation rate was calculated for five randomized areas per sample using ImageJ (64-bit Java v. 1.6.0_24; National Institutes of Health (NIH), Bethesda, Maryland, USA). The expression of the Ki67 gene was calculated and is described in the RT-PCR section.

Transwell migration

The transwell migration assay was performed in a 6.5-mm Transwell™ chamber with an 8-µm pore diameter (Millipore EMD, Billerica, MA, USA). Cells treated with hUSC-EX (1010 particles per 104 cells) and those without exosomes treatment were cultured at a density of 5 × 104 cells with serum-free medium in tube for 1 h at 37 °C with 5% CO2 incubator. After 1 h culture, cells were seeded in the upper chamber compartment for the migration assay. DMEM supplemented with 10% (v/v) FBS was added to the lower chamber as a chemoattractant. After incubating at 37 °C for 24 h, the cells were migrated to the lower membrane. The migrated cells were fixed with 4% formaldehyde in PBS for 15 min, and washed twice with PBS. Then, the methanol was added and incubated 10 minutes to increase cell permeability, followed by staining with 0.1% crystal violet for 30 min. The migrated cells were counted under a microscope. The relative migration rate was calculated as the ratio of the migration of each treatment group to that of the control group (% of the control).

Scratch assay

The 8 weeks injured ACLs were seeded at a density of 106 cells at 6 well plates in 2% FBS culture medium incubated at 37 °C with 5% CO2 overnight. The next day, when the cells reached > 90% confluence, the plate was scratched with a sterile 200-µL pipette tip to draw a line in the middle and removed the medium, and replaced it with a 10% FBS culture medium with or without hUSC-EX (1010 particles per 104 cells). Cell migration status was observed under a microscope (Leica DMI6000B; Leica Microsystems, Germany) by closing the scratch gap at regular intervals (6 hr, 12 h, 18 h, and 24 h). The relative changes in the cell migration rate were calculated with ImageJ (64-bit Java v. 1.6.0_24; National Institutes of Health (NIH), Bethesda, Maryland, USA).

Changes in immunofluorescence and gene expression were evaluated for the following: Collagen I and III, VEGF, TGFΒ, tenogenic markers in 8 weeks injured ACL cells after hUSC-EX uptake

We assessed the metabolic activity of injured ACL cells after hUSC-EX uptake by quantitatively measuring immunofluorescence and RT-PCR for Collagen Type I and III, TGFβ, VEGF and tenogenic markers (Tenascin C (TNC), and Tenomodulin (TNMD)).

Immunofluorescence

The 8 weeks injured ACL cells were seeded at a density of 2 × 104 cells at 16 mm coverslip and placed into 12 well plates incubated at 37 °C with 5% CO2 overnight. The next day, the study group was treated with hUSC-EX (1010 particles per 104 cells). After 24 h of treatment, the cells were washed twice with PBS and fixed in 4% paraformaldehyde for 20 min, permeabilized with 0.5% Triton X-100 in PBS for 10 min and blocked with 5% bovine serum albumin (BSA) in PBS for 1 h. These cells were assessed for Collagen types I and III, TGFβ, and VEGF expression. These cells were stained with primary antibodies against Collagen types I (1:1000, cat#ARG21965 ) and Collagen types III (1:1000, cat#ARG20786), TGF-β (1:1000, cat#ARG10002 ), and VEGF (1:1000, cat#ARG10513) (all from Arigo Biolaboratories, Hsinchu, Taiwan) overnight at 4°C, and then stained with the following fluorescent secondary antibodies: donkey anti-goat IgG (H + L)-FAM (Leadgene Biomedical, Tainan, Taiwan; 1:250) for Collagen types I and III and CoraLite594 – conjugated Donkey Anti-Mouse IgG(H + L), (cat# SA00013-7,Proteintech, Chicago, IL, USA 1:250) for TGFβ and VEGF for 1 h and rinsed twice with PBS [32]. The slides were counterstained with DAPI (Thermo Fisher Scientific), mounted, and observed under a confocal microscope (Olympus IX-81- FV100; Olympus, Japan ).

RNA isolation and real-time polymerase chain reaction

The 8 weeks injured ACL cells were cultured in 10 cm plates at a density of 5 × 105 cells containing 10mL medium (low-glucose DMEM supplemented with 10% FBS and 1% penicillin/streptomycin) incubated at 37°C with 5% CO2 overnight. The next day, the study group was treated with hUSC-EX (1010 particles per 104 cells). After 24 hr treatment, total RNA from the ACL cells treated with hUSC-EX (n = 6) and those without exosomes (n = 6) was extracted using RNAzol reagent (Cat. No. RN-190; Molecular Research Center, USA), and 2 µg of total RNA was reverse-transcribed using the Maxima First Strand cDNA Synthesis Kit (Cat. No. K1642, Thermo Fisher Scientific) according to the manufacturer’s instructions and described by Lu [41]. Real-time polymerase chain reaction (PCR) was carried out using SYBR Green PCR Master Mix (Cat. A25780, Thermo Fisher Scientific). The complementary DNA samples were amplified using primers according to Lu’s study on ACL cells [32]. The primer sequences in this study are shown following: Collagen I, forward (5’-TTCTG CAGGGCTCCAATGA-3’) and reverse (5’-TCGACAAGAACAGTGTAAGTGAAC CT-3’); Collagen III, forward (5’- CCTGAAGCCCCAGCAGAA − 3’) and reverse (5’-AACAGAAATTTAGTTGGTCACTTGTACTG-3’); TGF-β, forward (5’- CAGTGG AAAGACCCCACATCTC-3’) and reverse (5’- GACGCAGGCAGCAATTATCC-3’); VEGF, forward (5’- ATCATGCGGATCAAACCTCA-3’) and reverse (5’- CAAGGC CCACAGGGATTTTC-3’); TNC, forward (5’- CAGAAGCCTTGGCCATGTG-3’) and reverse (5’- GCACTCTCTCCCCTGTGTAGGA − 3’); TNMD, forward (5’-GATC CCATGCTGGATGAG-3’) and reverse (5’-TACAAGGCATGATGACACG-3’); Ki67, forward (5’- ACACCGCTCAAAAGAGGAGA − 3’) and reverse (5’- ATCATTCGCA ACTGGAGGAC − 3’). The cycling procedure was as follows: 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 30 s. Threshold cycles (Ct) for each gene tested were normalized to the housekeeping gene GAPDH value (ΔCt), and every experimental sample was referred as its control (ΔΔCt). The experimental data of the hUSC-EX treated ACL cells are expressed as fold-changes (2 − ΔΔCt) compared to those of the non-exosome treated ACL cells, which were set as 1.

Statistical analysis

The differences between hUSC-EX treated ACL cells and non-exosome treated cells were analyzed using the t-test. All data were presented as mean ± standard deviation (SD) with triple measurements. Statistical significance was set at p < 0.05. All statistical analyses were performed using SPSS software version 20 (IBM, USA).

Results

Quantification of exosomes derived from human umbilical cord stem cells (hUSC-EX)

The average size of hUSC-EX was 84.5 ± 70.6 nm with a concentration of 2.4 × 1011 particles/mL. Among these particles, 91.45% were < 200 nm. The hUSC-EX tested positive for the Alix, TSG101, CD9, CD63, and CD81 proteins, but negative for the α-Tubulin protein (Fig. 2). The results revealed that hydrated hUSC-EX met the MISEV 2014 and 2018 criteria [38–40]. For the specific markers expression, the flow cytometry results showed that CD9 + hUSC-EXs comprised 44.12% with an average size of 106.6 nm, CD63 + 50.00% with an average size of 98.9 nm, and CD81 + 43.24% with an average size of 93.4 nm.

Fig. 2 The size distribution, exosome markers west blotting and flow cytometry of hUSC-EX. (A) hUSC-EX size distribution; (B) hUSC-EX markers western blotting; (C) hUSC-EX markers flow cytomerty. hUSC-EX: human umbilical cord stem cells derived exosome

hUSC-EX was uptaken by the injured ACL cells

After 6 h of hUSC-EX exposure, the IFC image showed that the delivered hUSC-EX (stained in red) was uptaken and internalized by the 8 weeks injured ACL cells (Fig. 3).

Fig. 3 After 6 h of cell exposure to the hUSC-EX, the immunofluorescence images showed hUSC-EX was uptaken and internalized by the injured ACL cells. ACL: anterior cruciate ligament; hUSC-EX: human umbilical cord stem cells derived exosome

The 8 weeks injured ACL cells with increased viability, proliferation, and migration capability after hUSC-EX treatment

After 24 h of hUSC-EX treatment, the cell viability (Fig. 4A), the expression of EdU and Ki67 gene (Fig. 4B), migration capability (transwell (Fig. 5A) and scratch migration (Fig. 5B)) was significantly higher in the hUSC-EX treated injured ACL cells compared to that of non-exosome treated group.

Fig. 4 The cell viability and proliferation difference between the non-exosome treated 8 weeks injured ACL cells (control) and hUSC-EX treated cells after 24 h treatment. (A) Cell viability (MTT); (B) Cell proliferation (EdU, Ki67 gene expression). hUSC-EX: human umbilical cord stem cells derived exosome

Fig. 5 The migration capability difference between the non-exosome treated 8 weeks injured ACL cells (control) and hUSC-EX treated cells. (A) Transwell migration assay (after hUSC-EX treatment 24 h); (B) Scratch migration assay (after hUSC-EX treatment 6 h, 12 h, 18 h, 24 h). hUSC-EX: human umbilical cord stem cells derived exosome

The hUSC-EX treatment significantly improved the gene expression of collagen synthesis, TGFΒ, VEGF and tenogenesis in 8 weeks injured ACL cells

Moreover, compared with those in non-exosome treated cells, the gene expression of Collagen synthesis, TGF-β, VEGF (Fig. 6), and tenogenic markers (TNC, TNMD) (Fig. 7) of 8 weeks injured ACL cells were significantly improved after 24 h of hUSC-EX treatment.

Fig. 6 The expression of Collagen synthesis, TGFβ, and VEGF gene difference between the non-exosome treated 8 weeks injured ACL cells (control) and hUSC-EX treated cells after 24 h treatment. hUSC-EX: human umbilical cord stem cells derived exosome

Fig. 7 The expression of tenogenic markers (TNC & TNMD) gene difference between the non-exosome treated 8 weeks injured ACL cells (control) and hUSC-EX treated cells after 24 h treatment. hUSC-EX: human umbilical cord stem cells derived exosome

Discussion

Enhancing the activity of injured ACL cells is important for healing of partially injured ACL and remnant-preserving ACL reconstruction. In this study, we examined the effect of lyophilized hUSC-EX on chronically injured ACL cells. The average size of the hUSC-EX was 85.2 nm, and the cells tested positive for the Alix, TSG101, CD9, CD63, CD81 protein, but negative for the α-Tubulin protein. These results met the MISEV 2014 and 2018 criteria for hUSC-EX quality. After 24 h of hUSC-EX treatment, compared with non-exosome treated injured cells, 8 weeks injured ACL cells exhibited significantly improvements in cell viability, proliferation, migration capability and gene expression of collagen synthesis, TGFβ, VEGF and tenogenesis.

Stem cell derived exosomes have been proposed for the treatment of tendon/ligament injuries [17, 18, 42]. Wang et al. [17]. used adipose stem cell (ASC) derived exosomes to treat chronic rotator cuff tears in rabbits. They found that the exosome treated group exhibited decreased fatty infiltration, higher histological scores, increased newly regenerated fibrocartilage, and improved mechanical properties. Lyu et al. [42]. conducted a review on the use of ASC-derived exosomes for treating tendon injuries. Their conclusion highlighted that ASC-derived exosomes promote tendon healing by reducing inflammatory responses, stimulating the proliferation and migration of tenocytes, promoting angiogenesis, and boosting collagen synthesis. Yu et al. [18]. used bone marrow mesenchymal stem cell-derived exosomes to treat rat patellar tendon defects. The exosome-treated group exhibited increased histological scores, enhanced expression of collagen type I, mohawk, tenomodulin, and heightened proliferation of local tendon stem/progenitor cells in vivo. In our study, we observed that treatment with human umbilical cord stem cell derived exosomes (hUSC-EX) enhanced the cell viability, proliferation, migration capability and gene expression of collagen synthesis, TGFβ, VEGF, and tenogenesis in chronically injured ACL cells.

Exosomes from various sources exhibit distinct advantages and disadvantages [43–45]. While human umbilical cord mesenchymal stem cells may not be easily accessible, their advantages include a painless and noninvasive collection procedure, as well as a rapid self–renewal ability [22, 23]. Recently, exosomes derived from hUSC have increased in popularity for treating tendon/ligament injury [19, 20]. Han et al. [19]. found that hUSC derived exosomes enhance the proliferation and migration capability of injured Achilles tendon cells in vitro and improve biomechanical properties. They also confirmed that this effect was mediated through the miR-27b-3p/ ARHGAP5/RhoA signaling pathway. In a study by Yao et al. [20]. , hUSC-derived exosomes were shown to enhance tendon-specific matrix components, improve biomechanical strength, and positively impact histological structure in a rat Achilles tendon injury model. These effects were attributed to the potential PTEN/mTOR/TGF-β1 pathway through the delivery of miR-29a-3p. Zhang et al. [46]. found that hUSC exosomes could modulate macrophage polarization from M1 to M2 through the NF-κB signaling pathway, thereby improving the local inflammatory microenvironment. Taken together, our findings and those of others suggest that treatment with hUSC-derived exosomes could effectively enhance the activity of injured tendon/ligament cells in vitro, suggesting the potential to improve the healing of injured tissue in vivo.

The storage of exosomes is a major concern for clinical application. Ideally, the storage method should preserve the biological activities of exosomes, maintain structural stability, be convenient for transportation, be easily readable, and be clinically user-friendly. The suggested technique for exosome storage primarily involves cryopreservation, spray-drying and freeze-drying (lyophilization) [25]. The cryopreservation method results in the formation of “frostbite”, leading to the production of ice crystals inside the particles that can affect membrane stability. Storage at -80 °C over time may alter the morphology and biological activity of the exosomes [47, 48]. Moreover, it is necessary to add antifreeze after cryopreservation to extend the storage life of exosomes [49, 50]. During the spray-drying technique, the atomization pressure and heating temperature also affect the stability of exosomes [50]. The lyophilization process involves complete dehydration and drying of the exosomes under low-temperature and vacuum conditions, minimizing damage to biological structures [25, 26]. Additionally, lyophilized exosomes can be stored and maintained at room temperature and can be easily reconstituted by adding water [26].

The lyophilized exosomes have shown its potential clinical application in healing of injured tendons/ligaments recently. Zhao et al. developed a novel purified exosome product (PEP) derived from plasma with formulated and stored in a stabilized lyophilized powder form in a vial, allowing room temperature storage. They demonstrated that the PEP could enhance tenocyte’s proliferation, tendon-related gene expression, total collagen deposition and attenuated apoptosis [28]. Furthermore, the PEP improved the healing of repaired flexor tendon in an ex vivo model, [27] and the rotator cuff tendon-bone healing in rat animal model [29].

In this study, we stored and rehydrated lyophilized hUSC-EX at room temperature. The method preserved the size and expression of biological markers in exosomes and demonstrated the ability of the exosomes to effectively enhance the activity of injured ACL cells. The easy storage feature and effective anabolic effect after rehydration of lyophilized exosomes provide the possibility of an “off-the-shelf” product that shows possible advantage over current market orthobiologic products such as Platelet Rich Plasma (PRP) for treating ligament injuries. For the biologics augmentation in ACL injury, further preclinical in vitro and animal studies was needed to clarify and compare the different effects between PRP, fresh exosomes and lyophilized exosomes.

This study has several limitations. First, further investigations are needed to determine the optimal exosome dose and the possible mechanisms for enhancing injured ACL cells. Second, there was no comparison of the effects between freshly isolated exosomes and lyophilized exosomes on injured ACL cells. Third, we only investigated the exosome treatment on 8-weeks injured ACL cells; the exosome enhancing effect to injured ACL cells more than 8 weeks is unknown. Finally, an animal study is needed to confirm the effectiveness of lyophilized hUSC-EX for the treatment of partial tear ACL and remnant-preservation ACL reconstruction.

Conclusion

The study results indicated that the lyophilized hUSC-EX preserves the characteristics of exosomes and can improve chronically injured (8-week) ACL cells. Lyophilized hUSC-EX could serve as an effective and safe biomaterials that is ready to use at room temperature to enhance cell activity in patients with partial ACL tears and after remnant preservation ACL reconstruction.

Acknowledgements

We acknowledge the “Precision Biotech Taiwan Corp.” to sponsor the EV product in this study.

Author contributions

HLL and SYL contributed to writing the manuscript, CJH contributed to the design of experiment and concept of study. YMK contributed to the experiment and data analysis, CCL was the main design of experiment and concept, and contributed to manuscript writing and revising. All authors read and approved the final manuscript.

Funding

This study was supported by grants from Kaohsiung Medical University Hospital (KMUH108-8M50), Kaohsiung Municipal Siaogang Hospital (H-111-01&112-02), the Ministry of Science and Technology, Taiwan (NSTC 112-2314-B-037-100-MY2), and Regenerative Medicine and Cell Therapy Research 303 Center, Kaohsiung Medical University, Taiwan (KMU-TC113A02).

Data availability

All data generated or analysed during this study are included in this published article. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethical approval

The animal use protocol listed below has been reviewed and approved by the Institutional Animal Care and Use Committee (IACUC No.110232). The studied exosomes were purified from the culture medium of human umbilical cord stem cells (IRB approval No. A202205014),

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Bradley JP Klimkiewicz JJ Rytel MJ Powell JW Anterior cruciate ligament injuries in the National Football League: epidemiology and current treatment trends among team physicians Arthroscopy: J Arthroscopic Relat Surg : Official Publication Arthrosc Association North Am Int Arthrosc Association 2002 18 5 502 9 10.1053/jars.2002.30649
Bradley JP, Klimkiewicz JJ, Rytel MJ, Powell JW. Anterior cruciate ligament injuries in the National Football League: epidemiology and current treatment trends among team physicians. Arthroscopy: J Arthroscopic Relat Surg : Official Publication Arthrosc Association North Am Int Arthrosc Association. 2002;18(5):502–9.10.1053/jars.2002.30649
2. Gianotti SM Marshall SW Hume PA Bunt L Incidence of anterior cruciate ligament injury and other knee ligament injuries: a national population-based study J Sci Med Sport 2009 12 6 622 7 10.1016/j.jsams.2008.07.005 18835221
Gianotti SM, Marshall SW, Hume PA, Bunt L. Incidence of anterior cruciate ligament injury and other knee ligament injuries: a national population-based study. J Sci Med Sport. 2009;12(6):622–7.18835221 10.1016/j.jsams.2008.07.005
3. Sanders TL Maradit Kremers H Bryan AJ Larson DR Dahm DL Levy BA Incidence of anterior cruciate ligament tears and Reconstruction: a 21-Year Population-based study Am J Sports Med 2016 44 6 1502 7 10.1177/0363546516629944 26920430
Sanders TL, Maradit Kremers H, Bryan AJ, Larson DR, Dahm DL, Levy BA, et al. Incidence of anterior cruciate ligament tears and Reconstruction: a 21-Year Population-based study. Am J Sports Med. 2016;44(6):1502–7.26920430 10.1177/0363546516629944
4. Sonnery-Cottet B Colombet P Partial tears of the anterior cruciate ligament Orthop Traumatol Surg Research: OTSR 2016 102 1 Suppl S59 67 10.1016/j.otsr.2015.06.032 26797008
Sonnery-Cottet B, Colombet P. Partial tears of the anterior cruciate ligament. Orthop Traumatol Surg Research: OTSR. 2016;102(1 Suppl):S59–67.26797008 10.1016/j.otsr.2015.06.032
5. Temponi EF de Carvalho Júnior LH Sonnery-Cottet B Chambat P Partial tearing of the anterior cruciate ligament: diagnosis and treatment Revista Brasileira De Ortop 2015 50 1 9 15 10.1016/j.rbo.2014.04.009
Temponi EF, de Carvalho Júnior LH, Sonnery-Cottet B, Chambat P. Partial tearing of the anterior cruciate ligament: diagnosis and treatment. Revista Brasileira De Ortop. 2015;50(1):9–15.10.1016/j.rbo.2014.04.009
6. Janssen RP van der Wijk J Fiedler A Schmidt T Sala HA Scheffler SU Remodelling of human hamstring autografts after anterior cruciate ligament reconstruction. Knee surgery, sports traumatology, arthroscopy: official J ESSKA 2011 19 8 1299 306
Janssen RP, van der Wijk J, Fiedler A, Schmidt T, Sala HA, Scheffler SU. Remodelling of human hamstring autografts after anterior cruciate ligament reconstruction. Knee surgery, sports traumatology, arthroscopy: official. J ESSKA. 2011;19(8):1299–306.
7. Janssen RP Scheffler SU Intra-articular remodelling of hamstring tendon grafts after anterior cruciate ligament reconstruction. Knee surgery, sports traumatology, arthroscopy Official J ESSKA 2014 22 9 2102 8
Janssen RP, Scheffler SU. Intra-articular remodelling of hamstring tendon grafts after anterior cruciate ligament reconstruction. Knee surgery, sports traumatology, arthroscopy. Official J ESSKA. 2014;22(9):2102–8.
8. Matsumoto T Kubo S Sasaki K Kawakami Y Oka S Sasaki H Acceleration of tendon-bone healing of anterior cruciate ligament graft using autologous ruptured tissue Am J Sports Med 2012 40 6 1296 302 10.1177/0363546512439026 22427618
Matsumoto T, Kubo S, Sasaki K, Kawakami Y, Oka S, Sasaki H, et al. Acceleration of tendon-bone healing of anterior cruciate ligament graft using autologous ruptured tissue. Am J Sports Med. 2012;40(6):1296–302.22427618 10.1177/0363546512439026
9. Hong L Li X Zhang H Liu X Zhang J Shen JW Anterior cruciate ligament reconstruction with remnant preservation: a prospective, randomized controlled study Am J Sports Med 2012 40 12 2747 55 10.1177/0363546512461481 23075805
Hong L, Li X, Zhang H, Liu X, Zhang J, Shen JW, et al. Anterior cruciate ligament reconstruction with remnant preservation: a prospective, randomized controlled study. Am J Sports Med. 2012;40(12):2747–55.23075805 10.1177/0363546512461481
10. Hu J Qu J Xu D Zhang T Zhou J Lu H Clinical outcomes of remnant preserving augmentation in anterior cruciate ligament reconstruction: a systematic review. Knee surgery, sports traumatology, arthroscopy: official J ESSKA 2014 22 9 1976 85
Hu J, Qu J, Xu D, Zhang T, Zhou J, Lu H. Clinical outcomes of remnant preserving augmentation in anterior cruciate ligament reconstruction: a systematic review. Knee surgery, sports traumatology, arthroscopy: official. J ESSKA. 2014;22(9):1976–85.
11. Song GY Zhang J Li X Li Y Feng H Biomechanical and Biological findings between Acute Anterior Cruciate Ligament Reconstruction with and without an augmented remnant repair: a comparative in vivo animal study Arthroscopy: J Arthroscopic Relat Surg : Official Publication Arthrosc Association North Am Int Arthrosc Association 2016 32 2 307 19 10.1016/j.arthro.2015.08.011
Song GY, Zhang J, Li X, Li Y, Feng H. Biomechanical and Biological findings between Acute Anterior Cruciate Ligament Reconstruction with and without an augmented remnant repair: a comparative in vivo animal study. Arthroscopy: J Arthroscopic Relat Surg : Official Publication Arthrosc Association North Am Int Arthrosc Association. 2016;32(2):307–19.10.1016/j.arthro.2015.08.011
12. Dallo I Chahla J Mitchell JJ Pascual-Garrido C Feagin JA LaPrade RF Biologic approaches for the treatment of partial tears of the Anterior Cruciate Ligament: A Current concepts Review Orthop J Sports Med 2017 5 1 2325967116681724 10.1177/2325967116681724 28210653
Dallo I, Chahla J, Mitchell JJ, Pascual-Garrido C, Feagin JA, LaPrade RF. Biologic approaches for the treatment of partial tears of the Anterior Cruciate Ligament: A Current concepts Review. Orthop J Sports Med. 2017;5(1):2325967116681724.28210653 10.1177/2325967116681724
13. Fu Y Karbaat L Wu L Leijten J Both SK Karperien M Trophic effects of mesenchymal stem cells in tissue regeneration Tissue Eng Part B Rev 2017 23 6 515 28 10.1089/ten.teb.2016.0365 28490258
Fu Y, Karbaat L, Wu L, Leijten J, Both SK, Karperien M. Trophic effects of mesenchymal stem cells in tissue regeneration. Tissue Eng Part B Rev. 2017;23(6):515–28.28490258 10.1089/ten.teb.2016.0365
14. Phinney DG Pittenger MF Concise Review: MSC-Derived exosomes for cell-free therapy Stem Cells 2017 35 4 851 8 10.1002/stem.2575 28294454
Phinney DG, Pittenger MF. Concise Review: MSC-Derived exosomes for cell-free therapy. Stem Cells. 2017;35(4):851–8.28294454 10.1002/stem.2575
15. Lui PPY. Mesenchymal stem cell-derived extracellular vesicles for the Promotion of Tendon Repair - an update of literature. Stem Cell Rev Rep. 2020.
16. Wang C Song W Chen B Liu X He Y Exosomes isolated from adipose-derived stem cells: a New Cell-Free Approach to prevent the muscle degeneration Associated with Torn Rotator cuffs Am J Sports Med 2019 47 13 3247 55 10.1177/0363546519876323 31560856
Wang C, Song W, Chen B, Liu X, He Y. Exosomes isolated from adipose-derived stem cells: a New Cell-Free Approach to prevent the muscle degeneration Associated with Torn Rotator cuffs. Am J Sports Med. 2019;47(13):3247–55.31560856 10.1177/0363546519876323
17. Wang C Hu Q Song W Yu W He Y Adipose stem cell-derived exosomes decrease fatty infiltration and enhance Rotator Cuff Healing in a rabbit model of chronic tears Am J Sports Med 2020 48 6 1456 64 10.1177/0363546520908847 32272021
Wang C, Hu Q, Song W, Yu W, He Y. Adipose stem cell-derived exosomes decrease fatty infiltration and enhance Rotator Cuff Healing in a rabbit model of chronic tears. Am J Sports Med. 2020;48(6):1456–64.32272021 10.1177/0363546520908847
18. Yu H Cheng J Shi W Ren B Zhao F Shi Y Bone marrow mesenchymal stem cell-derived exosomes promote tendon regeneration by facilitating the proliferation and migration of endogenous tendon stem/progenitor cells Acta Biomater 2020 106 328 41 10.1016/j.actbio.2020.01.051 32027991
Yu H, Cheng J, Shi W, Ren B, Zhao F, Shi Y, et al. Bone marrow mesenchymal stem cell-derived exosomes promote tendon regeneration by facilitating the proliferation and migration of endogenous tendon stem/progenitor cells. Acta Biomater. 2020;106:328–41.32027991 10.1016/j.actbio.2020.01.051
19. Han Q Wang S Chen D Gan D Wang T Exosomes derived from human umbilical cord mesenchymal stem cells reduce tendon injuries via the miR-27b-3p/ARHGAP5/RhoA signaling pathway Acta Biochim Biophys Sin (Shanghai) 2022 54 2 232 42 10.3724/abbs.2021026 35130628
Han Q, Wang S, Chen D, Gan D, Wang T. Exosomes derived from human umbilical cord mesenchymal stem cells reduce tendon injuries via the miR-27b-3p/ARHGAP5/RhoA signaling pathway. Acta Biochim Biophys Sin (Shanghai). 2022;54(2):232–42.35130628 10.3724/abbs.2021026
20. Yao Z Li J Xiong H Cui H Ning J Wang S MicroRNA engineered umbilical cord stem cell-derived exosomes direct tendon regeneration by mTOR signaling J Nanobiotechnol 2021 19 1 169 10.1186/s12951-021-00906-4
Yao Z, Li J, Xiong H, Cui H, Ning J, Wang S, et al. MicroRNA engineered umbilical cord stem cell-derived exosomes direct tendon regeneration by mTOR signaling. J Nanobiotechnol. 2021;19(1):169.10.1186/s12951-021-00906-4
21. Hu Z Jiang Z Meng S Liu R Yang K Research Progress on the Osteogenesis-Related Regulatory mechanisms of Human umbilical cord mesenchymal stem cells Stem Cell Rev Rep 2023 19 5 1252 67 10.1007/s12015-023-10521-5 36917312
Hu Z, Jiang Z, Meng S, Liu R, Yang K. Research Progress on the Osteogenesis-Related Regulatory mechanisms of Human umbilical cord mesenchymal stem cells. Stem Cell Rev Rep. 2023;19(5):1252–67.36917312 10.1007/s12015-023-10521-5
22. Wang L Tran I Seshareddy K Weiss ML Detamore MS A comparison of human bone marrow-derived mesenchymal stem cells and human umbilical cord-derived mesenchymal stromal cells for cartilage tissue engineering Tissue Eng Part A 2009 15 8 2259 66 10.1089/ten.tea.2008.0393 19260778
Wang L, Tran I, Seshareddy K, Weiss ML, Detamore MS. A comparison of human bone marrow-derived mesenchymal stem cells and human umbilical cord-derived mesenchymal stromal cells for cartilage tissue engineering. Tissue Eng Part A. 2009;15(8):2259–66.19260778 10.1089/ten.tea.2008.0393
23. Ding DC Chang YH Shyu WC Lin SZ Human umbilical cord mesenchymal stem cells: a new era for stem cell therapy Cell Transplant 2015 24 3 339 47 10.3727/096368915X686841 25622293
Ding DC, Chang YH, Shyu WC, Lin SZ. Human umbilical cord mesenchymal stem cells: a new era for stem cell therapy. Cell Transplant. 2015;24(3):339–47.25622293 10.3727/096368915X686841
24. Wang S Jiang W Lv S Sun Z Si L Hu J Human umbilical cord mesenchymal stem cells-derived exosomes exert anti-inflammatory effects on osteoarthritis chondrocytes Aging 2023 15 18 9544 60 10.18632/aging.205034 37724890
Wang S, Jiang W, Lv S, Sun Z, Si L, Hu J, et al. Human umbilical cord mesenchymal stem cells-derived exosomes exert anti-inflammatory effects on osteoarthritis chondrocytes. Aging. 2023;15(18):9544–60.37724890 10.18632/aging.205034
25. Zhang Y Bi J Huang J Tang Y Du S Li P Exosome A review of its classification, isolation techniques, Storage, Diagnostic and targeted therapy applications Int J Nanomed 2020 15 6917 34 10.2147/IJN.S264498
Zhang Y, Bi J, Huang J, Tang Y, Du S, Li P, Exosome. A review of its classification, isolation techniques, Storage, Diagnostic and targeted therapy applications. Int J Nanomed. 2020;15:6917–34.10.2147/IJN.S264498
26. Charoenviriyakul C Takahashi Y Nishikawa M Takakura Y Preservation of exosomes at room temperature using lyophilization Int J Pharm 2018 553 1–2 1 7 10.1016/j.ijpharm.2018.10.032 30316791
Charoenviriyakul C, Takahashi Y, Nishikawa M, Takakura Y. Preservation of exosomes at room temperature using lyophilization. Int J Pharm. 2018;553(1–2):1–7.30316791 10.1016/j.ijpharm.2018.10.032
27. Shi G Wang Y Wang Z Thoreson AR Jacobson DS Amadio PC A novel engineered purified exosome product patch for tendon healing: an explant in an ex vivo model J Orthop Research: Official Publication Orthop Res Soc 2021 39 8 1825 37 10.1002/jor.24859
Shi G, Wang Y, Wang Z, Thoreson AR, Jacobson DS, Amadio PC, et al. A novel engineered purified exosome product patch for tendon healing: an explant in an ex vivo model. J Orthop Research: Official Publication Orthop Res Soc. 2021;39(8):1825–37.10.1002/jor.24859
28. Qi J Liu Q Reisdorf RL Boroumand S Behfar A Moran SL Characterization of a purified exosome product and its effects on canine flexor tenocyte biology J Orthop Research: Official Publication Orthop Res Soc 2020 38 8 1845 55 10.1002/jor.24587
Qi J, Liu Q, Reisdorf RL, Boroumand S, Behfar A, Moran SL, et al. Characterization of a purified exosome product and its effects on canine flexor tenocyte biology. J Orthop Research: Official Publication Orthop Res Soc. 2020;38(8):1845–55.10.1002/jor.24587
29. Ren Y Zhang S Wang Y Jacobson DS Reisdorf RL Kuroiwa T Effects of purified exosome product on rotator cuff tendon-bone healing in vitro and in vivo Biomaterials 2021 276 121019 10.1016/j.biomaterials.2021.121019 34325337
Ren Y, Zhang S, Wang Y, Jacobson DS, Reisdorf RL, Kuroiwa T, et al. Effects of purified exosome product on rotator cuff tendon-bone healing in vitro and in vivo. Biomaterials. 2021;276:121019.34325337 10.1016/j.biomaterials.2021.121019
30. Teng FY Tai IC Ho ML Wang JW Weng LW Wang YJ Controlled release of BMP-2 from titanium with electrodeposition modification enhancing critical size bone formation Mater Sci Eng C Mater Biol Appl 2019 105 109879 10.1016/j.msec.2019.109879 31546456
Teng FY, Tai IC, Ho ML, Wang JW, Weng LW, Wang YJ, et al. Controlled release of BMP-2 from titanium with electrodeposition modification enhancing critical size bone formation. Mater Sci Eng C Mater Biol Appl. 2019;105:109879.31546456 10.1016/j.msec.2019.109879
31. Wu SC Chen CH Wang JY Lin YS Chang JK Ho ML Hyaluronan size alters chondrogenesis of adipose-derived stem cells via the CD44/ERK/SOX-9 pathway Acta Biomater 2018 66 224 37 10.1016/j.actbio.2017.11.025 29128538
Wu SC, Chen CH, Wang JY, Lin YS, Chang JK, Ho ML. Hyaluronan size alters chondrogenesis of adipose-derived stem cells via the CD44/ERK/SOX-9 pathway. Acta Biomater. 2018;66:224–37.29128538 10.1016/j.actbio.2017.11.025
32. Lu CC Chou SH Shen PC Chou PH Ho ML Tien YC Extracorporeal shock wave promotes activation of anterior cruciate ligament remnant cells and their paracrine regulation of bone marrow stromal cells’ proliferation, migration, collagen synthesis, and differentiation Bone Joint Res 2020 9 8 458 68 10.1302/2046-3758.98.BJR-2019-0365.R1 32832074
Lu CC, Chou SH, Shen PC, Chou PH, Ho ML, Tien YC. Extracorporeal shock wave promotes activation of anterior cruciate ligament remnant cells and their paracrine regulation of bone marrow stromal cells’ proliferation, migration, collagen synthesis, and differentiation. Bone Joint Res. 2020;9(8):458–68.32832074 10.1302/2046-3758.98.BJR-2019-0365.R1
33. Lu CC Zhang T Reisdorf RL Amadio PC An KN Moran SL Biological analysis of flexor tendon repair-failure stump tissue: a potential recycling of tissue for tendon regeneration Bone Joint Res 2019 8 6 232 45 10.1302/2046-3758.86.BJR-2018-0239.R1 31346451
Lu CC, Zhang T, Reisdorf RL, Amadio PC, An KN, Moran SL, et al. Biological analysis of flexor tendon repair-failure stump tissue: a potential recycling of tissue for tendon regeneration. Bone Joint Res. 2019;8(6):232–45.31346451 10.1302/2046-3758.86.BJR-2018-0239.R1
34. Smith JR Pfeifer K Petry F Powell N Delzeit J Weiss ML Standardizing umbilical cord mesenchymal stromal cells for translation to clinical use: selection of GMP-Compliant Medium and a simplified isolation method Stem Cells Int 2016 2016 6810980 10.1155/2016/6810980 26966439
Smith JR, Pfeifer K, Petry F, Powell N, Delzeit J, Weiss ML. Standardizing umbilical cord mesenchymal stromal cells for translation to clinical use: selection of GMP-Compliant Medium and a simplified isolation method. Stem Cells Int. 2016;2016:6810980.26966439 10.1155/2016/6810980
35. Beeravolu N, McKee C, Alamri A, Mikhael S, Brown C, Perez-Cruet M et al. Isolation and characterization of mesenchymal stromal cells from human umbilical cord and fetal placenta. J Visualized Experiments: JoVE. 2017(122).
36. Li P Lv S Jiang W Si L Liao B Zhao G Exosomes derived from umbilical cord mesenchymal stem cells protect cartilage and regulate the polarization of macrophages in osteoarthritis Annals Translational Med 2022 10 18 976 10.21037/atm-22-3912
Li P, Lv S, Jiang W, Si L, Liao B, Zhao G, et al. Exosomes derived from umbilical cord mesenchymal stem cells protect cartilage and regulate the polarization of macrophages in osteoarthritis. Annals Translational Med. 2022;10(18):976.10.21037/atm-22-3912
37. Yin S Ji C Wu P Jin C Qian H Human umbilical cord mesenchymal stem cells and exosomes: bioactive ways of tissue injury repair Am J Transl Res 2019 11 3 1230 40 30972158
Yin S, Ji C, Wu P, Jin C, Qian H. Human umbilical cord mesenchymal stem cells and exosomes: bioactive ways of tissue injury repair. Am J Transl Res. 2019;11(3):1230–40.30972158
38. Ho ML, Hsu CJ, Wu CW, Chang LH, Chen JW, Chen CH et al. Enhancement of osteoblast function through Extracellular vesicles derived from adipose-derived stem cells. Biomedicines. 2022;10(7).
39. Théry C Witwer KW Aikawa E Alcaraz MJ Anderson JD Andriantsitohaina R Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines J Extracell Vesicles 2018 7 1 1535750 10.1080/20013078.2018.1535750 30637094
Théry C, Witwer KW, Aikawa E, Alcaraz MJ, Anderson JD, Andriantsitohaina R, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles. 2018;7(1):1535750.30637094 10.1080/20013078.2018.1535750
40. Lötvall J Hill AF Hochberg F Buzás EI Di Vizio D Gardiner C Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles J Extracell Vesicles 2014 3 26913 10.3402/jev.v3.26913 25536934
Lötvall J, Hill AF, Hochberg F, Buzás EI, Di Vizio D, Gardiner C, et al. Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles. J Extracell Vesicles. 2014;3:26913.25536934 10.3402/jev.v3.26913
41. Lu CC Ho CJ Chen SJ Liu ZM Chou PP Ho ML Anterior cruciate ligament remnant preservation attenuates apoptosis and enhances the regeneration of hamstring tendon graft Bone Joint Res 2023 12 1 9 21 10.1302/2046-3758.121.BJR-2021-0434.R2 36617435
Lu CC, Ho CJ, Chen SJ, Liu ZM, Chou PP, Ho ML, et al. Anterior cruciate ligament remnant preservation attenuates apoptosis and enhances the regeneration of hamstring tendon graft. Bone Joint Res. 2023;12(1):9–21.36617435 10.1302/2046-3758.121.BJR-2021-0434.R2
42. Lyu K Liu T Chen Y Lu J Jiang L Liu X A cell-free treatment for tendon injuries: adipose stem cell-derived exosomes Eur J Med Res 2022 27 1 75 10.1186/s40001-022-00707-x 35643543
Lyu K, Liu T, Chen Y, Lu J, Jiang L, Liu X, et al. A cell-free treatment for tendon injuries: adipose stem cell-derived exosomes. Eur J Med Res. 2022;27(1):75.35643543 10.1186/s40001-022-00707-x
43. Maqsood M Kang M Wu X Chen J Teng L Qiu L Adult mesenchymal stem cells and their exosomes: sources, characteristics, and application in regenerative medicine Life Sci 2020 256 118002 10.1016/j.lfs.2020.118002 32585248
Maqsood M, Kang M, Wu X, Chen J, Teng L, Qiu L. Adult mesenchymal stem cells and their exosomes: sources, characteristics, and application in regenerative medicine. Life Sci. 2020;256:118002.32585248 10.1016/j.lfs.2020.118002
44. Gupta A Shivaji K Kadam S Gupta M Rodriguez HC Potty AG Immunomodulatory extracellular vesicles: an alternative to cell therapy for COVID-19 Expert Opin Biol Ther 2021 21 12 1551 60 10.1080/14712598.2021.1921141 33886388
Gupta A, Shivaji K, Kadam S, Gupta M, Rodriguez HC, Potty AG, et al. Immunomodulatory extracellular vesicles: an alternative to cell therapy for COVID-19. Expert Opin Biol Ther. 2021;21(12):1551–60.33886388 10.1080/14712598.2021.1921141
45. Gupta A, Cady C, Fauser AM, Rodriguez HC, Mistovich RJ, Potty AGR et al. Cell-free stem cell-derived Extract Formulation for Regenerative Medicine Applications. Int J Mol Sci. 2020;21(24).
46. Zhang C Liao W Li W Li M Xu X Sun H Human umbilical cord mesenchymal stem cells derived extracellular vesicles alleviate salpingitis by promoting M1-to-M2 transformation Front Physiol 2023 14 1131701 10.3389/fphys.2023.1131701 36875046
Zhang C, Liao W, Li W, Li M, Xu X, Sun H, et al. Human umbilical cord mesenchymal stem cells derived extracellular vesicles alleviate salpingitis by promoting M1-to-M2 transformation. Front Physiol. 2023;14:1131701.36875046 10.3389/fphys.2023.1131701
47. Maroto R Zhao Y Jamaluddin M Popov VL Wang H Kalubowilage M Effects of storage temperature on airway exosome integrity for diagnostic and functional analyses J Extracell Vesicles 2017 6 1 1359478 10.1080/20013078.2017.1359478 28819550
Maroto R, Zhao Y, Jamaluddin M, Popov VL, Wang H, Kalubowilage M, et al. Effects of storage temperature on airway exosome integrity for diagnostic and functional analyses. J Extracell Vesicles. 2017;6(1):1359478.28819550 10.1080/20013078.2017.1359478
48. Lőrincz ÁM Timár CI Marosvári KA Veres DS Otrokocsi L Kittel Á Effect of storage on physical and functional properties of extracellular vesicles derived from neutrophilic granulocytes J Extracell Vesicles 2014 3 25465 10.3402/jev.v3.25465 25536933
Lőrincz ÁM, Timár CI, Marosvári KA, Veres DS, Otrokocsi L, Kittel Á, et al. Effect of storage on physical and functional properties of extracellular vesicles derived from neutrophilic granulocytes. J Extracell Vesicles. 2014;3:25465.25536933 10.3402/jev.v3.25465
49. Bahr MM Amer MS Abo-El-Sooud K Abdallah AN El-Tookhy OS Preservation techniques of stem cells extracellular vesicles: a gate for manufacturing of clinical grade therapeutic extracellular vesicles and long-term clinical trials Int J Veterinary Sci Med 2020 8 1 1 8 10.1080/23144599.2019.1704992
Bahr MM, Amer MS, Abo-El-Sooud K, Abdallah AN, El-Tookhy OS. Preservation techniques of stem cells extracellular vesicles: a gate for manufacturing of clinical grade therapeutic extracellular vesicles and long-term clinical trials. Int J Veterinary Sci Med. 2020;8(1):1–8.10.1080/23144599.2019.1704992
50. Kusuma GD Barabadi M Tan JL Morton DAV Frith JE Lim R To protect and to preserve: Novel Preservation Strategies for Extracellular vesicles Front Pharmacol 2018 9 1199 10.3389/fphar.2018.01199 30420804
Kusuma GD, Barabadi M, Tan JL, Morton DAV, Frith JE, Lim R. To protect and to preserve: Novel Preservation Strategies for Extracellular vesicles. Front Pharmacol. 2018;9:1199.30420804 10.3389/fphar.2018.01199
