
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12514-5
10.1016/j.heliyon.2024.e36483
e36483
Research Article
Navitoclax safety, tolerability, and effect on biomarkers of senescence and neurodegeneration in aged nonhuman primates
Greenberg Edward F. edward.greenberg@abbvie.com
efgreenberg@gmail.com
a⁎
Voorbach Martin J. martin.j.voorbach@abbvie.com
a
Smith Alexandra a
Reuter David R. a
Zhuang Yuchuan a
Wang Ji-Quan a
Wooten Dustin W. a
Asque Elizabeth a
Hu Min a
Hoft Carolin b
Duggan Ryan a
Townsend Matthew c
Orsi Karin d
Dalecki Karen e
Amberg Willi b
Duggan Lori d
Knight Heather d
Spina Joseph S. d
He Yupeng a
Marsh Kennan a
Zhao Vivian f
Ybarra Suzanne f
Mollon Jennifer g
Fang Yuni f
Vasanthakumar Aparna a
Westmoreland Susan d
Droescher Mathias b
Finnema Sjoerd J. a
Florian Hana a
a AbbVie Inc., North Chicago, IL, United States
b AbbVie Deutschland GmbH & Co. KG, Neuroscience Research, Knollstrasse, 67061, Ludwigshafen, Germany
c AbbVie, Cambridge Research Center, 200 Sidney Street, Cambridge, MA, 02139, United States
d AbbVie Bioresearch Center, 100 Research Drive, Worcester, MA, 01605, United States
e Former AbbVie Employee, United States
f AbbVie Bay Area, 1000 Gateway Boulevard, South San Francisco, CA, 94080, United States
g AbbVie Deutschland GmbH & Co. KG, Statistical Sciences and Analytics, Knollstrasse, 67061, Ludwigshafen, Germany
⁎ Corresponding author. edward.greenberg@abbvie.comefgreenberg@gmail.com
17 8 2024
30 8 2024
17 8 2024
10 16 e3648326 6 2024
1 8 2024
16 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Alzheimer's disease (AD) is the most common global dementia and is universally fatal. Most late-stage AD disease-modifying therapies are intravenous and target amyloid beta (Aβ), with only modest effects on disease progression: there remains a high unmet need for convenient, safe, and effective therapeutics. Senescent cells (SC) and the senescence-associated secretory phenotype (SASP) drive AD pathology and increase with AD severity. Preclinical senolytic studies have shown improvements in neuroinflammation, tau, Aβ, and CNS damage; most were conducted in transgenic rodent models with uncertain human translational relevance. In this study, aged cynomolgus monkeys had significant elevation of biomarkers of senescence, SASP, and neurological damage. Intermittent treatment with the senolytic navitoclax induced modest reversible thrombocytopenia; no serious drug-related toxicity was noted. Navitoclax reduced several senescence and SASP biomarkers, with CSF concentrations sufficient for senolysis. Finally, navitoclax reduced TSPO-PET frontal cortex binding and showed trends of improvement in CSF biomarkers of neuroinflammation, neuronal damage, and synaptic dysfunction. Overall, navitoclax administration was safe and well tolerated in aged monkeys, inducing trends of biomarker changes relevant to human neurodegenerative disease.

Graphical abstract

Image 1

Highlights

• Senescent cells are often pro-inflammatory and may help drive neurological disease.

• Aged monkeys have increased senescence, inflammation, and neurological damage.

• The senolytic navitoclax was safe in aged monkeys, with drug detectable in CSF.

• Navitoclax induced trends of improvement in markers of senescence, inflammation, and neuronal dysfunction.
==== Body
pmc1 Introduction

By 2050, over 100 million individuals worldwide are projected to be diagnosed with the common, progressive, fatal neurodegenerative disease known as Alzheimer's Disease (AD). AD-related cognitive decline has been primarily attributed to the accumulation of CNS misfolded proteins, particularly amyloid beta (Aβ) and tau. Levels of misfolded proteins have been linked to progressive cortical atrophy, especially in the medial temporal lobe, hippocampus, and entorhinal cortex. Over 3 billion dollars are spent annually on research focusing on AD and related dementias (media@alz.org, 2020), with hundreds of drugs now in clinical trials, primarily focused on the removal of these misfolded proteins [1]. Disappointingly, the best late-stage AD therapeutics only have modest clinical benefit. Aducanumab was granted conditional FDA approval for mild AD, based largely on its removal of amyloid plaques, with only modest effect on slowing cognitive decline [2]. With further large confirmatory studies needed for full approval, Biogen ultimately elected to terminate the aducanumab program [3]. Lecanemab, an anti-amyloid antibody with high selectivity for protofibrils, demonstrated a 27 % reduction in clinical decline on the Clinical Dementia Rating scale Sum of Boxes (CDR-SB) after 18 months of treatment compared to placebo in a Ph3 study ([4], [5]). Donanemab, another advanced anti-amyloid AD therapeutic, which markedly lowers Aβ levels, similarly reduced cognitive decline by 30 % in a Phase 2 study (iADRS and ADAS-Cog decline at 76 weeks) [6].

The focus on misfolded protein removal may be a key factor in the limited clinical benefit seen with investigational AD therapeutics. While misfolded proteins can directly impair neuron viability in vitro and in preclinical models [7], the direct neurotoxicity of these aggregates may not be the primary driver of human disease. The accumulation of misfolded proteins with age does not inevitably result in cognitive decline: almost half of nonagenarians and almost all centenarians accumulate significant levels of CNS Aβ and tau, but many retain normal cognition throughout their lifetimes even with extraordinarily high misfolded protein levels [8]. At the same time, key features of AD CNS pathology often appear years before overt cognitive decline. The timing of typical AD interventions (i.e., at symptom onset) may be too late to make a meaningful difference in disease progression. Earlier interventions when cognitive symptoms are minimal may be more effective; to be practical, they would need to be simple, well-tolerated, and ideally fixed in duration.

An emerging theory is that significant AD-related neurodegeneration only occurs when misfolded proteins and/or other toxic insults trigger an exaggerated downstream neuropathological response. In addition to the accumulation of aggregated Aβ and tau, AD is also characterized by defects in proteostasis [9], lysosomal dysfunction [10], mitochondrial dysfunction [11], and increased neuroinflammation [12]. Dysfunctional proteostasis and lysosomal function interfere with Aβ and tau degradation [9] and clearance [10]; defective mitochondria increase reactive oxygen species (ROS) and ROS-induced protein misfolding; and neuroinflammation can accelerate the formation and transmission of protein aggregates throughout the CNS in a progressive downward spiral [13]. To make a meaningful difference in clinical progression, disease-modifying AD therapeutics may need to modulate additional downstream drivers of neurodegeneration beyond misfolded proteins.

A key mediator of the disparate pathological features of AD is the accumulation of senescent cells (SC). DNA damage can be induced by a wide variety of cellular stressors, including Aβ [14] and tau [15], ultimately inducing oncogenesis if left unchecked. To prevent tumor formation, many DNA-damaged cells often undergo apoptosis. However, some DNA-damaged cells override the normal apoptotic response by upregulating the expression of anti-apoptotic proteins, particularly the B-Cell lymphoma 2 (Bcl-2) family members Bcl-2 and Bcl-xL (AKA BCL2L1). These SC are still metabolically active, with a pro-inflammatory senescence-associated secretory phenotype (SASP).

Senescence and SASP contribute to multiple pathological features of neurological disorders, including proteostasis defects [16,17], neuroinflammation [18,19], dysfunctional mitochondria [[20], [21], [22]], and accumulation of misfolded proteins [18,19,23,24]. Therapeutics that selectively remove senescent cells, termed “senolytics,” may therefore reduce multiple drivers of neurodegeneration and have a more profound clinical effect than protein aggregate removal alone. In addition, SC take several weeks to reaccumulate once removed by virtue of their irreversible cell cycle arrest [25], suggesting senolytics may only need to be given intermittently in order to produce durable benefits.

The dependence of many SC on Bcl-2 family members for survival suggests an “Achilles heel” for therapeutic intervention. Dual knockdown of Bcl-2 and Bcl-xL has been demonstrated to selectively kill SC from a wide range of cell lineages, while sparing their nonsenescent counterparts [26,27]. Navitoclax, an orally bioavailable selective inhibitor of Bcl-2 and Bcl-xL, has been published to have potent preclinical senolytic activity across multiple tissue types [27,28]. In aged wild-type (WT) mice, navitoclax was shown to kill senescent CNS neural precursor cells, boost hippocampal neurogenesis, and improve spatial memory [29]. Similarly, treating PS19 tauopathy mice with intermittent cycles of navitoclax reduced levels of senescent glia, lowered hippocampal and cortical inflammatory markers, and decreased tau aggregate accumulation [19].

Studies of other senolytics in preclinical neurodegenerative disease models have also suggested disease-modifying effects. A recent study of dasatinib and quercetin (D + Q) in the APPPS1 amyloidopathy mouse model was shown to reduce the burden of senescent oligodendrocyte precursor cells (OPC), decrease amyloid beta, and improve cognition [30]. In a separate study, D + Q reduced neuroinflammation, lowered neurofibrillary tangles (NFT), and increased levels of neuronal proteins in aged rTg4510 Mapt-null tauopathy mice [23]. While encouraging, all the above studies have been performed on genetically limited rodent models, often relying on transgenic overexpression of specific amyloid or tau isoforms. As such, the translational relevance of these studies to human neurodegenerative disease is limited at best.

In contrast, cynomolgus non-human primates (NHP) have over 90 % DNA sequence identity to humans [31], and share >80 % of human brain prefrontal cortex gene expression [32]. Like humans, NHP accumulate SC across tissues with age [33,34], particularly in vascular, skin, and immune systems [35]. Aged NHP also naturally develop human-like neurodegenerative pathology, with evidence of age-related amyloid plaques, aggregated tau hyperphosphorylation, and other AD-like lesions [32,36].

In this series of studies, we first assessed pharmacokinetics and CNS penetration of navitoclax in rodents (wild type mice and rats). With the translational relevance of NHP in mind, we then performed a comparative study of aged vs young cynomolgus monkeys, showing significant age-dependent enrichment of SC and SASP markers in the skin, blood, and CSF. In a subsequent study of navitoclax in aged NHP, we demonstrated navitoclax blood-brain-barrier (BBB) penetration at senolytic-relevant concentrations; acceptable safety and tolerability; reductions in selected systemic and CNS SC and SASP; and modulation of AD-relevant CSF biomarkers.

2 Materials/methods

Rodent animals and drug treatment: Mice were treated under German federal authority approval (code A17-9-005). Rats were treated under Institutional Animal Care and Use Committee (IACUC) protocols (IACUC protocol number 0812A01245), in accordance with local regulatory authorities. C57BL/6JRj mice (WT mice) were purchased from Janvier labs. Male Rat-CD® rats (Sprague Dawley, IGS Rat Strain 001) were acquired from Charles River Laboratories, inc. All [14C]navitoclax and navitoclax aliquots were produced by AbbVie, Inc. The single dose pharmacokinetics of [14C]navitoclax (10 mg/kg, single dose, administered by oral gavage in 2 % DMSO/5 % Tween 80/20 % PG/73 % D5W) was evaluated in rats (n = 12). Multiple dose pharmacokinetics of navitoclax (50 mg/kg/day x five days, administered by oral gavage in 10 % EtOH/30 % PEG 400/60 % Phosal 50 PG) was evaluated in WT mice (n = 3) by determining the compound's plasma and brain concentration on the first and fifth day of dosing. Mice were perfused prior to brain harvesting to remove residual capillary blood from the tissues. Drug concentrations were determined by LC-MS/MS.

NHP animals and drug treatment: Animals were treated under IACUC protocols (IACUC protocol numbers 1808C00027 and 2108C00039) in accordance with local regulatory authorities. Two cohorts of young (4–8 years old at baseline) and aged (17–25 years old at baseline) cynomolgus monkeys (Macaca fascicularis) were included in the study. Only baseline blood for PBMCs (2 mL/NHP in EDTA tubes) and CSF (1 mL CSF/NHP) samples were collected from NHP in cohort 2, comprising 12 aged NHP (AA1-12) and 21 young NHP (YY1-21). Unless otherwise specified, all other NHP methods refer to cohort 1, comprising 6 aged NHP (A1-6) and 13 young NHP (Y1-13).

Senolytic intervention in NHP was performed with navitoclax administered as an amorphous solid dispersion (ASD). Navitoclax ASD was mixed in food and administered orally once a day at an initial “low-dose lead-in” of 1.44 mg/kg/day x five days of treatment, followed by 16 days of rest. Navitoclax “full dose” was then administered on a repeating regimen of 12 mg/kg/day x 5 days of treatment followed by 16 days of rest. Six complete cycles of full dose navitoclax ASD were administered. NHP were housed in a 12h:12h light:dark cycle environment in pathogen-free barrier conditions. Compliance with relevant ethical regulations and all animal procedures were reviewed and approved by the IACUC (IACUC protocol numbers 1808C00027 and 2108C00039). Baseline blood (19–21 mL/NHP, divided between PAXgene blood RNA tubes and EDTA tubes), skin (three 4–6 mm skin punch biopsies/NHP: one formalin-fixed paraffin-embedded, one placed in RNAlater, one flash frozen), and CSF (1 mL CSF/NHP) samples were collected from all NHP in cohort 1, comprising six aged NHP (2 samples for A6, 1 sample for all other aged NHP) and 13 young NHP (1 sample/NHP). Blood (14 mL/NHP) and skin samples (three 4–6 mm punch biopsies) were also collected at Day 7 and Day 21 of each navitoclax cycle. Post-navitoclax CSF samples for biomarkers of neuroinflammation and neuronal damage were collected from four aged NHP (A1, A2, A3, and A4). Navitoclax CSF samples (0.5–1 mL CSF/NHP) were collected from four aged NHP (A2, A4, A5, and A6) 24 h after completing daily doses with navitoclax (12 mg/kg/day x 5 days, ASD mixed in food). A ∼10–50 μL volume of CSF was used for each CSF PK analysis; the remainder was used for CSF biomarker analysis.

NHP plasma and hematology analyses: Multiple dose pharmacokinetics and hematology were evaluated in two chair-trained aged NHP (A1 and A2) on Days 1–5 of daily navitoclax dosing. Hematology samples were also collected from four aged NHP (A1, A2, A3, and A4) on Day 7 of each navitoclax cycle. K2EDTA blood samples were obtained from a femoral artery or vein of each animal 24 h after compound administration from Days 1–5. Samples were profiled on a Cell Dyne 3700 hematology analyzer according to the manufacturer's recommendations. Plasma was separated by centrifugation (∼4 °C) and navitoclax separated using protein precipitation with acetonitrile containing the stable label internal standard (SLIS). A 10–50 μL plasma aliquot was used for each plasma PK analysis, further described in “NHP PK analyses” below; the remainder was used for plasma biomarker analysis.

NHP PK analyses (plasma and CSF): For both plasma and CSF PK analyses, navitoclax and the SLIS were separated from each other and co-extracted contaminants on a 30 × 2.1 mm Waters X-Bridge C18 5 μm column with an acetonitrile in 0.2 %/1 mM aqueous ammonium hydroxide gradient mobile phase at a flow rate of 1.5 mL/min. Analysis was performed on a Sciex API6500+™ Biomolecular Mass Analyzer with a turbo ionspray interface. Navitoclax and internal standard peak areas were determined using Sciex Analytst™ software. The plasma drug concentration of each sample was calculated by least squares linear regression analysis (non-weighted) of the peak area ratio (parent/internal standard) of the spiked plasma standards versus concentration.

NHP plasma biomarker analyses (protein levels): NHP platelet-poor plasma (0.5 mL/NHP) was diluted 1:2 to 1:8 to ensure assay linearity, then profiled for protein levels of interest via the following ligand-binding assays: 1) MILLIPLEX MAP Non-Human Primate Cytokine Magnetic Bead Panel (PCYTMG-40K-PX23); Millipore Human MMP Magnetic Bead Panel 2 - (HMMP2MAG-55K); IBL HMGB1 ELISA (Tecan ST51011); Human u-PAR Quantikine ELISA Kit (R&D DUP00).

NHP CSF biomarker analysis (protein levels): Baseline CSF Nf-L analyses were performed on all available NHP CSF samples (n = 13 young, n = 5 aged: A1, A2, A3, A4, and A6). For A4 and A6, two separate baseline CSF samples were collected; for all other aged NHP, one baseline CSF sample was collected. Post-navitoclax CSF Nf-L analyses were performed on four aged NHP (A1, A2, A3, and A4). Due to international regulatory and operational complications, all other post-navitoclax CSF protein level analyses were only performed on samples from two aged NHP (A2 and A4). CSF (10–50 μL/assay) was diluted 1:8 to 1:20 to ensure assay linearity, then profiled for protein levels of interest via Merck Millipore Single Molecule Counting technology (SMC), Proteinsimple Simpleplex Ella (Ella), Meso Scale Discovery (MSD), and Quanterix SIMOA HD-X (SIMOA) platforms. Further details of CSF biomarkers analyzed are provided in Table 1.Table 1 NHP CSF biomarkers.

Table 1Biomarker	CSF dilution	Method	
tTau	1:10	SMC	
pTau199	1:6	SMC	
pTau231	1:8	SMC	
pTau396	1:6	SMC	
Vilip 1	1:8	SMC	
Nf-L	1:40	SIMOA	
Gap43	1:20	Ella	
MCP-1	1:20	Ella	
sTREM2	1:20	Ella	
YKL-40	1:20	Ella	
Amyloid Aβ 1-38	1:10	MSD	
Amyloid Aβ 1-40	1:10	MSD	
Amyloid Aβ 1-42	1:10	MSD	
Abbreviations: SMC, Single Molecule Counting; Ella, Ella automated immunoassay; MSD, Meso Scale Discovery. SIMOA, Single Molecule Array.

NHP skin histology: NHP epidermal skin samples (4–6 mm back punch biopsies, yielding ∼10 mg tissue) were fixed in 10 % NBF, processed and paraffin-embedded routinely, and microtome sectioned at 5 μm. Immunohistochemistry was run on a Leica Bond RX (Leica Biosystems, Deer Park, IL), with minor modifications from that described previously [37,38]. Primary antibodies used: rabbit anti-human lamin B1, Abcam ab16048 [1 μg/ml]; rabbit mAb anti-human HMGB1, Cell Signaling 6893 [2.5 μg/ml]; both were detected with Leica's goat anti-rabbit/HRP polymer, visualized with chromogen DAB (3,3-Diaminobenzidine) and counterstained with hematoxylin. Imaging was performed using a 3DHISTECH scanner. VisioPharm software was used for automated image acquisition and analysis. The number of positive cells for a given marker were standardized to the total number of nuclei present in each section.

Quantitative RT-PCR (RT-qPCR): Analyses were performed on NHP skin, whole blood, and PBMCs. NHP skin punch biopsies: 4–6 mm skin punch biopsies were collected and treated with RNAlater according to manufacturer's protocol, (AM7021, Invitrogen). Each biopsy was cut in half and homogenized in a 2 mL Eppendorf Safelock tube with 700 μL Qiazol (79306, Qiagen) and Garnet PowerBead Tubes 0.7 mm (13123-50, Qiagen). Tissue lysates were incubated at room temperature for 5 min. Chloroform, 140 μL, (C2432, Millipore Sigma) was added to each sample, then vortexed on high speed for 15 s. Samples were allowed to incubate at room temperature for 2 min. Organic phase separation was carried out at 4 °C 12,000×g for 15 min 350 μL of the resulting aqueous layer was transferred to a 2 mL Eppendorf Safelock microcentrifuge tube and processed through the miRNeasy mini kit via the Total RNA isolation protocol (217004, Qiagen) according to manufacturer's protocol on the Qiacube Classic (9001292, Qiagen). NHP whole blood: 2.5 mL was collected into a PAXgene Blood RNA tube and prepared following manufacturer's protocols (762165, PreAnalytix/Qiagen). Total RNA from NHP whole blood was isolated on the QIAsymhpony (9001297, Qiagen) with the QIAsymphony PAXgene Blood RNA kit (762635, Qiagen) following manufacturer's protocol with UltraPure water (10977023, Invitrogen) used as the elution buffer. NHP PBMCs: PBMCs were isolated from 4 mL of NHP whole blood within 8 h post blood draw. Total RNA from PBMCs was isolated using organic phase extraction and the miRNeasy micro kit (217084, Qiagen) on the Qiacube Classic (9001292, Qiagen) following manufacturer's protocol. RT-QPCR: Total RNA from skin, whole blood, and PBMC was converted to cDNA with SuperScript IV VILO (11756050, Invitrogen). Specific Target Amplification was performed following manufacturer's protocol (Fluidigm ref 68000133 D2) with the following gene targets: p16, p21, IL-6 and TNFα were as previously described [25], IL-1β, IL-8 and MCP-1 were as previously described [39,40], ACTB forward 5′- CACCATTGGCAATGAGCGGTTC -3′, reverse 5′- AGGTCTTTGCGGATGTCCACGT-3′. 14 PCR cycles were used for pre-amplification of all samples, post pre-amplification all samples were diluted 1:5 with DNA Suspension buffer, pH 8.0 (T0223, Teknova). Samples were loaded on the Fluidigm 192.24 IFC dynamic array (100.6265, Fluidigm) following manufacturer's protocol for the Juno and RT-qPCR data capture was performed on the BioMark HD (Juno, BMKHD, Fluidigm). Expression for all experiments was normalized first to ACTB.

TSPO-PET: NHP imaging was performed at baseline and at the completion of all navitoclax treatment (228 ± 60 days apart). Briefly, animals were fasted for 18–24 h prior to PET and anesthetized using isoflurane (2–2.5 %) throughout the scan. After animal anesthesia and preparation, a CT of the brain was acquired using a Ceretom system (Neurologica, Danvers, MA) for use in PET attenuation correction. Dynamic [18F]PBR111 [41] PET data 120 min in duration were collected in aged (n = 6) male (n = 4) and female (n = 2) cynomolgus NHP (6.0 ± 1.1 kg) on a Focus220 system (Siemens, Knoxville TN). Arterial blood samples were collected for measurement of the arterial input function of the PET tracer. In one PET measurement arterial blood sampling was not successful. Body temperature was maintained at 37 °C using a heated water blanket and hot air. Vital signs were monitored throughout the scanning procedure. The injected amount of radioactivity was 4.92 ± 1.66 mCi, molar activity was 2846 ± 1708 Ci/mmol, and mass amount was 0.85 ± 0.35 μg. For image analysis, subject-space MRI and neuroanatomical atlas were coregistered to PET images of each animal to derive regional time activity curves. Total volume of distribution ratio (DVR) was computed using the Logan graphical method with the cerebral white matter as reference region [42].

Apoptotic Body Flow Cytometry (FCM): NHP whole blood samples were separated into intact cells (WBCs) and platelet poor plasma (PPP) by centrifugation as described previously [43]. PPP and WBC were incubated separately with an apoptosis dye (ApoTracker Green, BioLegend #427402), then further incubated with antibodies against the following cell surface epitopes: WBC subtype markers (mouse anti-human CD3-BUV395 for T cells, BD Biosciences clone SP34; mouse anti-human CD14-BUV805 for monocytes, BD biosciences clone M5E2; mouse anti-human CD20-BV711 for B cells, BioLegend clone 2H7; mouse anti-human CD56-PE for NK cells, BioLegend clone 5.1H11) and senescence-enriched markers (anti-B2M-PECy7, clone 2M2, BioLegend; anti-CD26-PerCP-Cy5.5 BioLegend clone BA5b, mouse anti-CCR6-BV421 AKA CD196, BioLegend 353408; APC mouse anti-DEP1, Abcam ab234278; purified anti-CD87 AKA uPAR, ThermoFisher, MA5-38490 – custom conjugated to CF680 using the Mix-n-stain protein labeling kit from Biotium). All antibodies were used at the recommended 5 μL test size in a final staining volume of 100 μL (1:20 dilution). Flow cytometry methods were performed as previously described [44]. Briefly, samples were analyzed using the Aurora Spectral Analyzer (Cytek Biosciences) with log forward scatter (FSC) and side scatter (SSC) detection to ensure proper resolution of the small apoptotic bodies. FSC and SSC resolution of small particle detection in the range of 0.5–2 μm in size was calibrated using the Nano Blank Polystyrene size standard kit – 0.1 μm–2.0 μm (Spherotech, Inc.) – data not shown. Instrument fluorescent ranges (−13000 to 4194304) were rescaled via analysis software to a range of −4 to 10. Negative values represented spreading error post spectral deconvolution and were interpreted as lacking expression of a given marker. Values 1–2 were no/minimally expressed markers; values 2–4 were moderately expressed markers; values > 4 were highly expressed markers. A gating strategy was used to maximize the purity of each immune cell subtype, identify it as apoptotic, and assess the expression of the senescence markers. Briefly, populations were gated by size via FSC-A and SSC-A to enrich for intact particles in the size range of the calibration beads (∼1 μm), then further gated on ApoTracker green positivity indicating an event as an Apoptotic Body, followed by a positive signal of the desired lineage marker (e.g., CD3+ or CD14+), and finally for the presence or absence of one of the senescence markers. Proportions of cells with a given cell surface senescence marker were reported as a percentage of total Apoptotic Bodies present in the sample.

Statistical analysis: Plots of CSF biomarkers, PK data, and PBMC cell surface markers were generated using R for Windows V4.1.2 [45] and R package ggplot2 V3.3.6 [46]. All other plotting and data analysis was done in GraphPad Prism version 9.1.0 for Windows, GraphPad Software, San Diego, California USA, www.graphpad.com. HMGB1 and lamin B1 epidermal expression were compared between groups using an unpaired t-test. A mixed model was fitted to the repeated measures in transcription profiles in skin and blood and each post-treatment time point was tested for significant difference compared to baseline. Group comparisons of transcription profiles in blood were tested using Welch's test, or in the presence of large outliers (IL-6, MCP-1), using a Mann-Whitney test. Group comparisons of protein biomarker profiles in plasma and CSF were tested using a Mann-Whitney test. A paired t-test was performed for each TSPO-PET brain region. All p-values were uncorrected unless otherwise stated. The following denotes significance in all figures: *P < 0.05, **P < 0.01, ***P < 0.001. Box-and-whisker plots denote the lower quartile, median, and upper quartile, with whiskers extending to the minimum and maximum values. Plots with error bars denote the mean ± 1 SEM. Given the small number of animals and the exploratory nature of this study, no power calculations were used. A5 and A6 samples were excluded from post-navitoclax assessments of senescence, SASP, and neuronal damage, given navitoclax dosing irregularities and elapsed time (>12 months) between baseline samples and navitoclax administration.

3 Results

3.1 Navitoclax CNS penetration in rodents

Though senolytic activity of navitoclax across tissue types has been widely reported [19,27,28,47,48], it has been uncertain if navitoclax has sufficient.

BBB permeability to have direct CNS effects. To assess the CNS penetration of navitoclax, we administered navitoclax (50 mg/kg/day x 5 days) to C57BL/6 mice, achieving a total brain concentration of 42 nM at the terminal timepoint 24h after the last dose (Fig. 1a). [14C]Navitoclax (10 mg/kg/day x 1 day) was also administered to male rats, resulting in a peak total brain concentration (navitoclax and metabolites) of 42 nM, with a 2–3% brain/plasma ratio (Fig. 1b).Fig. 1 Navitoclax reaches senolytic-relevant concentrations in the rodent CNS.

A. Navitoclax (50 mg/kg/day x 5 days) was administered to C57BL/6 mice (n = 3). Navitoclax concentrations in the brain and plasma were assessed 24 h following the last dose of navitoclax. B. [14C]Navitoclax (10 mg/kg/day x 1 day) was administered to male rats. Tissue concentrations of radioactivity were then assessed at 1–120 h following navitoclax administration.

Fig. 1

3.2 Intermittent navitoclax in aged cynomolgus monkeys

We next aimed to validate the role of senescence and navitoclax activity in aged cynomolgus macaques, an animal model with more human translational relevance than rodent models (Fig. 2, Table 2). Briefly, baseline blood, skin, and CSF samples (senescence, SASP, neurodegeneration, Aβ) were collected from young (age 4–7 YO) and aged (age 17–23 YO) cynomolgus monkeys. Baseline imaging assessments (TSPO-PET) were also collected from aged (age 17–23 YO) cynomolgus monkeys. Aged NHP (n = 6) were then treated with one three-week cycle of low-dose oral navitoclax (1.44 mg/kg/day x 5 days), followed by six cycles of full-dose navitoclax (12 mg/kg/day x 5 days/cycle), based on published navitoclax treatment in PS19 tauopathy mice [19]. Skin and blood assessments were repeated each cycle, while CSF and imaging studies were repeated after completion of navitoclax treatment.Fig. 2 Navitoclax in NHP study schema.

Fig. 2

Table 2 Navitoclax in NHP study activity schedule.

Table 2Activity	Baseline	Lead-ina,e, Cycles 1–6b,e	EOTd	
D1	D2	D3	D4	D5	D6	D8	
Physical Examination	X	X	X	X	X	X	X	X		
Blood for Hematology (CBC)	X	X	X	X	X	X	X	X		
Blood for Clinical Chemistry	X	X	X	X	X	X	X	X		
Skin for biomarkers (senescence, SASP)	X	X								
CSF for biomarkers (SASP, neurodegeneration, Aβ)	X						Xc		X	
Blood for biomarkers (senescence, SASP, apoptotic bodies, neurodegeneration, Aβ)	X	X								
CSF for navitoclax PKe							Xc			
Blood for navitoclax PKe			X	X	X	X	X			
Navitoclax treatmente		X	X	X	X	X				
TSPO-PETe	X								X	
a Navitoclax lead-in dosing: 1.44 mg/kg x 5/21 days.

b Navitoclax Cycles 1–6 (C1-6) dosing: 12 mg/kg x 5 days/cycle, 21 days/cycle.

c Post-baseline CSF samples were collected on cycle 1 only.

d EOT: End of Treatment visit, approximately 30 days after the last dose of navitoclax.

e Aged NHP only.

Due to operational challenges, A5 and A6 navitoclax dosing began >1 year after baseline blood, skin, and CSF samples were collected; these animals were excluded from post-navitoclax analyses for these biomarkers. On analysis, many plasma proteins were below the lower limit of quantitation. Plasma protein levels did not show significant differences between baseline aged and young NHP, nor were pre- and post-navitoclax treatment differences appreciated (data not shown), and these studies are not further discussed.

CSF samples were originally planned to be collected 24 h following the last dose of navitoclax in cycle 6. Due to technical challenges, only 2/4 of the original navitoclax-treated aged NHP had successful post-navitoclax CSF collections. An additional two aged NHP (A5 and A6) were subsequently treated with navitoclax, with CSF collected 24 h post-navitoclax. Baseline PBMC and CSF samples were also collected from a second cohort of 12 aged NHP (AA1-12) and 21 young NHP (YY1-21). Details of NHP demographics are provided in Supplementary Table 1 (cohort 1) and Supplementary Table 2 (cohort 2).

3.3 Navitoclax safety/tolerability, PK, and effects on peripheral SASP

Overall, navitoclax treatment was safe and well-tolerated in aged NHP. Consistent with its mechanism of action, navitoclax induced moderate thrombocytopenia in all animals; this was not associated with significant bleeding, and platelet counts rapidly returned to baseline upon withdrawal of study drug (Fig. 3a). Navitoclax was detectable in the CSF of aged NHP 24 h after study drug administration, with a peak detectable concentration of 1.7 nM (median 0.30 nM, mean 0.56 nM), and CSF:plasma ratios ranging from 0.03 to 0.9 % (Fig. 3b).Fig. 3 Navitoclax has on-target thrombocytopenia, BBB penetration, and senolysis in aged NHP.

A. Effect of navitoclax on aged NHP platelet levels. Drug was administered Days 1–5 of each cycle. Shown: 2 aged NHP (A2, A4). B. Average 24h post-navitoclax CSF and plasma concentrations from aged NHP (A1, A2, A5 x 2, A6). Left: 24h CSF navitoclax = 0.56 ± 0.29 nM. Right: 24h plasma navitoclax = 190 ± 64 nM. C. Effect of age and navitoclax on mRNA markers of whole-blood senescence (p16) and SASP (IL-8, MCP-1, IL-1β, IL-6). Left: Baseline bulk blood mRNA. Right: Navitoclax effect. D. Effect of age on mRNA markers of PBMC senescence (p16, p21) and SASP (IL1b, TNFa, MCP1, IL6, IL8) in a second cohort of young (N = 21) and aged (N = 12). Statistical comparisons performed using Welch's t-test (p16, p21, IL1b, TNFa) or Mann-Whitney test (MCP1, IL6, IL8). E. Effect of navitoclax on cell surface senescence marker β2M+ in circulating PBMC. Top left: CD20+ B lymphocytes/Bottom left: CD14+ monocytes. Top Right: CD3+ T lymphocytes. Bottom right: CD56+ NK cells. PRE: Baseline, samples collected after 1 cycle of low dose navitoclax lead-in (1.44 mg/kg). POST: post-navitoclax, samples collected 16 days after the last dose of navitoclax cycle 6. F. Effect of age and navitoclax on markers of NHP skin senescence. Left: Effect of age and navitoclax on NHP bulk skin p21 mRNA. Top right: Effect of age and navitoclax on epidermal LMNB1 skin IHC. Results presented as % positive cells for LMNB1 vs total # non-cornified epidermal cells present. Bottom right: Effect of age and navitoclax on epidermal HMGB1. Results presented as % positive cells for HMGB1 vs total # non-cornified epidermal cells present. All PBMC and whole blood mRNA results presented as ΔΔCt = ΔCt (gene of interest mRNA)/–ΔCt (β-actin mRNA). Error bars: ±1 SE. *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: NAV, navitoclax; β2M, beta-2 microglobulin. IHC, Immunohistochemistry; SC, senescent cells; SASP, Senescence Associated Secretory Phenotype; b-actin, beta-actin; SE, standard error; LMNB1, lamin B1; HMGB1, High mobility group box protein 1.

Fig. 3

NHP whole-blood samples showed marked age-dependent increases in mRNA markers of senescence, including a 2.7-fold increase in p16 mRNA and a 2-fold increase in IL-8 mRNA (Fig. 3c, top). Similar age-dependent elevation was also seen in blood SASP mRNA markers MCP-1 and IL-1b. Navitoclax treatment induced reductions of whole-blood RNA senescence (p16) and SASP (IL-8, MCP-1, IL-1b, and IL-6) in two of the four aged NHP, with peak effects appreciated by cycle 3. The remaining two aged NHP did not show significant post-navitoclax blood biomarkers (Fig. 3c, bottom).

To confirm and expand on the trends noted in the whole-blood senescence and SASP RNA, PBMC samples were collected from a second cohort consisting of 12 aged NHP (AA1-12) and 21 young NHP (YY1-21). As with the whole-blood samples, PBMC samples showed significant age-dependent increases in mRNA markers of senescence, including a 1.6-fold increase in p16 mRNA, a 1.3-fold increase in p21 mRNA and a 3.1-fold increase in IL-1β mRNA (Fig. 3d). Similar trends in age-dependent elevation were also seen in SASP mRNA markers TNFa and MCP-1.

To further investigate the effect of navitoclax on circulating senescent cells, blood samples were enriched for PBMCs, sorted via fluorescence-activated cell sorting (FACS), and profiled for cell surface markers of senescence. Navitoclax treatment was associated with a decline in CD20+β2M + B lymphocytes as a percentage of total cells (5-10x vs baseline), with post-treatment effects observed in all four aged NHP. Peak effect was observed by cycle 4, and levels remained suppressed 16 days post-treatment (Fig. 3e, top left). Navitoclax induced a similar trend of reduction in CD14+ β2M + monocytes (Fig. 3e, bottom left), CD3+β2M + T lymphocytes (Fig. 3d, top right), and CD56+β2M + NK cells (Fig. 3e, bottom right) in the four aged NHP. CD26, CCR6, uPAR, and DEP1 levels did not show significant modulation with navitoclax treatment (not shown). Similarly, NHP skin samples also showed marked age-dependent increases in several senescence markers, with a 2-fold elevation of bulk skin p21 mRNA, and a 25–35 % reduction in nuclear lamin B1 and HMGB1 in non-cornified epidermal cells (Fig. 3f). Navitoclax treatment partially reversed these skin senescence markers in all four aged NHP, with responses observed as early as cycle 3 (Fig. 3f).

3.4 Navitoclax effects on imaging and CSF biomarkers of SASP and neurodegeneration

NHP CSF and plasma samples were assessed by ligand binding assays for age-related and navitoclax-induced changes in AD-relevant soluble protein biomarkers. Several CSF biomarkers with significant age-dependent differences were identified at baseline levels, including MCP-1 (2.75-fold increase); YKL-40 (1.43-fold increase); Gap43 (2.01-fold decrease); neurofilament light (Nf-L, 1.84-fold increase); and sTREM2 (1.96-fold increase). (Fig. 4a–d, left). An independent comparison of a second cohort of young (N = 21) vs aged (N = 12) confirmed age-dependent changes in protein biomarkers (Fig. 4e–f). Post-navitoclax CSF samples obtained from two aged NHP showed trends of partial reversal of many age-dependent changes, inducing a 3.68-fold decline in MCP-1, a 1.7-fold decline in YKL-40, a 2.38-fold increase in Gap43, and a 1.63-fold reduction in NF-L (Fig. 4a–d, right).Fig. 4 Effect of age and Navitoclax on CSF biomarkers of SASP and neurodegeneration.

A.-D. Effect of age and navitoclax on CSF biomarkers. A. MCP-1. B. YKL-40. C. NF-L. D. GAP-43. Left: Baseline young (n = 12–13). Right: Effect of navitoclax on CSF biomarkers among individual aged NHP (n = 2–4). PRE: Baseline, samples collected after 1 cycle of low dose navitoclax lead-in (1.44 mg/kg). POST: post-navitoclax, samples collected 16 days after the last dose of navitoclax cycle 6. E., F. Baseline protein biomarkers of SASP and neurodegeneration in the CSF (E.) and plasma (F.) from a second cohort of young (N = 21) vs aged (N = 12). From left to right: MCP-1, YKL-40, NF-L, GAP-43 (a pre-synaptic protein biomarker to monitor synaptic health/synaptic damage). Error bars: ±1 SE. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.001. All statistical comparisons performed using Mann-Whitney test.

Fig. 4

Finally, TSPO-PET was performed in all aged NHP before and after navitoclax treatment. Frontal cortex TSPO-PET showed a significant reduction following navitoclax treatment; no other brain regions showed significant pre- and post-navitoclax treatment differences (Fig. 5).Fig. 5 Navitoclax effect on TSPO PET tracer binding in aged NHP.

TSPO-PET distribution volume ratios (DVR) for six aged NHPs before (closed symbol) and after navitoclax treatment (open symbol).

Fig. 5

4 Discussion

In this study, we have identified age-dependent changes in markers of senescence and SASP in the skin, blood, and CSF of aged NHP. Intermittent oral navitoclax administration was feasible, safe, and well-tolerated, with no serious treatment-emergent adverse effects. Intermittent navitoclax was associated with reduction in several systemic markers of senescence and SASP and achieved CSF concentrations at levels that may be relevant for senolytic activity based on previous preclinical studies. Finally, navitoclax treatment showed trends of improvement in CSF biomarkers of neuroinflammation (MCP-1, YKL-40), neuronal damage (NF-L), and synaptic integrity (GAP-43), along with an imaging biomarker of neuroinflammation (frontal cortex TSPO-PET).

This study provides uniquely detailed characterization of naturally occurring age-related NHP senescence and is one of the first long-term studies of a senolytic intervention in this animal model. Levels of senescent PBMCs increase significantly in human neurodegenerative disease, particularly senescent lymphocytes [49,50], and lymphocyte infiltration has been reported in the brains of patients with advanced human neurodegenerative disease [49,[51], [52], [53]]. The reduction in PBMC senescence markers in this study suggests an additional MOA for navitoclax CNS disease-modification.

While senescent β2M + cells have been reported to significantly increase in aged humans [54] and aged rodent brains [55,56], the use of this marker for assessing senescent PBMCs has not been widely established. Our study did also include more widely accepted markers of PBMC senescence, including p16, p21, and SASP markers (e.g., IL-1b), correlating with the β2M trends reported; nonetheless, further studies are warranted to further validate a link between β2M levels and PBMC senescence. Of note, β2M-directed therapies have been reported to selectively eliminate senescent cells [55,57], lower alpha-synuclein levels, and improve motor function in a rodent PD model [57]. The trends of navitoclax-induced reduction of β2M + cells across PBMC lineages suggests navitoclax may cause a similar reduction in β2M + senescent cells in the CNS.

Results from our study are consistent with prior navitoclax and ABT-737 studies in rodents, wherein treatment reduced systemic senescence and SASP [27,28,58,59], decreased markers of neuroinflammation and CNS senescence [19,29,[58], [59], [60]], lowered phosphorylated tau [19], and increased neurogenesis and cognitive performance [29,58]. Our results were also consistent with those reported with the senolytic combination dasatinib and quercetin (DQ) in obese insulin-dependent NHP, wherein DQ reduced the burden of adipose SC, reduced markers of systemic SASP, and improved biomarkers of kidney function and metabolic parameters such as fasting glucose, hemoglobin A1c, total cholesterol, triglycerides, and kidney function [61,62]. In both the rodent and NHP studies, time-limited senolytic interventions produced significant improvements in disease-relevant biomarkers, supporting the applicability of senolytics to serious human disorders.

The administered aged NHP dose (12 mg/kg/day) is the human equivalent dose of approximately 270 mg, within the therapeutic range of 200–300 mg daily used in human oncology trials [63]. At this dosage, navitoclax was detectable in aged NHP CSF following oral dosing, supporting the potential of navitoclax for CNS disease-modification. While the absolute navitoclax CSF concentrations (0.09–1.7 nM) were low, they were within the range of levels needed to inhibit its Bcl-2 family targets [64] and induce cellular senolysis [27]. Moreover, navitoclax reaches its plasma Cmax at 4–6 h following oral administration in dogs, with a half-life in cynomolgus monkeys of only 4–5 h [64]. As such, the 24h post-navitoclax CSF concentrations could significantly underrepresent the navitoclax CSF Cmax.

Prior reports have shown limited BBB penetration of navitoclax in preclinical models [58,65,66]. It cannot be ruled out that navitoclax detectability in aged NHP CSF in our study could be a consequence of age-related increased BBB permeability in these animals [67]. Navitoclax has also been shown in prior animal studies to have effects on cerebral vasculature, with improvements in cognitive health linked to a combination of improved cerebral blood flow and modulation of peripheral inflammation [58,68]. As such, the observed impact of navitoclax on CSF biomarkers of SASP and neurodegeneration in this study may be attributable to its effects on peripheral senescent cells and cerebral vasculature, rather than direct effects on CNS senescent cells.

The study had a number of limitations. Only a small number of aged monkeys were available for this study, limiting its statistical significance and generalizability. In particular, post-navitoclax peripheral and CSF biomarkers could only be evaluated from four aged NHP. The effect of navitoclax on PBMC SASP was not assessed due to resource limitations and technical challenges. Future studies with larger sample size of aged monkeys are needed to confirm the post-navitoclax trends observed in whole blood senescence and SASP.

Our aged NHP also did not show classical AD biomarker enrichment (e.g., no significant changes in CSF tau, pTau, or Aβ with age), reducing the direct applicability of results to human AD. However, non-AD human neurodegenerative disorders such as Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and multiple sclerosis (MS) share key pathological senescence-modulated features, including misfolded protein accumulation [[69], [70], [71], [72]], dysfunctional proteostasis [73], and neuroinflammation [[74], [75], [76]]. Indeed, senescence has been directly linked to the pathophysiology of PD [37,77], MS [78,79], and ALS [80,81], and senomodulators have shown DMT effects in preclinical PD models [82]. NF-L has also become increasingly recognized as a predictive and prognostic biomarker across human neurodegenerative diseases [83]. The NF-L modulation seen with navitoclax in our study suggests it could have broad disease-modifying potential in CNS disorders. In order to assess the generalizability of the effects and navitoclax trends to human AD, further studies would be needed with animal models displaying classic AD pathological features.

TSPO-PET is a useful measure of neuroinflammation in neurodegenerative diseases [84]. Navitoclax treatment induced a significant reduction in TSPO DVR in the frontal cortex, although no significant effect was observed beyond this region. In NHP, TSPO PET signal across brain regions has previously been shown to decrease following microglia depletion with the CSF1R inhibitor PLX3397 and to increase following acute lipopolysaccharide administration in young NHP [85,86]. In aged NHP, TSPO-PET signal was found relatively high in striatal regions, hippocampus, temporal cortex, and thalamus, and positively correlated with amyloid-beta tracer [11C]PIB binding in cortical regions [87]. Further evaluation of the regional effect of navitoclax on TSPO-PET is warranted.

Senolytics could potentially offer several advantages over existing AD therapeutics. While conventional therapeutics require daily dosing for continued efficacy, in preclinical studies senolytic effects persist for weeks following discontinuation of treatment [25]. Moreover, even partial SC removal appears sufficient for significant benefits, with a 30 % reduction in SC burden linked to meaningful improvements in preclinical pathology and function [25,88]. In contrast, in clinical studies, anti-amyloid therapeutics can achieve near-complete removal of amyloid plaques with only a 20–30 % reduction in cognitive decline at weeks 76–78 [2,6]. The durable benefits with short intermittent senolytic treatments may facilitate interventions at a presymptomatic phase, particularly with orally bioavailable therapeutics like navitoclax. Indeed, senolytics have now been safely administered in multiple clinical trials, with two senolytic studies now actively recruiting in AD: STOMP-AD [89] and ALSENlite NCT04785300. Our findings of navitoclax safety and tolerability at therapeutic dosages in aged NHP, along with trends of reductions in biomarkers of senescence, SASP, neuroinflammation, and CNS damage, support further investigations of senolytics in clinical studies of neurodegenerative disorders.

Conflict of interest (or declarations) and funding

EFG, MV, AS, DRR, YZ, JQW, DWW, EA, MH, CH, RD, MT, KO, WA, LD, HK, JSS, YH, KM, VZ, SY, JM, YF, AV, SW, MD, SJF, and HF are employees of AbbVie and may hold stock. KD was an employee of AbbVie at the time of the study and may hold stock. The design, study conduct, and all funding for this research was provided by AbbVie, the maker of navitoclax (ABT-263). AbbVie participated in the interpretation of data, review, and approval of the publication. This study conforms to all ethical guidelines stated in Elsevier's Publishing Ethics Policy. The manuscript represents an accurate account of the work performed as well as an objective discussion of its significance. It consists of original work, with appropriate citations of publications influencing the reported work, and has not been published in other research journals. No generative AI or AI-assisted technologies were used in the creation of this manuscript.

Data availability

The data associated with this study has not been deposited into a publicly available repository; data will be made available on request.

CRediT authorship contribution statement

Edward F. Greenberg: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Martin J. Voorbach: Writing – review & editing, Supervision, Resources, Project administration, Methodology, Investigation. Alexandra Smith: Writing – review & editing, Supervision, Resources, Investigation. David R. Reuter: Writing – review & editing, Methodology, Investigation, Data curation. Yuchuan Zhuang: Writing – review & editing, Methodology, Formal analysis, Data curation. Ji-Quan Wang: Methodology, Investigation, Formal analysis, Data curation. Dustin W. Wooten: Methodology, Investigation, Formal analysis, Data curation. Elizabeth Asque: Writing – review & editing, Visualization, Validation, Resources, Methodology, Investigation, Formal analysis, Data curation. Min Hu: Writing – review & editing, Visualization, Validation, Resources, Methodology, Investigation, Formal analysis, Data curation. Carolin Hoft: Writing – review & editing, Visualization, Validation, Supervision, Resources, Methodology, Investigation, Formal analysis, Data curation. Ryan Duggan: Writing – review & editing, Visualization, Resources, Methodology, Investigation, Formal analysis, Data curation. Matthew Townsend: Writing – review & editing, Validation, Resources, Methodology, Investigation, Formal analysis, Data curation. Karin Orsi: Writing – review & editing, Resources, Methodology, Investigation. Karen Dalecki: Writing – review & editing, Methodology, Investigation, Formal analysis, Data curation. Willi Amberg: Writing – review & editing, Methodology, Investigation, Formal analysis, Data curation. Lori Duggan: Writing – review & editing, Validation, Supervision, Methodology, Investigation, Formal analysis, Data curation. Heather Knight: Writing – review & editing, Resources, Methodology, Investigation, Formal analysis, Data curation. Joseph S. Spina: Writing – review & editing, Validation, Resources, Methodology, Investigation, Formal analysis, Data curation. Yupeng He: Writing – review & editing, Supervision, Resources, Methodology, Formal analysis. Kennan Marsh: Writing – review & editing, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Formal analysis, Data curation. Vivian Zhao: Writing – review & editing, Visualization, Validation, Resources, Methodology, Investigation, Formal analysis, Data curation. Suzanne Ybarra: Writing – review & editing, Resources, Project administration, Investigation, Data curation. Jennifer Mollon: Writing – review & editing, Visualization, Validation, Methodology, Formal analysis. Yuni Fang: Writing – review & editing, Validation, Supervision, Resources, Project administration, Investigation, Formal analysis, Data curation. Aparna Vasanthakumar: Writing – review & editing, Validation, Supervision, Resources, Methodology, Investigation, Formal analysis, Data curation. Susan Westmoreland: Writing – review & editing, Visualization, Supervision, Resources, Methodology, Investigation, Formal analysis, Data curation. Mathias Droescher: Writing – review & editing, Visualization, Validation, Supervision, Resources, Methodology, Investigation, Formal analysis, Data curation. Sjoerd J. Finnema: Writing – review & editing, Validation, Supervision, Resources, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Hana Florian: Writing – review & editing, Validation, Supervision, Resources, Methodology, Formal analysis, Conceptualization.

Declaration of competing interest

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Edward Greenberg, MD reports financial support was provided by AbbVie Inc. Edward Greenberg MD reports a relationship with AbbVie Inc that includes: employment, equity or stocks, and funding grants. EFG, MV, AS, DRR, YZ, JQW, DWW, EA, MH, CH, RD, MT, KO, WA, LD, HK, JSS, YH, KM, VZ, SY, JM, YF, AV, SW, MD, SJF, and HF are employees of AbbVie and may hold stock. KD was an employee of AbbVie at the time of the study and may hold stock. The design, study conduct, and all funding for this research was provided by AbbVie, the maker of navitoclax (ABT-263). AbbVie participated in the interpretation of data, review, and approval of the publication. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Abbreviations:

Aβ Amyloid beta

AD Alzheimer's Disease

ADAS-Cog Alzheimer's Disease Assessment Scale-Cognitive subscale

ALS Amyotrophic Lateral Sclerosis

APPPS1 Amyloid precursor protein/Presenilin Protein 1

Bcl-2 B-cell lymphoma 2

Bcl-xL: B-cell lymphoma-extra large

β-actin beta-actin

β2M Beta-2 microglobulin

CD3 Cluster of Differentiation 3

CD14 Cluster of Differentiation 14

CD20 Cluster of Differentiation 20

CD56 Cluster of Differentiation 56

CDKN2A Cyclin dependent kinase Inhibitor 2A, AKA p16

CDKN1A Cyclin dependent kinase Inhibitor 1A, AKA p21

CHI3L1 Chitinase 3-like protein 1. AKA YKL-40

Cmax Maximum concentration achieved

CNS Central nervous system

CSF Cerebrospinal fluid

CWM Cerebral White Matter

DQ Dasatinib and Quercetin

DMT Disease-modifying therapy

DVR Distribution volume ratio

Ella Ella automated immunoassay 600-100

EOT End of Treatment

Fp: Plasma free fraction

GAP-43 Growth associated protein 43

GFAP Glial fibrillary acidic protein

H + L: Heavy and light chain

H&E Hematoxylin and eosin

HMGB1 High mobility group box protein 1

iADRS Integrated Alzheimer's Disease Rating Scale

IHC Immunohistochemistry

HRP Horseradish Peroxidase

iADRS Integrated Alzheimer's Disease Rating Scale

IL-1β Interleukin-1 beta

IL-6 Interleukin 6

IL-8 Interleukin 8

LC3B Microtubule-associated proteins 1A/1B light chain 3B

LMNB1 Lamin B1

MCP-1 Monocyte Chemoattractant Protein-1

mRNA Messenger RNA

MS Multiple Sclerosis

MSD Meso Scale Discovery

NAV Navitoclax

NF-L: Neurofilament light

NFT Neurofibrillary tangles

NHP Non-human primate

p16 AKA CDKN2A

p21 AKA CDKN1A

p62 AKA Sequestosome-1 (SQSTM1)

PAI-1 Plasminogen Activator Inhibitor-1

PD Parkinson's Disease

PFA Paraformaldehyde

RT-PCR Reverse Transcriptase Polymerase Chain Reaction

SA-β-gal Senescence-associated beta galactosidase

SASP Senescence Associated Secretory Phenotype

SC Senescent cells

SE Standard error

SIMOA Single Molecule Array

SQSTM1 Sequestosome-1

sTREM2 Soluble triggering receptor expressed on myeloid cells 2

SMC Single Molecule Counting

t1/2 Half-life

TBS Tris-buffered Saline

TNF-α: Tumor necrosis factor alpha

TSPO-PET Translocator Protein-Positron Emission Tomography

Vilip1 Visinin-like protein 1

VT Distribution volume

WT Wild-type

YKL-40 Tyrosine lysine leucine-40 KDa. AKA Chitinase 3-like protein 1 (CHI3L1)

Appendix A Supplementary data

The following is the Supplementary data to this article:Multimedia component 1

Multimedia component 1

Acknowledgements

The authors would like to thank former AbbVie colleagues Joel Leverson, Michael Gold, and Thomas Möller and current AbbVie colleagues Drs. Ole Graff, Tracey Posadas, Andy Souers, Kristine Gleason, Jalaja Potluri, Julie Adams, Julian Sefrin, Knut Biber, Eric Karran, Allison Thiede, Emily Voss, Jodi Ternes, Lynn Fojut, Monika Wood, Debra Weisbecker, Robert Dunstan, Terry Melim, and James Jasiek for helpful conversations, advice, and encouragement.

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e36483.
==== Refs
References

1 Cummings J. Zhou Y. Lee G. Zhong K. Fonseca J. Cheng F. Alzheimer's disease drug development pipeline: 2023 Alzheimer's Dementia: Translational Research & Clinical Interventions 9 2023 e12385
2 Beshir S.A. Aadithsoorya A.M. Parveen A. Goh S.S.L. Hussain N. Menon V.B. Aducanumab therapy to treat Alzheimer's disease: a narrative review Int. J. Alzheimer's Dis. 2022 2022 9343514
3 Jack Cox C.T. Biogen to Realign Resources for Alzheimer's Disease Franchise 2024 Biogen news release
4 van Dyck C.H. Swanson C.J. Aisen P. Bateman R.J. Chen C. Gee M. Kanekiyo M. Li D. Reyderman L. Cohen S. Froelich L. Katayama S. Sabbagh M. Vellas B. Watson D. Dhadda S. Irizarry M. Kramer L.D. Iwatsubo T. Lecanemab in early Alzheimer's disease N. Engl. J. Med. 388 2023 9 21 36449413
5 Eisai Co L. Topline Results of Clarity AD: Conference for Media and Investors 2022
6 Mintun M.A. Lo A.C. Duggan Evans C. Wessels A.M. Ardayfio P.A. Andersen S.W. Shcherbinin S. Sparks J. Sims J.R. Brys M. Apostolova L.G. Salloway S.P. Skovronsky D.M. Donanemab in early Alzheimer's disease N. Engl. J. Med. 384 2021 1691 1704 33720637
7 Ashraf G.M. Greig N.H. Khan T.A. Hassan I. Tabrez S. Shakil S. Sheikh I.A. Zaidi S.K. Akram M. Jabir N.R. Firoz C.K. Naeem A. Alhazza I.M. Damanhouri G.A. Kamal M.A. Protein misfolding and aggregation in Alzheimer's disease and type 2 diabetes mellitus CNS Neurol. Disord.: Drug Targets 13 2014 1280 1293 25230234
8 Ganz A.B. Beker N. Hulsman M. Sikkes S. Netherlands Brain B. Scheltens P. Smit A.B. Rozemuller A.J.M. Hoozemans J.J.M. Holstege H. Neuropathology and cognitive performance in self-reported cognitively healthy centenarians Acta Neuropathologica Communications 6 2018 64 30037350
9 Morawe T. Hiebel C. Kern A. Behl C. Protein homeostasis, aging and Alzheimer's disease Mol. Neurobiol. 46 2012 41 54 22361852
10 Hwang J. Estick C.M. Ikonne U.S. Butler D. Pait M.C. Elliott L.H. Ruiz S. Smith K. Rentschler K.M. Mundell C. Almeida M.F. Stumbling Bear N. Locklear J.P. Abumohsen Y. Ivey C.M. Farizatto K.L.G. Bahr B.A. The role of lysosomes in a broad disease-modifying approach evaluated across transgenic mouse models of Alzheimer's disease and Parkinson's disease and models of mild cognitive impairment Int. J. Mol. Sci. 20 2019
11 Wang W. Zhao F. Ma X. Perry G. Zhu X. Mitochondria dysfunction in the pathogenesis of Alzheimer's disease: recent advances Mol. Neurodegener. 15 2020 30 32471464
12 Kinney J.W. Bemiller S.M. Murtishaw A.S. Leisgang A.M. Salazar A.M. Lamb B.T. Inflammation as a central mechanism in Alzheimer's disease Alzheimers Dement (N Y) 4 2018 575 590 30406177
13 Michalska P. León R. When it comes to an End: oxidative stress crosstalk with protein aggregation and neuroinflammation induce neurodegeneration Antioxidants 9 2020
14 Mao P. Reddy P.H. Aging and amyloid beta-induced oxidative DNA damage and mitochondrial dysfunction in Alzheimer's disease: implications for early intervention and therapeutics Biochim. Biophys. Acta 1812 2011 1359 1370 21871956
15 Colnaghi L. Rondelli D. Muzi-Falconi M. Sertic S. Tau and DNA damage in neurodegeneration Brain Sci. 10 2020
16 Sabath N. Levy-Adam F. Younis A. Rozales K. Meller A. Hadar S. Soueid-Baumgarten S. Shalgi R. Cellular proteostasis decline in human senescence Proc Natl Acad Sci U S A 117 2020 31902 31913 33257563
17 Meller A. Shalgi R. The aging proteostasis decline: from nematode to human Exp. Cell Res. 399 2021 112474
18 Ogrodnik M. Evans S.A. Fielder E. Victorelli S. Kruger P. Salmonowicz H. Weigand B.M. Patel A.D. Pirtskhalava T. Inman C.L. Johnson K.O. Dickinson S.L. Rocha A. Schafer M.J. Zhu Y. Allison D.B. von Zglinicki T. LeBrasseur N.K. Tchkonia T. Neretti N. Passos J.F. Kirkland J.L. Jurk D. Whole-body senescent cell clearance alleviates age-related brain inflammation and cognitive impairment in mice Aging Cell 20 2021 e13296
19 Bussian T.J. Aziz A. Meyer C.F. Swenson B.L. van Deursen J.M. Baker D.J. Clearance of senescent glial cells prevents tau-dependent pathology and cognitive decline Nature 562 2018 578 582 30232451
20 Schilling T. Eder C. Microglial K+ channel expression in young adult and aged mice Glia 63 2015 664 672 25472417
21 Abdouh M. Chatoo W. El Hajjar J. David J. Ferreira J. Bernier G. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons PLoS One 7 2012 e31870
22 Joshi A.U. Minhas P.S. Liddelow S.A. Haileselassie B. Andreasson K.I. Dorn G.W. Mochly-Rosen D. Fragmented mitochondria released from microglia trigger A1 astrocytic response and propagate inflammatory neurodegeneration Nat. Neurosci. 22 2019 1635 1648 31551592
23 Musi N. Valentine J.M. Sickora K.R. Baeuerle E. Thompson C.S. Shen Q. Orr M.E. Tau protein aggregation is associated with cellular senescence in the brain Aging Cell 17 2018 e12840
24 Bhat R. Crowe E.P. Bitto A. Moh M. Katsetos C.D. Garcia F.U. Johnson F.B. Trojanowski J.Q. Sell C. Torres C. Astrocyte senescence as a component of Alzheimer's disease PLoS One 7 2012 e45069
25 Xu M. Pirtskhalava T. Farr J.N. Weigand B.M. Palmer A.K. Weivoda M.M. Inman C.L. Ogrodnik M.B. Hachfeld C.M. Fraser D.G. Onken J.L. Johnson K.O. Verzosa G.C. Langhi L.G.P. Weigl M. Giorgadze N. LeBrasseur N.K. Miller J.D. Jurk D. Singh R.J. Allison D.B. Ejima K. Hubbard G.B. Ikeno Y. Cubro H. Garovic V.D. Hou X. Weroha S.J. Robbins P.D. Niedernhofer L.J. Khosla S. Tchkonia T. Kirkland J.L. Senolytics improve physical function and increase lifespan in old age Nat. Med. 24 2018 1246 1256 29988130
26 Zhu Y. Tchkonia T. Pirtskhalava T. Gower A.C. Ding H. Giorgadze N. Palmer A.K. Ikeno Y. Hubbard G.B. Lenburg M. O'Hara S.P. LaRusso N.F. Miller J.D. Roos C.M. Verzosa G.C. LeBrasseur N.K. Wren J.D. Farr J.N. Khosla S. Stout M.B. McGowan S.J. Fuhrmann-Stroissnigg H. Gurkar A.U. Zhao J. Colangelo D. Dorronsoro A. Ling Y.Y. Barghouthy A.S. Navarro D.C. Sano T. Robbins P.D. Niedernhofer L.J. Kirkland J.L. The Achilles' heel of senescent cells: from transcriptome to senolytic drugs Aging Cell 14 2015 644 658 25754370
27 Zhu Y. Tchkonia T. Fuhrmann-Stroissnigg H. Dai H.M. Ling Y.Y. Stout M.B. Pirtskhalava T. Giorgadze N. Johnson K.O. Giles C.B. Wren J.D. Niedernhofer L.J. Robbins P.D. Kirkland J.L. Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors Aging Cell 15 2016 428 435 26711051
28 Chang J. Wang Y. Shao L. Laberge R.-M. Demaria M. Campisi J. Janakiraman K. Sharpless N.E. Ding S. Feng W. Luo Y. Wang X. Aykin-Burns N. Krager K. Ponnappan U. Hauer-Jensen M. Meng A. Zhou D. Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice Nat. Med. 22 2016 78 83 26657143
29 Fatt M.P. Tran L.M. Vetere G. Storer M.A. Simonetta J.V. Miller F.D. Frankland P.W. Kaplan D.R. Restoration of hippocampal neural precursor function by ablation of senescent cells in the aging stem cell niche Stem Cell Rep. 17 2022 259 275
30 Zhang P. Kishimoto Y. Grammatikakis I. Gottimukkala K. Cutler R.G. Zhang S. Abdelmohsen K. Bohr V.A. Misra Sen J. Gorospe M. Mattson M.P. Senolytic therapy alleviates Aβ-associated oligodendrocyte progenitor cell senescence and cognitive deficits in an Alzheimer's disease model Nat. Neurosci. 22 2019 719 728 30936558
31 Ebeling M. Küng E. See A. Broger C. Steiner G. Berrera M. Heckel T. Iniguez L. Albert T. Schmucki R. Biller H. Singer T. Certa U. Genome-based analysis of the nonhuman primate Macaca fascicularis as a model for drug safety assessment Genome Res. 21 2011 1746 1756 21862625
32 Verdier J.-M. Acquatella I. Lautier C. Devau G. Trouche S. Lasbleiz C. Mestre-Francés N. Lessons from the analysis of nonhuman primates for understanding human aging and neurodegenerative diseases Front. Neurosci. 9 2015
33 Herbig U. Ferreira M. Condel L. Carey D. Sedivy J.M. Cellular senescence in aging primates Science 311 2006 1257-1257
34 Jeyapalan J.C. Ferreira M. Sedivy J.M. Herbig U. Accumulation of senescent cells in mitotic tissue of aging primates Mech. Ageing Dev. 128 2007 36 44 17116315
35 Didier E.S. MacLean A.G. Mohan M. Didier P.J. Lackner A.A. Kuroda M.J. Contributions of nonhuman primates to research on aging Veterinary Pathology 53 2016 277 290 26869153
36 Abdel Rassoul R. Alves S. Pantesco V. De Vos J. Michel B. Perret M. Mestre-Francés N. Verdier J.-M. Devau G. Distinct transcriptome expression of the temporal cortex of the primate Microcebus murinus during brain aging versus Alzheimer's disease-like pathology PLoS One 5 2010 e12770
37 Chinta S.J. Woods G. Demaria M. Rane A. Zou Y. McQuade A. Rajagopalan S. Limbad C. Madden D.T. Campisi J. Andersen J.K. Cellular senescence is induced by the environmental neurotoxin paraquat and contributes to neuropathology linked to Parkinson's disease Cell Rep. 22 2018 930 940 29386135
38 Fujita K. Motoki K. Tagawa K. Chen X. Hama H. Nakajima K. Homma H. Tamura T. Watanabe H. Katsuno M. Matsumi C. Kajikawa M. Saito T. Saido T. Sobue G. Miyawaki A. Okazawa H. HMGB1, a pathogenic molecule that induces neurite degeneration via TLR4-MARCKS, is a potential therapeutic target for Alzheimer's disease Sci. Rep. 6 2016 31895
39 Coppé J.-P. Patil C.K. Rodier F. Sun Y. Muñoz D.P. Goldstein J. Nelson P.S. Desprez P.-Y. Campisi J. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor PLoS Biol. 6 2008 e301
40 Hu Y. Fryatt G.L. Ghorbani M. Obst J. Menassa D.A. Martin-Estebane M. Muntslag T.A.O. Olmos-Alonso A. Guerrero-Carrasco M. Thomas D. Cragg M.S. Gomez-Nicola D. Replicative senescence dictates the emergence of disease-associated microglia and contributes to Aβ pathology Cell Rep. 35 2021
41 Fookes C.J.R. Pham T.Q. Mattner F. Greguric I. Loc’h C. Liu X. Berghofer P. Shepherd R. Gregoire M.-C. Katsifis A. Synthesis and biological evaluation of substituted [18F]Imidazo[1,2-a]pyridines and [18F]Pyrazolo[1,5-a]pyrimidines for the study of the peripheral benzodiazepine receptor using positron emission tomography J. Med. Chem. 51 2008 3700 3712 18557607
42 Logan J. Fowler J.S. Volkow N.D. Wang G.-J. Ding Y.-S. Alexoff D.L. Distribution volume ratios without blood sampling from graphical analysis of PET data J. Cerebr. Blood Flow Metabol. 16 1996 834 840
43 Serrano-Heras G. Díaz-Maroto I. Castro-Robles B. Carrión B. Perona-Moratalla A.B. Gracia J. Arteaga S. Hernández-Fernández F. García-García J. Ayo-Martín O. Segura T. Isolation and quantification of blood apoptotic bodies, a non-invasive tool to evaluate apoptosis in patients with ischemic stroke and neurodegenerative diseases Biol. Proced. Online 22 2020 17 32765191
44 Kohlhapp F.J. Haribhai D. Mathew R. Duggan R. Ellis P.A. Wang R. Lasater E.A. Shi Y. Dave N. Riehm J.J. Robinson V.A. Do A.D. Li Y. Orr C.J. Sampath D. Raval A. Merchant M. Bhathena A. Salem A.H. Hamel K.M. Leverson J.D. Donawho C. Pappano W.N. Uziel T. Venetoclax increases intratumoral effector T cells and antitumor efficacy in combination with immune checkpoint blockade Cancer Discov. 11 2021 68 79 32887697
45 Team R.C. R: A Language and Environment for Statistical Computing 2021 R Foundation for Statistical Computing Vienna, Austria
46 Wickham H. ggplot2: Elegant Graphics for Data Analysis 2016 Springer-Verlag New York
47 Fielder E. Wan T. Alimohammadiha G. Ishaq A. Low E. Weigand B.M. Kelly G. Parker C. Griffin B. Jurk D. Korolchuk V.I. von Zglinicki T. Miwa S. Short senolytic or senostatic interventions rescue progression of radiation-induced frailty and premature ageing in mice Elife 11 2022 e75492
48 Demaria M. O'Leary M.N. Chang J. Shao L. Liu S. Alimirah F. Koenig K. Le C. Mitin N. Deal A.M. Alston S. Academia E.C. Kilmarx S. Valdovinos A. Wang B. de Bruin A. Kennedy B.K. Melov S. Zhou D. Sharpless N.E. Muss H. Campisi J. Cellular senescence promotes adverse effects of chemotherapy and cancer relapse Cancer Discov. 7 2017 165 176 27979832
49 Groh J. Knöpper K. Arampatzi P. Yuan X. Lößlein L. Saliba A.-E. Kastenmüller W. Martini R. Accumulation of cytotoxic T cells in the aged CNS leads to axon degeneration and contributes to cognitive and motor decline Nature Aging 1 2021 357 367 37117598
50 Forero D.A. González-Giraldo Y. López-Quintero C. Castro-Vega L.J. Barreto G.E. Perry G. Meta-analysis of telomere length in Alzheimer's disease J. Gerontol.: Series A 71 2016 1069 1073
51 Togo T. Akiyama H. Iseki E. Kondo H. Ikeda K. Kato M. Oda T. Tsuchiya K. Kosaka K. Occurrence of T cells in the brain of Alzheimer's disease and other neurological diseases J. Neuroimmunol. 124 2002 83 92 11958825
52 Dulken B.W. Buckley M.T. Navarro Negredo P. Saligrama N. Cayrol R. Leeman D.S. George B.M. Boutet S.C. Hebestreit K. Pluvinage J.V. Wyss-Coray T. Weissman I.L. Vogel H. Davis M.M. Brunet A. Single-cell analysis reveals T cell infiltration in old neurogenic niches Nature 571 2019 205 210 31270459
53 Sommer A. Winner B. Prots I. The Trojan horse - neuroinflammatory impact of T cells in neurodegenerative diseases Mol. Neurodegener. 12 2017 78 29078813
54 Althubiti M. β2-microglobulin is overexpressed in buccal cells of elderly and correlated with expression of p16 and inflammatory genes Saudi J. Biol. Sci. 29 2022 103418
55 Poblocka M. Bassey A.L. Smith V.M. Falcicchio M. Manso A.S. Althubiti M. Sheng X. Kyle A. Barber R. Frigerio M. Macip S. Targeted clearance of senescent cells using an antibody-drug conjugate against a specific membrane marker Sci. Rep. 11 2021 20358
56 Zhang X. Pearsall V.M. Carver C.M. Atkinson E.J. Clarkson B.D.S. Grund E.M. Baez-Faria M. Pavelko K.D. Kachergus J.M. White T.A. Johnson R.K. Malo C.S. Gonzalez-Suarez A.M. Ayasoufi K. Johnson K.O. Tritz Z.P. Fain C.E. Khadka R.H. Ogrodnik M. Jurk D. Zhu Y. Tchkonia T. Revzin A. Kirkland J.L. Johnson A.J. Howe C.L. Thompson E.A. LeBrasseur N.K. Schafer M.J. Rejuvenation of the aged brain immune cell landscape in mice through p16-positive senescent cell clearance Nat. Commun. 13 2022 5671 36167854
57 Xu Z. Qu A. Zhang H. Wang W. Hao C. Lu M. Shi B. Xu L. Sun M. Xu C. Kuang H. Photoinduced elimination of senescent microglia cells in vivo by chiral gold nanoparticles Chem. Sci. 13 2022 6642 6654 35756519
58 Budamagunta V. Kumar A. Rani A. Bean L. Manohar-Sindhu S. Yang Y. Zhou D. Foster T.C. Effect of peripheral cellular senescence on brain aging and cognitive decline Aging Cell 22 2023 e13817
59 Aguado J. Amarilla A.A. Taherian Fard A. Albornoz E.A. Tyshkovskiy A. Schwabenland M. Chaggar H.K. Modhiran N. Gómez-Inclán C. Javed I. Baradar A.A. Liang B. Peng L. Dharmaratne M. Pietrogrande G. Padmanabhan P. Freney M.E. Parry R. Sng J.D.J. Isaacs A. Khromykh A.A. Valenzuela Nieto G. Rojas-Fernandez A. Davis T.P. Prinz M. Bengsch B. Gladyshev V.N. Woodruff T.M. Mar J.C. Watterson D. Wolvetang E.J. Senolytic therapy alleviates physiological human brain aging and COVID-19 neuropathology Nature Aging 3 2023 1561 1575 37957361
60 Rachmian N. Medina S. Cherqui U. Akiva H. Deitch D. Edilbi D. Croese T. Salame T.M. Ramos J.M.P. Cahalon L. Krizhanovsky V. Schwartz M. Identification of senescent, TREM2-expressing microglia in aging and Alzheimer’s disease model mouse brain Nat. Neurosci 27 2024 1116 1124 38637622
61 Ruggiero A.D. Block M. Davis M. Vemuri R. Orr M.E. Kavanagh K. 753-P: senolytics improve diabetes measures in type 2 diabetic nonhuman primates: a pilot study Diabetes 70 2021
62 Ruggiero A.D. Vemuri R. Blawas M. Long M. DeStephanis D. Williams A.G. Chen H. Justice J.N. Macauley S.L. Day S.M. Kavanagh K. Long-term dasatinib plus quercetin effects on aging outcomes and inflammation in nonhuman primates: implications for senolytic clinical trial design GeroScience 45 2023 2785 2803 37261678
63 Harrison C.N. Garcia J.S. Somervaille T.C.P. Foran J.M. Verstovsek S. Jamieson C. Mesa R. Ritchie E.K. Tantravahi S.K. Vachhani P. O'Connell C.L. Komrokji R.S. Harb J. Hutti J.E. Holes L. Masud A.A. Nuthalapati S. Potluri J. Pemmaraju N. Addition of navitoclax to ongoing ruxolitinib therapy for patients with myelofibrosis with progression or suboptimal response: phase II safety and efficacy J. Clin. Oncol. 40 2022 1671 1680 35180010
64 Tse C. Shoemaker A.R. Adickes J. Anderson M.G. Chen J. Jin S. Johnson E.F. Marsh K.C. Mitten M.J. Nimmer P. Roberts L. Tahir S.K. Xiao Y. Yang X. Zhang H. Fesik S. Rosenberg S.H. Elmore S.W. ABT-263: a potent and orally bioavailable Bcl-2 family inhibitor Cancer Res. 68 2008 3421 3428 18451170
65 Orr M.E. A need for refined senescence biomarkers and measures of senolytics in the brain J Alzheimers Dis 98 2024 411 415 38461508
66 He W. Li X. Morsch M. Ismail M. Liu Y. Rehman F.U. Zhang D. Wang Y. Zheng M. Chung R. Zou Y. Shi B. Brain-targeted codelivery of Bcl-2/Bcl-xl and Mcl-1 inhibitors by biomimetic nanoparticles for orthotopic glioblastoma therapy ACS Nano 16 2022 6293 6308 35353498
67 Knox E.G. Aburto M.R. Clarke G. Cryan J.F. O'Driscoll C.M. The blood-brain barrier in aging and neurodegeneration Mol Psychiatry 27 2022 2659 2673 35361905
68 Gulej R. Nyúl-Tóth Á. Ahire C. DelFavero J. Balasubramanian P. Kiss T. Tarantini S. Benyo Z. Pacher P. Csik B. Yabluchanskiy A. Mukli P. Kuan-Celarier A. Krizbai I.A. Campisi J. Sonntag W.E. Csiszar A. Ungvari Z. Elimination of senescent cells by treatment with Navitoclax/ABT263 reverses whole brain irradiation-induced blood-brain barrier disruption in the mouse brain Geroscience 45 2023 2983 3002 37642933
69 Padilla-Godínez F.J. Ramos-Acevedo R. Martínez-Becerril H.A. Bernal-Conde L.D. Garrido-Figueroa J.F. Hiriart M. Hernández-López A. Argüero-Sánchez R. Callea F. Guerra-Crespo M. Protein misfolding and aggregation: the relatedness between Parkinson's disease and hepatic endoplasmic reticulum storage disorders Int. J. Mol. Sci. 22 2021 12467
70 McAlary L. Plotkin S.S. Yerbury J.J. Cashman N.R. Prion-like propagation of protein misfolding and aggregation in amyotrophic lateral sclerosis Front. Mol. Neurosci. 12 2019 262 mediaalz.org 2020. Federal Alzheimer's and Dementia Research Funding Reaches $3.1 Billion Annually. Alzheimer's Association 31736708
71 David M.A. Tayebi M. Detection of protein aggregates in brain and cerebrospinal fluid derived from multiple sclerosis patients Front. Neurol. 5 2014 251 25520699
72 Schattling B. Engler J.B. Volkmann C. Rothammer N. Woo M.S. Petersen M. Winkler I. Kaufmann M. Rosenkranz S.C. Fejtova A. Thomas U. Bose A. Bauer S. Träger S. Miller K.K. Brück W. Duncan K.E. Salinas G. Soba P. Gundelfinger E.D. Merkler D. Friese M.A. Bassoon proteinopathy drives neurodegeneration in multiple sclerosis Nat. Neurosci. 22 2019 887 896 31011226
73 Höhn A. Tramutola A. Cascella R. Proteostasis failure in neurodegenerative diseases: focus on oxidative stress Oxid. Med. Cell. Longev. 2020 2020 5497046
74 Wang Q. Liu Y. Zhou J. Neuroinflammation in Parkinson's disease and its potential as therapeutic target Transl. Neurodegener. 4 2015 19 26464797
75 Liu J. Wang F. Role of neuroinflammation in amyotrophic lateral sclerosis: cellular mechanisms and therapeutic implications Front. Immunol. 8 2017 1005 28871262
76 Psenicka M.W. Smith B.C. Tinkey R.A. Williams J.L. Connecting neuroinflammation and neurodegeneration in multiple sclerosis: are oligodendrocyte precursor cells a nexus of disease? Front. Cell. Neurosci. 15 2021
77 Chinta S.J. Lieu C.A. Demaria M. Laberge R.M. Campisi J. Andersen J.K. Environmental stress, ageing and glial cell senescence: a novel mechanistic link to Parkinson's disease? J. Intern. Med. 273 2013 429 436 23600398
78 Oost W. Talma N. Meilof J.F. Laman J.D. Targeting senescence to delay progression of multiple sclerosis J. Mol. Med. (Berl.) 96 2018 1153 1166 30229272
79 Kritsilis M. S V.R. Koutsoudaki P.N. Evangelou K. Gorgoulis V.G. Papadopoulos D. Ageing, cellular senescence and neurodegenerative disease Int. J. Mol. Sci. 19 2018
80 Das M.M. Svendsen C.N. Astrocytes show reduced support of motor neurons with aging that is accelerated in a rodent model of ALS Neurobiol. Aging 36 2015 1130 1139 25443290
81 Trias E. Beilby P.R. Kovacs M. Ibarburu S. Varela V. Barreto-Núñez R. Bradford S.C. Beckman J.S. Barbeito L. Emergence of microglia bearing senescence markers during paralysis progression in a rat model of inherited ALS Front. Aging Neurosci. 11 2019 42 30873018
82 Miller S.J. Campbell C.E. Jimenez-Corea H.A. Wu G.H. Logan R. Neuroglial senescence, α-synucleinopathy, and the therapeutic potential of senolytics in Parkinson's disease Front. Neurosci. 16 2022 824191
83 Zanella I. Blasco H. Filosto M. Biasiotto G. Editorial: the impact of neurofilament light chain (NFL) quantification in serum and cerebrospinal fluid in neurodegenerative diseases Front. Neurosci. 16 2022
84 Masdeu J.C. Pascual B. Fujita M. Imaging neuroinflammation in neurodegenerative disorders J. Nucl. Med. 63 2022 45S 35649654
85 Hannestad J. Gallezot J.-D. Schafbauer T. Lim K. Kloczynski T. Morris E.D. Carson R.E. Ding Y.-S. Cosgrove K.P. Endotoxin-induced systemic inflammation activates microglia: [11C]PBR28 positron emission tomography in nonhuman primates Neuroimage 63 2012 232 239 22776451
86 Hillmer A.T. Holden D. Fowles K. Nabulsi N. West B.L. Carson R.E. Cosgrove K.P. Microglial depletion and activation: a [11C]PBR28 PET study in nonhuman primates EJNMMI Res. 7 2017 59 28741281
87 Tsukada H. Effects of amyloid-β deposition on mitochondrial complex I activity in brain: a PET study in monkeys INTECHOPEN Exploring New Findings on Amyloidosis 2016
88 Baker D.J. Wijshake T. Tchkonia T. LeBrasseur N.K. Childs B.G. van de Sluis B. Kirkland J.L. van Deursen J.M. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders Nature 479 2011 232 236 22048312
89 Gonzales M.M. Garbarino V.R. Marques Zilli E. Petersen R.C. Kirkland J.L. Tchkonia T. Musi N. Seshadri S. Craft S. Orr M.E. Senolytic therapy to modulate the progression of Alzheimer's disease (SToMP-AD): a pilot clinical trial J Prev Alzheimers Dis 9 2022 22 29 35098970
