
==== Front
J Endocr Soc
J Endocr Soc
jes
Journal of the Endocrine Society
2472-1972
Oxford University Press US

10.1210/jendso/bvae146
bvae146
Research Article
AcademicSubjects/MED00250
Jes/7
Gene Misexpression in a Smoc2+ve/Sox2-Low Population in Juvenile Prop1-Mutant Pituitary Gland
Masser Bailey E Department of Human Genetics, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48105, USA

Brinkmeier Michelle L Department of Human Genetics, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48105, USA

Lin Yuxuan Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA

Liu Qin Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA

Miyazaki Aya Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA

Nayeem Jannatun Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA

https://orcid.org/0000-0002-0912-9594
Cheung Leonard Y M Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, Stony Brook, NY 11794, USA
leonard.cheung@stonybrook.edu

Correspondence: Leonard Y. M. Cheung, PhD, Department of Physiology & Biophysics, Renaissance School of Medicine, Stony Brook University, 100 Nicolls Rd, Stony Brook, NY 11794, USA. Email: leonard.cheung@stonybrook.edu.
27 8 2024
27 8 2024
27 8 2024
8 10 bvae14605 7 2024
16 8 2024
09 9 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of the Endocrine Society.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (https://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com. See the journal About page for additional terms.

Abstract

Mutations in the pituitary-specific transcription factor Prophet of Pit-1 (PROP1) are the most common genetic etiology of combined pituitary hormone deficiency (CPHD). CPHD is associated with short stature, attributable to growth hormone deficiency and/or thyroid-stimulating hormone deficiency, as well as hypothyroidism and infertility. Pathogenic lesions impair pituitary development and differentiation of endocrine cells. We performed single-cell RNA sequencing of pituitary cells from a wild-type and a Prop1-mutant P4 female mouse to elucidate population-specific differential gene expression. We observed a Smoc2+ve population that expressed low Sox2, which trajectory analyses suggest are a transitional cell state as stem cells differentiate into endocrine cells. We also detected ectopic expression of Sox21 in these cells in the Prop1df/df mutant. Prop1-mutant mice are known to overexpress Pou3f4, which we now show to be also enriched in this Smoc2+ve population. We sought to elucidate the role of Pou3f4 during pituitary development and to determine the contributions of Pou3f4 upregulation to pituitary disease by utilizing double-mutant mice lacking both Prop1 and Pou3f4. However, our data showed that Pou3f4 is not required for normal pituitary development and function. Double mutants further demonstrated that the upregulation of Pou3f4 was not causative for the overexpression of Sox21. These data indicate loss of Pou3f4 is not a potential cause of CPHD, and further studies may investigate the functional consequence of upregulation of Pou3f4 and Sox21, if any, in the novel Smoc2+ve cell population.

pituitary
Prop1
Pou3f4
scRNA seq
National Institutes of Health 10.13039/100000002 R01HD097096 Stony Brook University 10.13039/100007259 University of Michigan 10.13039/100007270
==== Body
pmcThe pituitary gland is a neuroendocrine regulator which secretes hormones that are critical for the regulation of many physiological processes. Situated at the base of the brain, directly below the hypothalamus, the pituitary is divided into 3 lobes with dual developmental origins. Pituitary organogenesis begins around week 4 of human development and embryonic day 8 (E8) in mice, during which the neuroectoderm on the floor of the diencephalon gives rise to the posterior lobe [1, 2]. The anterior pituitary houses 5 distinct cell types, including somatotropes, lactotropes, gonadotropes, thyrotropes, and corticotropes. Upon receiving specific hypothalamic signals, these cell types are responsible for releasing the peptide hormones growth hormone (GH), prolactin (PRL), luteinizing hormone (LH) and follicle-stimulating hormone (FSH), thyroid-stimulating hormone (TSH), and adrenocorticotropic hormone (ACTH), respectively. These hormones, in turn, signal peripheral organs to regulate processes such as growth, lactation, fertility, metabolism, and stress response. With vital functions throughout the body, deficiencies in pituitary hormones can be fatal if left untreated.

Combined pituitary hormone deficiency (CPHD) is characterized by a shortage of GH and at least one other pituitary hormone. Due to these deficiencies, children with CPHD present with short stature, hypothyroidism, hypoglycemia, and hypogonadism [3]. CPHD is relatively common, affecting an estimated 1 in 8000 newborns worldwide [4]. To date, more than 60 genes are known to be implicated in the pathogenesis of CPHD, with mutations often impairing embryonic pituitary development and differentiation of endocrine cells in humans and mice [5-7]. Loss-of-function mutations in the pituitary-specific transcription factor Prophet of Pit-1 (Prop1) are the most common genetic etiology, accounting for 12% to 55% of cases in different cohorts [4, 5]. PROP1 is required to activate another pituitary transcription factor, POU Domain Class 1, Homeobox 1 (POU1F1, also known as Pit-1), to drive the differentiation of progenitor cells into cells that produce TSH, GH, or PRL, and mutations in POU1F1 also cause CPHD in humans and mice [8]. PROP1 alternatively induces other genes, such as Zinc Finger E-box Binding Homeobox 2 (Zeb2) and Notch Receptor 2 (Notch2) to regulate the epithelial-to-mesenchymal transition (EMT)-like process of differentiating stem cells, independent of POU1F1 [9], suggesting PROP1 has additional downstream targets that are necessary for normal pituitary development and function. Due to defects in these regulatory pathways, patients with PROP1 mutations typically present with progressive hormone deficiencies involving TSH, GH, PRL, and gonadotropins, and sometimes evolving to a life-threatening loss of ACTH. However, there is phenotypic heterogeneity among patients, with variable age of onset, effect on pituitary size, and the number and type of hormone deficiencies [10].

Prop1-null mice exhibit congenital TSH, GH, and PRL deficiencies, making them a compelling model organism to study disease pathophysiology and develop potential human therapies. Prop1-mutant mice show elevated expression of several genes, including Hesx1 and Pou3f4 [11, 12], indicating that PROP1 functions as an important transcriptional repressor. In this study, we performed single-cell RNA sequencing (scRNAseq) of pituitary cells from individual P4 female wild-type and Prop1df/df mutant mice to gain cell-type–specific resolution of differential gene expression in the absence of Prop1 function. We observed gene misexpression, including upregulated Pou3f4 as well as ectopic Sox21 expression, in a novel subset of Sox2-lowly expressing cells in the juvenile pituitary gland. RNA velocity trajectory analysis suggests that this population, marked by expression of Smoc2, comprises intermediary cells as stem cells differentiate into endocrine cells. We generated Pou3f4; Prop1 double-mutant mice but did not observe reversal of Sox21 ectopic expression or other changes from Prop1-mutant phenotypes. Therefore, we have identified that Prop1 is required to maintain proper gene expression in a novel juvenile Smoc2+ve/Sox2-low cell population.

Methods

Mouse Strains

The use of mice at the University of Michigan was approved by the University of Michigan's Animal Care and Use Program and the Institutional Animal Care & Use Committee (IACUC). Husbandry was provided by the Unit for Laboratory Animal Medicine (ULAM). Mice were housed under standard light/dark conditions and provided food ad libitum. All mouse strains used in this study have been previously published. The Proptm1Sac allele is functionally null and homozygous mice are mutants with the same phenotypes as the Prop1df/df spontaneous mutants. The Proptm1Sac allele is more simply referred to as Prop−. Sox21−/− knockout mice were previously generated [13, 14]. Pou3f4del-J(C3HeB/FeJ-Pou3f4del−J/J), JAX Stock No.: 004406 (RRID:IMSR_JAX:004406) [15]. Prop1df JAX Stock No.: 001618 [16]. Prop1− MGI: 3521736 [10]. Pou1f1dw JAX Stock No.: 000772 [12].

Genotyping

Genotyping for the Prop1df allele was performed as previously described using PCR and HinfI restriction digest [17]. Genotyping for the Pou1f1dw allele was performed by PCR and AvaII digest as previously described [12]. Genotyping for Pou3f4 and the sex chromosomes were performed in the same reaction, using primers for the Pou3f4 CDS and primers that amplify different products from the homologous genes, Uba1 on the X chromosome, and Uba1y on the Y chromosome. The Pou3f4 and Uba1y primers were designed using the National Center for Biotechnology Information (NCBI) Primer-Basic Local Alignment Search Tool (BLAST). Prop1tm1Sac genotyping was performed in 2 separate PCRs, independently from the Pou3f4 and sex genotyping as previously described [10]. PCR products were run on a 1.5% agarose gel and visualized using SYBR Safe. Prop1+/df F, 5′—GAGCTGGGGAGACCTAAGCTTTGCC—3′. Prop1+/df R 5′—GCCCAGATGTCAGGATACTG—3′. Pou1f1+/dw F 5′—GCTGCTAAGGATGCTCTGG—3′. Pou1f1+/dw R 5′—CCTTGGAAATAGAGAACAGGC –3′. Prop1 (F) 5′—GTGAGAAAACAGGTATCTAGCT—3′. Prop1 tm1Sac (R) 5′—CTTACTTCCACCTACTCACTTCC—3′. Prop1 WT (R) 5′—TTCGTTTGCTTTTCCTGTG—3′. Pou3f4 CDS (F) 5′—CCCCGCACCATAGATGTCAA—3′. Pou3f4 CDS (R) 5′—CCCCTGTGAAAGAAAAGAGC—3′. Uba1y (F) 5′—TGGATGGTGTGGCCAATG—3′. Uba1y (R) 5′—CACCTGCACGTTGCCCTT—3′.

Quantitative PCR

mRNA from mouse pituitaries was prepared using the QIAGEN RNeasy Mini Kit (Catalog No.: 74104). cDNA was synthesized using the Invitrogen SuperScript First-Strand Synthesis System for RT-PCR (Catalog No.:1190418). All reactions were prepared as suggested by the manufacturer. The quantitative polymerase chain reactions (qPCRs) were performed on an Applied Biosystems 7500 Real-Time PCR Instrument using TaqMan Universal PCR Master Mix (Catalog No.: 4304437). Hypoxanthine Guanine Phosphoribosyltransferase (Hprt) expression was used as the housekeeping control. Comparative mRNA expression was calculated using the 2−ΔΔCt method and data were plotted in GraphPad Prism 9. Statistical tests were performed in R Studio or Prism and differences between groups were analyzed by unpaired t test. TaqMan Probe mouse assays (Catalog No.: 4331182): Lhb mm00656868_g1; Nr5a1 mm00446826_m1; Pou1f1 mm00476852_m1, Smoc2 mm00491553_m1; Sox21 mm00844350_s1; Sox2 mm03053810_s1; Hprt mm03024075_m1.

Single-Cell RNA Library Preparation

ScRNAseq RNA libraries were prepared from one P4 female Prop1+/+ pituitary gland and one P4 female Prop1df/df pituitary gland from the same litter. Single-cell RNA libraries were prepared by the University of Michigan's Advanced Genomics Core on the 10× Genomics Chromium 3′ Gene Expression v3 platform following the manufacturer's instructions and sequenced on the NovaSeq6000 platform with an S4 chip.

Single-Cell Sequencing Computation Analyses

Samples were analyzed similarly to our previous studies [18]. Samples were demultiplexed and fastq files aligned using Cellranger Single Cell Software Suite 3.1.0. Sequence reads were aligned to a modified mm10 containing extended annotation for the Prop1 3′ untranslated region [19]. Binary sequence alignment maps were converted into loom files using velocyto.py [20] and imported into R for primary analyses using Seurat 3.1.2 and 5.1.0 [21, 22]. Core Seurat functions were used to import loom files, integrate samples, generate uniform manifold approximation and projection (UMAP), calculate clusters, and calculate differential gene expression. Expression plots used Nebulosa 1.12.1 [23]. Plots and images generated in R or Excel were compiled in Adobe Photoshop 2024. Sequencing data are available on National Center for Biotechnology Information Gene Expression Omnibus accession number GSE273683, and web-based expression visualization are viewable on the Broad Single Cell Portal at SCP2695.

Immunohistochemistry

Mouse postnatal heads were collected, paraffinized and sectioned on a coronal plane at 5 µm. Immunostaining of paraffin sections was performed using the Biotium Tyramide Amplification Kit with horseradish peroxidase-streptavidin and CF AlexaFluor 594 tyramide (TSA) (Biotium Catalog No.: 33009). Following dewaxing, epitopes were unmasked using citric acid. Endogenous peroxidases were quenched in 50% methanol and 3% hydrogen peroxide. Nonspecific reactions were blocked with a TSA block containing 10% donkey serum and 5% bovine serum albumin (BSA). Sections were treated with goat anti-human SOX21 antibody (R&D Systems AF3538 [RRID: AB_2195947, https://scicrunch.org/resolver/RRID:AB_2195947], 1:100) overnight at 4 °C followed by biotinylated donkey anti-goat secondary antibody (Invitrogen D-20698 [RRID: AB_2536519, https://scicrunch.org/resolver/RRID:AB_2536519], 1:500) for 1 hour at room temperature. The tertiary reaction with horseradish peroxidase-streptavidin was applied for 1 hour at room temperature before treating with the TSA-CF594 at 1:500 for 10 minutes. Slides were mounted using Invitrogen Molecular Probes ProLong Diamond Antifade Mountant with DAPI (Catalog No.: P36971, Lot No.: 2384717). Imaging was conducted using a Leica Leitz DM RP upright microscope and images were compiled and adjusted for clarity in Adobe Photoshop 2024.

RNAscope

RNAscope mRNA visualization was performed using the RNAscope 2.5 HD Duplex Detection Kit (Advanced Cell Diagnostics 322500) with the Smoc2 probe in red (C1) (318541) and the Slc16a2 probe in blue (C2) (545291-C2) following manufacturer's protocol. Target retrieval was performed by boiling in retrieval buffer for 7 minutes, and protease digestion for 20 minutes.

Results

Single-Cell RNA Sequencing of Prop1-Mutant Pituitary Cells

We performed scRNAseq on pituitary glands from one P4 Prop1+/+ female and one P4 Prop1df/df female on the 10× Genomics Chromium 3′ Gene Expression v3 platform targeting 10 000 cells from each sample. After filtering for cells with > 500 genes/cell, between 2000 and 20 000 transcripts per cell, and < 5% mitochondrial transcripts, we recovered 7893 cells from the wild-type and 5830 cells from the mutant (Fig. 1A). Computational clustering with Seurat detected 20 clusters (Fig. 1B), which were assigned identities based on expression of cell-type signature genes (Supplementary Fig. S1 [24]). All expected cell types were detected. Lactotropes were not detected, which was expected due to low number of lactotropes and low prolactin expression in juvenile mice. Two clusters were made up almost solely of cells in G2M/S phase, representing proliferating Sox2 stem cells and proliferating Pou1f1+ve cells (Fig. 1C). The composition of the Prop1df/df sample had fewer Pou1f1 lineage cells (somatotropes, thyrotropes, proliferating Pou1f1 cells) as expected and proportionally more gonadotropes and corticotropes (Fig. 1D). A small number of oligodendrocyte precursors expressing Olig1 and Olig2 were detected, with more in the Prop1df/df sample. This was likely due to accidental inclusion of neural tissue during the dissection. Accordingly, Pou1f1 expression is essentially absent from Prop1df/df cells (Fig. 1E). Prop1 transcripts are detected in the Prop1df/df mutant as the df mutation causes a missense mutation that inactivates the homeobox. The majority of Sox2-expressing cells was divided into 3 clusters: proliferating Sox2 cells (Fig. 1F), and parenchymal and cleft Sox2 stem cells based on recent description [25] of higher expression of Aqp3 in the parenchymal stem cells (Fig. 1G) and Ednrb in cleft stem cells (Fig. 1H). Expression of thyroid hormone transporter Slc16a2 (Mct8) appears higher in the cleft stem cells (Fig. 1I).

Figure 1. Single-cell sequencing of wild-type and Prop1-mutant P4 female pituitary cells. (A) UMAP of integrated wild-type and mutant cells. The mutant lacks cells from certain cell populations (detailed below). (B) Computational clustering and assignment of likely identity (see Supplementary Fig. S1 [24]). (C) Difference in cell-type proportions in Prop1-mutant mice. Prop1-dependent cell types such as somatotropes, thyrotropes, and proliferating Pou1f1-cells are depleted in the Prop1-mutant as expected. As a result, gonadotropes and corticotropes are proportionally enriched. (D) Cell cycle phase scoring, identifying proliferating stem cells and Pou1f1+ve cells. (E) Absence of Pou1f1 expression in the Prop1-mutant sample. (F-I) Expression of Sox2 and other markers that differentiate the cleft and parenchymal stem cells.

Detection of a Transient Juvenile Sox2-Low Subpopulation in Mouse Pituitary

Several computational clusters expressed Sox2 (Fig. 1F, Fig. 2A). We examined one cell cluster that expressed lower Sox2 than the major Sox2 stem cell clusters (Fig. 2A arrow, cluster 6). This cluster has unique gene expression, the most significant of which was SPARC-related modular calcium binding protein 2 (Smoc2) (Fig. 2B and C). This population was absent from previous scRNAseq data from wild-type P49 male mouse pituitary cells [19] and present in other juvenile samples from P4 and P7 mice [18, 26]. RNA velocity trajectory analysis with Velocyto setting the cleft stem cells as the root suggested that the Smoc2 population represented an intermediary cell state as stem cells differentiated into endocrine cells (Fig. 2D). Quantitative PCR for Smoc2 from wild-type pituitaries from embryos, newborn/juvenile, and 2- and 3-week-old mice showed that Smoc2 expression is highest in the first week of life (Fig. 2E). RNAscope for Smoc2 and Slc16a2 transcripts in P7 female control pituitary glands showed diffuse location of Smoc2 expression throughout the gland, while Slc16a2 expression was enriched along the cleft (Fig. 2F).

Figure 2. Detection of a transient juvenile Sox2-low cell state in mouse pituitary. (A) Violin plot of Sox2 expression across calculated clusters. Cluster 6 cells express Sox2, albeit lower than some other clusters. (B, C) Cluster 6 cells uniquely express Smoc2. (D) RNA velocity trajectory analysis setting the cleft Sox2+ve stem cells as the root suggests stem cells pass through the Smoc2+ve cluster 6 as they differentiate into endocrine cells. (E) qPCR for Smoc2 from control pituitary glands at young ages show highest expression at P3. (F) RNAscope detection of diffuse Smoc2 transcripts and Slc16a2 in cleft cells in female P7 mouse pituitary.

Ectopic Gene Expression in the Smoc2+ve Population in Prop1df/df Mutants

We examined differential gene expression within the Smoc2+ve population between the Prop1df/df and the wild-type to explore how the loss of Prop1 activity impacts this population. We detected expression of Sox21 in the Smoc2+ve population, specifically from Prop1-mutant cells in the Smoc2+ve cluster (Fig. 3A and 3B). Sox21 is not normally detected in the pituitary gland [13], so its expression is ectopically activated without Prop1. We validate by qPCR that Sox21 is highly upregulated in Prop1df/df pituitary glands at P7 (Fig. 3C); the very large fold change is due to comparison to almost zero expression in the controls. We observed no change in Sox21 expression in Pou1f1dw/dw mutant mice, another mouse model of CPHD which lacks GH, PRL and TSH as in the Prop1df/df but have normal ACTH and gonadotropins, showing that the ectopic expression was a specific effect of the loss of Prop1 action. Finally, we detected SOX21 protein in the Prop1df/df pituitary gland at P3 and P7 (Fig. 3D).

Figure 3. Ectopic expression of Sox21 in the Smoc2-expressing population in Prop1df/df mice. (A-B) Sox21 is upregulated in Prop1-mutants in cluster 6, the Sox2/Smoc2 population. (C) Sox21 upregulation occurs in Prop1df/df mutants but not Pou1f1dw/dw mutants, another model of pituitary hormone deficiency. (D) SOX21 ectopic expression in Prop1df/df pituitary glands in P3 and P7 mice.

Known Upregulation of Pou3f4 in Prop1df/df Mutants Occurs in the Smoc2+ve Population, Although Double Deletion of Pou3f4 and Prop1 Does Not Reverse Prop1-Mutant Phenotypes

We also observed expression of other transcription factors in the Smoc2+ve population, including Lef1 and Pou3f4 (Brn4) (Fig. 4A). Upregulation of Pou3f4 in Prop1df/df mutant mice has been previously reported [11]. With cell-type resolution from scRNAseq we determined that the upregulation of Pou3f4 occurs primarily in the Smoc2+ve population (Fig. 4B). Pou3f4 is X-linked in mice and hemizygous males and homozygous females develop deafness, but pituitary glands in these mice have not been described. Histology of Pou3f4 mutant was normal at P1 (Fig. 3C, males shown, females also normal). While deletion of Pou3f4 did not appear to have any influence on gross pituitary morphology or anterior lobe development, we wanted to determine if there were transcriptional defects in markers of stem cell maintenance or differentiation. We applied qPCR to samples from P1 wild-type (WT) and Pou3f4-mutant pituitaries to detect changes in expression of the stem cell marker Sox2, and the endocrine progenitor marker Pou1f1 (Fig. 4D). There were no significant changes in Sox2 or Pou1f1 expression between hemizygous-WT controls and Pou3f4-mutant males, Pou3f4-mutant females, or Pou3f4 mutants of both sexes. This suggested that loss of Pou3f4 does not influence Sox2 stem cell maintenance and Pou1f1 endocrine progenitor differentiation.

Figure 4. Pou3f4 overexpression in Prop1-mutants occurs in Smoc2/Sox2 cells but does not appear to drive Sox21 overexpression. (A) Transcription factors such as Lef1 and Pou3f4 are also expressed specifically in the Smoc2+ve population. (B) Average Pou3f4 expression per cell per cluster, split by genotype, is significantly increased in the Smoc2-expressing cluster 6 in Prop1-mutant cells. (C) P1 Pou3f4-mutant mice have normal pituitary morphology and (D) Sox2 and Pou1f1 expression are normal. (E) Double deletion of Prop1 and Pou3f4 does not reverse Prop1-mutant phenotypes such as Sox21 ectopic expression or hypoplasia and dysmorphology (Supplementary Fig. S2 [27]). For D-E, blue points represent male samples and orange points represent female samples.

To determine if Prop1-mutant phenotypes, including ectopic expression of Sox21 in Smoc2+ve cells, are attributable to Pou3f4 upregulation, we generated Pou3f4−/−; Prop1−/− double-knockout (dKO) mice. We obtained slightly fewer Prop1 mutants and dKOs than expected (chi-square statistic value, P value = .0225) (Supplementary Fig. S2 [27]). dKO mice were dwarfed akin to Prop1-mutant mice postnatally, and we did not observe rescue of pituitary dysmorphology or hypoplasia of Prop1-mutant mice in embryonic and newborn dKOs (Supplementary Fig. S2C and 2D [27]). We sought to address whether deletion of Pou3f4 would reduce the overexpression of Sox21 observed in Prop1-mutant mice. We applied qPCR to samples from P21 WT, Pou3f4- single-mutant, Prop1-single-mutant, and dKO pituitaries to compare the levels of Sox21 mRNA expression (Fig. 4E). However, when comparing the dKO mice to the controls, the elevation of Sox21 expression remains significant (P value = .02875), and there is not a significant difference in the level of expression between the Prop1-single-mutant and dKO mice (P value = .4). Considering levels of Sox21 mRNA expression were comparable between Prop1-mutant and dKO pituitaries, the upregulation of Pou3f4 is not required for the overexpression of Sox21 in Prop1-mutant mice. Upregulation of Smoc2 and Nr5a1 in the Prop1-mutants were similarly unaffected by the additional loss of Pou3f4. As a result, it is not clear whether the upregulation of Pou3f4 in the Prop1-mutant pituitary has a functional effect.

Discussion

Mutations in Prop1 are the most common genetic etiology of CPHD [4]. Prop1 functions to regulate the EMT-like process of differentiating stem cells and activate Pou1f1 to drive differentiation of progenitors into hormone-producing cells [8, 9]. Consequently, defects in Prop1 impair the migration of stem cells and the differentiation of endocrine cells. This leads to hypoplasia of the anterior lobe, misfolding, and endocrine defects, which are hallmarks of Prop1 mutations. Our scRNAseq of wild-type and Prop1-mutant cells provided the first cell-type–specific differential gene expression analyses occurring in Prop1-mutant pituitary gland. We observed expected gene expression and cell population changes such as reduced Pou1f1-lineage endocrine cell numbers, as well as differentiate between cleft and parenchymal Sox2-expressing pituitary stem cells based on higher expression of markers such as Aqp3 (parenchyma) and Ednrb (cleft) [25]. We also observed expression of the thyroid hormone transporter Slc16a2 (also called Mct8) with higher expression in cleft stem cells, which was also observed by RNAscope (Fig. 1). SLC16A2 genetic mutations in humans cause Allan Herndon Dudley Syndrome characterized by neurodevelopmental delay, but pituitary phenotypes in these patients are unclear [28].

We observed a cell population not corresponding to any expected cell-type in both the wild-type and Prop1-mutant samples. This population expressed Sox2 albeit at a lower level than the major clusters representing parenchymal, cleft, and proliferating Sox2+ve stem cells (Fig. 2). UMAP and RNA velocity trajectory analyses suggest that this population is an intermediary or transitional cell state as stem cells differentiate into endocrine cells (Fig. 2D). The most enriched marker of this population was Smoc2, an extracellular calcium binding glycoprotein, which is implicated in a variety of physiological and pathological processes. It is an intestinal stem cell marker associated with better survival in colorectal cancers [29], promotes EMT in renal cell carcinoma [30], regulates bone formation and healing [31, 32], and human mutations in SMOC2 can cause dental developmental defects [33] and growth plate defects [34]. A previous study with functionally null homozygous Smoc2-GFP-ires-CreERT2 knock-in mice had no reported gross phenotypes [35], although the International Mouse Phenotyping Consortium reports bone defects and weight and length reductions in Smoc2tm1.1 homozygous null mice, suggesting further studies may be needed to identify whether these growth reductions are due to bone and/or pituitary defects. Smoc2-expressing cells are detected in our previous P7 scRNAseq dataset (18Single Cell Portal SCP2110) but not in our P49 postnatal dataset (19SCP2058), corroborating qPCR data here that showed Smoc2 expression peaking in the first week of life in mice (Fig. 2E).

Pou3f4 is highly expressed during pituitary organogenesis from e10.5 until e14.5 in Rathke's pouch and the developing anterior lobe [11]. The endogenous function of Pou3f4 in the pituitary and the contributions of its upregulation to Prop1-mutant phenotypes have not been described. However, we have shown that Pou3f4 is not necessary for normal pituitary morphology, maintenance of Sox2-expressing stem cells, or differentiation of Pou1f1 endocrine progenitors. Consistent with these results, Pou3f4-mutant mice did not exhibit reduced growth, craniofacial defects, or infertility, which are indicative of hormone deficiencies.

Genetic defects in Pou3f4 cause nonsyndromic X-linked deafness 2 (DFNX2) (also known as conductive deafness with stapes fixation 3 [DFN3]) in humans and mice, which is the most common form of X-linked deafness [36, 37]. At the same time, Sox21-mutant mice also manifested hearing defects, exhibiting a higher decibel threshold for eliciting an auditory brainstem response [38], although SOX21 variants have not yet been associated with a human disease. Both the inner ear and pituitary gland derive from cranial placodes [39] (otic and adenohypophyseal placodes respectively) and express some shared transcription factors during development, for example Six1 and Eya1 [40-42], although loss of Six1 or Eya1 both affect otic placode development, while loss of both is required to cause pituitary defects [40]. We speculate whether the loss of Prop1, a pituitary-specific transcription factor, may lead to de-repression of genes normally expressed in other placodes, although we note that there does not appear to be transdifferentiation of pituitary cells into otic cells and we do not observe expression of otic markers such as Pax8.

Gene overexpression can impair pituitary development, for example transgenic mice with constitutively expressed HESX1 have impaired thyrotrope and gonadotrope differentiation [43]. We therefore sought to determine if any Prop1-mutant phenotypes are attributable to Pou3f4 upregulation. However, we found that Pou3f4 upregulation is not necessary for the gross dysmorphology, hypoplastic anterior lobe, or upregulation of Sox21 in Prop1-mutant mice. This suggested that Pou3f4 may not be a critical transcriptional regulator in the Prop1-mutant pituitary. The lack of rescue is not likely to be related to the age of tissues collected, as we observe generally no difference between Prop1-mutant and dKOs at e16.5, P3, or P21 by a combination of histology and qPCR.

An alternative model to the one proposed in this study is that Prop1 represses Sox21, which regulates Pou3f4. In this case, the loss of Prop1 would cause the upregulation of Sox21, which would lead to the overexpression of Pou3f4. We were only able to collect pituitary tissue from one Sox21; Prop1 double-mutant mouse, but growth phenotypes of the Prop1 and Sox21 mutations were additive. Double mutants were in poor health postnatally and the experiment was discontinued (Supplementary Fig. S3 [44]). Pituitary dysmorphology and hypoplasia was not rescued in one postnatal 3-week-old mutant, suggesting that Sox21 overexpression does not drive pituitary dysmorphology or hypoplasia in Prop1-mutant mice, although it does leave the possibility that ectopic expression of Sox21 is transcriptionally upstream of Pou3f4 upregulation in Prop1-mutants. Conversely, Prop1 could be independently repressing Pou3f4 and Sox21, leading to their simultaneous upregulation when Prop1 is lost. We are not able to generate further Prop1; Sox21 double-mutant mice for study.

Overall, this study has provided insights into population-specific gene expression changes in the Prop1-mutant pituitary gland including detection of a novel Smoc2+ve, Sox2-low population as well as how loss of Prop1 causes gene misexpression in this population. While we found that Pou3f4 overexpression did not cause overexpression of Sox21 or dysmorphology in Prop1-mutant mice, future studies may explore the molecular mechanisms driving gene dysregulation in Smoc2+ve cells and its functional impact on Prop1 mutant phenotypes.

Acknowledgments

We thank Sally A. Camper (University of Michigan, Ann Arbor, Michigan) for funding support, encouragement, and guidance.

Funding

This work was funded by the National Institutes of Health (R01HD097096 to S.A.C. and L.Y.M.C.), University of Michigan.

Disclosures

Authors have no conflicts of interest to disclose.

Data Availability

Original data generated and analyzed during this study are included in this published article or in the data repositories listed in “Methods” and “References.”

Abbreviations

ACTH adrenocorticotropic hormone

CPHD combined pituitary hormone deficiency

Dko double-knockout

EMT epithelial-to-mesenchymal transition

PRL prolactin

GH growth hormone

qPCR quantitative polymerase chain reaction

scRNAseq single-cell RNA sequencing

TSH thyrotropin (thyroid-stimulating hormone)

UMAP uniform manifold approximation and projection

WT wild-type
==== Refs
References

1 Sheng  HZ, Westphal  H. Early steps in pituitary organogenesis. Trends Genet. 1999;15 (6 ):236‐240.10354584
2 Kelberman  D, Rizzoti  K, Lovell-Badge  R, Robinson  IC, Dattani  MT. Genetic regulation of pituitary gland development in human and mouse. Endocr Rev. 2009;30 (7 ):790‐829.19837867
3 Dattani  M, Preece  M. Growth hormone deficiency and related disorders: insights into causation, diagnosis, and treatment. Lancet. 2004;363 (9425 ):1977‐1987.15194259
4 De Rienzo  F, Mellone  S, Bellone  S, et al  Frequency of genetic defects in combined pituitary hormone deficiency: a systematic review and analysis of a multicentre Italian cohort. Clin Endocrinol (Oxf). 2015;83 (6 ):849‐860.26147833
5 Fang  Q, George  AS, Brinkmeier  ML, et al  Genetics of combined pituitary hormone deficiency: roadmap into the genome era. Endocr Rev. 2016;37 (6 ):636‐675.27828722
6 Budny  B, Zemojtel  T, Kaluzna  M, et al  SEMA3A and IGSF10 are novel contributors to combined pituitary hormone deficiency (CPHD). Front Endocrinol (Lausanne). 2020;11 :368.32612575
7 Jee  YH, Gangat  M, Yeliosof  O, et al  Evidence that the etiology of congenital hypopituitarism has a major genetic component but is infrequently monogenic. Front Genet. 2021;12 :697549.34456972
8 Li  S, Crenshaw  EB, Rawson  EJ, Simmons  DM, Swanson  LW, Rosenfeld  MG. Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature. 1990;347 (6293 ):528‐533.1977085
9 Perez Millan  MI, Brinkmeier  ML, Mortensen  AH, Camper  SA. PROP1 triggers epithelial-mesenchymal transition-like process in pituitary stem cells. Elife. 2016;5 :e14470.27351100
10 Nasonkin  IO, Ward  RD, Raetzman  LT ,  et al  Pituitary hypoplasia and respiratory distress syndrome in Prop1 knockout mice. Hum Mol Genet. 2004;13 (22 ):2727‐2735.15459176
11 Sornson  MW, Wu  W, Dasen  JS, et al  Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature. 1996;384 (6607 ):327‐333.8934515
12 Gage  PJ, Brinkmeier  ML, Scarlett  LM, Knapp  LT, Camper  SA, Mahon  KA. The Ames dwarf gene, df, is required early in pituitary ontogeny for the extinction of Rpx transcription and initiation of lineage-specific cell proliferation. Mol Endocrinol. 1996;10 (12 ):1570‐1581.8961267
13 Cheung  LY, Okano  H, Camper  SA. Sox21 deletion in mice causes postnatal growth deficiency without physiological disruption of hypothalamic-pituitary endocrine axes. Mol Cell Endocrinol. 2017;439 :213‐223.27616671
14 Kiso  M, Tanaka  S, Saba  R, et al  The disruption of Sox21-mediated hair shaft cuticle differentiation causes cyclic alopecia in mice. Proc Natl Acad Sci U S A. 2009;106 (23 ):9292‐9297.19470461
15 Gangon  LH, Johnson  KR. A spontaneous deletion of the Pou3f4 gene causing inner ear abnormalities. MGI Direct Data Submission. 2003. http://www.informatics.jax.org/downloads/Reference_texts/J83049.pdf
16 Andersen  B, Pearse  RV  II, Jenne  K, et al  The Ames dwarf gene is required for Pit-1 gene activation. Dev Biol. 1995;172 (2 ):495‐503.8612966
17 Ward  RD, Raetzman  LT, Suh  H, et al  Role of PROP1 in pituitary gland growth. Mol Endocrinol. 2005;19 (3 ):698‐710.15591534
18 Cheung  LYM, Menage  L, Rizzoti  K, et al  Novel candidate regulators and developmental trajectory of pituitary thyrotropes. Endocrinology. 2023;164 (6 ):bqad076.37183548
19 Cheung  LYM, George  AS, McGee  SR, et al  Single-cell RNA sequencing reveals novel markers of male pituitary stem cells and hormone-producing cell types. Endocrinology. 2018;159 (12 ):3910‐3924.30335147
20 La Manno  G, Soldatov  R, Zeisel  A, et al  RNA velocity of single cells. Nature. 2018;560 (7719 ):494‐498.30089906
21 Stuart  T, Butler  A, Hoffman  P, et al  Comprehensive integration of single-cell data. Cell. 2019;177 (7 ):1888‐1902.e21.31178118
22 Hao  Y, Stuart  T, Kowalski  MH, et al  Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nat Biotechnol. 2024;42 (2 ):293‐304.37231261
23 Alquicira-Hernandez  J, Powell  JE. Nebulosa recovers single cell gene expression signals by kernel density estimation. Bioinformatics. 2021;37 (16 ):2485‐2487.33459785
24 Masser  BE, Brinkmeier  ML, Lin  Y, et al  Supplemental figure 1 for ‘gene misexpression in a Smoc2+ve/Sox2-low population in juvenile Prop1-mutant pituitary gland’. Figshare. 10.6084/m9.figshare.26127232
25 Rizzoti  K, Chakravarty  P, Sheridan  D, Lovell-Badge  R. SOX9-positive pituitary stem cells differ according to their position in the gland and maintenance of their progeny depends on context. Sci Adv. 2023;9 (40 ):eadf6911.37792947
26 Cheung  LYM, Camper  SA. PROP1-dependent retinoic acid signaling regulates developmental pituitary morphogenesis and hormone expression. Endocrinology. 2020;161 (2 ):bqaa002.31913463
27 Masser  BE, Brinkmeier  ML, Lin  Y, et al  Supplemental figure 2 for ‘gene misexpression in a Smoc2+ve/Sox2-low population in juvenile Prop1-mutant pituitary gland’. Figshare. 10.6084/m9.figshare.26127238
28 Groeneweg  S, van Geest  FS, Abacı  A, et al  Disease characteristics of MCT8 deficiency: an international, retrospective, multicentre cohort study. Lancet Diabetes Endocrinol. 2020;8 (7 ):594‐605.32559475
29 Jang  BG, Kim  HS, Bae  JM, Kim  WH, Kim  HU, Kang  GH. SMOC2, an intestinal stem cell marker, is an independent prognostic marker associated with better survival in colorectal cancers. Sci Rep. 2020;10 (1 ):14591.32884102
30 Feng  D, Gao  P, Henley  N, et al  SMOC2 promotes an epithelial-mesenchymal transition and a pro-metastatic phenotype in epithelial cells of renal cell carcinoma origin. Cell Death Dis. 2022;13 (7 ):639.35869056
31 Morkmued  S, Clauss  F, Schuhbaur  B, et al  Deficiency of the SMOC2 matricellular protein impairs bone healing and produces age-dependent bone loss. Sci Rep. 2020;10 (1 ):14817.32908163
32 Takahata  Y, Hagino  H, Kimura  A, et al  Smoc1 and Smoc2 regulate bone formation as downstream molecules of Runx2. Commun Biol. 2021;4 (1 ):1199.34667264
33 Bloch-Zupan  A, Jamet  X, Etard  C, et al  Homozygosity mapping and candidate prioritization identify mutations, missed by whole-exome sequencing, in SMOC2, causing major dental developmental defects. Am J Hum Genet. 2011;89 (6 ):773‐781.22152679
34 Long  F, Shi  H, Li  P, et al  A SMOC2 variant inhibits BMP signaling by competitively binding to BMPR1B and causes growth plate defects. Bone. 2021;142 :115686.33059102
35 Munoz  J, Stange  DE, Schepers  AG, et al  The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent ‘+4’ Cell markers. EMBO J. 2012;31 (14 ):3079‐3091.22692129
36 Kok  YJMd, van der Maarel  SM, Bitner-Glindzicz  M, et al  Association between X-linked mixed deafness and mutations in the POU domain gene POU3F4. Science. 1995;267 (5198 ):685‐688.7839145
37 Choi  BY, Kim  DH, Chung  T, et al  Destabilization and mislocalization of POU3F4 by C-terminal frameshift truncation and extension mutation. Hum Mutat. 2013;34 (2 ):309‐316.23076972
38 Hosoya  M, Fujioka  M, Matsuda  S, et al  Expression and function of Sox21 during mouse cochlea development. Neurochem Res. 2011;36 (7 ):1261‐1269.21287267
39 Saint-Jeannet  JP, Moody  SA. Establishing the pre-placodal region and breaking it into placodes with distinct identities. Dev Biol. 2014;389 (1 ):13‐27.24576539
40 Li  X, Ohgi  KA, Zhang  J, et al  Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis. Nature. 2003;426 (6964 ):247‐254.14628042
41 Nica  G, Herzog  W, Sonntag  C, et al  Eya1 is required for lineage-specific differentiation, but not for cell survival in the zebrafish adenohypophysis. Dev Biol. 2006;292 (1 ):189‐204.16458879
42 Xu  PX, Adams  J, Peters  H, Brown  MC, Heaney  S, Maas  R. Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nat Genet. 1999;23 (1 ):113‐117.10471511
43 Carvalho  LR, Brinkmeier  ML, Castinetti  F, Ellsworth  BS, Camper  SA. Corepressors TLE1 and TLE3 interact with HESX1 and PROP1. Mol Endocrinol. 2010;24 (4 ):754‐765.20181723
44 Masser  BE, Brinkmeier  ML, Lin  Y, et al  Supplemental figure 3 for ‘gene misexpression in a Smoc2+ve/Sox2-low population in juvenile Prop1-mutant pituitary gland’. Figshare. 10.6084/m9.figshare.26127241
