
==== Front
J Biol Chem
J Biol Chem
The Journal of Biological Chemistry
0021-9258
1083-351X
American Society for Biochemistry and Molecular Biology

S0021-9258(24)02112-4
10.1016/j.jbc.2024.107611
107611
Research Article
Cleavage of protein kinase c δ by caspase-3 mediates proinflammatory cytokine-induced apoptosis in pancreatic islets
Collins Jillian 1
Piscopio Robert A. 23
Reyland Mary E. 4
Johansen Chelsea G. 1
Benninger Richard K.P. richard.benninger@cuanschutz.edu
23∗
Farnsworth Nikki L. nfarnsworth@mines.edu
12∗
1 Department of Chemical and Biological Engineering, Colorado School of Mines, Golden, Colorado, USA
2 Barbara Davis Center for Childhood Diabetes, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA
3 Department of Bioengineering, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA
4 Department of Craniofacial Biology, School of Dental Medicine, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA
∗ For correspondence: Nikki L. Farnsworth; Richard K. P. Benninger richard.benninger@cuanschutz.edunfarnsworth@mines.edu
27 7 2024
9 2024
27 7 2024
300 9 10761114 1 2024
4 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
In type 1 diabetes (T1D), autoreactive immune cells infiltrate the pancreas and secrete proinflammatory cytokines that initiate cell death in insulin producing islet β-cells. Protein kinase C δ (PKCδ) plays a role in mediating cytokine-induced β-cell death; however, the exact mechanisms are not well understood. To address this, we used an inducible β-cell specific PKCδ KO mouse as well as a small peptide inhibitor of PKCδ. We identified a role for PKCδ in mediating cytokine-induced β-cell death and have shown that inhibiting PKCδ protects pancreatic β-cells from cytokine-induced apoptosis in both mouse and human islets. We determined that cytokines induced nuclear translocation and activity of PKCδ and that caspase-3 cleavage of PKCδ may be required for cytokine-mediated islet apoptosis. Further, cytokine activated PKCδ increases activity both of proapoptotic Bax with acute treatment and C-Jun N-terminal kinase with prolonged treatment. Overall, our results suggest that PKCδ mediates cytokine-induced apoptosis via nuclear translocation, cleavage by caspase-3, and upregulation of proapoptotic signaling in pancreatic β-cells. Combined with the protective effects of PKCδ inhibition with δV1-1, the results of this study will aid in the development of novel therapies to prevent or delay β-cell death and preserve β-cell function in T1D.

Keywords

protein kinase C δ
pancreatic islet
β-cell
apoptosis
proinflammatory cytokines
caspase-3
type 1 diabetes
Abbreviations

δCKAR PKCδ FRET-based kinase activity reporter

BMI body mass index

FBS fetal bovine serum

FLIM fluorescence lifetime imaging

FRET fluorescence resonance energy transfer

GFP green fluorescent protein

IFN-γ interferon-γ

IL-1β interleukin 1-beta

JNK C-Jun N-terminal kinase

MIN6 mouse insulinoma 6

MIP mouse insulin promoter

PI propidium iodide

p-JNK phospho-JNK

PKCδ protein kinase C δ

STAT1 signal transducer and activator of transcription

T1D type 1 diabetes

TNF-α tumor necrosis factor-α

Reviewed by members of the JBC Editorial Board. Edited by Donita C. Brady
==== Body
pmcType 1 diabetes (T1D) is characterized by the selective immune-mediated destruction of insulin producing β-cells in pancreatic islets (1, 2). Clinical onset of T1D results in life-long dependence on exogenous insulin and is associated with long-term complications including, ophthalmic, kidney, cardiovascular, and neurological disorders (3). While current therapeutic strategies aim to control glucose levels, they do not stop disease progression nor prevent disease complications. Furthermore, current clinical trials to prevent or reverse disease outcomes have had limited success, including modest disease remission and incomplete recovery of normoglycemia (4, 5). The exact mechanisms regulating β-cell death during T1D pathogenesis are not fully understood, making it difficult to develop effective therapies to preserve endogenous β-cells.

In T1D, proinflammatory cytokines secreted from autoreactive immune cells play a crucial role in β-cell apoptosis (6). Studies have shown that the proinflammatory cytokines tumor necrosis factor-α (TNF-α), interleukin 1-beta (IL-1β), and interferon-γ (IFN-γ) work synergistically to induce islet dysfunction and β-cell death in vitro (7, 8, 9). In the β-cell, cytokine-mediated apoptosis has been shown to occur through either activation of mitogen-activated protein kinase, or activation of nuclear factor kappa B or activation of signal transducer and activator of transcription 1 (STAT1), all of which lead to activation of caspase-3 and apoptosis (6, 10). Our lab has previously shown that proinflammatory cytokines also disrupt gap junction coupling, calcium (Ca2+) signaling and impair insulin secretion in both mouse and human islets via upregulation of protein kinase C δ (PKCδ) activity (7).

PKCδ regulates many cellular functions including cell proliferation, differentiation, and apoptosis (11). In response to apoptotic stimuli, such as DNA damaging H2O2 and infrared radiation, tyrosine sites on PKCδ are phosphorylated leading to a conformational change in PKCδ into its active state where it can initiate apoptosis through phosphorylation of downstream proapoptotic signaling messengers (12, 13, 14, 15). PKCδ has been shown to mediate fatty acid–induced apoptosis in human β-cells and studies using a mouse model with overexpression of a kinase-negative PKCδ protected against high-fat diet–mediated apoptosis (16, 17). Similarly, a whole-body KO of PKCδ protected against β-cell death in streptozotocin induced diabetes in mice in vivo and cytokine treated β-cells in vitro (18). However, PKCδ is ubiquitously expressed throughout the body and a global KO leads to spontaneous β-cell proliferation resulting in an increased autoimmunity (19).

While PKCδ has previously been implicated in mediating β-cell apoptosis in mouse islets, the mechanism by which PKCδ regulates cytokine-induced apoptosis has not been well-defined in the β-cell. In normal epithelial cells and some cancer cells, etoposide activated PKCδ is cleaved by caspase-3 into a 40 kDa catalytically active fragment that translocates to the nucleus and mediates cell apoptosis (12, 20). As caspase-3 activation plays a role in cytokine-mediated β-cell death, the goal of this study is to understand the role of caspase-3 in mediating PKCδ regulation of cytokine-induced β-cell death. We hypothesized that cytokines secreted by autoreactive immune cells mediate β-cell death through a signaling pathway that requires activation of PKCδ cleavage by caspase-3 and nuclear accumulation of PKCδ. We used isolated islets from a novel β-cell-specific PKCδ KO mouse or human islets treated with a cell permeable PKCδ inhibitor, δV1-1. Identification of novel regulators of cytokine-mediated human β-cell death will provide new avenues toward developing targeted therapies to preserve β-cell mass in T1D.

Results

Characterization of the PKCδfl/fl × MIP-CreER mouse

To assess the role of PKCδ in mediating cytokine-induced β-cell death, we developed a β-cell specific KO of PKCδ (PKCδ-βKO). β-cell specificity was achieved using mouse insulin promoter (MIP) Cre-ER on the C57Bl/6 mouse background, which is expected to produce mosaic expression in β-cells based on previous results with the inducible Cre-ER system (21). We also bred our MIP-CreER line with a mouse line with tdTomato reporter of Cre recombination inserted into Rosa26 locus as a marker of Cre-induced KO (22). Islets isolated from PKCδ-βKO mice 2 weeks after tamoxifen injection showed robust expression of tdTomato in 76.5 ± 5% of cells, where tdTomato is a reporter for Cre recombination and KO of PKCδ (Fig. 1A). For reference, mouse islets are composed of an average of 60 to 80% β-cells (23). PKCδ-βKO islets had 58% less PKCδ protein compared to control (PKCδfl/fl) as determined by Western blot (p = 0.015, Fig. 1, B and C). No significant alterations in glucose tolerance levels were observed between the PKCδ-KO and control mice using an intraperitoneal glucose tolerance test (Fig. 1D).Figure 1 β-cell specific inducible KO of PKCδ (PKCδ-βKO).A, representative images of tdTomato fluorescence (red) in PKCδ-βKO islets stained with a live cell dye (green) 2 weeks after tamoxifen injection, where 76.5 ± 5% of all cells were tdTomato positive (n = 4). B, representative Western blot of PKCδ and β-actin controls from islets isolated from four control and four age and gender matched PKCδ-βKO mice 2 weeks after tamoxifen injection. Images are from the same blot that has been cropped to remove the empty lane between samples. C, quantification of Western blots from panel A of PKCδ protein normalized to β-actin in islet isolated from control and PKCδ-βKO mice 2 weeks after tamoxifen injection (n = 4). p < 0.05 is statistically significant based on a paired-sample t test. D, blood glucose levels during a glucose tolerance test in 8 to 15-week-old control and age and gender matched control (MIPCreER negative) and PKCδ-βKO mice 2 weeks after tamoxifen injection following a glucose bolus (n = 3). MIP, mouse insulin promoter; PKCδ, protein kinase C δ.

PKCδ partially mediates cytokine-induced apoptosis in mouse and human islets

To determine if PKCδ is required for cytokine-induced apoptosis in the β-cell, isolated PKCδ-βKO, MIP Cre-ER positive, and control islets were treated with or without a cocktail of proinflammatory cytokines TNF-α (10 ng/ml), IL-1β (5 ng/ml), and IFN-γ (100 ng/ml) for 24 h. A significant increase in apoptotic cells, as measured with YO-PRO1 (Fig. 2A), was observed in cytokine treated control and MIP Cre-ER positive islets compared to untreated control islets (p < 0.001, Fig. 2B). The percentage of YO-PRO1 positive cells was significantly reduced in the cytokine-treated PKCδ-βKO islets compared to MIP Cre-ER negative control or MIP Cre-ER positive islets (p = 0.003, Fig. 2B). Similar results were seen with the untreated and cytokine treated WT and PKCδ-βKO islets stained with NucBlue and Annexin V, a stain that labels cells undergoing apoptosis (Fig. 2, C and D). Islets were also treated with Fluozin3, a zinc2+ sensor that has been previously used to identify insulin granules in β-cells, in addition to NucBlue Live cell stain and propidium iodide for dead cells (Fig. 2, E and F) (24, 25, 26). The percentage of propidium iodide (PI) positive β-cells was significantly less in the cytokine cocktail treated PKCδ-βKO islets compared to control islets (p = 0.04, Fig. 2E). Mouse C57Bl/6 and human islets were also treated with or without cytokine cocktail and with or without the PKCδ peptide inhibitor δV1-1. Both mouse (p < 0.001) and human (p = 0.02) islets treated with cytokine cocktail displayed a decrease in the percentage of YO-PRO1 positive cells with δV1-1 treatment compared to cytokine only control (Fig. 2, G and H). These data support a role for PKCδ in mediating cytokine-induced apoptosis, specifically in pancreatic β-cells.Figure 2 PKCδ mediates cytokine-induced islet apoptosis.A, representative images of live (red) cells as measured by NucRed Live and YO-PRO1 positive cells in WT control and PKCδ-βKO islets untreated and treated with cytokines for 24 h. B, percent YO-PRO1 cells in isolated control, MIP Cre-ER positive or PKCδ-βKO mouse islets treated for 24 h with a cytokine cocktail compared to untreated islets quantified in 4 to 5 islets per mouse from 16 animals (n = 16). C, representative images of live (blue) cells as measured by NucBlue Live and apoptotic cells as measured by Annexin V staining in WT control and PKCδ-βKO islets untreated and treated with cytokines for 24 h. D, percent Annexin V positive cells in isolated control, MIP Cre-ER positive or PKCδ-βKO mouse islets treated for 24 h with a cytokine cocktail compared to untreated islets. Apoptosis was quantified in 3 to 5 islets per mouse from 3 to 4 animals, where each animal represents an independent islet isolation (n = 3–4). E, percent Fluozin3 positive (β-cell) propidium iodide (PI) positive dead cells in isolated control or PKCδ-βKO mouse islets treated for 24 h with a cytokine cocktail compared to untreated islets (n = 3). F, representative images of FluoZin-3 staining of β-cells (green), live cells labeled with NucBlue live (blue), and dead cells labeled with propidium iodide (PI, red). G, percent YO-PRO1 positive cells in C57Bl/6 mouse islets treated for 24 h with a cytokine cocktail and the PKCδ inhibitor dV1-1 in 4 to 5 islets per mouse isolation in seven animals (n = 7). H, percent YO-PRO1 positive cells in human islets from four donors treated for 24 h with a cytokine cocktail and the PKCδ inhibitor dV1-1 in 4 to 5 islets from four different human donors (n = 4). ∗Indicates a significant difference in cytokine treated samples compared to untreated controls for islets from each respective mouse. p < 0.05 indicates statistical significance based on ANOVA with Tukey’s post hoc analysis. MIP, mouse insulin promoter; PKCδ, protein kinase C δ.

Cytokine treatment induces nuclear translocation and activity of PKCδ in islets

Nuclear translocation of PKCδ is an indication of activation and is associated with the proapoptotic functions of PKCδ (27). To investigate whether a cytokine cocktail induced nuclear translocation of PKCδ in pancreatic islet β-cells, PKCδ-βKO islets were transduced with an adenovirus to overexpress GFP fused to the c terminus of PKCδ (GFP-PKCδ, Fig. S1) or with an adenovirus to express GFP alone as a control overnight and transduced cells were cultured with or without cytokine cocktail for 24 h (27). GFP-PKCδ was expressed in PKCδ-βKO islets to avoid cell death due to supraphysiological levels of PKCδ. Prior to imaging, islets were stained with NucRed live to determine nuclear versus cytosolic PKCδ localization. In untreated islets that were successfully transfected with the GFP-PKCδ virus we observed diffuse GFP signal throughout the cytosol and the nucleus, with nuclear GFP intensity generally lower than cytosolic GFP (Fig. 3A). We observed an increase in GFP fluorescence in the cell nuclei with cytokine cocktail treatment compared to untreated controls (Fig. 3A, red arrows). Furthermore, at both 3 h (p = 0.034) and 24 h (p < 0.001) time points, the fluorescence intensity in the nucleus normalized to the cytosol significantly increased in cytokine-treated islets compared to untreated controls (Fig. 3B). We also transfected cells with GFP only using an adenoviral vector to confirm that GFP was not influencing the observed nuclear translocation with cytokine cocktail treatment. No significant change in the fluorescence intensity in the nucleus normalized to the cytosol was observed in PKCδ-βKO islets treated with GFP only virus with cytokine cocktail treatment compared to untreated controls (Fig. 3C).Figure 3 Cytokines induce nuclear translocation and activity of PKCδ.A, representative images of GFP-PKCδ (green) in PKCδ-βKO islets costained with NucRedLive (red) and either untreated or treated with cytokines for 24 h. Red arrows point to nuclei with increased fluorescence intensity compared to cytoplasm in cytokine treated samples. B, quantification of GFP intensity in the nucleus normalized to intensity in the cytoplasm of each cell in 4 to 5 islets per experiment (3 h n = 4, 24 h n = 10). C, quantification of GFP intensity in PKCδ-βKO islets costained with NucRedLive (red) and transduced with GFP only and treated with cytokines for 24 h (n = 4). D, representative images YFP and CFP emission with CFP excitation using the fluorescence resonance energy transfer (FRET) sensor for PKCδ (δCKAR) targeted to the nucleus. E, representative images of fluorescence lifetime imaging in mouse insulinoma 6 (MIN6) cells transfected with the FRET-based PKCδ activity sensor in E. Images on the top represent the number of photon counts and images on the bottom represent the calculated fluorescence lifetime in ns for untreated (left panel) and cytokine treated (right panel) MIN6 cells after 1.5 h culture. F, quantification of PKCδ activity by fluorescence lifetime imaging of the FRET sensor for PKCδ activity in the nucleus in MIN6 cells either untreated or treated with cytokines for 1.5 h (n = 3). In panels B and C, p < 0.05 indicates a significant difference as determined by ANOVA with Tukey’s post hoc analysis. In panel E, p < 0.05 indicates a significant difference as determined by students t test. CFP, cyan fluorescent protein; PKCδ, protein kinase C δ; YFP, yellow fluorescent protein.

We next measured changes in nuclear activity of PKCδ with cytokine cocktail treatment using a nuclear targeted PKCδ fluorescence resonance energy transfer (FRET)-based kinase activity reporter (δCKAR) in mouse insulinoma 6 (MIN6) cells. Expression of δCKAR was primarily localized to the nucleus (Fig. 3D). The average lifetime in the nuclear region of the cells (Fig. 3E) was measured using fluorescence lifetime imaging (FLIM) using a threshold on photon counts to calculate to determine changes in FRET with cytokine cocktail treatment. For reference, when no FRET is occurring and PKCδ is maximally active the expected lifetime is ∼2.9 ns; however, when FRET occurs with 100% efficiency and there is no PKCδ activity the anticipated lifetime is ∼1.9 ns (28). We found that the fluorescence lifetime of the δCKAR sensor increased in cells treated with cytokine cocktail, which indicates an increase in PKCδ activity in the nuclei of cytokine cocktail treated cells compared to untreated controls after 1.5 h of treatment (p = 0.039, Fig. 3F).

Cytokine-induced cleavage of PKCδ by caspase-3

In several cell types, cleavage of PKCδ yields a constitutively active fragment that localizes to the nucleus to promote apoptosis (29). Therefore, to determine if caspase-3 cleaves PKCδ during cytokine cocktail-induced apoptosis, and if caspase cleavage is necessary for cytokine-induced apoptosis, PKCδ-βKO islets were transduced with an adenovirus encoding a GFP-PKCδ peptide, where the sequence that can be cleaved by caspase-3 has been mutated to prevent PKCδ cleavage (CM-GFP-PKCδ). The islets treated with viruses coding for GFP-only, GFP-PKCδ, or CM-GFP-PKCδ were cultured for 24 h with or without cytokine cocktail (Fig. S1). Cytokine cocktail caused significant increases in YO-PRO1 positive cells under all conditions tested (Fig. 4A). No significant differences were observed in cytokine cocktail-induced cell death levels between the PKCδ-βKO alone and GFP-only treatment (Fig. 4A), indicating that GFP does not contribute to islet death. There was a significant increase in cytokine cocktail-induced cell death in islets expressing GFP-PKCδ compared to islets with no virus pre-treatment (p < 0.001, Fig. 4A), indicating normal function of the GFP-PKCδ peptide in the islet. The cytokine cocktail-treated CM-GFP-PKCδ islets showed a significant reduction in the percentage of dead cells compared to cytokine cocktail treated GFP-PKCδ islets (p < 0.001, Fig. 4A) and similar levels to GFP only treated cells indicating the inhibition of caspase-3 cleavage can mitigate PKCδ mediated apoptosis. Translocation of the CM-GFP-PKCδ to the nucleus was also measured as previously described, and an increase in the nuclear to cytosolic ratio of the GFP intensities was observed with cytokine cocktail treatment (p = 0.009, Fig. 4B), indicating increased nuclear translocation of the intact PKCδ determined as described above. Additionally, Western blot confirmed that similar levels of GFP-PKCδ and CM-GFP-PKCδ expression were obtained in PKCδ-βKO islets (Fig. 4, C and D). These results show that caspase cleavage of PKCδ is required for PKCδ-mediated apoptosis; however, cleavage is not required for nuclear translocation with cytokine cocktail treatment.Figure 4 Cleavage of PKCδ is required for cytokine-mediated islet apoptosis.A, percent YO-PRO1 positive cells in mouse PKCδ-βKO islets treated for 24 h with a cytokine cocktail and either GFP-only, GFP-PKCδ, or CM-GFP-PKCδ virus compared to untreated islets in 4 to 5 islets per isolation (n = 4). ∗Indicates a significant difference from untreated islets (p < 0.01). B, quantification of GFP fluorescence intensity in the nucleus normalized to intensity in the cytosol in PKCδ-βKO mouse islets transfected with the CM-GFP-PKCδ virus as in A and either untreated or treated with cytokines for 24 h in 4 to 5 islets per experiment (n = 3). C, representative Western blot of GFP-PKCδ, CM-GFP-PKCδ, and β-actin expression in PKCδ-βKO islets compared to control islets not treated with virus 24 h after treatment. D, quantification of the blots in E of GFP-PKC or CM-GFP-PKCδ in PKCδ-βKO islets normalized to β-actin expression (n = 3). E, representative Western blot of PKCδ, β-actin, and nuclear marker histone cluster 1 H3D in lysates from human islets treated for 24 h with or without cytokines and with or without the PKCδ inhibitor δV1-1. Islet lysates were fractionated into cytosolic and nuclear fractions. Images are from the same blot that has been cropped to place the cytoplasmic samples on the left. Two bands were identified for PKCδ staining, one at 75 kDa representing full length PKCδ and one at 45 kDa representing a cleaved version of PKCδ (Cl-PKCd). Quantification of the blots in A of either intact PKCδ (75 kDa) (F) or the 45 kDa PKCδ fragment (G) in both the cytosolic and nuclear fractions normalized to β-actin and further normalized to untreated control samples. p < 0.05 indicates a significant difference based on ANOVA. PKCδ, protein kinase C δ.

To determine if caspase-3 play a similar role in mediating cytokine-induced apoptosis and PKCδ cleavage in human islets, subcellular fractionation of lysates and Western blot were used to observe changes in both intact (78 kDa) and cleaved fragments (Cl-PKCδ, 45 kDa) of PKCδ in both the cytosolic and nuclear fractionations of human islet lysates treated with or without cytokine cocktail and with or without the PKCδ inhibitor δV1-1 (Fig. 4E). Staining of histone cluster 1 H3D in the nuclear fraction and not in the cytosolic fraction confirmed separation of the cytosolic and nuclear lysate (Fig. 4E). Quantification of the blot stained for PKCδ and β-actin revealed no significant changes in full-length PKCδ (78 kDa) in the cytosolic fraction or the nuclear fraction under any treatment, when normalized to untreated samples (Fig. 4F). This suggests that PKCδ translocation measured in Figure 3, A and B was mainly the PKCδ fragment, as GFP is fused to the c terminus (Fig. S1) and will identify both intact and cleaved PKCδ. While a fragment (45 kDa) of PKCδ was observed in the cytosol for all samples (Fig. 4E), no significant changes were observed in the PKCδ fragment in the cytosol under any treatment, when normalized to untreated samples (Fig. 4G). A significant increase in the PKCδ fragment was observed in the nuclear fraction of cytokine cocktail treated islets compared to untreated controls (based on 95% confidence interval, Fig. 4G). Treatment with the PKCδ inhibitor δV1-1 reduced cytokine-mediated increases in the PKCδ fragment in the nucleus (p = 0.053, Fig. 4G), supporting a reduction in PKCδ cleavage. These results support that δV1-1 inhibits activation of PKCδ as previous studies have shown that the caspase-3 cleavage site on PKCδ is only accessible after conversion of PKCδ from its immature folded conformation to an unfolded and activated conformation (15, 29, 30, 31). Overall, these results support that cytokine-mediated cleavage of PKCδ is required for β-cell death in both mouse and human islets.

To further verify the role of caspase-3 in cytokine-mediated apoptosis and regulation of PKCδ, mouse and human islets were treated for 24 h with the caspase-3 inhibitor ZEVD-FMK with or without cytokine cocktail (Fig. 5). Inhibiting caspase-3 protected against cytokine-induced cell death in both mouse (p < 0.001) and human islets (Fig. 5, A and B) as indicated with YO-PRO1 positive staining. To determine if inhibiting caspase-3 altered cleavage of PKCδ with and without cytokine treatment, Western blot analysis of PKCδ and β-actin was performed on control and PKCδ-βKO mouse islet lysates treated for 24 h with or without ZEVD-FMK and with or without cytokines (Fig. 5C). While inhibiting caspase-3 had no significant impact on the level of full-length PKCδ normalized to β-actin (Fig. 5D), we observed a decrease in the level of the PKCδ fragment (45 kDa) normalized to β-actin (Fig. 5E) or normalized to intact PKCδ (Fig. 5F) in ZEVD-FMK treated islets compared to untreated controls. A similar decrease in levels of the PKCδ fragment was observed in islets treated with cytokines and ZEVD-FMK compared to cytokine cocktail alone (p = 0.05, Fig. 5E). Overall, these results support the conclusion that caspase-3 cleavage of PKCδ is required for PKCδ mediation of cytokine-induced β-cell apoptosis in both mouse and human islets.Figure 5 Inhibiting caspase-3 protects against cytokine induced apoptosis and prevents PKCδ cleavage.A, percent YO-PRO1 positive cells in mouse C57Bl/6 islets treated for 24 h with a cytokine cocktail and caspase-3 inhibitor Z-DEVD-FMK as indicated compared to untreated islets in 4 to 5 islets per treatment per isolation (n = 4). B, percent YO-PRO1 positive cells in human islets treated for 24 h with a cytokine cocktail and the caspase-3 inhibitor Z-DEVD-FMK as indicated compared to untreated islets (n = 3). ∗Indicates a significant difference from untreated islets (p < 0.01). C, representative Western blots of PKCδ and β-actin in lysates from C57Bl/6 mouse islets treated with or without cytokines and with or without the caspase-3 inhibitor Z-DEVD-FMK for 24 h as in A and B. D, quantification of the blots in C of intact (75 kDa) PKCδ normalized to β-actin, where data were normalized to untreated controls for each experiment (n = 5). E, quantification of the blots in C of the PKCδ fragment (45 kDa) normalized to β-actin, where data were normalized to untreated controls for each experiment (n = 5). F, quantification of the blots in C of the PKCδ fragment (45 kDa) normalized to intact PKCδ (75 kDa), where data were normalized to untreated controls for each experiment (n = 5). In D–F, ∗indicates a significant difference from untreated controls as determined by 95% CI. p < 0.05 in all panels indicates a significant difference based on ANOVA. CI, confidence interval; PKCδ, protein kinase C δ.

Cytokine-activated PKCδ mediates proapoptotic signaling

Finally, we investigated PKCδ-mediated changes in proapoptotic signaling, including Bax and C-Jun N-terminal kinases (JNKs), with acute (1 h) and prolonged (24 h) exposure to cytokine cocktail. Control and PKCδ-βKO islets were either untreated or treated with cytokine cocktail for 1 or 24 h and levels of Bax, phospho-JNK (p-JNK), JNK, and β-actin were analyzed via Western blot (Fig. 6). After 1 h cytokine cocktail treatment, we found slight increases in Bax levels in WT islets treated with cytokine cocktail compared to untreated controls (Fig. 6, A and C). The cytokine-mediated increase in Bax was abolished in PKCδ-βKO islets compared to WT controls (p = 0.018, Fig. 6, A and C). JNK1 (46 kDa) and JNK2 (54 kDa) were both observed with JNK staining of the Western blot (Fig. 6B). We found that after 1 h cytokine treatment, no significant changes in p-JNK normalized to total JNK1 (46 kDa) were observed between cytokine cocktail treated islets and untreated controls or between WT and PKCδ-βKO islets (Fig. 6, B and D). After 24 h of cytokine cocktail treatment, we found that Bax levels were similar in both control and PKCδ-βKO islets either untreated or treated with cytokine cocktail for 24 h (Fig. 6, E and G). An increase in p-JNK/JNK1 was observed with cytokine cocktail treatment in control islets that was abolished in PKCδ-βKO islets (p = 0.025, Fig. 6, F and H). Only the quantification of JNK1 is shown as JNK2 levels did not significantly change in control versus PKCδ-βKO islets either in untreated or cytokine cocktail treated conditions (data not shown). Overall, these data support a role for PKCδ in differentially regulating cytokine-mediated proapoptotic signaling at 1 h versus 24 h in the islet.Figure 6 PKCδ mediates pro-apoptotic signaling.A, representative Western blots of Bax and β-actin in lysates from control and PKCδ-βKO mouse islets treated with or without cytokines for 1 h. Blots were cropped to put images of WT islet lysates to the left of PKCδ-βKO islet lysates to match the other panels. B, representative Western blot of JNK, p-JNK, and β-actin in lysates from control and PKCδ-βKO mouse islets treated with or without cytokines for 1 h. C, quantification of the blots in A, where Bax levels were normalized to β-actin for each condition (n = 9–12). D, quantification of the blots in B, where p-JNK was normalized to JNK1 (46 kDa) levels (n = 5–7). E, representative Western blots of Bax and β-actin in lysates from control and PKCδ-βKO mouse islets treated with or without cytokines for 24 h. Blots were cropped to put images of WT islet lysates to the left of PKCδ-βKO islet lysates to match the other panels. F, representative Western blot of JNK, p-JNK, and β-actin in lysates from control and PKCδ-βKO mouse islets treated with or without cytokines for 24 h. G, quantification of the blots in E, where Bax levels were normalized to β-actin for each condition (n = 4). H, quantification of the blots in F, where p-JNK was normalized to JNK1 (46 kDa) levels (n = 8–9). In panels C, D, G, and H p < 0.05 indicates a significant difference based on ANOVA with Tukey’s post hoc analysis. JNK, C-Jun N-terminal kinase; p-JNK, phospho-JNK; PKCδ, protein kinase C δ.

Discussion

The goal of this study was to elucidate the mechanism by which PKCδ mediates cytokine-induced apoptosis and identify a role for caspase-3 cleavage of PKCδ in regulating cytokine-mediated β-cell death in pancreatic islets. Utilizing an inducible β-cell specific PKCδ KO mouse as well as a small peptide inhibitor of PKCδ, we confirmed that PKCδ activity plays an active role in mediating cytokine-induced islet apoptosis in both mouse and human islets. We determined that cytokines induce nuclear translocation and activity of PKCδ. Further, our results support that caspase-3 cleavage of PKCδ is required for cytokine-mediated islet apoptosis. Ultimately, cytokine-activated PKCδ was shown to regulate proapoptotic Bax expression at 1 h with acute cytokine treatment and JNK activity with prolonged cytokine treatment, suggesting a downstream mechanism of PKCδ-mediated apoptosis as shown in Figure 7. Combined with the protective effects of PKCδ inhibition with δV1-1, the results of this study will aid in the development of novel therapies to prevent or delay β-cell death and preserve β-cell function in T1D.Figure 7 Proposed mechanism for PKCδ regulation of cytokine-induced β-cell death. Cytokine activated PKCδ is cleaved by caspase-3 into a 45 kDa fragment that translocates to and accumulates in the nucleus. Cytokine activated PKCδ promotes apoptosis through activation of Bax and JNK. We propose that catalytic activity of PKCδ in the cytosol activates Bax while nuclear PKCδ activity upregulates expression of kinases that activate JNK downstream of PKCδ. Created with BioRender.com. JNK, C-Jun N-terminal kinase; PKCδ, protein kinase C δ.

Inhibition of PKCδ protects against cytokine-induced death

Proinflammatory cytokines play a critical role in mediating islet cell death and dysfunction in T1D (6, 7, 32). Several studies have identified a potential role for PKCδ in mediating cytokine-induced β-cell death. For example, a KO of PKCδ, or expression of a kinase negative PKCδ, protected against cytokine-induced islet death and improved glucose homeostasis and β-cell function in high-fat diet mice in vitro (17, 18, 33). While these findings support a role for PKCδ in mediating cytokine-induced islet death, the results are confounded by the effects from a whole body PKCδ KO as PKCδ is ubiquitously expressed (19). To determine the role of PKCδ specifically in mediating β-cell death, we generated and characterized a novel mouse line with an inducible β-cell specific KO of PKCδ (PKCδ-βKO). Contrary to previously published results indicating that loss of PKCδ impairs glucose tolerance, our PKCδ-βKO mice were normoglycemic compared to control controls (34, 35). While this may be due to incomplete loss of PKCδ protein in the islets of our transgenic mouse, this may also be indicative of confounding effects of a whole-body KO from loss of PKCδ in the liver, where previous studies have indicated that global PKCδ KO impairs insulin sensitivity (36, 37). Our data support Cre-mediated KO of PKCδ in ∼76% of islet cells, which is in agreement with previous studies indicating that 60 to 80% of rodent islets are composed of β-cells (23). It has been previously reported that PKCδ is present in α-cells, which comprise up to 20% of a pancreatic islet that may also explain the incomplete KO of PKCδ in whole islet lysates (38). Overall, our results support KO of PKCδ in the majority of β-cells that will allow us to probe the role of PKCδ in mediating cytokine-induced apoptosis.

Our results indicate that KO of PKCδ significantly protects against cytokine-induced apoptosis in mouse islets. To specifically analyze β-cell apoptosis, we used the YO-PRO1 dye, which labels early apoptotic cells through selective permeability and has been previously shown to overlap with terminal deoxynucleotidyl transferase dUTP nick end labeling staining of apoptotic cells and not PI staining of membrane integrity, supporting protection against β-cell apoptosis (39). Furthermore, this protection was specific to β-cells, as β-cell specific cytokine-induced apoptosis was reduced in PKCδ-βKO islets compared to WT controls, demonstrating the efficacy of our β-cell KO mouse.

To confirm our results with a genetic KO of PKCδ, we also utilized a cell permeable inhibitor of PKCδ, δV1-1, a Food and Drug Administration approved peptide that specifically inhibits PKCδ binding to membrane-associated RACK anchor proteins that facilitate PKCδ activation by inducing a conformation change (40). Our results in human islets treated with cytokines and with or without δV1-1 show a reduction in PKCδ cleavage and translocation to the nucleus. The caspase cleavage site and nuclear localization sequence of PKCδ are only accessible after PKCδ has been activated by phosphorylation and undergone a conformational change; therefore, our results support inhibition of cytokine-mediated PKCδ activation by δV1-1 (27, 41). We found inhibiting PKCδ activation with δV1-1 protects against cytokine-induced islet apoptosis in both mouse and human islets verified by both YO-PRO1 and Annexin V staining. Collectively, this supports a role for PKCδ in partially mediating cytokine-induced apoptosis in the β-cell and our results in human islets suggest that cytokine-induced activity of PKCδ may promote β-cell death under inflammatory conditions associated with diabetes (6). While our results with the Zn2+ sensor FluoZin-3 supports a role for PKCδ KO in specifically protecting the β-cell from cytokine-induced death, one limitation of using this sensor is it that diffusional limitations in the islet may prevent the dye from staining cells in the islet core, making it more difficult to identify β-cell deep within the islet (25). However, quantification of β-cell protection was limited to the first three cell layers, minimizing any potential limitations. Therefore, future studies are warranted to investigate the role of PKCδ in β-cell death during diabetes pathogenesis and to determine therapeutic efficacy of δV1-1 in protecting against β-cell death in T1D.

Cleavage and nuclear translocation of PKCδ is required for cytokine-mediated β-cell apoptosis

Full-length PKCδ is an isoenzyme of ∼78 kDa and is comprised of a regulatory and catalytic domain separated by a hinge region (15, 42). In the presence of apoptotic stimuli, such as ionizing radiation and etoposide, PKCδ has been shown to be proteolytically cleaved into a constitutively active catalytic fragment (∼45 kDa) which can undergo translocation from the cytosol to the nucleus via a nuclear localization sequence (27, 30, 31). In this study nuclear translocation and accumulation of PKCδ was observed with cytokine-treated islets via expression of a fusion protein with GFP tagged to the C terminus, showing localization of both full-length and cleaved PKCδ (Fig. S1). Furthermore, we demonstrated that PKCδ was cleaved into a smaller 45 kDa fragment in the presence of proinflammatory cytokines that accumulate in the nucleus. While we were unable to distinguish between the activity of full-length PKCδ and the 45 kDa fragment in the nucleus, we observed cytokine-mediated increases in nuclear PKCδ activity that correlates with increases accumulation of the 45 kDa fragment. Our results indicate that caspase-3 cleaves cytokine-activated PKCδ into the observed 45 kDa fragment and that cleavage is required for PKCδ mediated cytokine-induced apoptosis in the islet. While we were unable to determine if PKCδ is cleaved before or after nuclear translocation, DeVries-Seimon et al. provide evidence that supports intact PKCδ translocates to the nucleus before being cleaved by caspase-3 in etoposide-treated parC5 cells (19). Caspase-3 has also been shown to undergo nuclear translocation in α-Fas or etoposide-treated HepG2 cells only after activation, further suggesting that cleavage of PKCδ occurs in the nucleus (43). This is supported by our results where expression of a mutant PKCδ that cannot be cleaved by caspase-3 translocates to the nucleus in the presence of cytokines but translocation of the full-length PKCδ did not increase β-cell apoptosis. Overall, our results suggest that PKCδ participates in mediating cytokine-induced β-cell apoptosis via nuclear translocation and caspase-3 cleavage into a 45 kDa fragment. This novel mechanism of cytokine-induced apoptosis involving PKCδ and caspase-3 may present a unique target to prevent inflammation-induced β-cell death in diabetes.

Furthermore, our results support an increase in PKCδ activity in the nucleus, suggesting that PKCδ may partially mediate cytokine-induced apoptosis through phosphorylation and subsequent activation of downstream mediators of apoptosis either directly or through activation of transcription factors that regulate proapoptotic genes. Previous studies in keratinocytes have shown that PKCδ mediates activation of the signal transducer and activator of transcription 3 (STAT3) factor, which is regulated by cytokine signaling and increase expression of proapoptotic genes (44). In the β-cell, PKCδ has also been shown to activate the FOXO1 transcription factor in response to free fatty acids, leading to β-cell apoptosis (17). Taken together, our results supported further investigation into the role PKCδ in regulating cytokine-induced apoptosis via upregulation of proapoptotic signaling pathways.

Cytokine-activated PKCδ regulates proapoptotic signaling

PKCδ regulation of proapoptotic signaling has been characterized in several cell types. For example, in lung cancer cells exposed to ionized radiation, activation of PKCδ leads to downstream activation of proapoptotic Bax, ultimately resulting in apoptosis (45). Additionally, JNKs are a protein kinase family that regulate cell death, where cytokine-induced inflammation has been shown to specifically activate JNK1 (46, 47). This led us to investigate a potential role for PKCδ in mediating the activation of Bax and JNK with cytokine treatment. Our results are consistent with previous studies in human islets that showed increases in Bax activity between 1 to 3 h and increases in p-JNK at 1 h and 24 h after treatment with IL-1β and IFN-γ (48). Overall, our results in PKCδ-βKO islets support a role for activated PKCδ in regulating apoptotic signaling via a fast mechanism that activates Bax after 1 h of cytokine treatment and via a slower mechanism that activates JNK1 after 24 h of cytokine treatment. In human keratinocytes, activation of the catalytic subunit of PKCδ by 4-hydroxytamoxifen leads to redistribution and activation of Bax that initiates downstream cytochrome-c release from the mitochondrial and cell apoptosis (49). Furthermore, previous studies in cancer cells have shown that activated PKCδ upregulates expression of apoptosis signal-regulating kinase 1, which directly activates JNK via phosphorylation (50). Taken all together with our results, this supports a role for PKCδ in regulating cytokine-induced apoptosis via acute activation of Bax through catalytic activity in the cytosol and longer term upregulation of genes encoding for kinases that activate JNK. Future studies will further investigate the mechanisms by which PKCδ activates Bax and JNK as well as potential regulation of antiapoptotic signaling. Further characterization of the downstream signaling pathways mediated by PKCδ will provide novel insight into cellular targets to protect pancreatic islets from cytokine induced death in T1D.

Conclusion

To summarize, we identified a role for PKCδ in mediating cytokine-induced β-cell death and have shown that inhibiting PKCδ protects pancreatic β-cells from cytokine-induced apoptosis in both mouse and human islets. Proinflammatory cytokine treatment results in PKCδ translocation from the cytosol to the nucleus were PKCδ is cleaved by caspase-3. Cleavage by caspase-3 was also found to be required for PKCδ mediated cytokine-induced cell death. Furthermore, our data suggest that cytokine activated PKCδ increases the activity of the proapoptotic Bax with acute cytokine treatment and JNK1 with prolonged cytokine treatment. Overall, the results from this study provide novel insight into the role of PKCδ in mediating cytokine-induced apoptosis in pancreatic islets and supports a role for PKCδ in mediating cytokine-induced apoptosis in T1D in humans. Furthermore, the results of this study have clinical implications as targeted inhibition of this novel PKCδ mediated apoptotic pathway may preserve β-cell mass in T1D.

Experimental procedures

Mice

All experiments with mice were approved by the University of Colorado Denver Institutional Animal Care and Use Committee (Protocols 000929 and 00024). Animals were housed in a temperature-controlled facility with access to food and water ad libitum and were on a 12 h light/dark cycle. PKCδLoxP/LoxP (PKCδfl/fl) animals were a generous gift from Dr Ronald Kahn (36). MIP CreEr (51), Rosa26 tdTomato (22), and C57Bl/6 mice were purchased from The Jackson Laboratory. To generate a β-cell specific KO of PKCδ, PKCδfl/fl, and MIP-CreEr mice were bred, which we will refer to as control (PKCδfl/fl) and PKCδ-βKO (PKCδfl/flMIPCreEr). Control and PKCδ-βKO were bred in house, and genotyping was performed by Transnetyx using real-time PCR with the following primer sets: Cre (Forward: TTAATCCATATTGGCAGAACGAAAAC, Reverse: CAGGCTAAGTGCCTTCTCTACA), PKCδfl/fl (Forward: CTCCCCACCGATTAGTGTTGAAAA, Reverse: GGACGTAAACTCCTCTTCAGACCTA), PKCδWT (Forward: GGCAGTTATCTGACTCTTGCAGCT, Reverse: CCAAATAGGAACAACAGGTGCCTCT).

Human islets

Human islets were obtained from the Integrated Islet Distribution Program from the following donors: SAMN17928660 (62 year old White male, body mass index (BMI) 25.9), SAMN18196260 (41 year old Black female, BMI 28.0), SAMN18092805 (56 year old Asian male, BMI 26.0), and SAMN23079315 (37 year old White female, BMI 30.2). All donor islets were ≥90% viable and ≥90% pure.

Cell lines

MIN6 cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (FBS) and 5% penicillin/streptomycin at 37 °C and were passaged at ∼80% confluency using 0.25% trypsin. MIN6 cells used in this study ranged from passage 23 to 30 as previous studies have shown loss of glucose responsiveness after passage 35 in culture (52).

Materials

Recombinant mouse and human proinflammatory cytokines (TNF-α (410-MT, 210-TA), IL-1β (401-ML, 201-LB), and IFN-γ (485-MI, 285-IF)) were purchased from R&D systems. RPMI 1640, Dulbecco's modified Eagle's medium, Hanks balanced salt solution, FBS, penicillin, streptomycin, YO-PRO1 (Y3603), NucBlue Live ReadyProbes Reagent (R37605), fluorescein diacetate, lipofectamine 3000 transfection reagent (L3000015), Halt Protease and Phosphatase Inhibitor Cocktail (1861281), FluoZin-3 (F24195), Annexin V Alexa 488 apoptotic stain (NC0233267), and caspase inhibitor Z-DEVD-FMK (FMK004) were purchased from Thermo Fisher Scientific. Collagenase (C9263), tamoxifen, corn oil, D-glucose, ethylenediaminetetraacetic acid, egtazic acid, Hepes, magnesium chloride hexahydrate (H12Cl2MgO6), PI, were purchased from Millipore-Sigma. Potassium chloride was purchased from Avantor Performance Materials. PKCδ inhibitor, δV1-1 was purchased from AnaSpec Inc (AS-65111). Western blot buffers and reagents were purchased from Azure biosystems. Bacterial vectors encoding FRET sensors for PKCδ activity targeted to the nucleus (δCKAR) were a kind gift from Dr Alexandra Newton (53, 54).

Fasting glucose tolerance test

Mice were fasted for 16 h with access to water ad libitum and fasting glucose measurements were taken from the tail vein prior to intraperitoneal injection of 200 mg/kg glucose. Blood glucose was monitored over 2 h post glucose bolus via the tail vein.

Islet isolation and culture

Control and PKCδ-βKO mice were injected with 50 mg/kg tamoxifen in corn oil once daily for five consecutive days to induce recombination. Islets were isolated from 8 to 12-week-old C57Bl/6 or 8 to 12-week-old age and sex matched control and PKCδ-βKO mice 2 weeks after the first tamoxifen injection. For islet isolation, animals were injected with 100 mg/kg ketamine and 8 mg/kg xylazine and euthanized via exsanguination. Islets were isolated by injecting the pancreas with 12.5 mg/ml collagenase, pancreas removal, and subsequent enzymatic digestion at 37 °C. Islets were handpicked into 1640 RPMI Medium (Millipore-Sigma) with 10% FBS, 10,000 U/ml penicillin and 10,000 μg/ml streptomycin and incubated overnight at 37 °C and 5% CO2. Both mouse and human islets were cultured overnight at 37 °C and 5% CO2 prior to use in experiments.

Adenoviral vectors

Adenoviral vectors for expression of GFP-only, GFP fused to the c terminus of PKCδ (GFP-PKCδ), and PKCδ with a D→A327 point mutation that cannot be cleaved by caspase-3 with GFP fused to the c terminus (CM-GFP-PKCδ) were generated by Dr Mary Reyland as previously described (27, 55) and the expressed proteins are shown in Fig. S1. Briefly, mouse PKCδ was cloned into the pEGFP-N1 adenoviral vector and the point mutation in PKCδ in the CM-GFP-PKCδ vector was generated by PCR using the primers and site mutagenesis kit descried by DeVries, Neville, and Reyland 2002 (27).

Islet treatments and apoptosis measurements

PKCδ-KO and control islets were cultured for 24 h either untreated or treated with a cytokine cocktail at 1× relative cytokine concentration (1× RCC, 10 ng/ml TNF-α, 5 ng/ml IL-1β, and 100 ng/ml IFN-γ). Human and C57Bl/6 mouse islets were treated with a cytokine cocktail containing human or mouse recombinant cytokines, respectively, and 1 μM of a PKCδ inhibitor δV1-1 for 24 h. The islets were stained with either PI, YO-PRO1, or Annexin V and NucBlue, NucRed or fluorescein diacetate (Food and Drug Administration) per the manufacturer’s instructions. Imaging was performed either on a Leica STELLARIS 5 LIAchroic laser supply unit, with a 40× water immersion objective. In addition, 405 nm, 488 nm, and 514 nm solid state lasers were used for excitation, and emission was collected with HyD spectral detectors or on a Zeiss LSM 780 with 488 nm or 514 nm excitation laser. All islets were imaged as a Z-stack consisting of three images 8-10 μm apart. All live, apoptotic (stained via YO-PRO1 or Annexin V) and dead cells (PI) were counted manually in ImageJ (NIH, https://imagej.net/ij/). To assess the extent PKCδ was knocked out of the pancreatic β-cells in the PKCδ-KO mice, untreated and cytokine treated islets were stained with FluoZin-3 (1 μl/ml) to visualize insulin + cells. To determine if caspase-3 mediates cytokine-induced apoptosis, islets from female C57Bl/6 mice or isolated human islets were cultured for 24 h with or without cytokines and with or without the caspase-3 inhibitor Z-DEVD-FMK (10 μl/ml). Islets were costained with YO-PRO1 (1 h) and NucBlue as described above and imaged with a Leica Stellaris confocal microscope with a 40× water immersion objective. Live and YO-PRO1 positive cells were manually counted in ImageJ in 5 to 10 islets per treatment per experiment. To determine if cleavage of PKCδ by caspase-3 mediates cytokine-induced β-cell death, PKCδ-KO islets were either untreated or treated with a GFP only expression virus (GFP), GFP-PKCδ, or a GFP-tagged cleavage mutant of PKCδ (CM-GFP-PKCδ, 1:2000) which cannot be cleaved by caspase-3, all for 24 h with or without cytokines. GFP fusion protein expression was confirmed by Western blot. Islets were costained with YO-PRO1 and NucBlue as described above and imaged with a Leica Stellaris confocal microscope. Live and YO-PRO1 positive cells were manually counted in ImageJ in 5 to 10 islets per treatment per experiment.

PKCδ translocation to the nucleus

PKCδ localization and translocation was determined with a GFP adenoviral vector, a GFP-tagged PKCδ adenoviral vector (GFP-PKCδ) or a GFP-tagged cleavage mutant of PKCδ which cannot be cleaved by caspase-3 (CM-GFP-PKCδ) for 24 h. Viral vectors were generously provided by Dr Mary Reyland and were constructed as described above (Fig. S1). Mouse PKCδ-KO islets were used to reduce potential deleterious contributions from endogenous PKCδ. Isolated islets were cultured with GFP-PKCδ for 24 h prior to culture for 3 or 24 h with or without cytokines. The GFP-PKCδ virus was also cultured simultaneously with cytokine treatment. The islets were costained with NucRed or NucBlue prior to imaging. The Islets were imaged either on a Leica Stellaris confocal or a Zeiss LSM 800 confocal with 40× water immersion objective and a 405 nm/488 nm/514 nm excitation laser for each respective dye. Nuclear translocation was determined in ImageJ by normalizing the GFP pixel intensity within each nucleus as determined by colocalization with NucRed or NucBlue, against its respective cytosolic GFP pixel intensity. The ratio of nuclear to cytosolic fluorescence intensity for all GFP-expressing cells was averaged for each islet, in 3 to 5 islets per experiment.

Determining nuclear PKCδ activity

PKCδ activity in the nucleus was determined with a FRET-based kinase activity sensor (δCKAR) containing a nuclear localization sequence, which was generously given by Dr Alexandra Newtown and previously described (53). The δCKAR construct was transfected into MIN6 cells using lipofectamine 3000 transfection reagent per the manufacturer’s instructions. Transfected islets were treated for 1.5 h with or without cytokines, and changes in FRET were measured with time-resolved FLIM on a Zeiss LSM 780 confocal with a tunable infrared Coherent Chameleon Ultra II laser (Zeiss). FLIM imaging was done in 2-photon mode. Fluorescence was excited at 720 nm with fs-pulses generated by a Coherent Chameleon laser. The microscope is equipped with an ISS FastFLIM acquisition unit and a Becker and Hickl SPC-150E TCSPC acquisition card which allow for fluorescence lifetime imaging in frequency domain and time correlated single photon counting mode respectively in two photon imaging. FLIM images were acquired for MIN6 cells over three independent experiments. The average FRET-sensor lifetime in 3 to 10 MIN6 cells was analyzed in ISS VistaVision software (https://iss.com/software/vistavision) with a threshold of 100 to 200 photon counts applied prior to lifetime calculations with a logarithmic fit and bin size of 1, and the average lifetime was calculated in a manually drawn region of interest for each cell.

Subcellular fractionation

Subcellular fractionation was conducted as previously described on humans islets (7). Briefly, human islets were washed with 1× Tris-buffered saline and placed in cold fractionation buffer containing 20 mM Hepes, 10 mM KCl, 2 mM MgCl2, 1 mM ethylenediaminetetraacetic acid, 1 mM egtazic acid, 1 mM dithiothreitol, and 1 mM phosphatase and protease inhibitor cocktail. Samples were incubated on ice for 15 min before being passed through a 25G needle 20 times, incubated on ice for 20 min and centrifuged at 3000 rpm for 5 min. The supernatant, which contained the cytosolic content was transferred to a separate tube and the nuclear pellet was re-suspended with fractionation buffer, passed through a 25G needle, and centrifuged at 3000 rpm for 10 min. The supernatant was discarded, and the pellet was resuspended with Tris-buffered saline/0.1wt% SDS and sonicated.

Western blotting

Mouse and human islets were cultured for 1 or 24 h with treatments as indicated. Mouse islets were washed once with PBS and lysed by sonication for 30s in lysis buffer containing 100 mM NaCl, 50 mM Tris–HCl, 10 mM MgCl2, 1 mM dithiothreitol, and with a protease and phosphatase inhibitor cocktail (5 μl/ml). Human islets were fractionated into cytosolic and nuclear components as described above. Protein concentration was measured with Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) per manufacturer’s instructions. Samples were run on 4 to 15% mini-PROTEAN TGX protein gels (Bio-Rad) and transferred to either a polyvinylidene difluoride (AC2105; Azure Biosystems) or nitrocellulose (AC2107; Azure Biosystems) membrane. Polyvinylidene difluoride membranes were blocked in chemi-blot blocking buffer (AC2148; Azure Biosystems) for 2 h and probed with the following antibodies for >2 h at 4 °C, all at a 1:1000 dilution: anti-Bax (ab32503; Abcam), anti-PKCδ (ab182126; Abcam); anti-β-actin (NC9426659; Thermo Fisher Scientific); anti-p-JNK (sc-6254, Santa Cruz), and anti-JNK (sc-7345; Santa Cruz). Secondary anti-rabbit (102649-670; VWR) or anti-mouse (626520; Thermo Fisher Scientific) horseradish peroxidase-conjugated antibodies diluted 1:5000-1:10,000 for 2 h at room temperature. All membranes were imaged using an Azure c600 imaging system (AC6001; Azure Biosystems) and protein quantification was performed in ImageJ using densitometric analysis. Membranes containing fractionated samples were stripped and restained with nuclear marker histone cluster 1 H3D (sc-134355; Santa Cruz) at a 1:100 dilution and anti-mouse horseradish peroxidase-conjugated secondary diluted 1:10,000. Blot were imaged and quantified as described above.

Statistical analysis

Statistics were performed using Origin software (OriginLabs, Northampton, MA, https://www.originlab.com/). Two sample t test and one-way ANOVA with Tukey’s post hoc analysis were performed as indicated. A p-value of <0.05 was considered statistically significant.

Data availability

All data presented in this manuscript will be made available upon request to the corresponding authors.

Supporting information

This article contains supporting information.

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.

Supporting information

Supplemental Figure S1

Author contributions

J. C., R. A. P., M. E. R., C. G. J., R. K. P. B., and N. L. F. writing–review and editing; J. C., R. A. P., C. G. J., R. K. P. B., and N. L. F. formal analysis; J. C., R. A. P., C. G. J., and N. L. F. data curation; J. C., M. E. R., R. K. P. B., and N. L. F. investigation; J. C., M. E. R., R. K. P. B., and N. L. F. methodology; J. C. and N. L. F. writing–original draft; J. C. and N. L. F. visualization; M. E. R., R. K. P. B. and N. L. F. conceptualization; M. E. R. and R. K. P. B. resources; R. K. P. B., and N. L. F. funding acquisition; N. L. F. validation; N. L. F. supervision; N. L. F. project administration.

Funding and additional information

The authors would like to acknowledge the funding sources that made this work possible, including the following grants: 10.13039/100000901 Juvenile Diabetes Research Foundation grants 3-APF-2019-749-A-N and 1-FAC-2020-891-A-N to N. L. F. and 5-CDA-2014-198-A-N to R. K. P. B., Colorado Clinical and Translational Science Institute grant CO-M-19-133 to N. L. F., 10.13039/100000041 American Diabetes Association grant 7-21-JDF-020 to N. L. F., and 10.13039/100000062 National Institute of Diabetes and Digestive and Kidney Diseases grant F32 DK1022706 to NLF and R01 DK102950 and R01 DK106412 to R. K. P. B. We would also like to acknowledge the University of Colorado Diabetes Research Center Islet Isolation Core funded by 10.13039/100000002 NIH grant P30-DK116073 and the Advanced Light Microscopy Core facility partly funded by 10.13039/100000002 NIH grants P30 NS048154 , P30 DK116073 , R01DE015648 , and R01DE027517 to M. E. R. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
==== Refs
References

1 Lightfoot Y.L. Chen J. Mathews C.E. Immune-mediated β-cell death in type 1 diabetes: lessons from human β-cell lines Eur. J. Clin. Invest. 42 2012 1244 1251 22924552
2 Pugliese A. Autoreactive T cells in type 1 diabetes J. Clin. Invest. 127 2017 2881 2891 28762987
3 Nathan D.M. Long-term complications of diabetes mellitus N. Engl. J. Med. 328 1993 1676 1685 8487827
4 Ovalle F. Grimes T. Xu G. Patel A.J. Grayson T.B. Thielen L.A. Verapamil and beta cell function in adults with recent-onset type 1 diabetes Nat. Med. 24 2018 1108 1112 29988125
5 Herold K.C. Gitelman S.E. Ehlers M.R. Gottlieb P.A. Greenbaum C.J. Hagopian W. AbATE Study Team Teplizumab (anti-CD3 mAb) treatment preserves C-peptide responses in patients with new-onset type 1 diabetes in a randomized controlled trial: metabolic and immunologic features at baseline identify a subgroup of responders Diabetes 62 2013 3766 3774 23835333
6 Lu J. Liu J. Li L. Lan Y. Liang Y. Cytokines in type 1 diabetes: mechanisms of action and immunotherapeutic targets Clin. Transl. Immunol. 9 2020 1 17
7 Farnsworth N.L. Walter R.L. Hemmati A. Westacott M.J. Benninger R.K.P. Low level pro-inflammatory cytokines decrease connexin36 gap junction coupling in mouse and human islets through nitric oxide-mediated protein kinase Cδ J. Biol. Chem. 291 2016 3184 3196 26668311
8 Wachlin G. Augstein P. Schröder D. Kuttler B. Klöting I. Heinke P. IL-1β, IFN-γ and TNF-α increase vulnerability of pancreatic beta cells to autoimmune destruction J. Autoimmun. 20 2003 303 312 12791316
9 Padgett L.E. Broniowska K.A. Hansen P.A. Corbett J.A. Tse H.M. The role of reactive oxygen species and proinflammatory cytokines in type 1 diabetes pathogenesis Ann. N. Y. Acad. Sci. 1281 2013 16 35 23323860
10 Tomita T. Apoptosis of pancreatic β-cells in Type 1 diabetes Bosn. J. Basic Med. Sci. 17 2017 183 193 28368239
11 Reyland M.E. Protein kinase C isoforms: multi-functional regulators of cell life and death Front. Biosci. 14 2009 2386 2399
12 Reyland M.E. Anderson S.M. Matassa A.A. Barzen K.A. Quissell D.O. Protein kinase C δ is essential for etoposide-induced apoptosis in salivary gland acinar cells J. Biol. Chem. 274 1999 19115 19123 10383415
13 Konishi H. Yamauchi E. Taniguchi H. Yamamoto T. Matsuzaki H. Takemura Y. Phosphorylation sites of protein kinase C δ in H2O2-treated cells and its activation by tyrosine kinase in vitro Proc. Natl. Acad. Sci. U. S. A. 98 2001 6587 6592 11381116
14 Yuan Z.M. Utsugisawa T. Ishiko T. Nakada S. Huang Y. Kharbanda S. Activation of protein kinase Cδ by the c-Abl tyrosine kinase in response to ionizing radiation Oncogene 16 1998 1643 1648 9582011
15 Kikkawa U. Matsuzaki H. Yamamoto T. Protein kinase Cδ (PKCδ): activation mechanisms and cellular functions J. Biochem. 132 2002 831 839 12473183
16 Eitel K. Staiger H. Rieger J. Mischak H. Brandhorst H. Brendel M.D. Protein kinase C δ activation and translocation to the nucleus are required for fatty acid-induced apoptosis of insulin-secreting cells Diabetes 52 2003 991 997 12663471
17 Hennige A.M. Ranta F. Heinzelmann I. Düfer M. Michael D. Braumüller H. Overexpression of kinase-negative protein kinase Cδ in pancreatic β-cells protects mice from diet-induced glucose intolerance and β-cell dysfunction Diabetes 59 2010 119 127 19826167
18 Cantley J. Boslem E. Laybutt D.R. Cordery D.V. Pearson G. Carpenter L. Deletion of protein kinase Cδ in mice modulates stability of inflammatory genes and protects against cytokine-stimulated beta cell death in vitro and in vivo Diabetologia 54 2011 380 389 21103982
19 Kuehn H.S. Niemela J.E. Rangel-Santos A. Zhang M. Pittaluga S. Stoddard J.L. Loss-of-function of the protein kinase C δ (PKCδ) causes a B-cell lymphoproliferative syndrome in humans Blood 121 2013 3117 3125 23430113
20 DeVries-Seimon T.A. Ohm A.M. Humphries M.J. Reyland M.E. Induction of apoptosis is driven by nuclear retention of protein kinase Cδ J. Biol. Chem. 282 2007 22307 22314 17562707
21 Guo C. Yang W. Lobe C.G. A Cre recombinase transgene with mosaic, widespread tamoxifen-inducible action Genesis 32 2002 8 18 11835669
22 Madisen L. Zwingman T.A. Sunkin S.M. Oh S.W. Zariwala H.A. Gu H. A robust and high-throughput Cre Repooting and characterization system for the whole mouse brain Nat. Neurosci. 13 2010 133 140 20023653
23 Steiner D.J. Kim A. Miller K. Hara M. Pancreatic islet plasticity: interspecies comparison of islet architecture and composition Islets 2 2010 135 145 20657742
24 Wagner T.F.J. Drews A. Loch S. Mohr F. Philipp S.E. Lambert S. TRPM3 channels provide a regulated influx pathway for zinc in pancreatic beta cells Pflugers Arch. 460 2010 755 765 20401728
25 Jayaraman S. A novel method for the detection of viable human pancreatic beta cells by flow cytometry using fluorophores that selectively detect labile zinc, mitochondrial membrane potential and protein thiols Cytometry A 73 2008 615 625 18412218
26 Iglesias I. Bentsi-Barnes K. Umeadi C. Brown L. Kandeel F. Al-Abdullah I.H. Comprehensive analysis of human pancreatic islets using flow and laser scanning cytometry Transplant. Proc. 40 2008 351 354 18374064
27 DeVries T.A. Neville M.C. Reyland M.E. Nuclear import of PKCδ is required for apoptosis: identification of a novel nuclear import sequence EMBO J. 21 2002 6050 6060 12426377
28 Bacskai B.J. Skoch J. Hickey G.A. Allen R. Hyman B.T. Fluorescence resonance energy transfer determinations using multiphoton fluorescence lifetime imaging microscopy to characterize amyloid-beta plaques J. Biomed. Opt. 8 2003 368 12880341
29 Day T.W. Wu C.H. Safa A.R. Etoposide induces protein kinase Cδ- and caspase-3-dependent apoptosis in neuroblastoma cancer cells Mol. Pharmacol. 76 2009 632 640 19549763
30 Steinberg S.F. Distinctive activation mechanisms and functions for protein kinase C δ Biochem J 384 2004 449 459 15491280
31 Emoto Y. Manome Y. Meinhardt G. Kisaki H. Kharbanda S. Robertson M. Proteolytic activation of protein kinase C δ by an ICE-like protease in apoptotic cells EMBO J. 14 1995 6148 6156 8557034
32 Demine S. Schiavo A.A. Marín-Cañas S. Marchetti P. Cnop M. Eizirik D.L. Pro-inflammatory cytokines induce cell death, inflammatory responses, and endoplasmic reticulum stress in human iPSC-derived beta cells Stem Cell Res. Ther. 11 2020 1 15 31900237
33 Frangioudakis G. Burchfield J.G. Narasimhan S. Cooney G.J. Leitges M. Biden T.J. Diverse roles for protein kinase C δ and protein kinase C ε in the generation of high-fat-diet-induced glucose intolerance in mice: regulation of lipogenesis by protein kinase C δ Diabetologia 52 2009 2616 2620 19809797
34 Uchida T. Iwashita N. Ohara-Imaizumi M. Ogihara T. Nagai S. Choi J.B. Protein kinase Cδ plays a non-redundant role in insulin secretion in pancreatic β cells J. Biol. Chem. 282 2007 2707 2716 17135234
35 Schmitz-Peiffer C. Biden T.J. PKCδ blues for the β-cell Diabetes 59 2010 1 3 20040481
36 Bezy O. Tran T.T. Pihlajamäki J. Suzuki R. Emanuelli B. Winnay J. PKCδ regulates hepatic insulin sensitivity and hepatosteatosis in mice and humans J. Clin. Invest. 121 2011 2504 2517 21576825
37 Klymenko K. Novokhatska T. Kizub I. Parshikov A. Dosenko V. Soloviev A. PKC-δ isozyme gene silencing restores vascular function in diabetic rat J. Basic Clin. Physiol. Pharmacol. 27 2014 1 9
38 Peterson Q.P. Veres A. Chen L. Slama M.Q. Kenty J.H.R. Hassoun S. A method for the generation of human stem cell-derived alpha cells Nat. Commun. 11 2020 2241 32382023
39 Fujisawa S. Romin Y. Barlas A. Petrovic L.M. Turkekul M. Fan N. Evaluation of YO-PRO-1 as an early marker of apoptosis following radiofrequency ablation of colon cancer liver metastases Cytotechnology 66 2014 259 273 24065619
40 Qi X. Inagaki K. Sobel R.A. Mochly-Rosen D. Sustained pharmacological inhibition of δPKC protects against hypertensive encephalopathy through prevention of blood-brain barrier breakdown in rats J. Clin. Invest. 118 2008 173 182 18097471
41 Lu W. Lee H.K. Xiang C. Finniss S. Brodie C. The phosphorylation of tyrosine 332 is necessary for the caspase 3-dependent cleavage of PKCδ and the regulation of cell apoptosis Cell Signal. 19 2007 2165 2173 17658731
42 Basu A. Involvement of protein kinase C- δ in DNA damage-induced apoptosis J. Cell Mol. Med. 7 2003 341 350 14754503
43 Kamada S. Kikkawa U. Tsujimoto Y. Hunter T. Nuclear translocation of caspase-3 is dependent on its proteolytic activation and recognition of a substrate-like protein(s) J. Biol. Chem. 280 2004 857 860 15569692
44 Gartsbein M. Alt A. Hashimoto K. Nakajima K. Kuroki T. Tennenbaum T. The role of protein kinase C δ activation and STAT3 Ser727 phosphorylation in insulin-induced keratinocyte proliferation J. Cell Sci. 119 2006 470 481 16418226
45 Choi S.Y. Kim M.J. Kang C.M. Bae S. Cho C.K. Soh J.W. Activation of Bak and Bax through c-Abl-protein kinase Cδ-p38 MAPK signaling in response to ionizing radiation in human non-small cell lung cancer cells J. Biol. Chem. 281 2006 7049 7059 16410245
46 Bonny C. Oberson A. Negri S. Sauser C. Schorderet D.F. Cell-permeable peptide inhibitors of JNK novel blockers of β-cell death Diabetes 50 2001 77 82 11147798
47 Liu J. Minemoto Y. Lin A. c-Jun N-terminal protein kinase 1 (JNK1), but not JNK2 , is essential for tumor necrosis factor alpha-induced c-jun kinase activation and apoptosis Mol. Cell Biol. 24 2004 10844 10856 15572687
48 Collier J.J. Fueger P.T. Hohmeier H.E. Newgard C.B. Pro- and antiapoptotic proteins regulate apoptosis but do not protect against cytokine-mediated cytotoxicity in rat islets and β-cell lines Diabetes 55 2006 1398 1406 16644697
49 Sitailo L.A. Tibudan S.S. Denning M.F. Bax activation and induction of apoptosis in human keratinocytes by the protein kinase C δ catalytic domain J. Invest. Dermatol. 123 2004 434 443 15304079
50 Kim Y.R. Byun H.S. Jeon J. Choi B.L. Park K.A. Won M. Apoptosis signal-regulating Kinase1 is inducible by protein kinase Cδ and contributes to phorbol ester-mediated G1 phase arrest through persistent JNK activation Cell Biochem. Biophys. 61 2011 199 207 21468691
51 Wicksteed B. Brissova M. Yan W. Opland D.M. Plank J.L. Reinert R.B. Conditional gene targeting in mouse pancreatic β-cells Diabetes 59 2010 3090 3098 20802254
52 Cheng K. de lghingaro-Augusto V. Nolan C.J. Turner N. Hallahan N. Andrikopoulos S. High passage MIN6 cells have impaired insulin secretion with impaired glucose and lipid oxidation PLoS One 7 2012 e40868
53 Kajimoto T. Sawamura S. Tohyama Y. Mori Y. Newton A.C. Protein kinase C δ-specific activity reporter reveals agonist-evoked nuclear activity controlled by Src family J. Biol. Chem. 285 2010 41896 41910 20959447
54 Kajimoto T. Shirai Y. Sakai N. Yamamoto T. Matsuzaki H. Kikkawa U. Ceramide-induced apoptosis by translocation, phosphorylation, and activation of protein kinase Cdelta in the Golgi complex J. Biol. Chem. 279 2004 12668 12676 14715667
55 Humphries M.J. Limesand K.H. Schneider J.C. Nakayama K.I. Anderson S.M. Reyland M.E. Suppression of apoptosis in the protein kinase Cδ null mouse in vivo J. Biol. Chem. 281 2006 9728 9737 16452485
