
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39245656
70980
10.1038/s41598-024-70980-9
Article
Use of high-resolution fluorescence in situ hybridization for fast and robust detection of SARS-CoV-2 RNAs
Hu Jiapei 12
Hu Jiayi 12
Jin Li 13
Hu Dakang 4
Nicholls Philip K. 5
Wang Tao 67
Ren Yonglin 8
Hu Dailun 17300574@hebmu.edu.cn

9
Ma Bin B.Ma@murdoch.edu.au

510
1 https://ror.org/04eymdx19 grid.256883.2 0000 0004 1760 8442 Tangshan Clinical Medical College, Hebei Medical University, Tangshan, Hebei China
2 https://ror.org/04eymdx19 grid.256883.2 0000 0004 1760 8442 Graduate School, Hebei Medical University, Shijiazhuang, Hebei China
3 https://ror.org/051jg5p78 grid.429222.d 0000 0004 1798 0228 Graduate School, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu China
4 https://ror.org/027gw7s27 grid.452962.e Department of Laboratory Medicine, Taizhou Municipal Hospital, Taizhou, Zhejiang China
5 https://ror.org/00r4sry34 grid.1025.6 0000 0004 0436 6763 School of Medical, Molecular and Forensic Sciences, Murdoch University, 90 South Street, Murdoch, WA 6149 Australia
6 grid.518128.7 0000 0004 0625 8600 Telethon Kids Institute, Perth Children’s Hospital, Nedlands, WA Australia
7 https://ror.org/047272k79 grid.1012.2 0000 0004 1936 7910 Medical School, University of Western Australia, Nedlands, WA Australia
8 https://ror.org/00r4sry34 grid.1025.6 0000 0004 0436 6763 School of Agricultural Science, Murdoch University, Murdoch, WA Australia
9 https://ror.org/04eymdx19 grid.256883.2 0000 0004 1760 8442 Department of Pathogenic Biology, Hebei Medical University, 361 Zhongshan East Road, Shijiazhuang, 050017 Hebei China
10 https://ror.org/00r4sry34 grid.1025.6 0000 0004 0436 6763 Centre for Healthy Aging, Health Futures Institute, Murdoch University, Murdoch, WA Australia
8 9 2024
8 9 2024
2024
14 2090610 5 2024
22 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Early, rapid, and accurate diagnostic tests play critical roles not only in the identification/management of individuals infected by SARS-CoV-2, but also in fast and effective public health surveillance, containment, and response. Our aim has been to develop a fast and robust fluorescence in situ hybridization (FISH) detection method for detecting SARS-CoV-2 RNAs by using an HEK 293 T cell culture model. At various times after being transfected with SARS-CoV-2 E and N plasmids, HEK 293 T cells were fixed and then hybridized with ATTO-labeled short DNA probes (about 20 nt). At 4 h, 12 h, and 24 h after transfection, SARS-CoV-2 E and N mRNAs were clearly revealed as solid granular staining inside HEK 293 T cells at all time points. Hybridization time was also reduced to 1 h for faster detection, and the test was completed within 3 h with excellent results. In addition, we have successfully detected 3 mRNAs (E mRNA, N mRNA, and ORF1a (−) RNA) simultaneously inside the buccal cells of COVID-19 patients. Our high-resolution RNA FISH might significantly increase the accuracy and efficiency of SARS-CoV-2 detection, while significantly reducing test time. The method can be conducted on smears containing cells (e.g., from nasopharyngeal, oropharyngeal, or buccal swabs) or smears without cells (e.g., from sputum, saliva, or drinking water/wastewater) for detecting various types of RNA viruses and even DNA viruses at different timepoints of infection.

Keywords

SARS-CoV-2
COVID-19
Fluorescence in situ hybridization
mRNA
RNA virus
Infection
Subject terms

Biological techniques
Genetics
Microbiology
Medical research
Molecular medicine
http://dx.doi.org/10.13039/501100012505 Hebei Medical University 2022007, USIP2021111 2022007, USIP2021111 2022007, USIP2021111 2022007, USIP2021111 issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Coronavirus disease 2019 (COVID-19) is a highly transmissible disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)1–3. According to data from the World Health Organization (WHO), as of January 7, 2024, the cumulative total of confirmed COVID-19 cases worldwide exceeded 774 million, with the death toll surpassing seven million. Between December 11, 2023, and January 7, 2024, the global tally of new COVID-19 cases saw an increase of 4% over the previous 28 days, surpassing 1.1 million new infections. Conversely, the number of new deaths during this period fell by 26%, with 8,700 fatalities reported. In the same timeframe, there was a significant rise in COVID-19 related hospitalizations and intensive care unit (ICU) admissions, with increases of 40% and 13% respectively, resulting in over 173,000 hospitalizations and 1,900 ICU admissions.

Early, rapid, and accurate diagnostic tests play critical roles not only in the identification/management of individuals infected by SARS-CoV-2, but also in fast and effective public health surveillance, containment, and response4–6. Three primary methods, namely polymerase chain reaction (PCR)-based tests, antigen tests, and antibody tests, have been developed to detect SARS-CoV-2, and their roles have changed in the last three years of the pandemic4–6.

The reverse transcription-polymerase chain reaction (RT-PCR) is the most commonly used detection method for SARS-CoV-2 (in both symptomatic and asymptomatic patients) and remains the gold standard detection method for SARS-CoV-24–7. The three major highly conserved and abundantly expressed genes targeted by primers of RT-PCR are: the open reading frame 1ab (ORF1ab), nucleocapsid (N), and envelope (E)7. Although RT-PCR is highly sensitive and specific in the detection of viral RNA, several limitations/challenges are apparent. The first is the production of false-negative results attributable to several factors (from primer design to data interpretation). For example, in RT-PCR assays, some variants of concern (VOCs) of SARS-CoV-2 (Alfa and Omicron) can give negative results or weaker signals with the spike (S) gene, but positive results for other genes (e.g., ORF1ab, N or E)7. False negatives have been reported in ~ 30% (range 10–40%) of results4,8,9. The second is the production of a false-positive result that might arise because of laboratory errors (e.g., sample contamination during sample collection/processing or very recent vaccination) and off-target reaction9–11. The third is that the test requires specialized laboratory/equipment and well-trained medical scientists/technicians.

Several laboratory-based serology immunoassay tests have been developed since 2020. These tests intend to detect IgG and/or IgM antibodies to SARS-CoV-2 in venous or finger blood samples12,13. They are fast and convenient tests, since results can usually be obtained in 15–30 min. A positive antibody test indicates that a person has antibodies against SARS-CoV-2 because of recent/past infection or vaccination against COVID-19. However, these tests also have certain limitations or challenges. The specific IgM and IgG tests also produce false positives; these are attributable to endogenous/exogenous interfering substances or the cross-reactivity of antibodies6,14. In addition, antibody tests should generally not be used to diagnose current infection since sufficient antibodies can take 1–3 weeks after infection to appear in body fluids6.

The rapid antigen test (RAT) is an immunoassay used at the point of care to detect the presence of specific viral proteins (e.g., N) from SARS-CoV-26,8,14–16. It can be used in the diagnosis of a SARS-CoV-2 infection in patients with/without signs/symptoms. Samples such as nasopharyngeal/throat/nasal swabs and saliva can be used. However, recent studies have shown that false-positive results might occur up to 40% under some scenarios17. In addition, the sensitivity may be moderate compared with RT-PCR. Thus, a negative test result does not entirely rule out a patient having the COVID-19 virus, and an RT-PCR test is needed to confirm or exclude the infection17.

Fluorescence in situ hybridization (FISH)18 has been utilized for detecting several RNA viruses including the influenza virus and SARS-CoV-219–24. Because SARS-CoV-2 is a single-stranded RNA coronavirus, our aim has been to develop a highly sensitive and robust RNA FISH method for detecting SARS-CoV-2 by using the HEK 293 T cell culture system.

Materials and methods

Cell culture and transfection

The culture of HEK 293 T cells (Sigma) is performed as previously described19. After reaching 60–70% confluency, HEK 293 T cells were transfected by using the Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher, Malaga, WA, Australia). In Tube 1, 1 µl Lipofectamine 3000 reagent was diluted in 25 µl Opti-MEM™ I Reduced Serum Medium (Thermo Fisher). In Tube 2, 200 ng plasmid and 1 µl P3000™ reagent were added to 25 µl Opti-MEM™ I Reduced Serum Medium. For single transfection, we used 200 ng pUNO1-SARS2-E plasmid (InvivoGen, San Diego, CA, USA) or 200 ng INV-puno1-cov2-n-pUNO1-SARS2-N plasmid (Jomar Life Research, Scoresby, VIC, Australia). For double transfection, we used 100 ng pUNO1-SARS2-E plasmid (InvivoGen) and 100 ng INV-puno1-cov2-n-pUNO1-SARS2-N plasmid. After being mixed, the solution in Tube 2 was then added slowly to that in Tube 1. The resulting mixture was incubated at room temperature for 10 min and then added to 10 wells (about 5.5 µl/well) of the 24-well cell culture plate. This meant that 20 ng plasmid was used for each well in a 24-well culture plate.

At various time points after transfection (e.g., 4 h, 12 h, and 24 h), cells were fixed with 4% paraformaldehyde (PFA; Electron Microscopy Sciences, Hatfield, PA, USA) for 10 min and used for further analysis (FISH and immunostaining).

Buccal smears

The study with human subjects has been approved by the Human Ethics Committee of Murdoch University (permit number: 2023/137). All methods were performed in accordance with the Declaration of Helsinki. Three healthy subjects and three infected subjects (with COVID-19; confirmed by RT-PCR or RAT (MP Biomedical Asia Pacific, Singapore)) were recruited for the study. Informed consent was obtained from each subject.

Buccal cells were collected by scraping the oral cavity with a cotton swab. Buccal smears were prepared by rolling the swab back and forth on the glass coverslips (round, 13 mm diameter; ProSciTech, Kirwan, QLD, Australia). The buccal smears were then fixed with 4% PFA for 10 min and used for further analysis.

FISH

Diethyl pyrocarbonate (DEPC)-treated water (ribonuclease-free water) was utilized for the preparation of phosphate-buffered saline (PBS) and other reagents. After fixation with PFA, cells on glass coverslips were washed twice with PBS. After a 5-min rinse with 1 × sodium chloride/sodium citrate (1 × SSC), coverslips (upside down on a paraffin film in a humidified chamber) were incubated in 40 μl hybridization buffer (40% formamide (Sigma)), 25% dextran sulfate (Sigma), 20 μg/ml single-stranded salmon sperm DNA (Sigma), 20 μg/ml yeast tRNA (Sigma), 0.4% bovine serum albumin (Sigma), 20 mM ribonucleoside vanadyl complex (Sigma), 0.01 M sodium phosphate buffer (pH 7.0; 2 × SSC) in an Extron HI 2001 hybridization oven (Bartelt Instruments, Heidelberg West, VIC, Australia) for 30 min at 37 °C for pre-hybridization.

The cells were then hybridized with ATTO-labeled probes (single probe: 1 µg; mixed probes: 500 ng Probe 1 + 500 ng Probe 2; for same RNA) diluted in 40 μl hybridization buffer in the hybridization oven for 4 h (or reduced to 2 h or 1 h) at 37 °C.

The FISH probes were designed using the Primer-BLAST program (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?GROUP_TARGET=on), which includes modules for generating candidate primer pairs and checking their target specificity. The optimal probes should have a high G/C content (≥ 50% if possible), low self-complementarity, no dimer formation, and no hairpin structures25. The sequences and sources of probes are shown in Table 1. For digoxin (DIG) labeled probes, we used 200 ng mixed probes (100 ng each for same RNA) for each well.Table 1 Sequences, labeling, and sources of probes used for RNA FISH.

Probe	Sequences and labeling	Company	
BME-001	TCGGAAGAGACAGGTACGTT/3ATTO550N/	Integrated DNA Technologies (IDT; Coralville, Iowa, USA)	
BME-002	CTAGCCATCCTTACTGCGCT/3ATTO550N/	IDT	
BME-003	CACTAGCCATCCTTACTGCGCTTCGATTGT

GTGCGTACTGCTGC/3DiG_N/

	IDT	
BME-004	GCCATCCTTACTGCGCTTCGATTGTGTGCGT

ACTGCTGCA/3DiG_N/

	IDT	
BMN-001	TCTTGGTTCACCGCTCTCAC/3ATTO488N/	IDT	
BMN-002	/5ATTO488N/ACCGCTCTCACTCAACATGG	IDT	
BMO-001	ACCTACATTAATAGAACCGT/3ATTO633N/	IDT	
BMO-002	GGTGCGCTTGTTTATCTACC/3ATTO633N/	IDT	
Oligo dT	Single-stranded sequence of deoxythymine (dT), 24mer-DIG-Alexa 488	Life Technologies, Grand Island, NY, USA	

After hybridization, the cells were washed with 40% formamide/1 × SSC for 20 min at 37 °C with gentle shaking (in the hybridization oven) followed by washes for 2 × 10 min in 1 × SSC at room temperature (with gentle shaking on an orbital shaker). Coverslips (upside down) were then mounted on microscope slides with Fluorescence Mounting Medium (DAKO, North Sydney, NSW, Australia) or processed for immunostaining for DIG detection.

Detection of DIG-labeled probes and immunofluorescence staining

Coverslips with cells were washed briefly with PBS. All washes (3 × 5 min) between steps were performed in PBS at room temperature. Cells were then incubated with antibody dilution buffer (2% goat serum (Sigma) in PBS) for 15 min at room temperature to block potential non-specific binding sites to the antibodies. The cells of the experimental group were incubated with primary antibodies for 1 h (for all primary antibodies) at room temperature. Cells were then incubated with secondary antibodies for 45 min (for all secondary antibodies) at room temperature. The specificities and sources of antibodies are described in Table 2. Finally, coverslips (upside down) were mounted on microscope slides by means of a Fluorescence Mounting Medium (DAKO).Table 2 Specificities and sources of primary and secondary antibodies.

Target	Conjugate	Species and isotype	Dilution	Company	
Digoxin (CDIG-65A)		Chick IgY, polyclonal	1:1000	Immunology Consultants Laboratory (Portland, OR, USA)	
SARS-CoV-2 Nucleocapsid		Rabbit IgG, monoclonal (MA5-36271)	1:300	Thermo Fisher Scientific	
SARS-CoV-2 E protein		Rabbit IgG, polyclonal	1:300	Abcam Australia (Melbourne, Australia)	
Chick IgG	Alexa Fluor® 555	Goat polyclonal	1:1000	Abcam Australia	
Rabbit IgG H&L	Alexa Fluor® 488	Goat polyclonal	1:1000	Abcam Australia	
Rabbit IgG H&L	Alexa Fluor® 555	Goat polyclonal	1:1000	Abcam Australia	

Confocal microscopy and image processing/analysis

Confocal microscopy was performed by using a Nikon C2 Plus Confocal Microscope (Nikon Instruments, Melville, NY, USA) equipped with two lasers (with wavelengths 488 nm and 561 nm)26. A Plan Apo λ 60 × /1.40 oil immersion objective lens was used for all imaging. The acquisition program was NIS-Elements AR. The maximal intensity projection of a Z-stack was obtained by using the “Maximal intensity projection” of the NIS-Elements AR program. Three-dimensional (3D) reconstruction was achieved by using the “Volume rendering” in the NIS-Elements AR program27. The images were then saved as bitmap images and edited (cropping and labeling) further by using Corel PaintShop Pro 2020 (Corel, Ottawa, Canada).

The adjusted mean intensity (AMI) = Fluorescence intensity of FISH/Area of the cells. The fluorescence intensity of FISH was measured (by using the Measure function in Analyze tab) by ImageJ (version 1.53t: https://imagej.nih.gov/ij/download.html). The area of the cells = Length (pixels) × Width (pixels) × Area percentage of the cells (which was measured by using the Analyze Skeleton in the ImageJ). Briefly, merged images (green and red) or single-color images (green or red) were imported into ImageJ and transformed into 8-bit images (black and white). After that, the images were analyzed by the Analyze Skeleton in Analyze tab and the area percentage of the cells was obtained by using the Measure function. The AMI was rounded to the nearest integer.

Results

Detection of SARS-CoV-2 E mRNA in HEK 293 T cells

At first, we evaluated our mRNA FISH by using single directly labeled (with ATTO 550) probe (BME001 or BME002) for SARS-CoV-2 E mRNA. HEK 293 T cells were transfected with SARS-CoV-2 E plasmid, and at 12 h after transfection, SARS-CoV-2 E mRNA was detected by using our mRNA FISH. The results are shown in Fig. 1A. Abundant E mRNAs (demonstrated by solid granular staining) were observed inside the HEK 293 T cells after hybridization with the single probe.Fig. 1 Detection of SARS-CoV-2 E mRNA (red) and SARS-CoV-2 E protein (green) in HEK 293 T cells at 12 h after transfection with SARS-CoV-2 E plasmids. (A) Detection of SARS-CoV-2 E mRNA by using single probe (BME001 or BME002) or mixed probes (BME001 and BME002) labeled with ATTO 550. Images are maximal intensity projections of a Z-stack. Optical slice interval: 0.50 µm; Stack size: 6.0 µm. (B–C) Detection of SARS-CoV-2 E mRNA by using mixed probes (BME001 and BME002). (C) Images are maximal intensity projections of a Z-stack. Optical slice interval: 0.50 µm; Stack size: 6.0 µm. Objective lens: 60 × ; Nu: nucleus; 2D: two-dimensional; 3D: three-dimensional; 3D-HR: three-dimensional high-resolution; Scale bar: 10 µm.

We then evaluated our mRNA FISH by using mixed directly labeled (with ATTO 550) probes (BME001 and BME002) for E mRNA inside HEK 293 T cells after transfection with SARS-CoV-2 E plasmids. The results are shown in Fig. 1A. We also observed abundant E mRNAs (demonstrated by solid granular staining) inside the HEK 293 T cells after hybridization with mixed probes.

We then combined our direct mRNA approach with indirect immunostaining for the co-detection of E mRNA and E protein inside HEK 293 T cells. After hybridization of the cells with mixed directly labeled (with ATTO 550) probes (BME001 and BME002) for SARS-CoV-2 E mRNA, the cells were probed with antibody against E protein. The results are shown in Fig. 1B,C. We observed abundant SARS-CoV-2 E mRNA (solid granular staining) together with SARS-CoV-2 E protein (solid granular staining) inside the cells. Colocalization of E and its mRNA (appearing yellow in the merged image) indicated the E protein being translated (Fig. 1B,C).

Comparison of direct and indirect RNA FISH methods

We compared our mRNA FISH (with directly labeled probes) with another mRNA FISH (with DIG-labeled probes)20. For indirect detection, HEK 293 T cells were hybridized with DIG-labeled probes, and DIG was then detected by immunostaining. The results are shown in Fig. 2A,B. The FISH signals of the direct method (Fig. 2A) were slightly weaker than those of the indirect detection method (Fig. 2B). In addition, a directly labeled Oligo dT probe (with Alexa 488; targeting the poly-A tail of all mRNAs) was used to detect all mRNAs in the HEK 293 T cells; the results are shown in Fig. 2C.Fig. 2 Detection of SARS-CoV-2 E mRNA and E in HEK 293 T cells at 12 h after transfection with SARS-CoV-2 E plasmid. (A) SARS-CoV-2 E mRNA (with ATTO 550-labeled BME001 and BME002) and SARS-CoV-2 E are shown in red and green, respectively. (B) SARS-CoV-2 E mRNA (with DIG-labeled BME003 and BME004) and SARS-CoV-2 E are shown in red and green, respectively. (C) Total mRNA (detected by Oligo dT-Alexa 488 probes) and SARS-CoV-2 E are shown in green and red, respectively. Objective lens: 60 × ; Scale bar: 10 µm; Nu: nucleus.

FISH of SARS-CoV-2 E or N mRNAs at various time points after transfection

We then checked whether mRNAs could be detected at various time points after transfection (mimicking virus replication inside the human body). HEK 293 T cells were transfected with SARS-CoV-2 E plasmid, and at 4 h, 12 h, and 24 h after transfection, E mRNA was detected using FISH. The results are shown in Fig. 3A,B and Supplementary Fig. 1. E mRNA was clearly demonstrated by the solid granular staining inside HEK 293 T cells at all time points.Fig. 3 Detection of SARS-CoV-2 E mRNA (A–B; with mixed ATTO 550-labeled probes BME001 and BME002; red) or SARS-CoV-2 N mRNA (C–D; with mixed ATTO 488-labeled probes BMN001 and BMN002; green) in HEK 293 T cells after transfection (4 h, 12 h, and 24 h) with SARS-CoV-2 E or N plasmids. (B) High-resolution view of cropped regions shown in (A). (D) High-resolution view of cropped regions shown in (C). The number of samples (12) for each group is shown after the time post transfection. Objective lens: 60 × ; Scale bar: 10 µm; Nu: nucleus.

We also applied a similar approach for the detection of SARS-CoV-2 N mRNA. HEK 293 T cells were transfected with SARS-CoV-2 N plasmids, and at 4 h, 12 h, and 24 h after transfection, SARS-CoV-2 N mRNA was detected using FISH. The results are shown in Fig. 3C,D and Supplementary Fig. 1. N mRNA was clearly demonstrated by the solid granular staining inside HEK 293 T cells at all time points. Therefore, SARS-CoV-2 mRNAs (E mRNA and N mRNA) were observed as early as 4 h after transfection with E/N plasmids.

Co-detection of SARS-CoV-2 E and N mRNAs in HEK 293 T cells

Since the co-detection of two or more genetic sequences can improve the sensitivity and specificity of virus detection, we tested our approach for the co-detection of SARS-CoV-2 E and N mRNAs in HEK 293 T cells. HEK 293 T cells were transfected with SARS-CoV-2 E and N plasmids, and 12 h after transfection, SARS-CoV-2 E and N mRNAs were detected using FISH. The results are shown in Fig. 4 and Supplementary Videos 1–3. Abundant E mRNA and N mRNA (demonstrated by solid granular staining) were observed inside the HEK 293 T cells after a 4-h hybridization. Many SARS-CoV-2 E and N mRNAs were found colocalized inside HEK 293 T cells.Fig. 4 Co-detection of SARS-CoV-2 E mRNA (with mixed ATTO 550-labeled probes BME001 and BME002; red) and SARS-CoV-2 N mRNA (with mixed ATTO 488-labeled probes BMN001 and BMN002; green) in HEK 293 T cells 12 h after transfection with SARS-CoV-2 E and N plasmids. (B) High-resolution view of cropped regions shown in (A). (C–D) Images are maximal intensity projections of a Z-stack. Optical slice interval: 0.50 µm; Stack size: 6.0 µm. (D) High-resolution view of cropped regions shown in (C). Objective lens: 60 × ; Scale bar: 10 µm; Nu: nucleus.

FISH of SARS-CoV-2 mRNAs with reduced hybridization time

We then checked whether the time for hybridization could be reduced to achieve a faster detection of viral mRNAs. At 12 h after transfection with SARS-CoV-2 E and N plasmids, HEK 293 T cells were pre-hybridized for 30 min and then hybridized with mixed probes for 1 h, 2 h, and 4 h. 3D reconstruction was utilized for the better visualization of the two mRNAs inside HEK 293 T cells, and the results are shown in Fig. 5 and Supplementary Fig. 2. We observed clear solid granular FISH signals for SARS-CoV-2 E and N at all three different hybridization times. Although E mRNA and N mRNA were readily detectable at reduced hybridization times, the resulting images (shown in Fig. 5A,B) were slightly weaker than those shown in Fig. 5C and Supplementary Fig. 2.Fig. 5 Co-detection of SARS-CoV-2 E mRNA (with mixed ATTO 550-labeled probes BME001 and BME002; red) and SARS-CoV-2 N mRNA (with mixed ATTO 488-labeled probes BMN001 and BMN002; green) at various hybridization times (1 h (A), 2 h (B), and 4 h (C)) in HEK 293 T cells (12 h after co-transfection with SARS-CoV-2 E and N plasmids). The number of samples (12) for each group is shown after the hybridization time. Images are maximal intensity projections of a Z-stack. Optical slice interval: 0.50 µm; Stack size: 6.0 µm; Objective lens: 60 × ; Scale bar: 10 µm; Nu: nucleus.

Co-detection of 3 mRNAs in buccal smears of COVID-19 patients

We then tested our RNA FISH in detecting mRNAs in clinical samples. Buccal smears from COVID-19 patient and control subjects were prepared and mRNA FISH was performed with ATTO-labeled probes against 3 mRNAs. The results are shown in Fig. 6. 3 mRNAs (E mRNA, N mRNA, and ORF1a (−) RNA) were simultaneously detected (demonstrated by solid granular staining) inside the buccal cells of COVID-19 patients. For the samples from control subjects, no signal was detected in all three channels for 3 probes.Fig. 6 Representative confocal images of mRNA FISH of SARS-CoV-2 E mRNA (with mixed ATTO 550-labeled probes BME001 and BME002; red), SARS-CoV-2 N mRNA (with mixed ATTO 488-labeled probes BMN001 and BMN002; green), and SARS-CoV-2 ORF1a (−) RNA (with mixed ATTO 633-labeled probes BMO001 and BMO002; blue) in buccal cells of a COVID-19 patient (A) and a control subject (B). (A) Images are maximal intensity projections of a Z-stack. Optical slice interval: 0.50 µm; Stack size: 6.0 µm. (B) 3 probes were applied on 3 buccal smear samples (from same healthy subject) separately. Objective lens: 60 × ; Scale bar: 10 µm; Nu: nucleus.

Discussion

By using HEK 293 T cells, we have developed a high-sensitivity single-particle RNA FISH detection method for SARS-CoV-2 viral RNAs (including N and E). The whole procedure can be accomplished within 3 h. Compared with conventional RT-PCR and our recently reported indirect RNA FISH method19, this method can reduce detection time significantly. We have set up this method by using cell culture on coverslips, which is similar to the smear taken from a nasopharyngeal/oropharyngeal/buccal swab.

RNA FISH might increase the sensitivity of viral RNA detection

RT-PCR is an extremely sensitive method for SARS-CoV-2 detection. Some studies have reported a sensitivity of 90–100%. However, a few studies have detected a very low sensitivity of 30%4. In addition, best-in-class assays indicated a limit of detection (LoD) of approximately 100 copies of viral RNA per ml of transport media28. Therefore, a significant difference in sensitivity exists between the massive numbers of RT-PCR kits available from the various production companies. For example, the LoD of The United States Food and Drug Administration (FDA)-registered RT-PCR test kits is lower than that of non-FDA-registered test kits, which indicates that FDA-registered tests have a higher sensitivity and a better performance in virus detection.

Since, theoretically, RT-PCR can detect a single copy of a gene, misdetection might be attributable to inadequate sample collection/handling or the loss of RNAs during the extraction step4. In our previous study, RT-PCR and mRNA FISH were compared with regard to their detection of mRNA/RNAs18. Our RNA FISH method does not require RNA extraction, reverse transcription, or DNA amplification. Therefore, the loss of genetic materials during extraction can be avoided, and the processing/reaction time can be significantly reduced. In addition, the loss of RNA is further minimized because of smear fixation in our RNA FISH.

The cycle threshold (Ct; number of cycles required to amplify viral RNA to a detectable level) provides an estimate of viral load. In addition, recent studies have shown that low Ct values are associated with a poor prognosis in COVID-19 patients29. However, Ct values are affected by many factors. For example, the Ct cut-off is determined by the manufacturer of the test, not by the state or laboratory performing the test. Test manufacturers establish the cut-offs based on the evaluation of their test with known positive and negative samples. In addition, other factors (e.g., specimen collection, storage, transport, time from collection, nucleic acid target, primers/probes, extraction methods, amplification methods, and instruments used) can affect the Ct value30,31. For our RNA FISH, no cut-off value such as Ct is needed to decide between positive and negative results. Nevertheless, in order to analyze the fluorescent signals and images, a threshold that has to be set up by individual laboratories (e.g., by using the FISH results from non-infected subjects) is needed to distinguish between noise and signals.

RAT is a portable test used at the point of care or in non-healthcare settings (e.g., at home, school, and aged care homes). However, certain limitations should be kept in mind. For example, RAT is most accurate when used in patients having signs or symptoms of COVID-19 (especially during the first week of illness) or when the viral load is high (e.g., 90% when 20 ≤ Ct ≤ 25)14–17. People who test negative might however still be infected, which means that false-negative results occur. For example, one prospective cohort study of 255 patients showed that RAT sensitivities were 64% and 84% (when compared with same-day RT-PCR and viral culture, respectively14. At 4 days after illness onset, RAT sensitivity peaks (77%), and 1–2 days later, a second test shows improved sensitivity (81–85%)14. Therefore, RATs are considerably less accurate when they are utilized on people with no signs/symptoms of COVID-19 but might perform better in people who have been in contact with confirmed COVID-19 cases14. Our RNA FISH should overcome these problems and detect viral mRNA at each period/stage of infection/disease because of the high-sensitivity single-particle RNA detection. For example, our FISH method can detect the virus inside the cells (even without replication), which cannot be detected by RAT or RT-PCR.

Potential of RNA FISH to improve the specificity of viral RNA detection

Some recent studies have shown that the specificity of RT-PCR is almost 100%4, whereas a few other studies have reported a small number of false-positive results14–17. These false-positive results might be caused by cross-contamination or/and non-specific primers. Therefore, extra care should be taken during sample collection/transport/storage/processing in order to minimize the risk of cross-contamination between samples and thereby to increase the specificity of viral RNA detection, because the genetic material from contamination can be amplified enormously17,32. Our RNA FISH can overcome this problem, since we detect the viral RNA that is not amplified during the test procedure. In addition, intracellular detection may reduce false positive, since contaminated RNA is highly unlikely to be present inside the cells on smears (e.g., nasopharyngeal, oropharyngeal, or buccal smears)33.

Another type of false-positive RT-PCR result can occur shortly after the vaccination, especially in people vaccinated with inactivated whole-virus, adjuvanted SARS-CoV-2 vaccines10. By using our approach, this type of false-positive result can be avoided, since our approach can detect replicating virus/active infection by detecting the positive and negative RNAs inside the cells or in body fluids.

CoronaFISH approach has been utilized to detect SARS-CoV-2 RNAs in the culture cells and human cells/tissues21. This approach used 96 probes with the highest next-generation sequencing (NGS) coverage for hybridization. Although a large number of probes can increase the sensitivity of detection, it might decrease the specificity and increase the detection cost. These limitations might also be present in Turbo FISH, in which dozens of probes at much higher concentrations are applied to reduce the hybridization time significantly34.

RNA FISH enables intracellular analysis of viral RNAs

Qualitative RT-PCR tests are not designed to provide semi-quantitative or quantitative measurements of viral RNAs in a sample4,18. Using our RNA FISH, we can detect the viral RNAs on smears made from body fluid (e.g., saliva, sputum) or cells (e.g., epithelial cells from nasopharyngeal, oropharyngeal, or buccal smears). In addition, co-detection of 3 mRNAs in one cell can increase the sensitivity of detection and therefore reduce the false positive (e.g., due to the off-target reaction) or false negative (e.g., due to misdetection) in the virus detection. Since mRNA exits from the nucleus to the cytoplasm in the form of mRNA granules (mRNA plus mRNA-binding proteins)18, the puncta-like fluorescent signals in our RNA FISH presumably represent the mRNAs inside the mRNA granules. In clinical samples, the fluorescent signals inside the cells will represent the RNAs inside perinuclear double-membrane vesicles (DMVs)35, which are the sites for SARS-CoV-2 viral genomic RNA replication and transcription. Therefore, semi-quantitative analysis can be performed by measuring the fluorescent intensity or the number of granules/DMVs containing RNA inside the cells on the smears18.

Although a cut-off value is set, the processing of samples and the determination of results are automated in RT-PCR. With regard to our RNA FISH, the determination of the results is performed manually, since an analysis of the fluorescence signal is required. Nevertheless, digital pathology techniques can also be used in automatic FISH procedures and image analysis/result determination36,37. In our previous study, we have performed semi-automatic quantitative analysis (number-based analysis and intensity-based analysis by ImageJ) on mRNA molecules/granules in the neurons18. Automatic quantitative analysis of SARS-CoV-2 viral RNAs can also be performed by using FISH-quant, Big-FISH, and Imaris Spot23,38,39.

Cost-effectiveness and convenience of RNA FISH

During any review of the analytical methods for SARS-CoV-2 detection, the prices of the instruments required should be mentioned. Our RNA FISH does not need sophisticated laboratory and instruments. In the current study, we have utilized a confocal microscope for the detection and imaging. Certainly, a fluorescence microscope will also be used if a confocal microscope is not available. In addition, our RNA FISH does not require large amounts of primers/probes and enzymes for amplification, which can thus reduce the cost of SARS-CoV-2 identification even further.

In a recent study, we have described an RNA FISH method involving the use of DIG-labeled DNA probes (about 50 nt) for hybridization and immunofluorescent staining for DIG detection19. In this study, we have used ATTO-labeled shorter (about 20 nt) and more concentrated DNA probes, which reduce the test time significantly (since no immunostaining step is needed). With strong absorption and high fluorescence quantum yield, ATTO dyes can be used in many applications, including single-molecule detection, high-resolution microscopy, and FISH40. In addition, the background and noise inside the cells and on the coverslips can also be reduced (data not shown). Therefore, ATTO-labeled short DNA probes can generate excellent FISH signals after hybridization without amplification steps (e.g., amplification through anti-DIG primary antibodies and secondary antibodies).

Another type of RNA FISH, namely RNAscope, has been utilized for detecting SARS-CoV-2 RNA in human cells and tissues41. Although excellent FISH signals have been obtained, this method (including three steps of amplification) is more complicated and time-consuming than our method.

Although our RNA FISH has been applied successfully to clinical samples, it has certain limitations. First, the evaluation of sensitivity and specificity has been constrained by limited access to clinical samples. In this study, we compared our RNA FISH with other established test methods, primarily from methodological perspectives. We also did not test our FISH approach on different variants of SARS-CoV-2. The variant we detected was likely to be Omicron (e.g., XBB), the dominant variant at that test time in Australia. Second, despite the potential for automation in RNA FISH, manual determination of results by pathologists (or aided by digital pathology/artificial intelligence) is required. Third, the need for a fluorescence/confocal microscope may limit its applicability for point-of-care testing like RAT. However, this limitation could be addressed by employing a portable device such as a smartphone fluorescence microscope42.

Our RNA FISH might significantly increase the accuracy and sensitivity of SARS-CoV-2 detection while significantly reducing test time. It can be conducted on smears with cells (e.g., from nasopharyngeal, oropharyngeal, or buccal swabs) or smears without cells (e.g., from sputum, saliva, or even drinking water/wastewater) for diverse types of RNA viruses. In addition, it can also be used to detect DNA viruses (e.g., monkeypox virus, human papillomavirus, and cytomegalovirus) by detecting their mRNAs inside cells. Our RNA FISH approach might be applied to obtain a more accurate diagnosis and more effective public health surveillance of severe viral infectious diseases.

Supplementary Information

Supplementary Figures.

Supplementary Video 1.

Supplementary Video 2.

Supplementary Video 3.

Supplementary Legends.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-70980-9.

Acknowledgements

This project was supported by the Cooperative Project between University and Enterprise (Grant number: 2022007) and the Innovation Study Program for College Students (Grant number: USIP2021111) from Hebei Medical University, China.

Author contributions

D.L.H. and B.M. conceived the study and designed the experiments. J.P.H., J.Y.H, L.J., D.K.H, T.W., and P.K.N. performed the experiments. J.P.H., J.Y.H., L.J., and Y.R. analyzed the data. J.P.H., J.Y.H., L.J., and B.M. wrote the paper. All the authors reviewed the manuscript before submission.

Data availability

Data supporting the results are included in the article and its supplementary materials.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Jiapei Hu, Jiayi Hu and Li Jin.
==== Refs
References

1. Sharma A Ahmad Farouk I Lal SK COVID-19: A review on the novel coronavirus disease evolution, transmission, detection Control and Prevention Viruses 2021 13 202 10.3390/v13020202 33572857
Sharma, A., Ahmad Farouk, I. & Lal, S. K. COVID-19: A review on the novel coronavirus disease evolution, transmission, detection control and prevention. Viruses 13, 202. 10.3390/v13020202 (2021).33572857 10.3390/v13020202
2. Araf Y Omicron variant of SARS-CoV-2: Genomics, transmissibility, and responses to current COVID-19 vaccines J. Med. Virol. 2022 94 1825 1832 10.1002/jmv.27588 35023191
Araf, Y. et al. Omicron variant of SARS-CoV-2: Genomics, transmissibility, and responses to current COVID-19 vaccines. J. Med. Virol. 94, 1825–1832. 10.1002/jmv.27588 (2022).35023191 10.1002/jmv.27588
3. Nitin P Nandhakumar R Vidhya B Rajesh S Sakunthala A COVID-19: Invasion, pathogenesis and possible cure – A review J. Virol. Methods 2022 300 114434 10.1016/j.jviromet.2021.114434 34919978
Nitin, P., Nandhakumar, R., Vidhya, B., Rajesh, S. & Sakunthala, A. COVID-19: Invasion, pathogenesis and possible cure – A review. J. Virol. Methods 300, 114434. 10.1016/j.jviromet.2021.114434 (2022).34919978 10.1016/j.jviromet.2021.114434
4. Filchakova O Review of COVID-19 testing and diagnostic methods Talanta 2022 244 123409 10.1016/j.talanta.2022.123409 35390680
Filchakova, O. et al. Review of COVID-19 testing and diagnostic methods. Talanta 244, 123409. 10.1016/j.talanta.2022.123409 (2022).35390680 10.1016/j.talanta.2022.123409
5. Maia R Diagnosis methods for COVID-19: A systematic review Micromachines 2022 13 1349 10.3390/mi13081349 36014271
Maia, R. et al. Diagnosis methods for COVID-19: A systematic review. Micromachines 13, 1349. 10.3390/mi13081349 (2022).36014271 10.3390/mi13081349
6. Peeling RW Heymann DL Teo YY Garcia PJ Diagnostics for COVID-19: Moving from pandemic response to control Lancet 2022 399 757 768 10.1016/S0140-6736(21)02346-1 34942102
Peeling, R. W., Heymann, D. L., Teo, Y. Y. & Garcia, P. J. Diagnostics for COVID-19: Moving from pandemic response to control. Lancet 399, 757–768. 10.1016/S0140-6736(21)02346-1 (2022).34942102 10.1016/S0140-6736(21)02346-1
7. Dutta D COVID-19 diagnosis: A comprehensive review of the RT-qPCR method for detection of SARS-CoV-2 Diagnostics 2022 12 1503 10.3390/diagnostics12061503 35741313
Dutta, D. et al. COVID-19 diagnosis: A comprehensive review of the RT-qPCR method for detection of SARS-CoV-2. Diagnostics 12, 1503. 10.3390/diagnostics12061503 (2022).35741313 10.3390/diagnostics12061503
8. Weissleder R Lee H Ko J Pittet MJ COVID-19 diagnostics in context Sci. Transl. Med. 2020 12 eabc1931 10.1126/scitranslmed.abc1931 32493791
Weissleder, R., Lee, H., Ko, J. & Pittet, M. J. COVID-19 diagnostics in context. Sci. Transl. Med. 12, eabc1931. 10.1126/scitranslmed.abc1931 (2020).32493791 10.1126/scitranslmed.abc1931
9. Fevraleva I Glinshchikova O Makarik T Sudarikov A How to avoid false-negative and false-positive COVID-19 PCR testing Int. J. Transl. Med. 2022 2 204 209
Fevraleva, I., Glinshchikova, O., Makarik, T. & Sudarikov, A. How to avoid false-negative and false-positive COVID-19 PCR testing. Int. J. Transl. Med. 2, 204–209 (2022).
10. Kong XQ Wang YJ Fang ZX Yang TC Tong ML False-positive results of SARS-CoV-2 RT-PCR in oropharyngeal swabs from vaccinators Front. Med. 2022 9 847407 10.3389/fmed.2022.847407
Kong, X. Q., Wang, Y. J., Fang, Z. X., Yang, T. C. & Tong, M. L. False-positive results of SARS-CoV-2 RT-PCR in oropharyngeal swabs from vaccinators. Front. Med. 9, 847407. 10.3389/fmed.2022.847407 (2022).10.3389/fmed.2022.847407
11. Healy B Khan A Metezai H Blyth I Asad H The impact of false positive COVID-19 results in an area of low prevalence Clin. Med. (Lond) 2021 21 e54 e56 10.7861/clinmed.2020-0839 33243836
Healy, B., Khan, A., Metezai, H., Blyth, I. & Asad, H. The impact of false positive COVID-19 results in an area of low prevalence. Clin. Med. (Lond) 21, e54–e56. 10.7861/clinmed.2020-0839 (2021).33243836 10.7861/clinmed.2020-0839
12. Yamamoto M Comparison of six antibody assays and two combination assays for COVID-19 Virol. J. 2022 19 24 10.1186/s12985-022-01752-y 35115008
Yamamoto, M. et al. Comparison of six antibody assays and two combination assays for COVID-19. Virol. J. 19, 24. 10.1186/s12985-022-01752-y (2022).35115008 10.1186/s12985-022-01752-y
13. Chamkhi S Comparative study of six SARS-CoV-2 serology assays: Diagnostic performance and antibody dynamics in a cohort of hospitalized patients for moderate to critical COVID-19 Int. J. Immunopathol. Pharmacol. 2022 36 20587384211073232 10.1177/20587384211073232 35113728
Chamkhi, S. et al. Comparative study of six SARS-CoV-2 serology assays: Diagnostic performance and antibody dynamics in a cohort of hospitalized patients for moderate to critical COVID-19. Int. J. Immunopathol. Pharmacol. 36, 20587384211073230. 10.1177/20587384211073232 (2022).35113728 10.1177/20587384211073232
14. Chu VT Comparison of home antigen testing with RT-PCR and viral culture during the course of SARS-CoV-2 infection JAMA Intern. Med. 2022 182 701 709 10.1001/jamainternmed.2022.1827 35486394
Chu, V. T. et al. Comparison of home antigen testing with RT-PCR and viral culture during the course of SARS-CoV-2 infection. JAMA Intern. Med. 182, 701–709. 10.1001/jamainternmed.2022.1827 (2022).35486394 10.1001/jamainternmed.2022.1827
15. Arshadi M Diagnostic accuracy of rapid antigen tests for COVID-19 detection: A systematic review with meta-analysis Front. Med. 2022 9 870738 10.3389/fmed.2022.870738
Arshadi, M. et al. Diagnostic accuracy of rapid antigen tests for COVID-19 detection: A systematic review with meta-analysis. Front. Med. 9, 870738. 10.3389/fmed.2022.870738 (2022).10.3389/fmed.2022.870738
16. Khandker SS Nik Hashim NHH Deris ZZ Shueb RH Islam MA Diagnostic accuracy of rapid antigen test kits for detecting SARS-CoV-2: A systematic review and meta-analysis of 17,171 suspected COVID-19 patients J. Clin. Med. 2021 10 3493 10.3390/jcm10163493 34441789
Khandker, S. S., Nik Hashim, N. H. H., Deris, Z. Z., Shueb, R. H. & Islam, M. A. Diagnostic accuracy of rapid antigen test kits for detecting SARS-CoV-2: A systematic review and meta-analysis of 17,171 suspected COVID-19 patients. J. Clin. Med. 10, 3493. 10.3390/jcm10163493 (2021).34441789 10.3390/jcm10163493
17. Gans JS False-positive results in rapid antigen tests for SARS-CoV-2 JAMA 2022 327 485 486 10.1001/jama.2021.24355 34994775
Gans, J. S. et al. False-positive results in rapid antigen tests for SARS-CoV-2. JAMA 327, 485–486. 10.1001/jama.2021.24355 (2022).34994775 10.1001/jama.2021.24355
18. Ma B Savas JN Chao MV Tanese N Quantitative analysis of BDNF/TrkB protein and mRNA in cortical and striatal neurons using alpha-tubulin as a normalization factor Cytom. A 2012 81 704 717 10.1002/cyto.a.22073
Ma, B., Savas, J. N., Chao, M. V. & Tanese, N. Quantitative analysis of BDNF/TrkB protein and mRNA in cortical and striatal neurons using alpha-tubulin as a normalization factor. Cytom. A 81, 704–717. 10.1002/cyto.a.22073 (2012).10.1002/cyto.a.22073
19. Hu D Development of a high-sensitivity and short-duration fluorescence in situ hybridization method for viral mRNA detection in HEK 293T cells Front. Cell Infect. Microbiol. 2022 12 960938 10.3389/fcimb.2022.960938 36268226
Hu, D. et al. Development of a high-sensitivity and short-duration fluorescence in situ hybridization method for viral mRNA detection in HEK 293T cells. Front. Cell Infect. Microbiol. 12, 960938. 10.3389/fcimb.2022.960938 (2022).36268226 10.3389/fcimb.2022.960938
20. Lakdawala SS Influenza a virus assembly intermediates fuse in the cytoplasm PLoS Pathog. 2014 10 e1003971 10.1371/journal.ppat.1003971 24603687
Lakdawala, S. S. et al. Influenza a virus assembly intermediates fuse in the cytoplasm. PLoS Pathog. 10, e1003971. 10.1371/journal.ppat.1003971 (2014).24603687 10.1371/journal.ppat.1003971
21. Rensen, E. et al. Sensitive visualization of SARS-CoV-2 RNA with CoronaFISH. Life Sci. Alliance 5 (2022). 10.26508/lsa.202101124
22. Acheampong KK Subcellular detection of SARS-CoV-2 RNA in human tissue reveals distinct localization in alveolar type 2 pneumocytes and alveolar macrophages mBio 2021 13 e0375121 10.1128/mbio.03751-21 35130722
Acheampong, K. K. et al. Subcellular detection of SARS-CoV-2 RNA in human tissue reveals distinct localization in alveolar type 2 pneumocytes and alveolar macrophages. mBio 13, e0375121. 10.1128/mbio.03751-21 (2021).35130722 10.1128/mbio.03751-21
23. Lee JY Absolute quantitation of individual SARS-CoV-2 RNA molecules provides a new paradigm for infection dynamics and variant differences eLife 2022 11 e74153 10.7554/eLife.74153 35049501
Lee, J. Y. et al. Absolute quantitation of individual SARS-CoV-2 RNA molecules provides a new paradigm for infection dynamics and variant differences. eLife 11, e74153. 10.7554/eLife.74153 (2022).35049501 10.7554/eLife.74153
24. Tamminga GG Jansen GJ Wiersma M Evaluation of a fluorescence in situ hybridization (FISH)-based method for detection of SARS-CoV-2 in saliva PLoS One 2022 17 e0277367 10.1371/journal.pone.0277367 36346813
Tamminga, G. G., Jansen, G. J. & Wiersma, M. Evaluation of a fluorescence in situ hybridization (FISH)-based method for detection of SARS-CoV-2 in saliva. PLoS One 17, e0277367. 10.1371/journal.pone.0277367 (2022).36346813 10.1371/journal.pone.0277367
25. Ma B Tanese N Combined FISH and immunofluorescent staining methods to co-localize proteins and mRNA in neurons and brain tissue Methods Mol. Biol. 2013 1010 123 138 10.1007/978-1-62703-411-1_9 23754223
Ma, B. & Tanese, N. Combined FISH and immunofluorescent staining methods to co-localize proteins and mRNA in neurons and brain tissue. Methods Mol. Biol. 1010, 123–138. 10.1007/978-1-62703-411-1_9 (2013).23754223 10.1007/978-1-62703-411-1_9
26. Al-Shalan HAM Hu D Nicholls PK Greene WK Ma B Immunofluorescent characterization of innervation and nerve-immune cell neighborhood in mouse thymus Cell Tissue Res. 2019 378 239 254 10.1007/s00441-019-03052-4 31230166
Al-Shalan, H. A. M., Hu, D., Nicholls, P. K., Greene, W. K. & Ma, B. Immunofluorescent characterization of innervation and nerve-immune cell neighborhood in mouse thymus. Cell Tissue Res. 378, 239–254. 10.1007/s00441-019-03052-4 (2019).31230166 10.1007/s00441-019-03052-4
27. Ma B Distribution of non-myelinating Schwann cells and their associations with leukocytes in mouse spleen revealed by immunofluorescence staining Eur. J. Histochem. 2018 62 2890 10.4081/ejh.2018.2890 29943953
Ma, B. et al. Distribution of non-myelinating Schwann cells and their associations with leukocytes in mouse spleen revealed by immunofluorescence staining. Eur. J. Histochem. 62, 2890. 10.4081/ejh.2018.2890 (2018).29943953 10.4081/ejh.2018.2890
28. Arnaout R The limit of detection matters: The case for benchmarking severe acute respiratory syndrome coronavirus 2 testing Clin. Infect. Dis. 2021 73 e3042 e3046 10.1093/cid/ciaa1382 33532847
Arnaout, R. et al. The limit of detection matters: The case for benchmarking severe acute respiratory syndrome coronavirus 2 testing. Clin. Infect. Dis. 73, e3042–e3046. 10.1093/cid/ciaa1382 (2021).33532847 10.1093/cid/ciaa1382
29. Martinez MJ Lack of prognostic value of SARS-CoV2 RT-PCR cycle threshold in the community Infect Dis. Ther. 2022 11 587 593 10.1007/s40121-021-00561-0 34762246
Martinez, M. J. et al. Lack of prognostic value of SARS-CoV2 RT-PCR cycle threshold in the community. Infect Dis. Ther. 11, 587–593. 10.1007/s40121-021-00561-0 (2022).34762246 10.1007/s40121-021-00561-0
30. Mardian Y Kosasih H Karyana M Neal A Lau CY Review of current COVID-19 diagnostics and opportunities for further development Front. Med. 2021 8 615099 10.3389/fmed.2021.615099
Mardian, Y., Kosasih, H., Karyana, M., Neal, A. & Lau, C. Y. Review of current COVID-19 diagnostics and opportunities for further development. Front. Med. 8, 615099. 10.3389/fmed.2021.615099 (2021).10.3389/fmed.2021.615099
31. Engelmann I Preanalytical issues and cycle threshold values in SARS-CoV-2 real-time RT-PCR testing: Should test results include these? ACS Omega 2021 6 6528 6536 10.1021/acsomega.1c00166 33748564
Engelmann, I. et al. Preanalytical issues and cycle threshold values in SARS-CoV-2 real-time RT-PCR testing: Should test results include these? ACS Omega 6, 6528–6536. 10.1021/acsomega.1c00166 (2021).33748564 10.1021/acsomega.1c00166
32. Ahmed W Minimizing errors in RT-PCR detection and quantification of SARS-CoV-2 RNA for wastewater surveillance Sci. Total Environ. 2022 805 149877 10.1016/j.scitotenv.2021.149877 34818780
Ahmed, W. et al. Minimizing errors in RT-PCR detection and quantification of SARS-CoV-2 RNA for wastewater surveillance. Sci. Total Environ. 805, 149877. 10.1016/j.scitotenv.2021.149877 (2022).34818780 10.1016/j.scitotenv.2021.149877
33. Jansen GJ Wiersma M van Wamel WJB Wijnberg ID Direct detection of SARS-CoV-2 antisense and sense genomic RNA in human saliva by semi-autonomous fluorescence in situ hybridization: A proxy for contagiousness? PLoS One 2021 16 e0256378 10.1371/journal.pone.0256378 34403446
Jansen, G. J., Wiersma, M., van Wamel, W. J. B. & Wijnberg, I. D. Direct detection of SARS-CoV-2 antisense and sense genomic RNA in human saliva by semi-autonomous fluorescence in situ hybridization: A proxy for contagiousness? PLoS One 16, e0256378. 10.1371/journal.pone.0256378 (2021).34403446 10.1371/journal.pone.0256378
34. Shaffer SM Wu MT Levesque MJ Raj A Turbo FISH: A method for rapid single molecule RNA FISH PLoS One 2013 8 e75120 10.1371/journal.pone.0075120 24066168
Shaffer, S. M., Wu, M. T., Levesque, M. J. & Raj, A. Turbo FISH: A method for rapid single molecule RNA FISH. PLoS One 8, e75120. 10.1371/journal.pone.0075120 (2013).24066168 10.1371/journal.pone.0075120
35. V’Kovski P Kratzel A Steiner S Stalder H Thiel V Coronavirus biology and replication: Implications for SARS-CoV-2 Nat. Rev. Microbiol. 2021 19 155 170 10.1038/s41579-020-00468-6 33116300
V’Kovski, P., Kratzel, A., Steiner, S., Stalder, H. & Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 19, 155–170. 10.1038/s41579-020-00468-6 (2021).33116300 10.1038/s41579-020-00468-6
36. Jamalzadeh S QuantISH: RNA in situ hybridization image analysis framework for quantifying cell type-specific target RNA expression and variability Lab Invest. 2022 102 753 761 10.1038/s41374-022-00743-5 35169222
Jamalzadeh, S. et al. QuantISH: RNA in situ hybridization image analysis framework for quantifying cell type-specific target RNA expression and variability. Lab Invest. 102, 753–761. 10.1038/s41374-022-00743-5 (2022).35169222 10.1038/s41374-022-00743-5
37. Frankenstein Z Automated 3D scoring of fluorescence in situ hybridization (FISH) using a confocal whole slide imaging scanner Appl. Microsc. 2021 51 4 10.1186/s42649-021-00053-y 33835321
Frankenstein, Z. et al. Automated 3D scoring of fluorescence in situ hybridization (FISH) using a confocal whole slide imaging scanner. Appl. Microsc. 51, 4. 10.1186/s42649-021-00053-y (2021).33835321 10.1186/s42649-021-00053-y
38. Mueller F FISH-quant: automatic counting of transcripts in 3D FISH images Nat. Methods 2013 10 277 278 10.1038/nmeth.2406 23538861
Mueller, F. et al. FISH-quant: automatic counting of transcripts in 3D FISH images. Nat. Methods 10, 277–278. 10.1038/nmeth.2406 (2013).23538861 10.1038/nmeth.2406
39. Gonzalez-Dominguez I Puente-Massaguer E Cervera L Godia F Quantification of the HIV-1 virus-like particle production process by super-resolution imaging: From VLP budding to nanoparticle analysis Biotechnol. Bioeng. 2020 117 1929 1945 10.1002/bit.27345 32242921
Gonzalez-Dominguez, I., Puente-Massaguer, E., Cervera, L. & Godia, F. Quantification of the HIV-1 virus-like particle production process by super-resolution imaging: From VLP budding to nanoparticle analysis. Biotechnol. Bioeng. 117, 1929–1945. 10.1002/bit.27345 (2020).32242921 10.1002/bit.27345
40. Han Y A labeling strategy for living specimens in long-term/super-resolution fluorescence imaging Front. Chem. 2020 8 601436 10.3389/fchem.2020.601436 33520932
Han, Y. et al. A labeling strategy for living specimens in long-term/super-resolution fluorescence imaging. Front. Chem. 8, 601436. 10.3389/fchem.2020.601436 (2020).33520932 10.3389/fchem.2020.601436
41. Van Slambrouck J Visualising SARS-CoV-2 infection of the lung in deceased COVID-19 patients BioMedicine 2023 92 104608 10.1016/j.ebiom.2023.104608
Van Slambrouck, J. et al. Visualising SARS-CoV-2 infection of the lung in deceased COVID-19 patients. BioMedicine 92, 104608. 10.1016/j.ebiom.2023.104608 (2023).10.1016/j.ebiom.2023.104608
42. Schaefer MA Nelson HN Butrum JL Gronseth JR Hines JH A low-cost smartphone fluorescence microscope for research, life science education, and STEM outreach Sci. Rep. 2023 13 2722 10.1038/s41598-023-29182-y 36894527
Schaefer, M. A., Nelson, H. N., Butrum, J. L., Gronseth, J. R. & Hines, J. H. A low-cost smartphone fluorescence microscope for research, life science education, and STEM outreach. Sci. Rep. 13, 2722. 10.1038/s41598-023-29182-y (2023).36894527 10.1038/s41598-023-29182-y
