
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4248
10.1186/s12917-024-04248-9
Research
Oral administration of Lactobacillus plantarum expressing aCD11c modulates cellular immunity alleviating inflammatory injury due to Klebsiella pneumoniae infection
Zeng Yang 1
Li Tiantian 1
Chen Xueyang 1
Fang Xiaowei 2
Fang Chun 1
Liang Xiongyan 1
Liu Jing 519053@yangtzeu.edu.cn

1
Yang Yuying yangyycn@yangtzeu.edu.cn

1
1 https://ror.org/05bhmhz54 grid.410654.2 0000 0000 8880 6009 College of Animal Science and Technology, Yangtze University, Jingzhou, 434025 China
2 https://ror.org/05bhmhz54 grid.410654.2 0000 0000 8880 6009 College of Agriculture, Yangtze University, Jingzhou, 434025 China
7 9 2024
7 9 2024
2024
20 3996 4 2024
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Klebsiella pneumoniae (KP), responsible for acute lung injury (ALI) and inflammation of the gastrointestinal tract, is a zoonotic pathogen that poses a threat to livestock farming worldwide. Nevertheless, there is currently no validated vaccine to prevent KP infection. The development of mucosal vaccines against KP using Lactobacillus plantarum (L. plantarum) is an effective strategy.

Results

Firstly, the L. plantarum strains NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c were constructed via homologous recombination to express the aCD11c protein either inducibly or constitutively. Both NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c strains could enhance the adhesion and invasion of L. plantarum on bone marrow-derived dendritic cells (BMDCs), and stimulate the activation of BMDCs compared to the control strain NC8-pSIP409 in vitro. Following oral immunization of mice with NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c, the cellular, humoral, and mucosal immunity were significantly improved, as evidenced by the increased expression of CD4+ IL-4+ T cells in the spleen, IgG in serum, and secretory IgA (sIgA) in the intestinal lavage fluid (ILF). Furthermore, the protective effects of L. plantarum against inflammatory damage caused by KP infection were confirmed by assessing the bacterial loads in various tissues, lung wet/dry ratio (W/D), levels of inflammatory cytokines, and histological evaluation, which influenced T helper 17 (Th17) and regulatory T (Treg) cells in peripheral blood and lung.

Conclusions

Both the inducible and constitutive L. plantarum strains NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c have been found to stimulate cellular and humoral immunity levels and alleviate the inflammatory response caused by KP infection. These findings have provided a basis for the development of a novel vaccine against KP.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-04248-9.

Keywords

L. plantarum
Klebsiella pneumoniae
aCD11c
Mucosal vaccine
Oral immunization
STAT5/FOXP3
Treg cells
Natural Science Foundation of Hubei Province2021CFB173 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Klebsiella pneumoniae (KP) is a common zoonotic pathogen located at the respiratory and gastrointestinal tracts, leading to acute lung injury (ALI) and gastrointestinal infections [1–4]. Since the initial isolation of which in airway secretions in 1875, KP has exhibited an increasing resistance to the external environment, which results in challenges due to its drug resistance and virulence [5]. With the increasing isolation rate of KP in the global livestock farming industry, which has raised increasing concerns regarding the food safety and economic implications [6, 7]. Bacterial vaccines have shown efficacy in reducing pathogenic bacterial infections, while the complex structural composition and numerous serotypes of KP have hindered the development of targeted commercial vaccines [8–10]. As one of the most predominant conditional pathogens, KP primarily causes disease through the mucosal route of infection, particularly in instances of compromised host immunity [11]. Consequently, oral vaccinations are feasible to enhancing the mucosal immunity and preventing pathogens such as KP [12].

Lactobacillus, an edible beneficial microorganism, is involved in regulating the dynamic equilibrium of intestinal flora and promoting the proliferation of immunological cells to modulate the immune response [13]. Research on Lactobacillus-based live vector vaccines has advanced significantly across various pathogens. In recent years, different expression systems have been widely utilized in Lactobacillus spp., including the constitutive or inducible expression vectors. For example, the constitutive expression vector pOri23, which was based on the P23 promoter modification, and the vector pSIP409, which was based on the sppK, sppR inducible expression system, have facilitated precise manipulation of the expressed target genes [14]. Therefore, we replaced the inducible expression system in the pSIP409 vector with the P23 promoter to construct the constitutive expression vector pLc23. Since the crucial role of antigen-presenting cells (APCs), such as dendritic cells (DCs), in antigen presentation and uptake, the use of recombinant vectors fused with receptor molecules targeting DCs can significantly enhance their effectiveness in order to enhance the uptake of antigens by APCs during immunization [15]. In a previous study, Lactobacillus plantarum (L. plantarum) strain NC8-pSIP409-aCD11c was employed to expresses a single-chain antibody against CD11c (scFv-CD11c, aCD11c), which efficiently bound DCs, induced DC maturation, promoted T cell differentiation, and enhanced B cell production in vivo [16].

In the development of L. plantarum vaccines, it is imperative to thoroughly understand the immunomodulatory mechanisms of L. plantarum. In case studies related to respiratory diseases, changes in T helper 17 (Th17) and regulatory T (Treg) cell numbers are critical for disease progression and are linked to COPD, lung cancer, and tuberculosis [17–19]. The stability and suppression of CD4+ CD25+ Treg cells depend on FOXP3, a transcription factor, and FOXP3 expression and regulation require phosphorylated STAT5 (p-STAT5) [20]. Consequently, this pathway regulates the prevention of Treg’s immunological inflammation. It has been shown that the STAT5/FOXP3 signaling pathway was dramatically suppressed in a mouse model of asthma, increasing Th17 cells and decreasing Treg cells in the bronchoalveolar lavage fluid (BALF) [21–23]. Therefore, in this study, the inducible and constitutive L. plantarum expressing aCD11c (NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c) were used to investigate the effect of aCD11c expression on DCs activation, and to elucidate the relationship between the immunomodulatory effects of L. plantarum on KP infection and the activation of the STAT5/FOXP3 signaling pathway.

Materials and methods

Strains, plasmids, and primers

Table 1 lists the strains, plasmids, and primers used in this study. L. plantarum NC8 (CCUG 61730) [24] was kindly provided by Prof. Chunfeng Wang (Jilin Agricultural University, China). The NC8 strains were quiescently grown in anaerobic conditions at 37 °C in an MRS medium containing erythromycin (Em) (10 µg/mL). E. coli Top10 strain was cultured in Luria–Bertani (LB) broth under shaking conditions at 37 °C (200 µg /mL Em). The K. pneumoniae HRB2020005 strain isolated from swine was kindly provided by Prof. Liancheng Lei (Jilin University, China) and identified via 16s rDNA (GeneBank OQ674507).

Table 1 The list of the strains, plasmids and primers used in this study

Strains, plasmids, primers	Description	Source	
E. coli Top 10	Host strain	TaKaRa	
L. plantarum NC8

(CCUG 61730)

	Host strain, Plasmid-free, silage isolate	[24]	
pSIP409-aCD11c	PsppIP, sppR, K, aCD11c, Emr	[16]	
409-a’-F	CTATTACAAGGAGATTTTAGCC

ATGAAAAAATTGG TTTCAAC

	This study	
409-a’-R	GAAGCTTTTAagcgtaatctggaacatcgtatgggtaAGCAGCCCGCTTAATTTC	This study	
pLc23-a-F	CCATGAAAAAATTGGTTTCAAC

GATTGTTACGACGAGTGCTGCTGC

	This study	
Primers 409-a’-F, 409-a’-R and pLc23-a-F were designed by the study [16]

aCD11c-expressing L. plantarum Construction

The plasmid extracted from Top10-pSIP409-aCD11c was utilized as a template. The aCD11c fragment was amplified using two primer pairs, 409-a’-F/409-a’-R and pLc23-a-F/409-a’-R (Table 1), respectively. Subsequently, the fragments were ligated with vectors pSIP409 (Hind III) and pLc23 (Hind III) using the Seamless Assembly Cloning Kit (Clone Smarter Technologies, China) to generate the recombinant plasmids pSIP409-aCD11c’ and pLc23-aCD11c. After sequencing and verification by Biocorp (Tsingke Biotechnology, China), the recombinant plasmids were electro-transformed into L. plantarum NC8 using an electroporation gene introducer (Bio-Rad, USA) with parameters set at 2.5 KV, 400 Ω, and 25 µF. This resulted in the generation of recombinant L. plantarum strains NC8-pSIP409-aCD11c’ and NC8-pLc23-aCD11c, abbreviated as 409-a and pLc23-a, respectively.

Western blotting of aCD11c

The recombinant strains were inoculated in an MRS medium for anaerobic culture. SppIP (50 ng/mL, sakacin P) was added to the NC8-pSIP409 (409) and 409-a to induce protein expression, except the strain pLc23-a. After incubation, the above three strains were harvested via centrifugation, and protein samples were obtained as previously described [16]. The samples were evaluated by western blotting using an HA-labeled primary antibody (1:1000, Beyotime, China), followed by an HRP-conjugated goat anti-mouse IgG (1:5000, Solarbio, China) as the secondary antibody. Detection was performed using a chemiluminescence imager.

Adhesive and invasive ability of recombinant L. plantarum to BMDCs

C57BL/6 mice (5–6 weeks old) were obtained from the Experimental Animal Center of Three Gorges University, Yichang. Bone marrow-derived dendritic cells (BMDCs) were acquired according to the previously methods [25]. BMDCs were isolated from the tibiae and fibulae of mice. The culture medium of BMDCs was supplemented with 20 ng /mL GM-CSF and 10 ng /mL IL-4 (PeproTech, USA). On the 8th day, cells were harvested and placed in 24-well culture dishes at a density of 2 × 105 cells per well. The cells were then incubated for 24 h. Following that, the adhesion and invasion test of 409-a and pLc23-a were conducted. The strains were cultivated together with cells (MOI = 1000), and the monoclonal anti-mouse CD11c antibody (Bioss, China) was introduced. Following a two-hour period of stimulation, the cells were exposed to aseptic PBS solution containing 0.2% Triton X-100 for a duration of 10 min. After being diluted in a gradient manner, then the cells were incubated in MRS culture plates (37 °C, 10 µg/mL Em) overnight. Subsequently, the cells were counted in order to evaluate the rate of L. plantarum adhesion. Concurrently, those cells were exposed to L. plantarum stimulation for 2 h were subjected to invasion assays, after being treated with gentamicin (500 µg /mL). The adhesion or invasion ratio was computed according to the previously method [16].

Activation of BMDCs cells

After BMDCs were cultured in 24-well plates, 409, 409-a, pLc23-a, and LPS were added to each group of cells. L. plantarum was added to the cultures at an MOI of 10. Subsequent experiments were performed after overnight incubation. Cells were collected and incubated with antibodies purchased from BD, such as APC-labeled anti-mouse CD11c, FITC-labeled anti-mouse CD40, PerCP-Cy5.5-labeled anti-mouse CD80, and their respective isotype control antibodies. Then, all samples were processed by flow cytometry (FCM) (BD FACSMelody, USA) for analysis. The databases were parsed by FlowJo V10.

Immunization and challenge

BALB/c mice (6–8 weeks old) were supplied by the Experimental Animal Center of Three Gorges University, Yichang, Hubei Province, China. In total, 75 same-aged mice were randomly and equally categorized into five groups, namely, PBS, KP, 409, 409-a, and pLc23-a. Mice were immunized orally twice consecutively on 1st to 3rd day and 15th to 17th day (Fig. 1A). The L. plantarum immunization dosage was 109 CFU/100 µL/ mouse. Furthermore, the PBS group was fed an equal volume of PBS. One week after the immunization, 3 mice were randomly selected from the PBS and L. plantarum groups to perform FCM assays.

On the 25th day, all BALB/c mice, except those in the PBS group, were injected with 1 × 107 CFU KP by intraperitoneal injection. After 24 h, the lung, spleen, and liver organs were removed and minced from euthanized mice after rapid cervical dislocation. The tissue homogenates were appropriately diluted and incubated on LB agar plates in a 37 °C incubator for colony counting. Colonization was calculated as the ratio of organ colonies to inoculation colonies.

Fig. 1 Detection of CD4+T cells activation via FCM and antibody levels through ELISA. (A) Immunization and infection processes in mice and the implementation of separate assays. Flow chart (B) and analysis (C) of the expression of IFN-γ+ CD4+ T cells and IL-4+ CD4+ T cells in spleen. (D) The levels of sIgA in ILF and IgG in the serum of mice after the second immunization. A one-way ANOVA test was performed to determine statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001)

Characterization of CD4+ T cells in the spleen

On the 24th day, 3 mice per group were measured by FCM. The spleens were aseptically removed and ground in RPMI 1640 medium. Furthermore, the supernatant was discarded via centrifugation and lysed by erythrocyte lysis solution, washed with PBS, and permeabilized. Subsequently, the cells were counted after re-suspension in 1 mL of culture medium. Surface and intracellular staining of T cells were separately performed. For intracellular staining, RPMI1640 complete medium (10% FBS) containing PMA, Ionomycin and Brefeldin A stimulating agent (BD Leukocyte Activation Cocktail, USA) was added into a 48-well culture plate containing 2 × 106 cells per well and cultured in an incubator for 5 h (37 °C, 5% CO2) for stimulation. After the completion of stimulation, BV510 labeled anti-mouse CD3e and BV421 labeled anti-mouse CD4 were added for surface staining, APC labeled anti-mouse IFN-γ and PE-Cy7 labeled anti-mouse IL-4 and their respective isotype control antibodies (BD Pharmingen) were used for intracellular staining after fixation and permeabilization (BD fixation/permeabilization solution kit, USA). Lastly, the single-cell suspended solution was re-suspended in PBS for FCM assays.

ELISA

Blood samples were obtained after the second immunization, and the supernatants were collected via centrifugation. Intestinal tissues were washed with pre-cooled PBS containing 1% protease inhibitor PMSF (Beyotime, China). Furthermore, the contents were obtained, and the supernatant was collected via centrifugation. Mucosal antibody secretory IgA (sIgA) in intestinal lavage fluid (ILF) was detected as per the manufacturer’s protocol (MEIMIAN, China). Concurrently, IgG levels in the serum were detected using the Cytokine ELISA Kit for Mouse IgG (MEIMIAN, China).

Flow cytometry assays for Th17 and Treg cells after KP infection

On the 32nd day, peripheral blood of 3 mice from each group was obtained, and one-half of the anticoagulated blood was supplemented with RPMI1640 complete medium (10% FBS) containing PMA, Ionomycin and Brefeldin A stimulating agent (BD Leukocyte Activation Cocktail, USA), which was cultured in an incubator for 5 h (37 °C, 5% CO2) and homogenized every 1 h. The suspensions were incubated with BV421 labeled anti-mouse CD4, fixed, permeabilized, and incubated with PE-labeled anti-mouse IL-17 A and their respective isotype control antibodies. This was then rinsed with PBS and resuspended for FCM detection of Th17 cells. Concurrently, lungs were obtained under aseptic conditions to prepare single-cell suspensions. Tissue fragments were digested in RPMI1640 digestion solution for 30 min (10% FBS, 25 U/mL DNase I, 2.0 mg/mL collagenase IV, 1.0 mg/mL collagenase I) and mixed slowly. After digestion, the lung tissue was gently ground and filtered through a cell sieve (70 μm), centrifuged, and lysed twice by adding erythrocyte lysis solution. The lysis was terminated by PBS. The supernatant was discarded via centrifugation and suspended in RPMI 1640 complete medium to obtain single-cell suspensions. BV421-labeled anti-mouse CD4 and PE-labeled anti-mouse CD25 were first treated with cell suspensions to detect Treg cells in the other half of the unstimulated peripheral blood and lung tissues. After fixation and permeabilization, APC-labeled anti-mouse FOXP3 and their respective isotype control antibodies were added for incubation and used for FCM detection.

Lung wet/dry (W/D) ratio

On the 7th day after the KP infection, lungs were removed from mice sacrificed by cervical dislocation, washed with sterile PBS, and wet weights were obtained. Lungs were then dried in a thermostat at 65 °C for 24 h, removed, and weighed. The W/D ratio was calculated to estimate the effect of recombinant L. plantarum on pulmonary edema.

Histological evaluation (HE)

The lung and intestinal tissues of mice were obtained, washed with aseptic PBS, and immobilized in 4% paraformaldehyde solution. Furthermore, tissues were treated with dehydration and inserted in paraffin wax, sectioned, colored with hematoxylin and eosin (H&E), and observed using a microscope (Leica, Germany).

Analysis of STAT5, p-STAT5, and FOXP3

Lysis buffer RIPA (Beyotime, USA) consisting of proteinase and phosphatase inhibitor compounds was added to the samples. The mixture was homogenized and the supernatant was obtained via centrifugation. For the western blotting assay, primary antibodies included STAT5, p-STAT5, FOXP3, and GAPDH (ABclonal, China), whereas secondary antibodies included HRP-conjugated goat anti-rabbit IgG (1:5000, Solarbio, China). A chemiluminescence imager was used for detection. The results were analyzed using Image J.

Quantitative RT-PCR

The expression of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and transforming growth factor-β (TGF-β) mRNA from lung tissue was detected using qRT-PCR. Total RNA was extracted using an RNA extraction kit (Tsingke, China), and reversal transcription was performed by cDNA Synthesis Kit (Vazyme, China). PCR was performed as per the manufacturer’s protocol in a reaction mixture containing 2×Universal SYBR green qPCR mix (ABclonal, China). Transcripts of the indicated genes were detected on a 7500 Real-Time PCR system Real-Time PCR system (Thermo Fisher, USA). Amplifications were processed with gene-targeted primers as follows: β-actin (AY618569), forward primer (Fw) 5’- AATCGTGCGTGACATCAAAG-3’ and reverse primer (Rv) 5’- AAGAAGGAAGGCTGGAAAAGAG-3’. TNF-α (NM_013693), Fw 5’- CAGAAAGCATGATCCGCGAC-3’ and Rv 5’-TCTGAGTGTGAGGGTCTGGG − 3’. TGF-β (M13177), Fw 5’-GCTGAACCAAGGAGACGGAA-3’ and Rv 5’- GTTGGTATCCAGGGCTCTCC-3’. IL-1β (NM_008361), Fw 5’- ATGAAAGACGGCACACCCAC-3’ and Rv 5’-GCTTGTGCTCTGCTTGTGAG-3’. The conserved gene β-actin was used as an internal control.

Statistical analysis

The GraphPad Prism 6.01 software was used for statistical analysis. Data are presented as the mean ± standard error of the mean (S.E.M.) and were assessed through one-way ANOVA (Dunnett’s multiple comparison test) in at least three independent experiments. P < 0.05 was considered statistically significant.

Results

409-a and pLc23-a expressed aCD11c protein

The plasmid pSIP409-aCD11c’ added only the HA-tag as a flag after the aCD11c sequence to allow the detection of protein expression, while the cell wall fractions were collected to detect the expression of the aCD11c protein of strains 409-a and pLc23-a. The results showed that both different types of vectors successfully expressed aCD11c protein with the same size (39 kDa) (Fig. 2C), indicating that aCD11c was expressed by both strains. Furthermore, the expression of aCD11c protein was higher in the inducible strain 409-a than in the constitutive strain pLc23-a under the same treatment conditions.

Fig. 2 Structural diagrams of pSIP409-aCD11c’ and pLc23-aCD11c plasmids and the detection of aCD11c expression. (A) Plasmid profile of pSIP409-aCD11c’. pSIP409 is a shuttle vector that can be activated by the addition of SppIP, with the sequence MAGNSSNFIHKIKQIFTHR. (B) Plasmid profile of pLc23-aCD11c. pLc23 is a modified version of pSIP409 that employs a continuous expression system (pOri23) to substitute for the inducible expression system (sppK, sppR). (C) The expression of aCD11c. M: Low molecular weight protein standard; Lane 1: NC8-pSIP409-aCD11c’; Lane 2: NC8-pLc23-aCD11c; Lane 3: empty vector NC8-pSIP409

aCD11c-expressing strains improved adhesion and invasion of BMDCs and promoted the activation

The recombinant strains expressing aCD11c protein improved the adhesion and invasion efficiency of BMDCs. Furthermore, the inducible expression of strain 409-a was more effective than the constitutive expression of strain pLc23-a in adhesion (P < 0.01) (Fig. 3A) and invasion rate (P < 0.05) (Fig. 3A). The increased adhesion rates were distinctly decreased during the competitive assay, wherein the anti-CD11c antibody was used before co-incubation with BMDCs (P < 0.001) (Fig. 3A). This showed that the cellular adhesion was improved via the expression of aCD11c on the surface of the strains. Similar results were observed in the invasion study (P < 0.001) (Fig. 3A). This suggests that the expression of aCD11c significantly increased the numbers of bacteria in BMDCs, whereas the presence of anti-CD11c antibody decreased these results. A FACS assay was performed to further analyze the activation of targeting strains to BMDCs. Both targeting strains effectively promoted the expression of CD40 (P < 0.05, P < 0.01) and CD80 (P < 0.001, P < 0.05) in BMDCs compared with the 409 strain as control (Fig. 3B). These results showed that aCD11c protein promoted the activation of BMDCs in vitro.

Fig. 3 The adhesion and invasion of aCD11c-expression strains and activation for BMDCs. (A) Adhesion and invasion of targeting L. plantarum to BMDCs. (B) The expression of CD11c+ CD40+ and CD11c+ CD80+ for BMDCs were analyzed by FCM. LPS was used as a positive control. A one-way ANOVA test was performed to determine statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001)

aCD11c-expressing strains promoted the activation of CD4+ T cells and the production of humoral antibodies

In the mouse model, to further determine the T cell response induced by the strains 409-a and pLc23-a, we determined the interferon-γ (IFN-γ) and interleukin-4 (IL-4)-producing T cells in the spleen (Fig. 1B). The results indicated that the expression of CD4+ IL-4+ T cells from the 409-a group was upregulated compared with the 409 control group after immunization (P < 0.05). However, the expression of IFN-γ was not considerably changed (Fig. 1C), indicating that immunization can activate CD4+ T cells and stimulate the differentiation of CD4+ T cells toward Th2 subtypes. Further, the sIgA assay was performed to evaluate the ability of gastrointestinal mucosa to resist bacterial and viral adhesion. After oral immunization with L. plantarum, sIgA levels in ILF were significantly increased in both the 409-a (P < 0.001) and pLc23-a (P < 0.01) groups compared with the PBS group. Furthermore, the 409-a was significantly increased compared with the 409 groups (P < 0.01) (Fig. 1D). IgG, which is the main antibody in the serum that exerts antibacterial activity, was measured to determine the immune response of the body. The IgG expression in serum was increased in both the 409-a (P < 0.01) and pLc23-a (P < 0.05) groups compared with the 409 groups (Fig. 1D), indicating that oral immunization could effectively induce the mucosal immunity and humoral immunity.

L. plantarum expressing aCD11c alleviated the colonization ability of KP in lung

To verify the ability of mice immunized with L. plantarum to defend against KP infection, the amounts of bacteria in the lung, liver, and spleen of different groups of mice were measured on the 7th day after KP infection. The amounts of bacteria in the lungs, livers, and spleens of mice immunized with strains 409-a and pLc23-a were significantly decreased compared with those in the control KP group (P < 0.01) (Fig. 4), especially in lung tissue (P < 0.001) (Fig. 4A). This showed that mice immunized with L. plantarum could efficiently alleviate the colonization ability of KP in different tissues, in particularly L. plantarum expressing aCD11c could efficiently alleviate the colonization ability of KP in lung.

Fig. 4 Detection of bacterial loads of different organs after KP infection for 24 h in mice., Bacterial loads of lung (A), liver (B), and spleen (C) organs. A one-way ANOVA test was performed to determine statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001)

aCD11c-expressing strains reduced Th17 cells and improved Treg cells expression levels

To better evaluate the changes in the Th17 cells and Treg cells following KP infection in the mouse model, the levels of Th17 in peripheral blood and Treg cells in lung were detected 3 days after KP infection. The levels of CD4+ IL-17 A+ Th17 cells in peripheral blood were significantly lower in the aCD11c-expressing group compared with those in the 409 groups (P < 0.01) (Fig. 5A). The 409-a + KP group and pLc23-a + KP exhibited substantially higher levels of CD4+ CD25+ FOXP3+ Treg cells than the 409 + KP group in lung (P < 0.01 and P < 0.05) (Fig. 5B). Furthermore, there was no significant difference in Th17 cells and Treg cells levels between the two groups 409-a and pLc23-a (Fig. 5A and B), indicating that the expression of aCD11c reduced the Th17 cells in peripheral blood and improved Treg cells expression levels in lung.

Fig. 5 Detection of the expression of CD4+IL-17 A+Th17 cells and CD4+CD25+FOXP3+Treg cells after KP infection. (A) Flow chart and analysis of the expression of CD4+ IL-17+ Th17 cells in peripheral blood. (B) Flow chart and analysis of the expression of CD4+CD25+FOXP3+ Treg cells in lung by FCM. A one-way ANOVA was performed to determine statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001)

L. plantarum expressing aCD11c ameliorated pulmonary edema and histopathological symptoms

Following intraperitoneal injection of KP, mice in the experimental groups, as compared to the PBS group, exhibited symptoms such as a disheveled coat, restlessness, decreased appetite, reduced motility, and increased fecal excretion within 24 h. On the 7th day post-KP infection, three mice from each group were sampled, and their pulmonary tissue wet/dry (W/D) ratios were recorded. The results indicated that the W/D ratios decreased in the L. plantarum-immunized groups compared to the KP group (P < 0.01) (Fig. 6A), in particularly L. plantarum expressing aCD11c groups. This suggests that L. plantarum expressing aCD11c can alleviate pulmonary edema induced by KP infection. The tissues showed varying degrees of inflammatory pathological alterations, with altered lung tissue structural deformation, and inflammatory cells and exudates flooding the alveolar space. In the intestine, the intestinal villi were separated, the epithelial cells were morphologically aberrant, the intestinal mucosa was injured, and the tissue mucosa or muscle layer was destroyed. Mice in the immunized L. plantarum groups exhibited significant relief of pathological symptoms (Fig. 6B).

Fig. 6 Evaluation of inflammatory response after KP infection. (A) W/D ratios of pulmonary tissue in each group were recorded. A one-way ANOVA test was applied to estimate statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001). (B) Lung and intestinal samples from different KP-infected groups were acquired, fixed, and embedded in paraffin. Sections were stained through H&E (magnification, ×200). Scale bar, 200 μm

The targeting L. plantarum regulated Treg cells through STAT5/FOXP3 signaling pathway

KP infection can affect the inflammatory process in the lungs via NF-κB and other validation-related signaling pathways. The question arises whether targeting L. plantarum can influence the expression of Treg cells through the modulation of the STAT5/FOXP3 signaling pathway, as evidenced by the subsequent findings. The results showed an upregulation of p-STAT5 levels in the lung tissues of the 409-a and pLc23-a groups compared to the 409 group. The upregulation was notably more significant in the 409-a group after KP infection (P < 0.001) (Fig. 7B). Furthermore, there was significantly higher in FOXP3 expression in the 409-a (P < 0.01) and pLc23-a (P < 0.01) groups when compared with the 409 control group (Fig. 7C). Analyzing the FCM results, it was observed that the levels of CD4+ CD25+ FOXP3+ Treg cells were significantly higher in lung tissue in the aCD11c-expressing groups compared to the 409 group (P < 0.01) (Fig. 7B). This indicates that aCD11c-expressing strains have the potential to improve Treg cell expression by regulating the STAT5/FOXP3 signaling pathway in the lung.

Fig. 7 Activation of the STAT5/FOXP3 signaling pathway and expression of inflammatory factors in the lung after KP infection. (A) Expression of STAT5, p-STAT5, FOXP3, and GAPDH in the lungs of different groups of mice immunized with L. plantarum after KP infection. (B and C) The analysis of STAT5 phosphorylation level and evaluation of FOXP3 expression. (D-F) Gene expression of IL-1β, TNF-α and TGF-β in the lung. The housekeeping gene β-actin was selected as an internal control for normalization. A one-way ANOVA test was performed to determine the statistical significance (*P < 0.05, **P < 0.01 and ***P < 0.001)

The expression of inflammatory cytokine was downregulated caused by the targeting L. plantarum

KP can cause pathogenic changes in lung tissue by activating several inflammatory signaling pathways and impairing the production of cytokines involved in inflammation. Upon assessing the expression levels of IL-1β, TGF-β, and TNF-α in lung tissue, the findings revealed that both the 409-a and pLc23-a groups significantly reduced the expression of KP-induced inflammatory cytokines IL-1β (P < 0.001) (Fig. 7D), TGF-β (P < 0.01) (Fig. 7E) and TNF-α (P < 0.001) (Fig. 7F) compared with that in the 409 group. This indicates that vaccination with L. plantarum expressing aCD11c can effectively prevent the production of inflammatory cytokines due to KP.

Discussion

Lactic acid bacteria (LAB), as a representative intestinal probiotic, exhibit the ability for stable colonization in the gastrointestinal tract. LAB can stimulate the mucosal immune response by maintaining the equilibrium of intestinal microorganisms. Moreover, LAB functions as an effective oral vaccine delivery vehicle, offering immunological defense against pathogenic bacterial infections [13]. There is an important connection between the gut microbiome and the lung, known as the “gut-lung axis” (GLA). Disruptions to intestinal and pulmonary homeostasis can lead to allergic or inflammatory reactions. However, probiotics such as LAB can help regulate the microbiota and alleviate these conditions [26–28]. Despite the sophisticated nature of the pathogenesis and influencing factors involved in gastrointestinal and respiratory diseases, probiotics can effectively alleviate allergic or inflammatory reactions. This is accomplished by regulating microbiota when there is a disruption in intestinal and pulmonary homeostasis [29]. Probiotics can stimulate the body’s immune response, strengthen the protective function of the mucosal barrier, inhibit the invasion of pathogenic bacteria, and decrease the morbidity of respiratory or gastrointestinal diseases to some extent [30–32]. Specifically, the intestinal microbiota can mediate distal immune regulation in the lungs through the gut-lung axis [33]. In this study, oral administration of L. plantarum expressing aCD11c was found to have an immunoprotective effect against KP lung infection in mice. Furthermore, the investigation into the state of cellular and humoral immunity during immune protection and the regulatory mechanisms laid the foundation for the future development of KP vaccines.

Although KP infections are currently not major issues in livestock, the increasing detection of drug-resistant KP strains is concerning, especially with the growing integration of pets into human life [34, 35]. Existing KP vaccines have limited efficacy due to the complex and variable serotypes of the pathogen [3, 36, 37]. Currently, the efficacy of pertinent vaccines cannot be assured, and they struggle to address the complex and variable serotypes of KP [8, 38]. L. plantarum is a promising probiotic-based vaccine candidate. It can efficiently suppress harmful bacteria through metabolite production [39, 40] and can effectively colonize both the gut and respiratory tract [41]. In the mouse model, L. plantarum immunization decreased organ bacterial loads, demonstrating its potential as a KP vaccine (Fig. 1).

Under normal conditions, the intestinal and pulmonary microbiomes maintain a dynamic equilibrium. The intestinal microbiota can control the threshold of immune activation and influence the systemic immune response. The mucosal immune system, which includes sIgA, acts as a key defense against inhaled pathogens in the respiratory and gastrointestinal tracts [42]. In this study, KP infection damaged the intestinal and lung mucosal barriers, while oral administration of L. plantarum was able to increase sIgA levels in ILF (Fig. 4D). Ultimately, the mucosal integrity of the intestinal and lung tissues was superior to the control group, as observed in histopathological sections after KP infection in mice (Fig. 6B).

DCs play a crucial role in antigen processing and T cell activation [15, 43, 44], when activated by foreign pathogens, they travel to nearby lymph nodes to transmit antigens to T cells, mobilizing them to promote the acquired immune response [45]. Recently, therapies targeting APCs have shown promise. The DC-SIGN, FcR, and CD11c receptors enable DCs to process foreign antigens and identify pathogens involved in innate immunity. As part of the host immune response, immature DCs acquire and internalize specific antigens, express costimulatory molecules, mature, and transport processed antigens to drive T-cell differentiation and B-cell generation [46, 47]. In this study, L. plantarum strains expressing the aCD11c protein were able to more effectively target and activate DCs in vitro (Fig. 4). Analysis of the T-cell response showed that immunization with the L. plantarum strains NC8-pSIP409-aCD11c’and NC8-pLc23-aCD11c triggered a Th2-skewed immune response, with increased IL-4 production and B-cell antibody generation, rather than a Th1 IFN-γ response (Fig. 1B and C). This Th2 response is more effective against extracellular pathogens such as bacteria, and is mediated by IL-4, which drives the maturation of B cells into plasma cells and increases antibody production [48]. This finding is consistent with the increased IgG level in humoral immunity (Fig. 4D).

When immunity is compromised, the lung barrier cannot withstand external bacterial infestation or infection, and the absence of effective antibiotics against KP can complicate treatments. KP induces severe acute lung inflammation, such as ALI, causing respiratory failure or mortality [4, 49]. The primary pathogenic mechanisms of ALI are triggered by inflammatory responses, oxidative stress, and apoptosis [50]. Th17/Treg is closely linked with the immunopathogenesis of prevalent clinical lung diseases such as tuberculosis and asthma [51–54]. Tregs can suppress the non-specific immunological effects of immune effector cells via direct contact, killing immune effector cells, or indirectly triggering apoptosis [55, 56]. Furthermore, Tregs have the ability to inhibit the synthesis of inflammatory molecules by expressing high levels of galectin-1, eliminating Pseudomonas aeruginosa and KP [57]. The study found that immunization with aCD11c-expression L. plantarum led to a decrease in CD4+ IL-17+ Th17 cells in the peripheral blood (Fig. 5).

STAT5/FOXP3 signaling pathway is crucial for Treg cells evolution and function [20, 57, 58]. The study revealed that the group treated with aCD11c-expressing L. plantarum had significantly greater levels of phosphorylated STAT5 (p-STAT5) and the transcription factor FOXP3 than did the KP infection group. This finding suggested that L. plantarum intervention activated the STAT5/FOXP3 pathway under inflammatory conditions, leading to increased FOXP3 expression and enhanced Treg function (Fig. 7A and B). However, the expression levels of p-STAT5 and FOXP3 were not positively correlated in the KP infection group compared to the control group. This may be because the KP infection affected the production or expression of other signaling pathways and cytokines, such as the PI3K/Akt/mTOR pathway and TGF-β, TLR, and hemoglobin, which can also contribute to FOXP3 expression through compensatory mechanisms [59, 60]. Bacterial translocation and intrapulmonary immune response mobilization induce inflammatory factors such as IL-1β and TNF-α to damage lung tissue and trigger oxidative stress causing subsequent infection [61, 62]. However, IL-1β, TNF-α, and TGF-β expression were lower in the aCD11c groups than that in the KP group. Furthermore, inflammatory pathological changes in the lung and gut decreased, indicating that L. plantarum intervention could reduce KP-induced inflammation (Fig. 7C). Although TNF-α production in lung tissues was higher in the 409 + KP group than in the KP group, it probably due to the fact that L. plantarum 409 induced the production of some inflammatory factors as an exogenous stimulus or immunogen [63], the side effect was alleviated by L. plantarum 409-a and pLc23-a, which express the aCD11c protein, by stimulating the DCs to better regulate cellular immunity and humoral immunity.

In conclusion, this study revealed that the targeting of the L. plantarum strains NC8-409-aCD11c’ and NC8-pLc23-aCD11c, which exhibit induced expression of aCD11c in the former and constitutive expression in the latter, could effectively improve the adhesion, invasion, and activation of BMDCs in vitro. L. plantarum strains expressing aCD11c were able to enhance cellular, humoral, and mucosal immunity in mice after oral immunization. Furthermore, L. plantarum-induced immunity was able to reduce inflammatory pathological changes in tissues by activating the STAT5/FOXP3 signaling pathway. This led to an increase in CD4+ CD25+ FOXP3+ Treg cells from the lungs and a reduction in Th17 cells from the peripheral blood after infection. No significant differences were found between the two L. plantarum strains in the experiments, except for protein expression. The study then determined the relationship between targeting L. plantarum, dendritic cells, and KP based on the improved protein expression of the strain with constitutive aCD11c expression.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

The authors would like to thank Prof. Chunfeng Wang in Jilin Agricultural University from China, for providing Lactobacillus plantarum NC8 and Prof. Liancheng Lei in Jilin University from China, for providing Klebsiella pneumoniae HRB2020005 strain.

Author contributions

YZ and JL conceived and designed research. YZ, TTL, XYC, XWF conducted experiments. YZ and JL analyzed data. CF, XYL, YYY contributed to the text editing. YZ wrote the manuscript and JL reviewed the manuscript. All authors all read and approved the manuscript.

Funding

This work was supported by Natural Science Foundation of Hubei Province (2021CFB173).

Data availability

Data is provided within the manuscript.

Declarations

Ethics approval and consent to participate

We obtained informed consent from the Experimental Animal Center of Three Gorges University to use the animals in this study. In the experiments, we collected blood, spleen, intestinal lavage fluid, internal organs, liver and lung. All applicable international, national, and/or institutional guidelines for the care and use of animals were followed (People’s Republic of China Ministry of Health, document NO.55, 2001), and all procedures were approved by the Ethics Committee of Health Science Center, Yangtze University (202401002). This study was conducted in accordance with the ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Argyres MI Hospital-acquired infections due to Gram-negative Bacteria N Engl J Med 2010 363 15 1483 10.1056/NEJMc1006641 20931682
Argyres MI. Hospital-acquired infections due to Gram-negative Bacteria. N Engl J Med. 2010;363(15):1483. 10.1056/NEJMc1006641.20931682 10.1056/NEJMc1006641
2. Bidewell CA Williamson SM Rogers J Tang Y Ellis RJ Petrovska L Emergence of Klebsiella pneumoniae subspecies pneumoniae as a cause of septicaemia in pigs in England PLoS ONE 2018 13 2 e0191958 10.1371/journal.pone.0191958 29470491
Bidewell CA, Williamson SM, Rogers J, Tang Y, Ellis RJ, Petrovska L, et al. Emergence of Klebsiella pneumoniae subspecies pneumoniae as a cause of septicaemia in pigs in England. PLoS ONE. 2018;13(2):e0191958. 10.1371/journal.pone.0191958.29470491 10.1371/journal.pone.0191958
3. Yang F Deng B Liao W Wang P Chen P Wei J High rate of multiresistant Klebsiella pneumoniae from human and animal origin Infect Drug Resist 2019 12 2729 37 10.2147/IDR.S219155 31564923
Yang F, Deng B, Liao W, Wang P, Chen P, Wei J. High rate of multiresistant Klebsiella pneumoniae from human and animal origin. Infect Drug Resist. 2019;12:2729–37. 10.2147/IDR.S219155.31564923 10.2147/IDR.S219155
4. Zou B Jiang W Han H Li J Mao W Tang Z Acyloxyacyl hydrolase promotes the resolution of lipopolysaccharide-induced acute lung injury PLoS Pathog 2017 13 6 e1006436 10.1371/journal.ppat.1006436 28622363
Zou B, Jiang W, Han H, Li J, Mao W, Tang Z, et al. Acyloxyacyl hydrolase promotes the resolution of lipopolysaccharide-induced acute lung injury. PLoS Pathog. 2017;13(6):e1006436. 10.1371/journal.ppat.1006436.28622363 10.1371/journal.ppat.1006436
5. Yan X Zeng J Li X Zhang Z Din AU Zhao K High incidence and characteristic of PRRSV and resistant bacterial co-infection in pig farms Microb Pathog 2020 149 104536 10.1016/j.micpath.2020.104536 32980472
Yan X, Zeng J, Li X, Zhang Z, Din AU, Zhao K, et al. High incidence and characteristic of PRRSV and resistant bacterial co-infection in pig farms. Microb Pathog. 2020;149:104536. 10.1016/j.micpath.2020.104536.32980472 10.1016/j.micpath.2020.104536
6. Fuentes-Castillo D Shiva C Lincopan N Sano E Fontana H Streicker DG Global high-risk clone of extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae ST307 emerging in livestock in Peru Int J Antimicrob Agents 2021 58 3 106389 10.1016/j.ijantimicag.2021.106389 34166775
Fuentes-Castillo D, Shiva C, Lincopan N, Sano E, Fontana H, Streicker DG, et al. Global high-risk clone of extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae ST307 emerging in livestock in Peru. Int J Antimicrob Agents. 2021;58(3):106389. 10.1016/j.ijantimicag.2021.106389.34166775 10.1016/j.ijantimicag.2021.106389
7. Sirichokchatchawan W Apiwatsiri P Pupa P Saenkankam I Khine NO Lekagul A Reducing the risk of transmission of critical Antimicrobial Resistance determinants from contaminated pork products to humans in South-East Asia Front Microbiol 2021 12 689015 10.3389/fmicb.2021.689015 34385984
Sirichokchatchawan W, Apiwatsiri P, Pupa P, Saenkankam I, Khine NO, Lekagul A, et al. Reducing the risk of transmission of critical Antimicrobial Resistance determinants from contaminated pork products to humans in South-East Asia. Front Microbiol. 2021;12:689015. 10.3389/fmicb.2021.689015.34385984 10.3389/fmicb.2021.689015
8. Assoni L Girardello R Converso TR Darrieux M Current stage in the development of Klebsiella pneumoniae vaccines Infect Dis Ther 2021 10 4 2157 75 10.1007/s40121-021-00533-4 34476772
Assoni L, Girardello R, Converso TR, Darrieux M. Current stage in the development of Klebsiella pneumoniae vaccines. Infect Dis Ther. 2021;10(4):2157–75. 10.1007/s40121-021-00533-4.34476772 10.1007/s40121-021-00533-4
9. Dell’Annunziata F Dell’Aversana C Doti N Donadio G Dal Piaz F Izzo V Outer membrane vesicles derived from Klebsiella pneumoniae are a driving force for horizontal gene transfer Int J Mol Sci 2021 22 16 8732 10.3390/ijms22168732 34445438
Dell’Annunziata F, Dell’Aversana C, Doti N, Donadio G, Dal Piaz F, Izzo V, et al. Outer membrane vesicles derived from Klebsiella pneumoniae are a driving force for horizontal gene transfer. Int J Mol Sci. 2021;22(16):8732. 10.3390/ijms22168732.34445438 10.3390/ijms22168732
10. Zhang B Hu D Dou Y Xiong L Wang X Hu J Identification and Evaluation of Recombinant Outer Membrane Proteins as vaccine candidates against Klebsiella pneumoniae Front Immunol 2021 12 730116 10.3389/fimmu.2021.730116 34745099
Zhang B, Hu D, Dou Y, Xiong L, Wang X, Hu J, et al. Identification and Evaluation of Recombinant Outer Membrane Proteins as vaccine candidates against Klebsiella pneumoniae. Front Immunol. 2021;12:730116. 10.3389/fimmu.2021.730116.34745099 10.3389/fimmu.2021.730116
11. Martin RM Bachman MA Colonization, infection, and the Accessory Genome of Klebsiella pneumoniae Front Cell Infect Microbiol 2018 8 4 10.3389/fcimb.2018.00004 29404282
Martin RM, Bachman MA. Colonization, infection, and the Accessory Genome of Klebsiella pneumoniae. Front Cell Infect Microbiol. 2018;8:4. 10.3389/fcimb.2018.00004.29404282 10.3389/fcimb.2018.00004
12. Vela Ramirez JE Sharpe LA Peppas NA Current state and challenges in developing oral vaccines Adv Drug Deliv Rev 2017 114 116 31 10.1016/j.addr.2017.04.008 28438674
Vela Ramirez JE, Sharpe LA, Peppas NA. Current state and challenges in developing oral vaccines. Adv Drug Deliv Rev. 2017;114:116–31. 10.1016/j.addr.2017.04.008.28438674 10.1016/j.addr.2017.04.008
13. Suez J Zmora N Zilberman-Schapira G Mor U Dori-Bachash M Bashiardes S Post-antibiotic gut mucosal microbiome reconstitution is impaired by Probiotics and improved by autologous FMT Cell 2018 174 6 1406 23 10.1016/j.cell.2018.08.047 30193113
Suez J, Zmora N, Zilberman-Schapira G, Mor U, Dori-Bachash M, Bashiardes S, et al. Post-antibiotic gut mucosal microbiome reconstitution is impaired by Probiotics and improved by autologous FMT. Cell. 2018;174(6):1406–23. 10.1016/j.cell.2018.08.047.30193113 10.1016/j.cell.2018.08.047
14. Simon D Chopin A Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis Biochimie 1988 70 4 559 66 10.1016/0300-9084(88)90093-4 2844302
Simon D, Chopin A. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie. 1988;70(4):559–66. 10.1016/0300-9084(88)90093-4.2844302 10.1016/0300-9084(88)90093-4
15. Balan S Saxena M Bhardwaj N Dendritic cell subsets and locations Int Rev Cell Mol Biol 2019 348 1 68 10.1016/bs.ircmb.2019.07.004 31810551
Balan S, Saxena M, Bhardwaj N. Dendritic cell subsets and locations. Int Rev Cell Mol Biol. 2019;348:1–68. 10.1016/bs.ircmb.2019.07.004.31810551 10.1016/bs.ircmb.2019.07.004
16. Liu J Yang G Gao X Zhang Z Liu Y Yang X Immunomodulatory properties of Lactobacillus plantarum NC8 expressing an Anti-CD11c single-chain fv fragment J Microbiol Biotechnol 2019 29 1 160 70 10.4014/jmb.1809.09017 30415527
Liu J, Yang G, Gao X, Zhang Z, Liu Y, Yang X, et al. Immunomodulatory properties of Lactobacillus plantarum NC8 expressing an Anti-CD11c single-chain fv fragment. J Microbiol Biotechnol. 2019;29(1):160–70. 10.4014/jmb.1809.09017.30415527 10.4014/jmb.1809.09017
17. Bernard-Raichon L Colom A Monard SC Namouchi A Cescato M Garnier H A pulmonary Lactobacillus murinus strain induces Th17 and RORγt (+) Regulatory T cells and reduces lung inflammation in tuberculosis J Immunol 2021 207 7 1857 70 10.4049/jimmunol.2001044 34479945
Bernard-Raichon L, Colom A, Monard SC, Namouchi A, Cescato M, Garnier H, et al. A pulmonary Lactobacillus murinus strain induces Th17 and RORγt (+) Regulatory T cells and reduces lung inflammation in tuberculosis. J Immunol. 2021;207(7):1857–70. 10.4049/jimmunol.2001044.34479945 10.4049/jimmunol.2001044
18. Jia L Wu R Han N Fu J Luo Z Guo L Porphyromonas gingivalis and Lactobacillus rhamnosus GG regulate the Th17/Treg balance in colitis via TLR4 and TLR2 Clin Transl Immunol 2020 9 11 e1213 10.1002/cti2.1213
Jia L, Wu R, Han N, Fu J, Luo Z, Guo L, et al. Porphyromonas gingivalis and Lactobacillus rhamnosus GG regulate the Th17/Treg balance in colitis via TLR4 and TLR2. Clin Transl Immunol. 2020;9(11):e1213. 10.1002/cti2.1213.10.1002/cti2.1213
19. Nagai Y Lam L Greene MI Zhang H FOXP3 and its cofactors as targets of Immunotherapies Engineering 2019 5 1 115 21 10.1186/s12876-015-0388-x
Nagai Y, Lam L, Greene MI, Zhang H. FOXP3 and its cofactors as targets of Immunotherapies. Engineering. 2019;5(1):115–21. 10.1186/s12876-015-0388-x.10.1186/s12876-015-0388-x
20. Farrar MA Harris LM Turning transcription on or off with STAT5: when more is less Nat Immunol 2011 12 12 1139 40 10.1038/ni.2163 22089213
Farrar MA, Harris LM. Turning transcription on or off with STAT5: when more is less. Nat Immunol. 2011;12(12):1139–40. 10.1038/ni.2163.22089213 10.1038/ni.2163
21. Thomas R, Qiao S, Yang X. Th17/Treg Imbalance: implications in Lung Inflammatory diseases. Int J Mol Sci. 2023;24(5). 10.3390/ijms24054865.
22. Garín MI Chu CC Golshayan D Cernuda-Morollón E Wait R Lechler RI Galectin-1: a key effector of regulation mediated by CD4+ CD25+ T cells Blood 2007 109 5 2058 65 10.1182/blood-2006-04-016451 17110462
Garín MI, Chu CC, Golshayan D, Cernuda-Morollón E, Wait R, Lechler RI. Galectin-1: a key effector of regulation mediated by CD4+ CD25+ T cells. Blood. 2007;109(5):2058–65. 10.1182/blood-2006-04-016451.17110462 10.1182/blood-2006-04-016451
23. Passerini L Allan SE Battaglia M Di Nunzio S Alstad AN Levings MK STAT5-signaling cytokines regulate the expression of FOXP3 in CD4+ CD25+ regulatory T cells and CD4+ CD25g effector T cells Int Immunol 2008 20 3 421 31 10.1093/intimm/dxn002 18270368
Passerini L, Allan SE, Battaglia M, Di Nunzio S, Alstad AN, Levings MK, et al. STAT5-signaling cytokines regulate the expression of FOXP3 in CD4+ CD25+ regulatory T cells and CD4+ CD25- effector T cells. Int Immunol. 2008;20(3):421–31. 10.1093/intimm/dxn002.18270368 10.1093/intimm/dxn002
24. Sørvig E Mathiesen G Naterstad K Eijsink VGH Axelsson L High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors Microbiolog 2005 151 7 2439 49 10.1099/mic.0.28084-0
Sørvig E, Mathiesen G, Naterstad K, Eijsink VGH, Axelsson L. High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiolog. 2005;151(7):2439–49. 10.1099/mic.0.28084-0.10.1099/mic.0.28084-0
25. Liu J Yang G Huang H Shi C Gao X Yang W Dendritic cells targeting Lactobacillus plantarum strain NC8 with a surface-displayed single-chain variable fragment of CD11c induce an Antigen-Specific Protective Cellular Immune Response Infect Immun 2020 88 2 e00759 19 10.1128/IAI.00759-19 31740528
Liu J, Yang G, Huang H, Shi C, Gao X, Yang W, et al. Dendritic cells targeting Lactobacillus plantarum strain NC8 with a surface-displayed single-chain variable fragment of CD11c induce an Antigen-Specific Protective Cellular Immune Response. Infect Immun. 2020;88(2):e00759–19. 10.1128/IAI.00759-19.31740528 10.1128/IAI.00759-19
26. Budden KF Gellatly SL Wood DL Cooper MA Morrison M Hugenholtz P Emerging pathogenic links between microbiota and the gut-lung axis Nat Rev Microbiol 2017 15 1 55 63 10.1038/nrmicro.2016.142 27694885
Budden KF, Gellatly SL, Wood DL, Cooper MA, Morrison M, Hugenholtz P, et al. Emerging pathogenic links between microbiota and the gut-lung axis. Nat Rev Microbiol. 2017;15(1):55–63. 10.1038/nrmicro.2016.142.27694885 10.1038/nrmicro.2016.142
27. Dang AT Marsland BJ Microbes, metabolites, and the gut-lung axis Mucosal Immunol 2019 12 4 843 50 10.1038/s41385-019-0160-6 30976087
Dang AT, Marsland BJ. Microbes, metabolites, and the gut-lung axis. Mucosal Immunol. 2019;12(4):843–50. 10.1038/s41385-019-0160-6.30976087 10.1038/s41385-019-0160-6
28. Willis KA Stewart JD Ambalavanan N Recent advances in understanding the ecology of the lung microbiota and deciphering the gut-lung axis Am J Physiol Lung Cell Mol Physiol 2020 319 4 710 16 10.1152/ajplung.00360.2020
Willis KA, Stewart JD, Ambalavanan N. Recent advances in understanding the ecology of the lung microbiota and deciphering the gut-lung axis. Am J Physiol Lung Cell Mol Physiol. 2020;319(4):710–16. 10.1152/ajplung.00360.2020.10.1152/ajplung.00360.2020
29. Stavropoulou E Bezirtzoglou E Probiotics in Medicine: a long debate Front Immunol 2020 11 2192 10.3389/fimmu.2020.02192 33072084
Stavropoulou E, Bezirtzoglou E. Probiotics in Medicine: a long debate. Front Immunol. 2020;11:2192. 10.3389/fimmu.2020.02192.33072084 10.3389/fimmu.2020.02192
30. Mortaz E, Adcock IM, Folkerts G, Barnes PJ, Paul Vos A, Garssen J. Probiotics in the management of lung diseases. Mediators Iflamm. 2013:751068. 10.1155/2013/751068
31. Yang Y Huang W Fan Y Chen GQ Gastrointestinal microenvironment and the gut-lung Axis in the Immune responses of severe COVID-19 Front Mol Biosci 2021 8 647508 10.3389/fmolb.2021.647508 33912590
Yang Y, Huang W, Fan Y, Chen GQ. Gastrointestinal microenvironment and the gut-lung Axis in the Immune responses of severe COVID-19. Front Mol Biosci. 2021;8:647508. 10.3389/fmolb.2021.647508.33912590 10.3389/fmolb.2021.647508
32. De Oliveira GLV Oliveira CNS Pinzan CF de Salis LVV Cardoso CRB Microbiota Modulation of the gut-lung Axis in COVID-19 Front Immunol 2021 12 635471 10.3389/fimmu.2021.635471 33717181
De Oliveira GLV, Oliveira CNS, Pinzan CF, de Salis LVV, Cardoso CRB. Microbiota Modulation of the gut-lung Axis in COVID-19. Front Immunol. 2021;12:635471. 10.3389/fimmu.2021.635471.33717181 10.3389/fimmu.2021.635471
33. Fanos V Pintus MC Pintus R Marcialis MA Lung microbiota in the acute respiratory disease: from coronavirus to metabolomics J Pediatr Neonatal I 2020 9 1 e090139 10.7363/090139
Fanos V, Pintus MC, Pintus R, Marcialis MA. Lung microbiota in the acute respiratory disease: from coronavirus to metabolomics. J Pediatr Neonatal I. 2020;9(1):e090139. 10.7363/090139.10.7363/090139
34. Jian W Yuan-Yuan S Shou-Yu G Fei-Fei D Jia-Yu Y Xue-Hua W Serotype and virulence genes of Klebsiella pneumoniae isolated from mink and its pathogenesis in mice and mink Sci Rep 2017 7 1 17291 10.1038/s41598-017-17681-8 29230010
Jian W, Yuan-Yuan S, Shou-Yu G, Fei-Fei D, Jia-Yu Y, Xue-Hua W, et al. Serotype and virulence genes of Klebsiella pneumoniae isolated from mink and its pathogenesis in mice and mink. Sci Rep. 2017;7(1):17291. 10.1038/s41598-017-17681-8.29230010 10.1038/s41598-017-17681-8
35. Roberts DE McClain HM Hansen DS Currin P Howerth EW An outbreak of Klebsiella pneumoniae infection in dogs with severe enteritis and septicemia J Vet Diagn Invest 2000 12 2 168 73 10.1177/104063870001200215 10730951
Roberts DE, McClain HM, Hansen DS, Currin P, Howerth EW. An outbreak of Klebsiella pneumoniae infection in dogs with severe enteritis and septicemia. J Vet Diagn Invest. 2000;12(2):168–73. 10.1177/104063870001200215.10730951 10.1177/104063870001200215
36. Coletti M Passamonti F Del Rossi E Franciosini MP Setta B Klebsiella pneumoniae infection in Italian rabbits Vet Rec 2001 149 20 626 7 10.1136/vr.149.20.626 11761296
Coletti M, Passamonti F, Del Rossi E, Franciosini MP, Setta B. Klebsiella pneumoniae infection in Italian rabbits. Vet Rec. 2001;149(20):626–7. 10.1136/vr.149.20.626.11761296 10.1136/vr.149.20.626
37. Wei H Shen J Pang X Ding D Zhang Y Zhang B Fatal infection in human flora-associated piglets caused by the opportunistic pathogen Klebsiella pneumoniae from an apparently healthy human donor J Vet Med Sci 2008 70 7 715 7 10.1292/jvms.70.715 18685245
Wei H, Shen J, Pang X, Ding D, Zhang Y, Zhang B, et al. Fatal infection in human flora-associated piglets caused by the opportunistic pathogen Klebsiella pneumoniae from an apparently healthy human donor. J Vet Med Sci. 2008;70(7):715–7. 10.1292/jvms.70.715.18685245 10.1292/jvms.70.715
38. Lundberg U Senn BM Schüler W Meinke A Hanner M Identification and characterization of antigens as vaccine candidates against Klebsiella pneumoniae Hum Vaccin Immunother 2013 9 3 497 505 10.4161/hv.23225 23250007
Lundberg U, Senn BM, Schüler W, Meinke A, Hanner M. Identification and characterization of antigens as vaccine candidates against Klebsiella pneumoniae. Hum Vaccin Immunother. 2013;9(3):497–505. 10.4161/hv.23225.23250007 10.4161/hv.23225
39. Mohammadi F Eshaghi M Razavi S Sarokhalil DD Talebi M Pourshafie MR Characterization of bacteriocin production in Lactobacillus spp. isolated from mother’s milk Microb Pathog 2018 118 242 6 10.1016/j.micpath.2018.03.020 29551436
Mohammadi F, Eshaghi M, Razavi S, Sarokhalil DD, Talebi M, Pourshafie MR. Characterization of bacteriocin production in Lactobacillus spp. isolated from mother’s milk. Microb Pathog. 2018;118:242–6. 10.1016/j.micpath.2018.03.020.29551436 10.1016/j.micpath.2018.03.020
40. Wyszyńska A Kobierecka P Bardowski J Jagusztyn-Krynicka EK Lactic acid bacteria–20 years exploring their potential as live vectors for mucosal vaccination Appl Microbiol Biotechnol 2015 99 7 2967 77 10.1007/s00253-015-6498-0 25750046
Wyszyńska A, Kobierecka P, Bardowski J, Jagusztyn-Krynicka EK. Lactic acid bacteria–20 years exploring their potential as live vectors for mucosal vaccination. Appl Microbiol Biotechnol. 2015;99(7):2967–77. 10.1007/s00253-015-6498-0.25750046 10.1007/s00253-015-6498-0
41. Garcia-Gonzalez N Prete R Battista N Corsetti A Adhesion properties of Food-Associated Lactobacillus plantarum strains on human intestinal epithelial cells and modulation of IL-8 release Front Microbiol 2018 9 2392 10.3389/fmicb.2018.02392 30349520
Garcia-Gonzalez N, Prete R, Battista N, Corsetti A. Adhesion properties of Food-Associated Lactobacillus plantarum strains on human intestinal epithelial cells and modulation of IL-8 release. Front Microbiol. 2018;9:2392. 10.3389/fmicb.2018.02392.30349520 10.3389/fmicb.2018.02392
42. Li Y, Jin L, Chen T. The effects of secretory IgA in the Mucosal Immune System. Biomed Res Int. 2020;2032057. 10.1155/2020/2032057.
43. Macri C Pang ES Patton T O’Keeffe M Dendritic cell subsets Semin Cell Dev Biol 2018 84 11 21 10.1016/bs.ircmb.2019.07.004 29246859
Macri C, Pang ES, Patton T, O’Keeffe M. Dendritic cell subsets. Semin Cell Dev Biol. 2018;84:11–21. 10.1016/bs.ircmb.2019.07.004.29246859 10.1016/bs.ircmb.2019.07.004
44. Worbs T Hammerschmidt SI Förster R Dendritic cell migration in health and disease Nat Rev Immunol 2017 17 1 30 48 10.1038/nri.2016.116 27890914
Worbs T, Hammerschmidt SI, Förster R. Dendritic cell migration in health and disease. Nat Rev Immunol. 2017;17(1):30–48. 10.1038/nri.2016.116.27890914 10.1038/nri.2016.116
45. Shapouri-Moghaddam A Mohammadian S Vazini H Taghadosi M Esmaeili SA Mardani F Macrophage plasticity, polarization, and function in health and disease J Cell Physiol 2018 233 9 6425 40 10.1002/jcp.26429 29319160
Shapouri-Moghaddam A, Mohammadian S, Vazini H, Taghadosi M, Esmaeili SA, Mardani F, et al. Macrophage plasticity, polarization, and function in health and disease. J Cell Physiol. 2018;233(9):6425–40. 10.1002/jcp.26429.29319160 10.1002/jcp.26429
46. Hussain A Rafeeq H Munir N Jabeen Z Afsheen N Rehman KU Dendritic cell-targeted therapies to treat Neurological disorders Mol Neurobiol 2022 59 1 603 19 10.1007/s12035-021-02622-4 34743292
Hussain A, Rafeeq H, Munir N, Jabeen Z, Afsheen N, Rehman KU, et al. Dendritic cell-targeted therapies to treat Neurological disorders. Mol Neurobiol. 2022;59(1):603–19. 10.1007/s12035-021-02622-4.34743292 10.1007/s12035-021-02622-4
47. Mosca PJ Lyerly HK Clay TM Morse MA Lyerly HK Dendritic cell vaccines Front Biosci 2007 12 4050 60 10.2741/2371 17485358
Mosca PJ, Lyerly HK, Clay TM, Morse MA, Lyerly HK. Dendritic cell vaccines. Front Biosci. 2007;12:4050–60. 10.2741/2371.17485358 10.2741/2371
48. Wang J Jiang H Yang R Zhang S Zhao W Hu J Construction and evaluation of recombinant Lactobacillus plantarum NC8 delivering one single or two copies of G protein fused with a DC-targeting peptide (DCpep) as novel oral rabies vaccine Vet Microbiol 2020 251 108906 10.1016/j.vetmic.2020.108906 33160196
Wang J, Jiang H, Yang R, Zhang S, Zhao W, Hu J, et al. Construction and evaluation of recombinant Lactobacillus plantarum NC8 delivering one single or two copies of G protein fused with a DC-targeting peptide (DCpep) as novel oral rabies vaccine. Vet Microbiol. 2020;251:108906. 10.1016/j.vetmic.2020.108906.33160196 10.1016/j.vetmic.2020.108906
49. Peleg AY Hooper DC Hospital-acquired infections due to gram-negative bacteria N Engl J Med 2010 362 19 1804 13 10.1056/NEJMc1006641 20463340
Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med. 2010;362(19):1804–13. 10.1056/NEJMc1006641.20463340 10.1056/NEJMc1006641
50. Weng TI Wu HY Kuo CW Liu SH Honokiol rescues sepsis-associated acute lung injury and lethality via the inhibition of oxidative stress and inflammation Intensive Care Med 2011 37 3 533 41 10.1007/s00134-010-2104-1 21279327
Weng TI, Wu HY, Kuo CW, Liu SH. Honokiol rescues sepsis-associated acute lung injury and lethality via the inhibition of oxidative stress and inflammation. Intensive Care Med. 2011;37(3):533–41. 10.1007/s00134-010-2104-1.21279327 10.1007/s00134-010-2104-1
51. Zhang W Liu X Zhu Y Liu X Gu Y Dai X Transcriptional and posttranslational regulation of Th17/Treg balance in health and disease Eur J Immunol 2021 51 9 2137 50 10.1002/eji.202048794 34322865
Zhang W, Liu X, Zhu Y, Liu X, Gu Y, Dai X, et al. Transcriptional and posttranslational regulation of Th17/Treg balance in health and disease. Eur J Immunol. 2021;51(9):2137–50. 10.1002/eji.202048794.34322865 10.1002/eji.202048794
52. Li XN Pan X Qiu D Imbalances of Th17 and Treg cells and their respective cytokines in COPD patients by disease stage Int J Clin Exp Med 2014 7 12 5324 9 25664038
Li XN, Pan X, Qiu D. Imbalances of Th17 and Treg cells and their respective cytokines in COPD patients by disease stage. Int J Clin Exp Med. 2014;7(12):5324–9. PMCID: PMC4307485.25664038
53. Singh D Agusti A Anzueto A Barnes PJ Bourbeau J Celli BR Global strategy for the diagnosis, management, and Prevention of Chronic Obstructive Lung Disease: the GOLD science committee report 2019 Eur Respir J 2019 53 5 1900164 10.1183/13993003.00164-2019 30846476
Singh D, Agusti A, Anzueto A, Barnes PJ, Bourbeau J, Celli BR, et al. Global strategy for the diagnosis, management, and Prevention of Chronic Obstructive Lung Disease: the GOLD science committee report 2019. Eur Respir J. 2019;53(5):1900164. 10.1183/13993003.00164-2019.30846476 10.1183/13993003.00164-2019
54. Lourenço JD Teodoro WR Barbeiro DF Velosa APP Silva LEF Kohler JB Th17/Treg-Related Intracellular Signaling in patients with Chronic Obstructive Pulmonary Disease: comparison between local and systemic responses Cells 2021 10 7 1569 10.3390/cells10071569 34206428
Lourenço JD, Teodoro WR, Barbeiro DF, Velosa APP, Silva LEF, Kohler JB, et al. Th17/Treg-Related Intracellular Signaling in patients with Chronic Obstructive Pulmonary Disease: comparison between local and systemic responses. Cells. 2021;10(7):1569. 10.3390/cells10071569.34206428 10.3390/cells10071569
55. Zhang Y Guo J Jia R Treg A promising immunotherapeutic target in oral diseases Front Immunol 2021 12 667862 10.3389/fimmu.2021.667862 34177907
Zhang Y, Guo J, Jia R, Treg. A promising immunotherapeutic target in oral diseases. Front Immunol. 2021;12:667862. 10.3389/fimmu.2021.667862.34177907 10.3389/fimmu.2021.667862
56. Barbi J Pardoll D Pan F Treg functional stability and its responsiveness to the microenvironment Immunol Rev 2014 259 1 115 39 10.1111/imr.12172 24712463
Barbi J, Pardoll D, Pan F. Treg functional stability and its responsiveness to the microenvironment. Immunol Rev. 2014;259(1):115–39. 10.1111/imr.12172.24712463 10.1111/imr.12172
57. Dong Y Yang C Pan F Post-translational regulations of Foxp3 in Treg Cells and their therapeutic applications Front Immunol 2021 12 626172 10.3389/fimmu.2021.626172 33912156
Dong Y, Yang C, Pan F. Post-translational regulations of Foxp3 in Treg Cells and their therapeutic applications. Front Immunol. 2021;12:626172. 10.3389/fimmu.2021.626172.33912156 10.3389/fimmu.2021.626172
58. Ono M Control of regulatory T-cell differentiation and function by T-cell receptor signalling and Foxp3 transcription factor complexes Immunology 2020 160 1 24 37 10.1111/imm.13178 32022254
Ono M. Control of regulatory T-cell differentiation and function by T-cell receptor signalling and Foxp3 transcription factor complexes. Immunology. 2020;160(1):24–37. 10.1111/imm.13178.32022254 10.1111/imm.13178
59. Galgani M De Rosa V La Cava A Matarese G Role of metabolism in the Immunobiology of Regulatory T Cells J Immunol 2016 197 7 2567 75 10.4049/jimmunol.1600242 27638939
Galgani M, De Rosa V, La Cava A, Matarese G. Role of metabolism in the Immunobiology of Regulatory T Cells. J Immunol. 2016;197(7):2567–75. 10.4049/jimmunol.1600242.27638939 10.4049/jimmunol.1600242
60. Ogawa C Tone Y Tsuda M Peter C Waldmann H Tone M TGF-β-mediated Foxp3 gene expression is cooperatively regulated by Stat5, Creb, and AP-1 through CNS2 J Immunol 2014 192 1 475 83 10.4049/jimmunol.1301892 24298014
Ogawa C, Tone Y, Tsuda M, Peter C, Waldmann H, Tone M. TGF-β-mediated Foxp3 gene expression is cooperatively regulated by Stat5, Creb, and AP-1 through CNS2. J Immunol. 2014;192(1):475–83. 10.4049/jimmunol.1301892.24298014 10.4049/jimmunol.1301892
61. Aschner Y Downey GP Transforming growth Factor-β: Master Regulator of the respiratory system in Health and Disease Am J Respir Cell Mol Biol 2016 54 5 647 55 10.1165/rcmb.2015-0391TR 26796672
Aschner Y, Downey GP. Transforming growth Factor-β: Master Regulator of the respiratory system in Health and Disease. Am J Respir Cell Mol Biol. 2016;54(5):647–55. 10.1165/rcmb.2015-0391TR.26796672 10.1165/rcmb.2015-0391TR
62. Del Valle DM Kim-Schulze S Huang HH Beckmann ND Nirenberg S Wang B An inflammatory cytokine signature predicts COVID-19 severity and survival Nat Med 2020 26 10 1636 43 10.1038/s41591-020-1051-9 32839624
Del Valle DM, Kim-Schulze S, Huang HH, Beckmann ND, Nirenberg S, Wang B, et al. An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat Med. 2020;26(10):1636–43. 10.1038/s41591-020-1051-9.32839624 10.1038/s41591-020-1051-9
63. Suez J Zmora N Segal E Elinav E The pros, cons, and many unknowns of probiotics Nat Med 2019 25 5 716 29 10.1038/s41591-019-0439-x 31061539
Suez J, Zmora N, Segal E, Elinav E. The pros, cons, and many unknowns of probiotics. Nat Med. 2019;25(5):716–29. 10.1038/s41591-019-0439-x.31061539 10.1038/s41591-019-0439-x
