
==== Front
J Adv Res
J Adv Res
Journal of Advanced Research
2090-1232
2090-1224
Elsevier

S2090-1232(23)00320-X
10.1016/j.jare.2023.10.016
Medicine
Depleting LCAT Aggravates Atherosclerosis in LDLR-deficient Hamster with Reduced LDL-Cholesterol Level
Lin Xiao ab1
Zhang Wei c1
Yang Chun d
Ma Ping a
He Kunxiang a
Chen Gonglie a
Tao Yijun a
Yan Haizhao e
Yang Zhao f
Zhang Ling a
Fan Jianglin e
Cui Qinghua b
Huang Wei a
Liu George a
Xian Xunde xianxunde@bjmu.edu.cn
ag⁎
Wang Yuhui wangyuhui2009@bjmu.edu.cn
a⁎
a Institute of Cardiovascular Sciences, School of Basic Medical Sciences, Health Science Center, State Key Laboratory of Vascular Homeostasis and Remodeling, Peking University, China
b Department of Biomedical Informatics, Center for Noncoding RNA Medicine, State Key Laboratory of Vascular Homeostasis and Remodeling, School of Basic Medical Sciences, Peking University, 38 Xueyuan Rd, Beijing 100191, China
c Peking University Hepatology Institute, Peking University People’s Hospital, Beijing, China
d Department of General Practice, Beijing Friendship Hospital, Capital Medical University, Beijing, China
e Department of Molecular Pathology, Graduate School of Medicine, University of Yamanashi, Chuo, Japan
f Faculty of Art and Science, University of Toronto, Toronto, Canada
g Beijing Key Laboratory of Cardiovascular Receptors Research, Peking University Third Hospital, Beijing, China
⁎ Corresponding authors at: No.38, Xueyuan Road, Haidian District, Beijing 100191, China. xianxunde@bjmu.edu.cnwangyuhui2009@bjmu.edu.cn
1 These authors contributed equally to this work.

02 11 2023
9 2024
02 11 2023
63 187194
13 8 2023
18 10 2023
31 10 2023
© 2024 The Authors. Published by Elsevier B.V. on behalf of Cairo University.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Graphical abstract

Highlights

• A hamster model lacking both LCAT and LDL receptor (DKO) was successfully constructed in the present study.

• A significant reduction in plasma LDL-C and HDL-C levels with increased triglyceride and free cholesterol levels was observed in DKO hamsters on a regular chow diet.

• Dyslipidemia contributed to HFD-induced atherosclerosis and fatty liver independent on LDL levels in DKO hamsters.

• Lipid metabolism was impaired in primary peritoneal macrophages from DKO hamsters.

Introduction

Lecithin cholesterol acyltransferase (LCAT) plays a crucial role in acyl-esterifying cholesterol in plasma, which is essential for reverse cholesterol transport (RCT). Previous studies indicated that its activity on both α and β lipoproteins interpret its effects on lipoproteins for many controversial investigations of atherosclerosis.

Objectives

To better understand the relationship between LCAT, diet-induced dyslipidemia and atherosclerosis, we developed a double knockout (LCAT−/−&LDLR−/−, DKO) hamster model to evaluate the specific role of LCAT independent of LDL clearance effects.

Methods

Plasma triglyceride (TG), total cholesterol (TC), high-density lipoprotein-cholesterol (HDL-C), and free cholesterol (FC) levels were measured using biochemical reagent kits. FPLC was performed to analyze the components of lipoproteins. Apolipoprotein content was assessed using western blotting (WB). The hamsters were fed a high cholesterol/high fat diet (HCHFD) to induce atherosclerosis. Oil Red O staining was employed to detect plaque formation. Peritoneal macrophages were studied to investigate the effects of LCAT on cholesterol uptake and efflux.

Results

On HCHFD, DKO hamsters exhibited significantly elevated levels of TG and FC, while HDL-C was nearly undetectable without affecting TC levels, as compared to low-density lipoprotein receptor (LDLR)-deficient (LDLR−/−, LKO) hamsters. Lipoprotein profiling revealed a marked increase in plasma chylomicron/very low-density lipoprotein (CM/VLDL) fractions, along with an unexpected reduction in LDL fraction in DKO hamsters. Furthermore, DKO hamsters displayed aggravated atherosclerotic lesions in the aorta, aortic root, and coronary artery relative to LKO hamsters, attributed to a pro-atherogenic lipoprotein profile and impaired cholesterol efflux in macrophages.

Conclusions

Our study demonstrates the beneficial role of LCAT in inhibiting atherosclerotic development and highlights the distinctive lipid metabolism characteristics in hamsters with familial hypercholesterolemia.

Keywords

LCAT
LDL
Triglyceride
Atherosclerosis
Coronary disease
Abbreviations

ABCA1 ATP-binding cassette transporter A1

ABCG1 ATP-binding cassette transporter G1

ApoA1 Apolipoprotein A1

ApoB Apolipoprotein B

ASCVD Atherosclerotic cardiovascular disease

ApoE Apolipoprotein E

CM chylomicron

FED fish eye disease

FLD familial LCAT deficiency

HCHF high cholesterol high fat

HDL high density lipoprotein

LCAT lecithin cholesterol acyl transferase

LDL low density lipoprotein

LDLR low density lipoprotein receptor

LPL lipoprotein lipase

RCT reverse cholesterol transport

α-SMA Alpha-smooth muscle actin

SRB1 scavenger receptor B1

TRLs triglyceride-rich lipoproteins

VLDL very low-density cholesterol
==== Body
pmcIntroduction

In the past decades, low-density lipoprotein-cholesterol (LDL-C) has been recognized to be an independent risk factor positively related to the occurrence and severity of atherosclerosis. Reverse cholesterol transport (RCT) plays an important role in maintaining plasma LDL-C homeostasis [1], [2], in which HDL is one of the major participants to inhibit the development of atherosclerosis [3]. In the population, loss-of-function mutations in Lcat gene encoding lecithin–cholesterol acyltransferase (LCAT) cause two types of disease: fish eye disease (FED) and familial LCAT deficiency (FLD), in which an extremely low HDL-C level with elevated triglyceride level is observed [4] and may promote the development of atherosclerosis. But the results of the current study on LCAT-deficient population showed that the plasma LDL-C and high-density lipoprotein-cholesterol (HDL-C) levels were concurrently decreased in patients with FLD, resulting in no impact on the susceptibility to atherosclerosis. In FED patients, the level of LDL-C remained unchanged due to the presence of β activity, but the level of HDL-C decreased significantly, resulting in a significantly higher ratio of LDL-C/HDL-C than normal people and enhanced susceptibility to atherosclerosis [5].

However, the conclusions on the relationship between LCAT and atherosclerosis based on the independent studies using different experimental species are still not clear. Brousseau and their colleagues found that overexpression of human LCAT (hLCAT) in wild-type (WT) and heterozygous LDLR-deficient (LDLR+/−) rabbits could significantly increase HDL-C level and reduce LDL-C level in plasma, but did not decrease LDL-C level in homozygous LDLR-deficient (LDLR−/−) rabbits. Surprisingly, hLCAT overexpression only protected against atherosclerosis in WT and LDLR+/− rabbits after high cholesterol feeding, but not in LDLR−/− rabbits [6]. When Amar et al. used adenovirus to overexpress hLCAT on squirrel monkeys, they found that HDL-C concentration was markedly increased and ApoB-containing lipoproteins were significantly reduced in plasma, while unfortunately, the effect of elevated hLCAT level on atherosclerosis had not been studied on this non-human primate model yet [7]. In addition, the contradictory observations of LCAT and atherogenesis have also been reported on mouse models as our previous description, which depended on the composition of the plasma lipoproteins [8], [9]. However, our recent data using LCAT knockout golden hamster, a small rodent animal model with the metabolic traits similar to FLD patients, consistently indicated the protective effects of LCAT on spontaneous or diet-induced atherosclerosis [8], [9].

Since LDL-C is one of the key determinants of atherosclerotic cardiovascular disease (ASCVD), it is important to study whether the function of LCAT in lipid metabolism and ASCVD is LDL-dependent. Previous investigations only focused on the effect of LCAT on HDL metabolism [10], [11], but there was little mention of the impact of LCAT on LDL. Interestingly, no change in LDL-C was observed also in the previous LCAT-deficient (LCAT−/−) hamster model in the presence of endogenous LDLR. Taken together, these models are difficult to be used to discuss the influence of β -LCAT activity on the relationship between LDL-C and atherogenesis.

Noting that LDLR-deficient (LDLR−/−) hamster can replicate familial hypercholesterolemia (FH) with elevated circulating LDL-C, suggesting that it would be an ideal to study LDL-C metabolism, we herein generated LCAT−/− hamster in LDLR−/− hamster model. In the present study, we will try to answer the unsolved question on whether high plasma LDL-C level is required for atherosclerotic development in the vascular walls in the absence of LCAT, further confirming the role of LCAT in atherosclerosis.

Methods

Animals

Syrian golden hamsters were originally purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). LDLR−/− hamsters and LCAT−/− hamsters were generated by CRISPR/Cas9 genetic editing system in our lab and bred at the facility of Hebei Ex&Invivo Biotechnology Co. (Hebei, China) as described previously [8], [9]. In this study, LDLR−/− hamsters and LCAT−/− hamsters were crossed to obtain LDLR−/−&LCAT+/+(LKO) and LDLR−/−&LCAT−/−(DKO) hamsters. Fifteen eight-week-old hamsters of LKO or DKO with a weight of 110–130 g were selected for the experiment, respectively. All animals were fed with normal chow diet (Feed for mouse, 20% protein and 4% fat; purchased from Beijing KEAO XIELI Feed Co., LTD. Beijing, China) or high cholesterol high fat (HCHF) diet (0.5% cholesterol, 15% lard (w/w) based on powdered chow diet processed by BiotechHD Co. LTD. Beijing, China) and water ad libitum. All animals were kept in a temperature-controlled environment with a 12/12 h light/dark cycle. All animal procedures were handled according to the guidelines of the laboratory animal care (NIH publication no.85Y23, revised 1996) and approved by the Animal Care and Use Committee of the Peking University Health Science Center (LA2015-012).

Plasma lipids and lipoprotein analysis

Blood samples were collected with a heparinized capillary tube after an overnight fast, and anticoagulated blood was centrifuged (4000 rpm, 4℃, 10 min) to separate the plasma. Total cholesterol and triglyceride contents were measured using commercially available assay kits from Biosino Biotechnology and Science, Inc. (Beijing, China). Phospholipid content and free cholesterol content were measured using commercial kit (Sigma, MAK122 and Applygen, E1006). Fractions of plasma lipoproteins were separated and collected using an ÄKTA fast protein liquid chromatography (FPLC) system (Amersham Biosciences). Briefly, pooled plasma from 10 aliquots of each group was followed by the process as described before [12], and 100 μL were eluted with the buffer in column (superpose 6 HR10/30, GE) at a constant flow rate of 1 mL/min. 500 μL per fraction was collected for triglyceride and cholesterol concentrations measurement.

LPL activity analysis

Briefly, post-heparin plasma was collected 30 min after intraperitoneal injection of heparin (200U/kg BW). LPL activity was detected according to the instruction of the commercial kit (Solarbio, BC2440).

Tissue lipid analysis

Lipids extraction was referred to modified method of Bligh and Dyer [13]. Briefly, 100 mg tissues were homogenized in 1 mL cold PBS. Then the lipids were extracted in 5 mL glass tubes to avoid polymer contamination by vortex with the same volume of chloroform/methanol (v:v = 2:1) for 90 s and then centrifuged at 2000 rpm for 20 min. The chloroform layer at the lower phase was transferred using glass syringe and the rest was repeated the above operations. The collected chloroform layer was dried under nitrogen. Lipids dissolved with 3% TritonX-100 for measurement of the cholesterol and triglyceride contents with the kits described above.

Peritoneal macrophage acquisition and treatment

LKO or DKO hamsters were given 2 mL of sterilized 4% thioglycollate solution intraperitoneally, and peritoneal macrophages were extracted 48–72 h later. Peritoneal fluid was collected in precooled PBS solution and centrifuged at 1000 rpm for 5 min. The cells were cultured in DMEM medium supplemented with 10% FBS. After 4–6 h of incubation, nonadherent cells were washed away with PBS. Adhered macrophages were cultured at 37 °C, 5% CO2 for future experiments.

The peritoneal macrophages were treated with oxidized LDL (ox-LDL, IO1300, Solarbio) or VLDL (separated from LKO or DKO hamsters) for lipid uptake analysis and the determination of relative gene expression. Peritoneal macrophages from LKO and DKO hamsters were collected after intraperitoneal injection of 4% thioglycollate solution and cultured in DMEM (12100, Solarbio) containing 10% FBS. After overnight starvation, the cells were treated with or without 100 μg/mL oxLDL (protein quantification) or 100 μg/mL VLDL (triglyceride quantification) for 24 h, then followed by Oil Red O staining or quantitative real-time PCR analysis.

Western blot analysis

1 μL plasma or 15 μL of fractionated FPLC samples were prepared with the loading buffer containing sodium dodecyl sulfate (SDS) and dithiothreitol (DTT) by heating at 95 °C for 10 min. The samples were loaded for electrophoresis in 10% or 6% SDS-PAGE gels at 110 V and then transferred into nitrocellulose membrane for 90 min at 220 mA. Following blocking with 5% BSA, the membrane was hybridized with the following antibodies respectively: ApoB, ApoE, or ApoAI (ab20737, ab20874, ab20453, rabbit polyclonal IgG, Abcam). The target bands were visualized by incubation with horseradish peroxidase conjugated secondary antibodies followed by enhanced chemiluminescence detection (Molecular Imager Gel Doc XR System, Bio-Rad, Hercules, CA, USA).

Pathological analysis

Briefly, the heart, liver and aorta were collected and fixed in 4% paraformaldehyde. For Oil Red O (Sigma-Aldrich, St. Louis, MO, USA) staining, the heart and liver were embedded in OCT for frozen and sectioned at 7 μm in −20 °C by a freezing microtome (Leica), and the full length of the aorta was laid on the wax plate. The quantitative atherosclerotic lesions were analyzed by the percentage of en face lesions area and the total area of aortic root lesions by Image J software. For H&E, Sirius Red and immunohistochemical staining, the tissues were embedded in paraffin and sectioned at 3 μm with a Leica microtome, and then following a standard protocol referring to our pathological platform. Immunohistochemical staining was performed with CD68, CD106, and α-SMA antibodies (BA3638, BA3840 and BM0002, rabbit or mouse polyclonal IgG, Boster).

Quantitative real-time PCR assay

Total RNA was extracted by Trizol reagent (12183555, Invitrogen) and 50 μg RNA was used for reverse transcription by a commercial kit (Invitrogen, 18091200). Real-time PCR was performed with Top Green PCR Master Mix (AQ131-01, TransGen Biotech) and the primers listed in Table 1 by AriaMx Real-Time PCR System.Table 1 The primers used in real-time PCR.

Gene	Forward	Reverse	
ABCG1	GCCATGAATGCCAGCAGC	GCAGGTCTGTCTCAACGTCA	
ABCA1	CGGCAAAAACCCAGCAATTC	CGGCAAAAACCCAGCAATTC	
CD36	TGTGTCTCCTTCAACGGTCA	CCAGTTGCTCCACTCGTTTC	
GAPDH	GACTCATGACCACAGTCCATGC	AGAGGCAGGGATGATGTTCTG	
SRB1	TGCCCGTCATCTACCAGTTG	TTTGGGACCCTACAGCTTGG	

Quantification and statistical analysis

All data were expressed as the mean ± SEM, and analyzed by Student's t-test. Pearson's correlation was used to analyze two independent variables. GraphPad Prism 7.0 software (GraphPad Software, La Jolla, CA, USA) was used for all statistical analyses. P < 0.05 were considered as significant differences.

Results

Deletion of LCAT caused the changes of plasma lipid composition in hamsters with familial hypercholesterolemia

In order to investigate how LCAT deletion affects plasma lipids in LDL knockout background, we analyzed the lipids components in the plasma of 8-week-old chow diet-fed animals at first. We found significant chylous plasma in DKO hamsters, with an average TG level of about 3000 mg/dL, 3 times higher than in LKO hamsters (Fig. 1A), and similar phenotypes were also found in female hamsters (Supplementary Figure 1A). DKO hamsters had higher FC levels by 2 folds (Fig. 1B), but their HDL-C levels were reduced by more than 90% (Fig. 1D). There was no difference in TC (Fig. 1C, Supplementary Figure 1B) and non-HDL-C levels (Fig. 1E) between the two groups. In addition, we found that the LPL activity was decreased in DKO hamsters compared with LKO hamsters (Supplementary Figure 2A), but the mRNA expression of HL, Angptl3/4/8 and Apoc3 did not change (Supplementary Figure 2B).Fig. 1 Analysis of plasma lipids of the LKO and DKO hamsters on chow diet. The lipids levels of the male hamsters (n = 15) were measured by plasma as described in Methods. A: triglyceride (TG), B: free cholesterol (FC), C: total cholesterol (TC), D: high density lipoprotein cholesterol (HDL-C) and E: non-HDL-C. Apolipoprotein B (ApoB), Apolipoprotein A1 (ApoA1) and Apolipoprotein E (ApoE) in plasma were evaluated by western blot (F) and their relative quantification were calculated by Image J software (G) (n = 4). Analysis of plasma lipoproteins profile (FPLC) and apolipoproteins (immunoblotting test) in the two kinds of male genetic modified hamsters on chow diet. FPLC analysis of chylomicron/very low-density lipoprotein (CM/VLDL), low-density lipoprotein (LDL) and high-density lipoprotein (HDL) in pooled plasma from male hamsters (n = 10) by determination of triglyceride (H) and total cholesterol (I) in these particles. Evaluation of apolipoproteins in different fractions collected from FPLC by western blot (J). Data are shown as means ± SEM. *: p < 0.05, ***: p < 0.001, vs LKO.

Apolipoprotein analysis in plasma showed lower ApoB levels and higher ApoE levels in DKO hamsters compared with LKO hamsters (Fig. 1F-G, Supplementary Figure 3). In addition, it should be noted that APOA-I was massive reduced in DKO hamsters. Interestingly, compared with LKO hamsters, TG, phospholipid and FC content in CM/VLDL components was significantly increased in DKO hamsters (Fig. 1H, Supplementary Figure 4A-B), while TC content in LDL components was significantly decreased in DKO hamsters (Fig. 1I). Consistent with the previous study [8], LCAT deficiency almost eliminates HDL components in LDLR knockout background (Fig. 1J). We also found that size-fractionated ApoB100 was significantly decreased in LDL fraction, while the content of ApoE in large and HDL-sized particles was significantly increased in DKO hamsters compared to LKO hamsters (Fig. 1K).

LCAT deficiency accelerated atherosclerosis and lipid deposition in the liver on HCHF diets in LDLR-deficient hamsters

After HCHF diet, triglyceride and cholesterol levels were significantly increased in LKO and DKO hamsters at 6 and 12 weeks. The triglyceride levels of male DKO hamsters were significantly higher than that of LKO animals, reaching 15,000 mg/dL at 6 weeks and 18,000 mg/dL at 12 weeks, but cholesterol levels were not different from LKO animals (Fig. 2A-B). Female DKO hamsters also had significantly higher triglyceride levels than LKO hamsters after 6 weeks HCHF diet, but the cholesterol levels in female DKO hamsters were significantly lower than in LKO hamsters (Supplementary Figure 1A-B). Furthermore, FC levels were significantly increased in both LKO and DKO hamsters after HCHF diet for 6 weeks, but the latter had a relatively higher level of FC (Supplementary Figure 5).Fig. 2 The analysis of atherosclerotic lesion, lipid deposition and fibrosis in the livers in HCHF diet-fed LKO and DKO hamsters. Plasma triglyceride (A) and total cholesterol (B) levels were determined described as Methods after HCHF diets feeding. Representative images of en face (C) and sinus (E) lesions in aorta were stained by Oil Red O. White arrows indicate Oil Red O positive areas and all scale bars are 500 μm. Quantification of lesion areas in full length (D) and roots (F) of aorta of LKO and DKO hamsters respectively. G: Representative images of three levels of coronary artery stained with Oil Red O after 6 weeks and 12 weeks’ HCHF diets feeding. Scale bars: 200 μm. Black arrows indicate atherosclerotic lesions. H: Semi-quantitative measurements of occlusion of the coronary arteries in LKO (n = 16) and DKO (n = 14) hamsters. I: Representative immunohistochemical staining of aortic arch sections with CD68 (left), CD106 (middle) and α-SMA (right) after HCHF diets for 6 weeks in LKO and DKO hamsters (n = 8 or 7 respectively). Black arrows indicate positive areas. Scale bars: 100 μm. J-L: Relative quantification of positive staining in aortic arch plaques of LKO and DKO hamsters. Ratios of liver mass to body mass (M)of LKO(n = 8) and DKO(n = 7) hamsters after 6 weeks and 12 weeks’ HCHF diets feeding. Hepatic triglyceride (N) and cholesterol (O) contents were measured and normalized to liver weights in LKO and DKO hamsters after 6 weeks and 12 weeks’ HCHF diets feeding (n = 6–9). P: Representative images of H&E (upper), Oil Red O (middle) and Sirius Red staining (lower) of liver cross-sections from LKO and DKO hamsters, and scale bars are 100 μm. The black arrows indicate the site of accumulation of lipids (HE and Oil Red O staining images) or areas of liver fibrosis (Sirius Red staining images), the red dotted boxs indicate the site of lipid deposition in hepatocytes, and the yellow arrows indicate areas of inflammatory cell infiltration. Data are shown as means ± SEM. *: p < 0.05, **: p < 0.01, ***: p < 0.001, vs LKO. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Pathological analysis showed that both LKO and DKO hamsters were induced to a certain degree of atherosclerosis after 6 and 12 weeks on HCHF diet. Aortic en face analysis showed that the plaques of LKO hamsters mainly occurred in the aortic arch and renal artery, while the plaques of DKO hamsters exhibited plaques observed in the aortic arch, renal artery, iliac artery (Fig. 2C, left). Quantitative results of aortic plaque showed that the lesion areas of the whole aorta (Fig. 2D, left) and the aortic root (Fig. 2E-F, left) were significantly increased in DKO hamsters, but there was no significant difference in aortic plaques of the whole aorta (Supplementary Figure 1C-D) and the aortic root (Supplementary Figure 1E-F) between female DKO and LKO hamsters after 6-week HCHF diet feeding. Moreover, plaques in LKO and DKO hamsters were mainly developed in the aortic arch, renal artery, iliac artery, which also could be detected in the abdominal aorta at 12 weeks (Fig. 2C, right); however, there was no significant difference in the plaque areas of the whole aorta (Fig. 2D, right), but only more plaques were observed in the aortic roots DKO hamsters compared to the control group (Fig. 2E-F, right).

In the previous studies [9], HCHFD has been reported to induce coronary artery disease in LDLR−/− hamsters. In this study, we analyzed the pathological sections of the cardiac outflow tract, and the results showed that the incidence of coronary artery lesions in DKO hamsters was significantly higher than that in LKO hamsters, and the degree of coronary artery occlusion in the DKO group was more serious than that in the LKO group. The proportion of coronary occlusion area greater than 5% and<50% was 20% in DKO hamsters, and 6% in LKO hamsters. The proportion of coronary occlusion areas over 50% was 13% in DKO hamsters, but none of that in LKO hamsters (Fig. 2G, H).

In addition, we analyzed the atherosclerotic lesions in the aortic arch with the sections by immunohistochemistry. Morphological results showed that the plaques of DKO hamsters had unstable characteristics with more severe protruding plaques, but LKO hamsters had the plaques indicating an early stage of atherosclerosis (Fig. 2I). The number of macrophages in the aortic arch plaques of DKO hamsters was significantly higher than that in LKO hamsters (Fig. 2J). However, the expression of endothelial inflammation factor (CD106) and smooth muscle cell marker (α-SMA), were not significantly different between the two groups (Fig. 2I, K, L). The results described above indicated that LCAT deficiency may affect the function of macrophages in atherosclerosis. Then, we cultured peritoneal macrophages from LKO and DKO hamsters and stimulated them with 100 μg/mL oxLDL. More lipids were accumulated in macrophages from DKO hamsters than in LKO group (Supplementary Figure 6A). Upon oxLDL stimulation for 24 h, the expression of genes regulating cholesterol uptake and cholesterol efflux was detected in macrophages. The expression levels of CD36 and scavenger receptor B1 (SRB1), two key genes participating in cholesterol uptake, were increased in DKO hamsters (Supplementary Figure 6B), while the expression levels of ATP-binding cassette transporter A1 (ABCA1) and ATP-binding cassette transporter G1 (ABCG1) responsible for cholesterol efflux were significantly decreased in macrophages from DKO hamsters (Supplementary Figure IB). We collected VLDL from LKO and DKO hamsters, and then stimulated macrophages from LKO hamsters at a dose of 100 μg/mL of triglyceride concentration. VLDL from DKO hamsters caused more lipid deposition than that from LKO hamsters (Supplementary Figure 6C). Gene expression analysis showed that the expression of CD36 was significantly increased in the VLDL-treated macrophages from DKO group (Supplementary Figure 6D), but the expression of ABCA1 was significantly decreased (Supplementary Figure 6D).

Lipid metabolism plays an important role in the relationship between fatty liver and cardiovascular disease. To investigate the effect of LCAT on lipid deposition in the liver, the liver weight and detailed pathological analysis were performed. We found that the ratio of liver weight to body weight of DKO hamsters was higher than that of LKO hamsters at 12 weeks (Fig. 2M), P < 0.05. The results of liver lipid extraction showed that the triglyceride content in the livers of DKO hamsters was higher than that of LKO after HCHF diet (Fig. 2N), and the cholesterol content in the livers of DKO hamsters was also higher at week 12 after HCHF diet feeding (Fig. 2O). The results of hematoxylin and eosin staining in paraffin sections and oil red O staining in frozen sections were consistent with lipid extraction (Fig. 2P), showing more lipids accumulated in the livers of DKO hamsters than that in LKO animals. Sirius red staining showed that liver fibrosis in DKO hamsters was significantly more severe than that in LKO hamsters after HCHF diet (Fig. 2P), suggesting that LCAT deficiency aggravated liver damage induced by HCHF diet. In addition, we observed a significant reduction in the weight of white adipose tissue from different locations in DKO hamsters compared to LKO hamsters (Supplementary Figure 7A-B), and the RT-PCR analysis showed that the expression level of MGLL (Monoacylglycerol lipase) related to lipolysis was significant upregulated in DKO hamsters (Supplementary Figure 7C), suggesting that lipolysis in white adipose tissue of DKO hamsters might be enhanced, thus then leading to a release of free fatty acids from adipose tissues.

Discussion

Since the relationship between LCAT and atherogenesis remains illusive in the absence of LDLR in mice from independent studies and whether the influence of LCAT on atherogenesis dependent of LDLR needs to be validated, it is rational for us to breed LCAT-deficient hamsters onto the atherosclerosis-prone LDLR-deficient hamsters to further comprehensively understand the role of LCAT in lipid metabolism and atherosclerotic development. In the present study, we showed that LCAT deletion in LDLR-deficient background not only caused an increase in TG and ApoE levels accompanied with a complete loss of HDL-C, but also resulted in an unexpected reduction in plasma LDL-C and ApoB levels. In further morphological analysis, DKO hamsters displayed diet-accelerated atherosclerotic lesions in whole aorta, aortic root and coronary artery, which has not been reported before.

In agreement with the findings reported in LCAT-deficient hamsters, the data of lipoprotein profile analyzed by FPLC showed the absence of HDL-C in DKO hamsters on regular chow diet whose triglyceride-rich lipoproteins, such as CM/VLDL, were increased markedly, whereas LDL-C level was unexpectedly decreased relative to LDLR−/− hamsters. We speculate that the reduction in LDL level found in DKO is probably attributed to the impaired conversion of VLDL to LDL. As demonstrated in previous study [14], increased free cholesterols were incorporated into lipoproteins to inhibit LPL-mediated hydrolysis process of large triglyceride-rich lipoprotein particles, thus blocking the conversion of triglyceride-contained VLDL to cholesteryl ester-rich LDL. In our study, the LPL activity was decreased and increased FC was primarily concentrated in CM/VLDL fractions in DKO hamsters compared with LKO hamsters (Supplementary Figure 4B), which further supported the possibility that the conversion of VLDL to LDL was impaired by FC in the absence of LCAT. Without LCAT activity, extremely low HDL levels together with reduced CETP activity impaired the exchange of triglyceride and cholesteryl ester [15]. Of note, the difference of plasma LDL levels were only found between DKO hamsters and LKO hamsters, which levels were identical between WT and LCAT-deficient hamsters. This discrepancy could be explained by the phenotype of hypercholesterolemia with a very high LDL level caused by the impairment of LDLR-mediated LDL clearance due to LDLR deficiency in hamsters, in which free cholesterol could not be efficiently esterified by LCAT and then were cleared quickly by kidney [16], eventually leading to reduced LDL level in DKO hamster compared to LKO controls.

The protective role of LCAT in atherosclerosis, at least in part, was influenced by ApoB levels modulated by different diets mouse models. Lambert et al found knocking out LCAT decreased ApoB-containing lipoproteins in plasma, thus reducing the atherosclerosis in LDLR−/− and ApoE−/− mice fed an HF/HC diet [17]. Later, Furbee et al found that lack of LCAT did not change ApoB100 and 48 level in plasma in LDLR−/− mice, but mildly increased circulating ApoB100 in ApoE−/− mice, which both contributed to the larger atherosclerotic lesions developed in double knockout mice [18]. Our analysis of apolipoproteins in plasma or lipoprotein fractions showed that ApoB concentration was significantly decreased in plasma and LDL fractions of DKO hamsters, while ApoE levels was markedly increased in triglyceride-rich lipoproteins (TRLs) but decreased in LDL fractions of DKO hamsters.

Although increased LDL-C level in circulation has been recognized as an independent risk factor of ASCVD, emerging data demonstrate that remnant lipoproteins containing cholesterol and ApoE, such as VLDL remnants, possess more atherogenic property than LDL particles [19]. In our present study, more atherosclerotic lesions were observed in DKO hamsters with increased CM/VLDL remnants containing ApoE, accompanied by a reduction in levels of cholesterol and ApoB carried on LDL particles, further supporting the concept that elevated concentration of plasma lipoprotein remnants is positively associated the incidence of ASCVD.

Moreover, it is surprising that except of more ApoE accumulated in CM/VLDL fractions, DKO hamsters also exhibited increased ApoE contents in HDL fractions, indicating that these ApoE particles found in circulation could be termed HDL-LpE, which lack ApoA-I because a clinical study led by Krimbou et al reported that using 2D gels, circulating ApoE could be detected at the position of HDL from LCAT-deficient patients without HDL and ApoA1, which was in agreement with our finding [20]. To our knowledge, only ApoE genotype, but not circulating ApoE concentration, is associated with the risk of CVD in two population-based studies [21], however, these studies only focused on total ApoE in plasma, but not ApoE distribution, suggesting that differential functions of different source-derived ApoE still remain unknown. Since this novel finding has not been discovered in other species, including mouse and rabbit, it will be tempting to investigate whether plasma HDL-LpE could be another contributor to atherosclerosis in our special DKO hamsters in the future study.

Macrophage-mediated lipid deposition in the vascular wall is one of the early events of atherosclerotic development. In DKO hamsters, although LCAT deficiency yielded a CM/VLDL predominant lipoprotein profile, we speculated that LDL metabolism was still affected by LCAT in the absence of LDLR to impair macrophage function. When cultured peritoneal macrophages from LKO and DKO hamsters were treated with ox-LDL, more lipids were accumulated in macrophages with LCAT and LDLR deficiency compared to control group, suggesting that LDL metabolism was also impaired due to LCAT deficiency in the absence of LDLR. Previously, Elkhalil et al [22] tested the ability of plasma from LCAT-deficient patients to show cholesterol efflux capacity reduced by 40%. Furthermore, Calabresi et al reported that the plasma of homozygous LCAT-deficient patients had a lower ability to promote cholesterol efflux mediated by ABCG1 and SRB1 in the presence of a low concentration of mature α-HDL, but the plasma of homozygous LCAT-deficient patients increased the ability of ABCA1-mediated cholesterol efflux by the increased content of alpha-HDL [23]. Therefore, functional LCAT is not required for the macrophage cholesterol removal and RCT, indicating that the relationship between LCAT function and cholesterol metabolism in macrophages has not been well established yet.

In addition, TRLs have been paid attention recently because increasing lines of evidence have shown that TRLs play an essential role in atherogenesis under hypertriglyceridemic condition [24], [25]. Therefore, we also compared the metabolism of TRLs derived from the plasma of LKO and DKO hamsters in the peritoneal macrophages of LKO animals. Our results demonstrated that more TRLs from DKO hamsters were observed in macrophages by upregulating the expression of CD36 and SRB1 and downregulating ABCA1 and ABCG1 expression, suggesting that LCAT deficiency impaired the lipid metabolism in macrophages, which accelerated atherosclerotic development.

Although deletion of LCAT from hamsters caused both spontaneous and diet-induced atherosclerosis in our previous studies, the influence of LCAT on the atherosclerotic lesion in coronary artery, a common feather of ASCVD in humans, has not been investigated yet. LDLR-deficient hamsters showed lesions in the coronary artery after dietary intervention. Consistently, LCAT deficiency aggravated diet-induced atherosclerotic lesions in the coronary artery in LDLR-deficient background. The mortality rate of DKO hamsters was up to 50% (Supplementary Figure 8A) and the heart of the DKO hamsters was significantly enlarged (Supplementary Figure 8B) after HCHFD for 12 weeks, it could be that a blockage of the distal coronary artery caused fibrosis of the heart and caused heart failure (Supplementary Figure 8C). In the meantime, DKO hamsters also showed significant nonalcoholic fatty liver with hepatic lipid accumulation after feeding HCHF diet, which could be a potential contributor to atherosclerosis because fatty liver caused by dyslipidemia is highly associated with the incidence of ASCVD.

In summary, we generated a hamster model lacking both LCAT and LDLR for the first time to study the effect of LCAT on ASCVD. Under chow diet condition, DKO hamsters show dyslipidemia and an atherogenic lipoprotein profile with increased CM/VLDL and reduced LDL in the setting of FH. Upon HCHFD feeding, these phenotypes are worsen, thus leading to accelerated atherosclerotic development and fatty liver, which has not been reported yet before. Our novel findings herein demonstrate a crucial role of LCAT in lipid metabolism and provide a new insight into the potential therapeutic approach for the treatment of lipid disorder and the related metabolic disease.

Compliance with Ethics Requirements

All Institutional and National Guidelines for the care and use of animals (fisheries) were followed.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary material

The following are the Supplementary data to this article:Supplementary data 1

Acknowledgments

We thank Qiang Shen (Institute of Cardiovascular Science, Health Science Center, Peking University) and Yajie Chen (School of Biotechnology and Health Sciences, Wuyi University, Jiangmen, China.) for their technical assistance in morphology. This study was financially supported by the National Key Research and Development Program of China from the Ministry of Science and Technology (2021YFF0702802, 2016YFE0126000) to YW, the National Natural Science Foundation (81770449 to YW, and 82070460, 82270479, HY2021-1 to XX) of China, Japan-China Sasakawa Medical Fellowship to YW, the Fundamental Research Funds for the Central Universities to XX, and the National Natural Science Foundation of China (82100351 to CY).

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.jare.2023.10.016.
==== Refs
References

1 Ikonen E. Mechanisms for cellular cholesterol transport: defects and human disease Physiol Rev 86 4 2006 1237 1261 17015489
2 van der Velde A.E. Reverse cholesterol transport: from classical view to new insights World J Gastroenterol 16 2010 5908 5915 21157966
3 Lewis G.F. Rader D.J. New insights into the regulation of HDL metabolism and reverse cholesterol transport Circ Res 96 12 2005 1221 1232 15976321
4 Kunnen S. Van Eck M. Lecithin:cholesterol acyltransferase: old friend or foe in atherosclerosis? J Lipid Res 53 9 2012 1783 1799 22566575
5 Ossoli A. Simonelli S. Vitali C. Franceschini G. Calabresi L. Role of LCAT in Atherosclerosis J Atheroscler Thromb 23 2 2016 119 127 26607351
6 Brousseau M.E. Kauffman R.D. Herderick E.E. Demosky S.J. Evans W. Marcovina S. LCAT modulates atherogenic plasma lipoproteins and the extent of atherosclerosis only in the presence of normal LDL receptors in transgenic rabbits Arterioscler Thromb Vasc Biol 20 2 2000 450 458 10669643
7 Amar M.J.A. Shamburek R.D. Vaisman B. Knapper C.L. Foger B. Hoyt R.F. Adenoviral expression of human lecithin-cholesterol acyltransferase in nonhuman primates leads to an antiatherogenic lipoprotein phenotype by increasing high-density lipoprotein and lowering low-density lipoprotein Metab Clin Exp 58 4 2009 568 575 19303980
8 Dong Z. Shi H. Zhao M. Zhang X. Huang W. Wang Y. Loss of LCAT activity in the golden Syrian hamster elicits pro-atherogenic dyslipidemia and enhanced atherosclerosis Metab Clin Exp 83 2018 245 255 29526535
9 Guo X. Gao M. Wang Y. Lin X. Yang L. Cong N. LDL Receptor Gene-ablated Hamsters: A Rodent Model of Familial Hypercholesterolemia With Dominant Inheritance and Diet-induced Coronary Atherosclerosis EBioMedicine 27 2018 214 224 29289533
10 Asztalos B.F. Schaefer E.J. Horvath K.V. Yamashita S. Miller M. Franceschini G. Role of LCAT in HDL remodeling: investigation of LCAT deficiency states J Lipid Res 48 3 2007 592 599 17183024
11 Ossoli A. Simonelli S. Varrenti M. Morici N. Oliva F. Stucchi M. Recombinant LCAT (Lecithin: Cholesterol Acyltransferase) Rescues Defective HDL (High-Density Lipoprotein)-Mediated Endothelial Protection in Acute Coronary Syndrome Arterioscler Thromb Vasc Biol 39 5 2019 915 924 30894011
12 Lin X. Ma P. Yang C. Wang J. He K. Chen G. Dietary-Induced Elevations of Triglyceride-Rich Lipoproteins Promote Atherosclerosis in the Low-Density Lipoprotein Receptor Knockout Syrian Golden Hamster Frontiers in cardiovascular medicine 8 2021 738060
13 Byrdwell W.C. Sato H. Schwarz A.K. Borchman D. Yappert M.C. Tang D. 31P NMR quantification and monophasic solvent purification of human and bovine lens phospholipids Lipids 37 11 2002 1087 1092 12558059
14 Schekatolina S. Lahovska V. Bekshaev A. Kontush S. Le Goff W. Kontush A. Mathematical Modelling of Material Transfer to High-Density Lipoprotein (HDL) upon Triglyceride Lipolysis by Lipoprotein Lipase: Relevance to Cardioprotective Role of HDL Metabolites 12 7 2022 623 35888747
15 Motte A. Gall J. Salem J.-E. Dasque E. Lebot M. Frisdal E. Reduced Reverse Cholesterol Transport Efficacy in Healthy Men with Undesirable Postprandial Triglyceride Response Biomolecules 10 5 2020 810 32466286
16 Dullaart R.P.F. Gansevoort R.T. Dikkeschei B.D. de Zeeuw D. de Jong P.E. van Tol A. Role of elevated lecithin: cholesterol acyltransferase and cholesteryl ester transfer protein activities in abnormal lipoproteins from proteinuric patients Kidney Int 44 1 1993 91 97 8355471
17 Lambert G. Sakai N. Vaisman B.L. Neufeld E.B. Marteyn B. Chan C.-C. Analysis of glomerulosclerosis and atherosclerosis in lecithin cholesterol acyltransferase-deficient mice J Biol Chem 276 18 2001 15090 15098 11278414
18 Furbee J.W. Sawyer J.K. Parks J.S. Lecithin:cholesterol acyltransferase deficiency increases atherosclerosis in the low density lipoprotein receptor and apolipoprotein E knockout mice J Biol Chem 277 5 2002 3511 3519 11719520
19 Johansen M.Ø. Vedel-Krogh S. Nielsen S.F. Afzal S. Davey Smith G. Nordestgaard B.G. Per-Particle Triglyceride-Rich Lipoproteins Imply Higher Myocardial Infarction Risk Than Low-Density Lipoproteins: Copenhagen General Population Study Arterioscler Thromb Vasc Biol 41 6 2021 2063 2075 33827253
20 Krimbou L. Marcil M. Chiba H. Genest J. Structural and functional properties of human plasma high density-sized lipoprotein containing only apoE particles J Lipid Res 44 5 2003 884 892 12611904
21 Sofat R. Cooper J.A. Kumari M. Casas J.P. Mitchell J.P. Acharya J. Circulating Apolipoprotein E Concentration and Cardiovascular Disease Risk: Meta-analysis of Results from Three Studies PLoS Med 13 10 2016 e1002146 27755538
22 Elkhalil L. Majd Z. Bakir R. Perez-Mendez O. Castro G. Poulain P. Fish-eye disease: structural and in vivo metabolic abnormalities of high-density lipoproteins Metab Clin Exp 46 5 1997 474 483 9160810
23 Calabresi L. Favari E. Moleri E. Adorni M.P. Pedrelli M. Costa S. Functional LCAT is not required for macrophage cholesterol efflux to human serum Atherosclerosis 204 1 2009 141 146 18922527
24 Watts G.F. Ooi E.M.M. Chan D.C. Demystifying the management of hypertriglyceridaemia Nat Rev Cardiol 10 11 2013 648 661 24060958
25 Alipour A. van Oostrom A.J.H.H.M. Izraeljan A. Verseyden C. Collins J.M. Frayn K.N. Leukocyte activation by triglyceride-rich lipoproteins Arterioscler Thromb Vasc Biol 28 4 2008 792 797 18218988
