
==== Front
J Adv Res
J Adv Res
Journal of Advanced Research
2090-1232
2090-1224
Elsevier

S2090-1232(24)00302-3
10.1016/j.jare.2024.07.018
Original Manuscript
CRISPR/Cas9-mediated neuronal deletion of 5-lipoxygenase alleviates deficits in mouse models of epilepsy
Guan Qiwen abc1
Wang Zhaojun ab1
Zhang Kai ab1
Liu Zhaoqian ab
Zhou Honghao ab
Cao Danfeng d
Mao Xiaoyuan xiaoyuanm@csu.edu.cn
ab⁎
a Department of Clinical Pharmacology and National Clinical Research Center for Geriatric Disorders, Xiangya Hospital, Central South University, Changsha 410008, China
b Institute of Clinical Pharmacology and Engineering Research Center of Applied Technology of Pharmacogenomics of Ministry of Education, Central South University, Changsha 410078, China
c Department of Clinical Pharmacy, Jiaozuo People’s Hospital, Jiaozuo 454000, China
d Academician Workstation and Hunan Provincial University Key Laboratory of the Fundamental and Clinical Research on Functional Nucleic Acid, Changsha Medical University, Changsha 410219, China
⁎ Corresponding author at: Department of Clinical Pharmacology and National Clinical Research Center for Geriatric Disorders, Xiangya Hospital, Central South University, Changsha 410008, China. xiaoyuanm@csu.edu.cn
1 These authors had equal contributions to this work.

22 7 2024
9 2024
22 7 2024
63 7390
18 3 2024
16 7 2024
18 7 2024
© 2024 The Authors. Published by Elsevier B.V. on behalf of Cairo University.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Graphical abstract

Highlights

• Alox5 deficiency in neuron alleviates seizure activity and epileptogenesis.

• Neuronal Alox5 deletion reverses neuron loss and astrogliosis.

• The development of comorbidities in the chronic phase of epilepsy was alleviated by Alox5 deletion.

• Anti-epileptic effect of neuronal Alox5 deletion may be linked with reducing glutamate.

• The identification of Alox5 as a potential therapeutic target suggests its promising role in the management of epilepsy.

Introduction

Our previous work reveals a critical role of activation of neuronal Alox5 in exacerbating brain injury post seizures. However, whether neuronal Alox5 impacts the pathological process of epilepsy remains unknown.

Objectives

To prove the feasibility of neuron-specific deletion of Alox5 via CRISPR-Cas9 in the blockade of seizure onset and epileptic progression.

Methods

Here, we employed a Clustered regularly interspaced short-palindromic repeat-associated proteins 9 system (CRISPR/Cas9) system delivered by adeno-associated virus (AAV) to specifically delete neuronal Alox5 gene in the hippocampus to explore its therapeutic potential in various epilepsy mouse models and possible mechanisms.

Results

Neuronal depletion of Alox5 was successfully achieved in the brain. AAV delivery of single guide RNA of Alox5 in hippocampus resulted in reducing seizure severity, delaying epileptic progression and improving epilepsy-associated neuropsychiatric comorbidities especially anxiety, cognitive deficit and autistic-like behaviors in pilocarpine- and kainic acid-induced temporal lobe epilepsy (TLE) models. In addition, neuronal Alox5 deletion also reversed neuron loss, neurodegeneration, astrogliosis and mossy fiber sprouting in TLE model. Moreover, a battery of tests including analysis of routine blood test, hepatic function, renal function, routine urine test and inflammatory factors demonstrated no noticeable toxic effect, suggesting that Alox5 deletion possesses the satisfactory biosafety. Mechanistically, the anti-epileptic effect of Alox5 deletion might be associated with reduction of glutamate level to restore excitatory/inhibitory balance by reducing CAMKII-mediated phosphorylation of Syn ISer603.

Conclusion

Our findings showed the translational potential of AAV-mediated delivery of CRISPR-Cas9 system including neuronal Alox5 gene for an alternative promising therapeutic approach to treat epilepsy.

Keywords

CRISPR
Cas9
Alox5
Gene therapy
Epilepsy
==== Body
pmcIntroduction

Epilepsy, the third leading contributor to the global burden of neurological disorders [1], is characterized with spontaneous recurrent seizures and associated comorbidities. Nowadays, it occurs at any age and affects approximately 65 million people globally, i.e., 1 % of world’s population [2]. Despite progress in medical treatments of epilepsy, which includes pharmacotherapy, neuromodulation, surgical resection and dietary intervention, these medications can merely provide symptomatic relief of seizures without affecting epileptogenesis, a pathological process involving the onset and progression of epilepsy [3]. It has been reported that nearly one-third of patients such as those with temporal lobe epilepsy (TLE) still suffer from repeated unprovoked or spontaneous seizures [4], after implementation of current medications. Therefore, it is of urgent need to explore a novel therapeutic strategy to delay or prevent the etiology of epilepsy [5].

There is consistent evidence supporting aggravated inflammatory response in the brain of both epilepsy patients and experimental models [6], [7], [8]. However, the role and mechanisms of how neuroinflammation is linked to the pathogenesis of these diseases remain to be clarified. 5-lipoxygenase (Alox5) is a key enzyme that produces a group of pro-inflammatory lipid mediators known as leukotrienes (LTs) using arachidonic acid as metabolic substrate [9]. Previously, our study illustrated that activation of Alox5 by ERK-dependent phosphorylation of Alox5 at serine 663 residue promoted neuronal ferroptosis after seizures [10]. Pharmacological inhibition of Alox5 by the FDA approved inhibitor zileuton significantly attenuated seizure-induced neuronal impairment via abrogating ferroptosis process [10], indicating a critical role of neuronal Alox5 in the modulation of seizure behavior. However, the severe toxic effect such as liver injury brings great clinical challenges regarding the usage of zileuton [11]. Given that neuronal Alox5 contributes to the brain injury post seizure, it is rational to speculate that neuron-specific depletion of Alox5 by gene editing has therapeutic effects on seizure activity and epileptic progression with satisfactory biosafety.

Clustered regularly interspaced short-palindromic repeat-associated proteins 9 system (CRISPR/Cas9) is a versatile genome editing tool which was initially discovered in the DNA sequences from Escherichia coli bacteria in 1987 by Ishino and coworkers [12]. Since then, the initial observations have been verified in other organisms and this technique has attracted considerable attention in the field of gene therapy due to its advantages of efficacy and precision. In general, this system comprises trans-activating tracrRNA, pre-crRNA, and Cas9 proteins [13], [14]. With the help of RNaseIII, pre-crRNA is cut into crRNA by tracrRNA. The combination of tracrRNA and crRNA facilitates formation of single guide RNA (sgRNA), which enables Cas9 protein to identify specific DNA sites. Thanks to the region- and cell type-specific genome editing, this technology has widespread application in preclinical models and has even been used to cure patients with life-threatening diseases [15], [16]. Recently, CRISPR-Cas9 strategy has been improved by integration of adeno-associated virus (AAV) vector [17], [18], [19] which was first discovered in 1960 s [20], [21] and remains the leading platform for in vivo gene therapy delivery [22], [23]. AAV-CRISPR-Cas9 method is widely reported in neurological disorders due to mild immune response, long-term transgene expression and favorable safety profiles for AAV vectors [24], [25]. For example, a single injection of AAV-CRISPR-Cas9 for targeting the huntingtin (HTT) gene led to the deletion of the mutant HTT gene in pigs and significant suppression of neurological symptoms [26]. Neuron-specific gene manipulation was also achieved in rats using AAV vectors expressing Cas9 protein [27], suggesting the feasibility of cell type-specific gene editing in the mammal brain via AAV-CRISPR-Cas9. Considering the contribution of neuronal Alox5 in neurological condition especially epilepsy as described in our previous study [10], we provide the hypothesis that neuronal loss of Alox5 may counteract epilepsy via AAV-CRISPR-Cas9 method.

In the current study, we demonstrated the translational potential of neuronal Alox5 deletion in combating seizures, delaying epileptic progression and mitigating epilepsy-associated neuropsychiatric comorbidities particularly anxiety, cognitive deficit and autistic-like behavior via AAV-mediated delivery of CRISPR-Cas9 system. The possible mechanism of action may be associated with reduction of glutamate level dependent upon Ca2+/calmodulin-dependent protein kinase II (CAMKII)-mediated phosphorylation of synapsin I at serine 603 residue (p-Syn ISer603), thereby decreasing neuronal hyperexcitability. Our results provided the compelling evidence supporting that Alox5 serves as a promising therapeutic target for seizure generation and epileptogenesis.

Materials and methods

Study design

The main research objective of our current work was to evaluate the effects of neuron-specific deletion of Alox5 in hippocampus, the vulnerable brain region to epileptic damage, on seizure susceptibility, epileptic progression and neuropsychiatric comorbidities. The overall experimental design was elaborated in each figure. Briefly, we employed behavioral, electrophysiological, histology and biochemical methods to test the hypotheses that (i) genetic ablation of Alox5 in hippocampal neurons improved epileptic phenotype and (ii) this protection was associated with reduction of glutamate level dependent upon CAMKII-mediated p-Syn ISer603.

In each experiment, mice were randomly divided to each group. Experiments and data analysis were blinded throughout the study. Totally, there were 238 mice included in the experiment. During the study, twenty mice died due to very severe seizures or surgery. Finally, the remaining 218 mice belong to different groups were enrolled in the present work. The number of mice in each experiment was marked in respective figures.

Animals

Male adult C57BL/6J mice weighing 18–22 g (6–8 weeks) were provided by the Experimental Animal Center of Central South University. All mice were maintained in individual cages under a constant temperature of 23 ± 2 °C and a day/night cycle of 12 h with a specific pathogen-free environment and free access to food and water.

Ethics statement

All the animal-handling procedures were in strict accordance with the National Institutes of Health guidelines and the Animal Care and Use Committee of Xiangya Hospital of Central South University (protocol number: 2022–0430).

Drugs

All the chemicals used in our present study were summarized in Supplementary Fig. 1. The purity of these products, if available, was also indicated.

Epilepsy models

Pilocarpine (Pilo) model: Mice were subject to intraperitoneal injection of 1  mg/kg methyl-scopolamine 30 min before treatment with 300 mg/kg Pilo (i.p.). Subsequently, Pilo injection was performed and diazepam (10  mg/kg, i.p.) was treated for termination of status epilepticus (SE) 90 min after Pilo treatment. Afterward, Racine score and video electroencephalogram (EEG) recording were conducted and associated details were shown in the following section.

Kainic acid (KA) model: For assessing effect of Alox5 deletion on SE, KA was injected intraperitoneally at the dose of 30 mg/kg. In other experiments involving KA model, KA was injected into the dorsal CA1 (coordinates: anteroposterior, −2.0  mm; mediolateral, −1.3 mm from Bregma; dorsoventral, −1.6 mm from dura) with a glass micropipette at the dose of 250 ng/μL. After each injection, the needle stayed in position for 10  min to avoid the backflow.

Racine score

Seizure severity was evaluated for 90 min using the following Racine scale [28]: stage 1, facial movements; stage 2, head nodding; stage 3, forlimb myoclonus; stage 4, rearing; stage 5, jumping and falling; stage 6, death. Mice with the third or higher seizure stage were successfully induced and used for the subsequent experiment.

EEG recording and analysis

Under anesthesia with sodium phenobarbital (50 mg/kg, i.p.), mice were mounted onto a stereotaxic apparatus (DW-2000, Chengdu Taimeng Software Co.Ltd.). Electrodes were carefully implanted into the right hippocampus (coordinates: anteroposterior, −2.0  mm; mediolateral, −1.3 mm from Bregma; dorsoventral, −1.6 mm from dura). After seven days’ recovery, mice were placed on EEG receiver platforms and the implanted electrodes were attached to an amplifier via flexible cables. In the acute stage, each mouse was subjected to 2 h EEG monitoring session for three consecutive days while 7-day-EEG signal with 2 h per day was collected in the chronic stage of epilepsy. EEG recording was converted into the data via Sirenia Seizure Pro software (Version 2.2.7, Pinnacle Technology Inc). Seizure activity was defined as regular spike clusters lasting more than 10 s, spike frequency higher than 3 Hz and amplitude at least three times exceeded the baseline as previously described [29], accompanied with behavioral convulsion.

AAV injection

AAV9 was widely applied for gene delivery as previously described [30], [31]. Alox5 sgRNA was designed by CRISPR/Cas9 target online predictor (CCTop). After elimination of sgRNAs with the predicted mismatched genes, the optimal sgRNA of Alox5 was selected for the subsequent in vivo experiment. Alox5 sgRNA (sequence: GCGCCCCGTTCGAAGTCATTG) or control (sequence: CACCGGCACTACCAGAGCTAACTCA) was inserted into the AAV9-hSyn-SaCas9-U6-sgRNA vector. AAV9-hSyn-MCS-EGFP-3Flag vector was constructed by inserting an enhanced green fluorescent protein (EGFP) gene. It was worth mentioning that SaCas9 was expressed under the control of the human synapsin (hSyn) promoter and utilization of U6 promoter was conducted for better expression of the sgRNA cassette. The titers of plasmid-integrated AAV9 vectors were shown below. AAV9-hSyn-SaCas9-U6-sgAlox5: 1.22 E+13 V.G./mL; AAV9-hSyn-SaCas9-U6-sgNC: 7.58 E+12 V.G./mL; AAV9-hSyn-MCS-EGFP-3Flag: 2.43 E+13 V.G./mL. They were all constructed by Obio Technology. Prior to AAV injection in mice, AAV9-hSyn-MCS-EGFP-3Flag and AAV9-hSyn-SaCas9-U6-sgNC were diluted into the same titer as AAV9-packaged sgAlox5 using sterile phosphate buffered saline (PBS). Thereafter, AAV9-hSyn-SaCas9-U6-sgAlox5 or AAV9-hSyn-SaCas9-U6-sgNC was mixed with AAV9-hSyn-MCS-EGFP-3Flag at the ratio of 2:1 to form AAV9-hSyn-SaCas9-U6-sgAlox5 ± AAV9-hSyn-EGFP (hereinafter referred to as Alox5-Cas9) and AAV9-hSyn-SaCas9-U6-sgNC±AAV9-hSyn-EGFP (hereinafter referred to as Ctrl-Cas9), respectively. Subsequently, a microsyringe pump (R452, RWD Life Science) with the total volume of 0.598 μL for each mouse was utilized for unilateral intrahippocampal injection (coordinates: anteroposterior, −2.0  mm; mediolateral, −1.3 mm from Bregma; dorsoventral, −1.6 mm from dura) of Alox5-Cas9 or Ctrl-Cas9 at a flow rate of 4.6 nL/6 s. After injection for more than 4 weeks, mice were sacrificed to detect protein expression and distribution of Alox5 as well as its metabolites including 5-hydroxyeicosatetronic acid (5-HETE) and Leukotriene B4 (LTB4) in hippocampus tissues via western blot, immunofluorescence and commercial kit analysis, respectively.

Behavioral tests

Open field test (OFT). Mice were placed individually in the middle of a perspex box (42 × 42 × 42  cm) and allowed to walk freely in the dark environment for 10 min [32]. The box was cleaned using 75 % ethanol after completion of experiment for each animal. The moving traces of mice were monitored with an infrared camera and the behavior analyses were conducted using a video tracking system (Smart v3.0, Panlab). The indices total distance (moving distances), center entries (the number of entries in the center area) and time spent in center area were analyzed between different groups.

Novel object recognition (NOR) test. In the adaptive step, mice were habituated for 10 min in a polyvinyl chloride chamber (45 cm × 45 cm × 45 cm) to explore two familiar objects for one day. On the second day, two same objects with both color and shape were placed in the chamber and mice back to these objects entered in the chamber to allow for free exploration for 10 min. On the third day, one object was replaced with a different one including different color and shape. Mice were then subjected to free exploratory trial for 10 min [33]. Throughout the study, the exploratory trial for each animal was performed under the diffused illumination (nearly 500 lx). The time spent in exploring the familiar or novel object (exploration time) in each group was recorded by video tracking and behavioral analysis software (Smart v3.0, Panlab). The time exploring a novel object was defined as N while the time spent in exploring a familiar object was defined as F. The discrimination index was calculated according to the following formula: (N–F)/(N+F) × 100 %. Olfactory cues were avoided by thorough cleaning of the apparatus and objects with 75 % ethanol solution after each trial.

Morris water maze (MWM) test. On the 46th day after Pilo injection, MWM test was carried out in an environment with the diffused illumination (nearly 500 lx) to assess the spatial memory performance in different groups as previously described [34]. Briefly, the maze (120  cm diameter) was filled with water (23 ± 2 °C). Mice were allowed for environmental adaptation for 1 h prior to training session. The training trial lasted for 5 consecutive days with three trials per day and followed by a probe trial on the 51th day. During each trial of training session, animals tried to find the hidden platform (10 cm diameter, 2  cm beneath the water), which was placed in the center of one quadrant within 60 s. After finding the platform, mice stayed in place for 10 s in order to acquire memory consolidation. The inter-trial interval for each mouse was more than 1 h to have the sufficient time to rest. The moving traces of each animal were monitored by a video tracking system (Smart v3.0, Panlab). In each trial, the escape latency (s) and swimming speed were measured. For probe trials, the hidden platform was removed and mice were succumbed to 60  s probe test for spatial memory recall. The number of times passing the platform, which also meant the number of times for which the mice crossed the hidden platform, were recorded.

Sucrose preference test (SPT). Two days before the training test, mice were allowed to drink a 1 % sucrose solution for habituation. One day prior to implementation of the experiment, mice were deprived of water and food for 24  h. On the next day, each mouse was exposed to two bottles containing 1 % sucrose and the same volume of tap water, respectively. The position of water and sucrose-containing bottles were then switched after 12 h. Twenty-four hours later, two bottles were weighed and sucrose preference was calculated using the following formula [35]: Sucrose preference ratio (%) = [sucrose intake (g)/(sucrose intake (g) ± water intake (g))] × 100 %. This behavioral test was conducted under the standard environment (12  h light/dark cycle) with the diffused illumination.

Social interaction test (SIT). The testing apparatus contained 3 chambers with a center chamber and two outer chambers consisting of wire cup-like cages (10 cm bottom diameter, 13 cm height) with a single entry between chambers, which were placed in an environment under the diffused illumination (nearly 500 lx). There were two phases throughout the test [36]: (1) Habituation; (2) Social preference. In the stage of habituation, mice were placed in the central chamber and subject to exploring the arena for 10 min. In the second phase (Social preference), a novel mouse with matched sex and age was placed in one of cup-like cages, whilst the other cup was empty. Then, the test mouse was placed in the central chamber and experienced 10 min-movements freely. The time each mouse spent investigating the empty cup-like cage or novel mouse (defined as sniffing or active interaction time, respectively) was recorded using a video tracking system (Smart v3.0, Panlab). The discrimination ratio (%) was analyzed using the following formula: (Active interaction time-Sniffing time)/(Active interaction time + Sniffing time) × 100.

Tissue processing

Brains collected for Nissl staining, Fluoro-Jade B (FJB) staining and immunofluorescence were first perfused via transcardial perfusion with ice-cold PBS and 4 % paraformaldehyde (PFA). After post-perfusion with 4 % PFA for 24 h, brains were processed through a series of solvents starting from ethanol solutions to xylenes and then embedded into paraffin blocks using standard protocols. Brains were sectioned at 10 μm thickness using a microtome (RM2016, Leica).

ELISA

The contents of 5-HETE and LTB4 in hippocampus and cortex samples were determined by the corresponding commercial ELISA kits according to the manufacturer’s instructions. Their wavelengths to detect the concentrations of 5-HETE and LTB4 were set at 450 nm and 450 nm, respectively.

Nissl staining

Brain tissue slides (10 μm) were washed with PBS for three times. Then, they were subject to removal of paraffin via sequential immersion with 100 % xylene for 15 min, gradient ethanol (100 %, 90 %, 70 %) for 5 min, 2 min and 2 min, respectively, and deionized water for 2 min. After that, slices were incubated with Nissl staining solution for 10 min at room temperature. Following two washes with deionized water, slides were dehydrated with 95 % ethanol twice for 5 s each and then incubated with xylene twice for 5 min each. Sections were then mounted with neutral resins. The images were taken under an optical microscope (TS2, Nikon) and analyzed using Image J software (Version 1.50i, Wayne Rasband).

FJB staining

Tissue slices were first immersed into a solution of 1 % sodium hydroxide for 5 min, followed by soaking in 70 % ethanol for 2 min. Subsequently, the slides were incubated with 0.06 % potassium permanganate for about 10 min at room temperature and washed with distilled water. Finally, brain slices were incubated in 0.0004 % FJB solution for 20 min and observed under a microscope. Degenerated neurons were analyzed using Image J software (Version 1.50i, Wayne Rasband).

RNA extraction and real-time quantitative PCR

Total RNA from brain tissues was isolated using TRIzol reagent. The quality of RNA was assessed by ensuring the ratio of OD260/OD280 in the range of 1.8–2.0. The concentration of RNA was measured by the Nanodrop. Total RNA (1 μg) was reverse transcribed to generate cDNA using a PrimeScript™ RT reagent Kit. Quantitative PCR was carried out on the instrument (LightCycler 480, Roche) with the following conditions: pre-denaturation at 95 °C for 30 s followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s and elongation at 72 °C for 30 s. The relative gene expression was calculated by 2-ΔΔ method using β-actin as a reference gene. The primer sequences were summarized in Supplementary Fig. 2. Each sample was repeated three times.

Western blot

The pellets of hippocampus or cortex tissues were lysed in a commercial lysis buffer supplemented with protease and phosphatase inhibitors. Tissue debris was then discarded by centrifugation at the speed of 14,000 g for 20 min at 4 °C. The supernatants were collected and quantified by BCA method. Protein denaturation was completed after boiling for 10 min with loading buffer. Equal amounts of protein (20 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (IPVH00010, Millipore). After blocking with 5 % non-fat milk in TBST for 1 h at room temperature, the membranes were incubated with primary antibodies including Alox5, IL-1β, IL-6, PKA, CAMKII, p-Syn ISer9, p-Syn ISer603, Synapsin I, TNFα, α-tubulin and GAPDH overnight at 4 °C. On the next day, the membranes were washed three times with TBST for 30 min and probed with secondary antibodies conjugated with horseradish peroxidase (HRP) against mouse IgG or rabbit IgG for 1 h at room temperature. The protein bands were visualized by enhanced chemiluminescence kit via a Bio-Rad imaging system (ChemiDoc 12003153, Bio-Rad). Protein levels from different groups were analyzed using Image J software (Version 1.50i, Wayne Rasband) with α-tubulin or GAPDH as a control. Other details of primary and secondary antibodies were summarized in Supplementary Fig. 3.

Measurement of calcium concentration

After treatments, hippocampus tissue samples were homogenized in 100 μL assay buffer and centrifuged for 20 min at 4 °C. The supernatants were then collected and the calcium concentration was determined by a Calcium Colorimetric Assay Kit according to the manufacturer’s instructions. The optical density was obtained by a microplate reader (Synergy LX, Bio Tek) with the wavelength set at 575 nm.

Detection of glutamate and γ-aminobutyric acid (GABA) levels

Measurement of glutamate level in hippocampus was performed by a commercial Glutamate Assay Kit. Briefly, hippocampus tissues from different groups were homogenized by adding 0.9 % NaCl at a weight (g): volume (mL) ratio of 1: 9 and the homogenates were then centrifuged at 12,000 g for 15 min at 4 °C. After that, the supernatants were collected for the determination of glutamate level. The standards and samples were prepared according to the reagents given in the kit. After incubation at 37 °C for 20 min, the optical density was measured at the wavelength of 450 nm using a microplate reader (Synergy LX, Bio Tek).

Measurement of GABA level in hippocampus was conducted by a commercial GABA Assay Kit. For short, tissue homogenization was performed in an ice-cold extracting solution at a 10 % w/v (g/mL) ratio using a plastic homogenizer and then transferred to an Eppendorf tube. The mixtures were reacted at 95 °C for 2 h. After cooling, the samples were centrifuged at 8,000 g for 10 min and the supernatants were used to measure GABA level. The assay procedure was conducted as described in the manufacturer’s protocol and the absorbance was read at 640 nm.

Immunofluorescent staining

Brain slices were immersed in Citrate Antigen Retrieval Solution for antigen repair at 96 °C for 20 min. Then, they were cooled and washed with PBS for three times with 3 min each. Afterward, sections were permeabilized with 0.2 % Triton X-100 in PBS for 15 min and blocked with 5 % donkey serum for 30 min. Afterward, sections were incubated with primary antibodies including Alox5, NeuN, GFAP, Iba1 and GFP overnight at 4 °C. On the next day, following three washes with PBS for 15 min, the slides were then incubated with Alexa fluorophore-coupled secondary antibodies diluted in blocking buffer (5 % donkey serum) for 45 min at room temperature. After several washes, cell nuclei were stained with DAPI solution for 10 min at room temperature. Images were captured under a fluorescence microscope (DM4B, Leica) and the immunofluorescent signal was quantified using Image J software (Version 1.50i, Wayne Rasband).

Biochemical assay

Routine blood test (RBT): Blood specimens (200 μL) were collected for detection of different hematological indices including white blood corpuscles (WBC), red blood corpuscles (RBC), platelets (PLT), hemoglobin (HGB), mean cell volume (MCV) and mean corpuscular hemoglobin (MCH). The results were obtained by the automatic hematology analyzer (XN-1000-B1, Sysmex Corporation).

Detections of aspartate aminotransferase (AST), alanine aminotransferase (ALT), creatinine (CREA) and blood urea nitrogen (BUN) levels in serum: Blood samples (200 μL) from each group were collected and centrifugated at 1200 × g for 15 min at 4 °C. Serum samples were then obtained for analysis of AST, ALT, CREA and BUN by the corresponding commercial kits according to manufacturer’s instructions. The final absorbance of AST, ALT, CREA and BUN was detected at 510 nm, 510 nm, 546 nm and 520 nm, respectively by a microplate reader (Synergy LX, Bio Tek).

Routine urine test (RUT): Urine samples from each group were collected to analyze protein (PRO), ketone (KET), urobilinogen (UBG) and bilirubin (BIL). The data analysis was performed by the automatic biochemical analyzer (VetLab UA Analyzer, IDEXX).

Statistical analysis

All the data was analyzed using GraphPad 9.0 software. Prior to the evaluation of the statistical significance, ShapiroeWilk test was first employed to determine whether the results conform to normal distribution. In terms of the normally distributed data, the following methods were then used for further statistical analysis: one-way ANOVA or repeated measure (RM)-two-way ANOVA with Tukey’s test, and Brown-Forsythe ANOVA test followed by Dunnett’s T3 multiple comparisons or Unpaired t-test with Welch’s correction. However, if the data were not normally distributed, Mann Whitney U test or KruskaleWallis test was employed. For animals’ survival analysis, Kaplan-Meier curves were obtained using log-rank and Gehan-Breslow-Wilcoxon tests. The details of statistical test were presented in Table 1. All results were shown as the mean ± SEM. A value with P less than 0.05 was deemed to be statistically significant.Table 1 Summary of statistical tests.

Figure.	Statistical Test	
1D	Unpaired t-test, two-tailed: t = 5.25, df = 8; α = 0.05	
1F	Unpaired t-test with Welch's correction, two-tailed: t = 4.282; df = 3.367; α = 0.05;
Unpaired t-test, two-tailed: t = 6.381, df = 6; α = 0.05;
Unpaired t-test, two-tailed: t = 1.342, df = 6; α = 0.05	
1G	Unpaired t-test, two-tailed: t = 4.561, df = 10; α = 0.05	
1H	Unpaired t-test, two-tailed: t = 4.561, df = 10; α = 0.05	
2B	Unpaired t-test, two-tailed: t = 2.172, df = 16; α = 0.05	
2C	RM-two-way ANOVA with Sidak's post-hoc; F (3, 32) = 228.2; α = 0.05	
2D	RM-two-way ANOVA with Sidak's post-hoc; F (3, 32) = 175.3; α = 0.05	
2E	One-way ANOVA with Tukey post-test; F (3, 32) = 228.2; α = 0.05	
2G	One-way ANOVA with Tukey post-test; F (3, 32) = 85.03; α = 0.05	
2H	One-way ANOVA with Tukey post-test; F (3, 32) = 16.52; α = 0.05	
2 K	RM-two-way ANOVA with Tukey post-test; F (3, 20) = 11.47; α = 0.05	
2L	One-way ANOVA with Tukey post-test; F (3, 30) = 1.753; α = 0.05	
2 M	RM-two-way ANOVA with Tukey post-test; F (3, 20) = 13.89; α = 0.05	
2 N	One-way ANOVA with Tukey post-test; F (3, 20) = 13.46; α = 0.05	
3B	Unpaired t-test, two-tailed: t = 2.847, df = 12; α = 0.05	
3C	Unpaired t-test, two-tailed: t = 3.363, df = 12; α = 0.05	
3D	RM-two-way ANOVA with Tukey post-test; F (3, 24) = 114.4; α = 0.05	
3E	RM-two-way ANOVA with Tukey post-test; F (3, 24) = 94.55; α = 0.05	
3F	One-way ANOVA with Tukey post-test; F (3, 24) = 114.4; α = 0.05	
4D	RM-two-way ANOVA with Tukey post-test; F (1, 14) = 321.5; α = 0.05	
4E	Mann Whitney U test, two-tailed: U=0; α = 0.05	
5C	One-way ANOVA with Tukey post-test; F (3, 12) = 15.4; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 5.388; α = 0.05;
Kruskal-Wallis test followed by Dunn's test: H=5.647; α = 0.05	
5E	One-way ANOVA with Tukey post-test; F (3, 12) = 18.27; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 7.199; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 7.505; α = 0.05	
5G	One-way ANOVA with Tukey post-test; F (3, 12) = 7.026; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 3.489; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 1.35; α = 0.05	
6C	One-way ANOVA with Tukey post-test; F (3, 36) = 0.2061; α = 0.05	
6D	One-way ANOVA with Tukey post-test; F (3, 36) = 5.541; α = 0.05	
6E	Mann Whitney U test, two-tailed, α = 0.05: Ctrl-Cas9 (U=17.5); Ctrl-Cas9 + Pilo (U=44); Alox5-Cas9 (U=12.5); Alox5-Cas9 + Pilo (U=21)	
6F	One-way ANOVA with Tukey post-test; F (3, 36) = 19.05; α = 0.05	
6G	One-way ANOVA with Tukey post-test; F (3, 36) = 1.284; α = 0.05	
6H	RM-two-way ANOVA with Tukey post-test; F (3, 36) = 4.431; α = 0.05	
6 J	One-way ANOVA with Tukey post-test; F (3, 36) = 10.21; α = 0.05	
6 K	Kruskal-Wallis test followed by Dunn's test: H=1.816; α = 0.05	
6 M	Kruskal-Wallis test followed by Dunn's test: H=18.22; α = 0.05	
6 N	One-way ANOVA with Tukey post-test; F (3, 36) = 9.977; α = 0.05	
7B	One-way ANOVA with Tukey post-test; F (3, 20) = 171.9; α = 0.05	
7D	One-way ANOVA with Tukey post-test; F (3, 20) = 0.9038; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 20) = 93.54; α = 0.05;
Kruskal-Wallis test followed by Dunn's test: H=4.759; α = 0.05;
Kruskal-Wallis test followed by Dunn's test: H=16.79; α = 0.05	
7E	One-way ANOVA with Tukey post-test; F (3, 20) = 68.06; α = 0.05	
7F	One-way ANOVA with Tukey post-test; F (3, 20) = 62.53; α = 0.05	
8B	RM-two-way ANOVA with Tukey post-test; F (1, 10) = 0.52; α = 0.05	
8C	Unpaired t-test, two-tailed: t = 0, df = 10; α = 0.05	
8D	RM-two-way ANOVA with Tukey post-test; F (1, 10) = 0.2148; α = 0.05	
8E	Log-rank (Mantel-Cox) test: df = 1	
8F	Unpaired t-test, two-tailed, df = 10; α = 0.05: WBC (t = 2.212); RBC (t = 0.4735); PLT (t = 1.598); HGB (t = 0.5348); MCV (t = 0.5376); MCH (t = 0.4829)	
8G	Mann Whitney U test, two-tailed: U=13; α = 0.05;
Unpaired t-test, two-tailed: t = 0.5736, df = 10; α = 0.05	
8H	Unpaired t-test, two-tailed, df = 10; α = 0.05: CREA (t = 0.4687); BUN (t = 0.6693)	
8 K	Unpaired t-test, two-tailed, df = 10; α = 0.05: IL-1β (t = 0.3876); IL-6 (t = 1.201); TNFα (t = 1.761)	
S4B	Mann Whitney U test, two-tailed: U=4; α = 0.05	
S5B	Unpaired t-test, two-tailed: t = 2.358, df = 10; α = 0.05	
S6B	Unpaired t-test with Welch's correction, two-tailed: t = 4.261, df = 2.076; α = 0.05	
S9A	Unpaired t-test, two-tailed: t = 9.516, df = 10; α = 0.05	
S9B	Mann Whitney U test, two-tailed: U=0; α = 0.05	
S11	RM-two-way ANOVA with Tukey post-test; F (3, 28) = 4.875; α = 0.05	
S13	Mann Whitney U test, two-tailed: U=0; α = 0.05	
S14B	One-way ANOVA with Tukey post-test; F (3, 12) = 2.939; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 10.9; α = 0.05;One-way ANOVA with Tukey post-test; F
(3, 12) = 2.218; α = 0.05	
S15	One-way ANOVA with Tukey post-test; F (3, 36) = 3.655; α = 0.05	
S17	One-way ANOVA with Tukey post-test; F (2, 15) = 128.2; α = 0.05;One-way ANOVA with Tukey post-test; F
(2, 15) = 64.98; α = 0.05;One-way ANOVA with Tukey post-test; F
(2, 15) = 316; α = 0.05	
S18B	Unpaired t-test, two-tailed, df = 10; α = 0.05: IL-1β (t = 0.8393); IL-6 (t = 1.579); TNFα (t = 2.160)	

In our present study, sample size was not calculated using the statistical method. However, according to our previous publication [37], three animals for each group can acquire a 44.12 % difference between treatment group and model group with a power value of 87.35 % and a type I error rate of 5 %. Therefore, at least three mice were employed for each group in our current work.

Results

Alox5 deletion was found in hippocampal neurons in vivo

AAV-mediated SaCas9 was previously reported to act as a powerful tool for deletion of target gene in vivo [26], [38]. Thus, taking advantage of this strategy, we first analyzed the efficiency of gene editing for Alox5 in mouse brain tissues including hippocampus and frontal cortex. Delivery of Alox5 sgRNA or control was performed via AA9-mediated SaCas9 through intrahippocampal injection (Fig. 1A). At 28 days post-injection, the effectiveness of SaCas9-mediated gene editing was evaluated via detecting mRNA level, protein expression, protein distribution and metabolic product of Alox5. The results showed that the percentage of EGFP cells that also expressed Cas9 was 87.3 % and 89.8 % in Ctrl-Cas9 and Alox5-Cas9 groups, respectively (Supplementary Fig. 4). EGFP-positive virus particle packaged with Alox5 sgRNA displayed evident colocalization with the specific neuronal marker NeuN [39] (Fig. 1B), which confirms the successful entry of Alox5 sgRNA into cerebral neurons. Furthermore, there were also significant reductions of Alox5 mRNA (data not shown) and protein level in hippocampus and frontal cortex of Alox5-Cas9 mice (Fig. 1C-D and Supplementary Fig. 5), compared with that of Ctrl-Cas9 group. The effect of AAV9-Cas9 on Alox5 protein distribution was also investigated via immunofluorescence. The results showed that the neuronal distribution of Alox5 was remarkably reduced especially in hippocampal CA1 and CA3 regions (Fig. 1E-F) and frontal cortex (Supplementary Fig. 6) while no evident effect on Alox5 protein distribution was found in astrocyte and microglia (Supplementary Figs. 7 and 8), suggesting that neuron-specific deletion of Alox5 was constructed via AAV9-Cas9 in our present study. Given that 5-HETE and LTB4 are two major metabolic products positively related with the enzymatic activity of Alox5 [40], [41], we also measured their levels in brain tissue samples. The results of ELISA demonstrated that genetic editing of Alox5 by CRISPR-Cas9 significantly diminished the levels of 5-HETE and LTB4 in both hippocampus (Fig. 1G-H) and frontal cortex samples (Supplementary Fig. 9A and B). Since hippocampus is the most vulnerable region in temporal lobe epilepsy (TLE) [42], we focused on this area in the subsequent experiments to investigate the suppressive effect on TLE via AAV-Cas9-mediated neuronal deletion of Alox5. Collectively, according to the above results, the in vivo gene editing system via AAV9-SaCas9 in our present work can be used to achieve the specific deletion of Alox5 in neurons.Fig. 1 Successful deletion of Alox5 was observed in hippocampal neurons in vivo. (A) Experimental timeline; (B) Successful entry of AAV was validated via GFP immunofluorescence. Scale bar: 100 μm; (C) Representative western blot image showing the protein expression of Alox5 in the hippocampus of different groups; (D) Quantitative analysis of Alox5 protein level; (E) Representative images showing colocalization of Alox5 and NeuN by immunofluorescence. Scale bar: 100 μm; (F) Statistical analysis; (G-H) Detections of 5-HETE and LTB4 levels, which indicate Alox5 activity in the hippocampus of different groups. *P<0.05, **P<0.01, ***P<0.001.

Alox5 deletion exerted anticonvulsant effects in Pilo-induced epilepsy model

Next, we examined whether neuron-specific deletion of Alox5 by CRISPR-Cas9 system displayed anticonvulsant activity. The virus Alox5-Cas9 or matched control (Ctrl-Cas9) was injected into the hippocampus of the mice in advance. Twenty-eight days later, when the successful virus expression was achieved, Pilo was then intraperitoneally injected at the dose of 300 mg/kg to induce epileptic seizures (Fig. 2A). The experimental design that virus injection was performed prior to Pilo treatment aimed to evaluate seizure susceptibility in addition to seizure severity. Our results illustrated that injection of Alox5-Cas9 significantly increased the time of onset of the first seizure, namely, seizure latency (Fig. 2B), which also indicates the decrease of seizure susceptibility, decreased a variety of seizure severity-associated indices including seizure score (Fig. 2C), cumulative score (sequential addition of score every ten minutes) (Fig. 2D), sum score (total score throughout 90 min) (Fig. 2E), number of seizures (Fig. 2F-G) and seizure duration (Fig. 2H), although no significance was observed in terms of the percentage of mice for more than seizure stage 3 between Alox5-Cas9 and Ctrl-Cas9 groups (Fig. 2I). EEG recording with monitoring for 3 consecutive days after Pilo injection was also further employed to evaluate the seizure activity. The results of EEG spikes revealed that mice with injection of Alox5-Cas9 exhibited the dramatic reduction of spikes per 10 min compared with vehicle-treated Pilo group, especially on the 1st day and the 2nd day after Pilo treatment (Fig. 2J-K), despite no significant difference among all the groups in the aspect of interictal spikes (Supplementary Fig. 10). In addition, the results of EEG power also showed that there were decreases of power per day (Fig. 2M) and total power (Fig. 2N) in a mouse model of Pilo when injection with Alox5-Cas9. However, baseline power (Fig. 2L) was not significantly in all groups assigned. These results suggest that neuron-targeted loss of Alox5 by AAV9-Cas9 exhibits an anticonvulsant effect in an acute seizure model induced by Pilo.Fig. 2 Alox5 deletion exerted anticonvulsant effects in Pilo-induced epilepsy model. (A) Experimental timeline; (B) Effects of Alox5-Cas9 intervention on seizure latency in Pilo model; (C-E) Analysis of alterations of seizure score, cumulative seizure score and sum seizure score after Alox5-Cas9 focal delivery; (F-G) Effects of Alox5-Cas9 intervention on the number of seizures within 90 min of Pilo injection; (H) Cumulative analysis of seizure duration within 90 min of Pilo injection in different groups; (I) Effect of focal Alox5-Cas9 delivery on the percentage of mice for more than seizure stage 3 and for less than seizure stage 3; (J) Representative EEG traces and power spectrum density; (K) Effects of Alox5-Cas9 on the epileptiform spike frequency (marked with spikes per 10 min) from day 1 to day 3 after Pilo injection in different groups; (L) Cumulative analysis of baseline power. The baseline EEG trace was monitored 30 min before Pilo injection; (M) Quantitative analysis of power per day from day 1 to day 3 after Pilo injection in different groups; (N) Cumulative analysis of total power in different groups. *P<0.05, **P<0.01, ***P<0.001.

Alox5 deletion reduced seizure susceptibility and seizure severity in mouse model of SE

SE is a common neurological emergency in the field of epilepsy accompanied with worse outcome and severe physiologic disturbances [43]. In our present work, we also explored whether the focal Alox5-Cas9 delivery suppressed SE in mouse model induced by KA. The experimental procedure was shown in Fig. 3A. It was worth noting that virus including Alox5-Cas9 and Ctrl-Cas9 was injected 28 d prior to KA administration. The reason why we conducted this design was that SE induction by KA was a serious acute epileptic condition. Preinjection of Alox5-Cas9 or Ctrl-Cas9 was carried out to verify the successful virus expression and it was convenient to assess the effect of neuronal Alox5 deletion on SE. In our present work, our results revealed the increase of seizure latency (Fig. 3B), decrease of time in motor seizures (Fig. 3C), reductions of seizure score (Fig. 3D), cumulative score (Fig. 3E) and sum score (Fig. 3F), and decreased tendency of the percentage of mice for more than seizure stage 3 between Alox5-Cas9 and Ctrl-Cas9 groups (Fig. 3G), suggesting the seizure-suppressant effect on KA-induced SE after Alox5 deletion in neuron, which was consistent with the results in Pilo model as mentioned above.Fig. 3 Alox5 deletion reduced seizure susceptibility and seizure severity in a mouse model of KA-induced status epilepticus. (A) Experimental timeline for evaluation of the effect of Alox5-Cas9 on animals’ survival in KA model; (B) Alox5-Cas9 significantly increased the latencies to the first motor seizures; (C) Alox5-Cas9 significantly reduced the time in motor seizures; (D) Effects of Alox5 deletion on the maximal seizure score per 10 min within 90 min of KA injection; (E) Effects of Alox5 deletion on the cumulative seizure score per 10 min within 90 min of KA injection; (F) Effects of Alox5 deletion on the sum seizure score within 90 min of KA injection; (G) Effects of Alox5 deletion on the percentage of seizure levels above grade 3 within 90 min of KA injection. *P<0.05, **P<0.01, ***P<0.001.

Alox5 deletion had anti-epileptogenic effect in Pilo-induced epilepsy model

To investigate the anti-epileptogenic effect of Alox5 deletion in hippocampus, Alox5-Cas9 or control virus was subject to intrahippocampal injection several hours after Pilo injection. After 42 days of Pilo treatment, mice could exhibit chronic epilepsy and in this situation video EEG recording was monitored for 7 consecutive days. The experimental procedure was summarized in Fig. 4A. AAV-mediated Alox5-Cas9 delivery significantly decreased the power (Fig. 4B), especially on the 42nd day (Supplementary Fig. 11). However, treatment with Alox5-Cas9 had no obvious effect on the interictal phase in the Pilo-induced epilepsy model (Supplementary Fig. 12). Besides, spontaneous recurrent seizure (SRS) defined by simultaneous appearance of behavioral convulsion and at least 10 s events more than 3 Hz, an important marker of epileptogenesis, was also further analyzed. It was noted that focal Alox5-Cas9 delivery remarkably reduced the number of SRS for each day of EEG monitoring (Fig. 4C-D), cumulative number of SRS (Fig. 4E) and the cumulative SRS duration (Supplementary Fig. 13). Altogether, these results suggest that neuron-targeted deletion of Alox5 exhibits anti-epileptogenetic effect.Fig. 4 Alox5 deletion reduced epileptogenesis in Pilo-induced epilepsy model. (A) Experimental timeline; (B) Examples of EEG monitoring for three consecutive days in Pilo model after Alox5-Cas9 treatment; (C) Heat map showing the number of SRS for each mouse following 7-day EEG recording in different groups; (D) Analysis of SRS within 7-day EEG monitoring in different groups; (E) Quantitative analysis of the number of cumulative SRS in different groups. *P<0.05, **P<0.01, ***P<0.001.

Effects of Alox5 deletion on molecular and pathological events involving epileptogenesis

We further examined whether Alox5-Cas9 delivery in hippocampus affected molecular and pathological events following epileptogenesis. Neuronal loss, neurodegeneration, gliosis (e.g. astrogliosis) and mossy fiber sprouting are prevalent traits in the epileptogenic stage [44]. Thus, several hours after Pilo injection, AAV with the package of Alox5-Cas9 or GFP control was delivered. Nissl staining and FJB staining were employed for evaluation of neuronal loss and neurodegeneration while immunofluorescent staining using GFAP (a well-established marker for astrocyte) [45] as the primary antibody and Timm staining were selected for assessing effects of Alox5 deletion on gliosis and mossy fiber sprouting, respectively, on the 42nd day after Pilo treatment, at which time point video EEG recording was carried out as mentioned in Fig. 4. The experimental procedures were displayed in Fig. 5A. The results of Nissl staining indicated that injection of Pilo significantly resulted in a decrease of Nissl-positive neurons in hippocampus (black arrows indicating intact Nissl bodies), especially CA1 and CA3 regions and neuron-specific deletion of Alox5 had a pronounced protection against neuronal damage in these two subregions (Fig. 5B-C). Analysis of FJB staining results demonstrated that Pilo-treated mice exhibited the increase of the number of degenerated neurons in hippocampal CA1, CA3 and DG subregions (Fig. 5D-E). However, these phenomena were significantly reversed in the acute stage of Pilo-induced epilepsy mouse model after treatment with Alox5-Cas9 (Fig. 5D-E). Immunofluorescent staining results revealed that focal delivery of Alox5-Cas9 resulted in a marked reduction of GFAP protein distribution in hippocampus, especially CA1 region, in Pilo-induced epilepsy model (Fig. 5F-G) and this result was also validated in KA mouse model (Supplementary Fig. 14), indicating the inhibitory effect on astrogliosis by Alox5 deletion. Furthermore, Timm staining results illustrated that neuronal Alox5 deletion evidently suppressed the mossy fiber sprouting in Pilo-induced epilepsy mouse model (Fig. 5H). Collectively, these results indicate that Alox5 deletion in hippocampal neuron improves molecular pathologies involved in epileptogenesis, especially suppressions of neuronal loss, neurodegeneration, astrogliosis and mossy fiber sprouting.Fig. 5 Effects of Alox5 deletion on molecular and pathological events involving epileptogenesis. (A) Experimental design; (B) Representative Nissl staining images in different groups. Arrows indicate Nissl-positive cells. Red scale bar: 200 μm, black scale bar: 50 μm; (C) Quantitative analysis of Nissl staining results; (D) Representative FJB staining images in different groups. Arrows indicate FJB-positive cells. Scale bar: 50 μm; (E) Quantitative analysis of FJB staining results; (F) Representative immunofluorescent images of GFAP in different groups. Scale bar: 100 μm; (G) Quantitative analysis of GFAP-positive signal; (H) Representative Timm staining images in different groups. Mossy fiber sprouting is marked with white dashed line. Scale bar: 100 μm. *P<0.05, **P<0.01, ***P<0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Alox5 deletion improved epilepsy-associated comorbidities in Pilo-induced epilepsy model

Chronic epilepsy is often accompanied with a variety of neuropsychiatric comorbidities such as anxiety, cognitive impairment, depressive-like and autistic-like behavior [46]. Therefore, we attempted to explore the effects of focal Alox5-Cas9 delivery on these comorbidities in vivo. Several hours after Pilo injection, Alox5-Cas9 or Ctrl-Cas9 virus was delivered into the hippocampus. On the 42nd day after Pilo treatment, mice displayed chronic epilepsy and the corresponding behavioral tests for assessment of associated comorbidities including OFT (for assessment of anxiety-like behavior), NOR and MWM (for assessment of cognitive function), SPT (for assessment of depressive-like behavior) and SIT (for assessment of autistic-like behavior) were carried out in our present work as summarized in Fig. 6A. The representative traces in each group during OFT were shown in Fig. 6B. No significance was found in Pilo mouse model when injection with Alox5-Cas9 virus (Fig. 6C), suggesting no effect on locomotor activity. However, mice subject to Pilo exhibited the remarkable decrease of center entries and reduction of time spent in center area and focal Alox5-Cas9 delivery significantly reversed the index in Pilo mouse model (Fig. 6D and Supplementary Fig. 15), which suggests that Alox5 deletion improves epilepsy-associated anxiety-like behavior. We further analyzed the cognitive function in Pilo-induced epilepsy mouse model using NOR and MWM tests. The results of NOR demonstrated that injection of Ctrl-Cas9 or Alox5-Cas9 into the normal mice displayed the normal ability to discriminate the new object as the exploration time, which meant the time when the mice explored the familiar or novel object, was greatly different (Fig. 6E). However, it was difficult for the mice with TLE to discriminate the new object since the exploration time was nearly the same when exploring the familiar and novel objects. Treatment with Alox5-Cas9 spent more time to explore the novel object (Fig. 6E-F), indicating the improvement of cognitive function in Pilo mice after injection of Alox5-Cas9 virus. In MWM test, we confirmed there was no difference in the swimming speed of all mice (Fig. 6G). Representative swimming traces concerning five days of training trials among different groups was shown in Supplementary Fig. 16. Despite almost no significant difference was observed in the five-day training except for the 47th day in the aspect of escape latency (Fig. 6H), the results of probe trial illustrated a significant increase of the number of passing times (Fig. 6I-J) in Pilo-induced epilepsy mouse model after focal Alox5-Cas9 delivery. In addition, the results of SPT demonstrated that there was no significant difference in sucrose preference among four groups (Fig. 6K), indicating the negligible effect of Alox5 deletion on depressive-like behavior in epilepsy. Furthermore, we also evaluated effect of Alox5-Cas9 delivery on epilepsy-associated autistic-like behavior using SIT. The representative traces during SIT were shown in Fig. 6L. It was noted that the active interaction time and discrimination ratio in Pilo-stimulated mice were significant reduced (Fig. 6M-N). However, treatment with Alox5-Cas9 virus dramatically increased these indices, suggesting the improvement of autistic-like behavior in epilepsy after Alox5 depletion. Collectively, these findings indicate that neuron-specific deletion of Alox5 improves diverse neuropsychiatric comorbidities, especially anxiety, cognitive deficit and autistic-like behavior.Fig. 6 Alox5 deletion improved epilepsy-associated comorbidities in Pilo-induced epilepsy model. (A) Schematic diagram of the timeline for behavioral tests; (B) Representative image of moving trajectory in the OFT; (C-D) Effects of Alox5-Cas9 on the total distance and center entries, respectively; (E-F) Cumulative analysis of the exploration time and discrimination index in the NOR test; (G) Statistical analysis of swimming speed in different groups; (H) Effects of Alox5-Cas9 intervention on the escape latency; (I) Representative swimming traces in the probe trial in different groups; (J) Quantitative analysis of the number of times of crossing platform; (K) Statistical analysis of the sucrose preference in different groups; (L) Representative traces of SIT in different groups; (M−N) Cumulative analysis the time spent on active interaction and discrimination ratio in different groups. *P<0.05, **P<0.01, ***P<0.001.

The possible molecular mechanisms underlying the antagonistic effect on epilepsy after Alox5 deletion

We further elucidated the potential mechanism by which neuron-specific deletion of Alox5 counteracted epileptic seizures and associated neuropsychiatric comorbidities. Since Alox5 was previously reported to function as a critical regulator in inflammatory process [9], effect of neuronal Alox5 deletion on inflammatory factors was firstly assessed in our present work. It was found that no obvious effect was observed in the aspect of the effect of neuronal Alox5 deletion on the mRNA expression of inflammatory factors (IL-1β, IL-6 and TNFα) in hippocampus tissue samples of chronic epilepsy model (Supplementary Fig. 17), indicating that neuronal Alox5 deletion attenuates epilepsy independent on the modulation of inflammation. Prior work illustrated that the metabolite of Alox12, namely, 12-HPETE, served as the second messenger to mediate presynaptic inhibition of neurotransmitter release dependent upon direct inhibition of calcium entry and calcium-mediated reduction of the number of synaptic vesicles [47], [48]. Thus, we speculated that Alox5 might also affect neurotransmitter level under epileptic condition. Following the completion of behavioral tests for the evaluation of epilepsy-associated comorbidities on the 56th day after Pilo injection, the tissue samples were processed for molecular and biochemical assays. The experimental design was displayed in Fig. 7A. Following the detection of calcium concentration, it was found that focal Alox5 inhibition by AAV9 significantly led to the decrease of calcium level in Pilo-induced epilepsy mouse model (Fig. 7B). Previous evidence proved the critical role of synapsin I, especially its phosphorylation, for the modulation of neurotransmitter level following calcium stimulation, and the phosphorylation of synapsin I was always modulated by different kinases at distinct sites: phosphorylation of serine 9 residue (hereinafter referred to as p-Syn ISer9) by PKA and phosphorylations of serine 603 residue (hereinafter referred to as p-Syn ISer603) by CaMKII [49]. Thus, we further detected whether Cas9-mediated inhibition of Alox5 in hippocampus affected the phosphorylated state of synapsin I. Our results illustrated that neuron-targeted inhibition of Alox5 evidently decreased CaMKII-dependent p-Syn ISer603 in Pilo model while no significance was observed for p-Syn ISer9 by PKA (Fig. 7C-D). In addition, the results of determinations of neurotransmitters including glutamate and GABA also showed that Alox5 inhibition by AAV9 and Cas9 resulted in decrease of glutamate level in Pilo epilepsy model despite no effect on GABA level (Fig. 7E-F). Totally, these results suggest that low level of calcium concentration contributes to CAMKII-mediated decrease of p-SynSer603 and subsequent reduction of glutamate level, which may act as the possible mechanism underlying the antagonistic effect on epilepsy after neuronal loss of Alox5 in hippocampus.Fig. 7 CAMKII-mediated phosphorylation of synapsin I at serine 603 residue is involved in the antagonistic effect on epilepsy after Alox5 deletion. (A) Experimental timeline; (B) Detection of calcium concentration in hippocampus tissues; (C) Representative images showing protein expressions of CAMKII, PKA, p-Syn I Ser9, p-Syn I Ser603 and synapsin I in hippocampus tissues by western blot; (D) Quantitative analysis of protein levels of CAMKII, PKA, p-Syn ISer9, p-Syn ISer603 and synapsin I in hippocampus tissues; (E-F) Detections of glutamate and GABA levels in hippocampus tissues. **P<0.01, ***P<0.001.

Evaluation of the biosafety of CRISPR-Cas9-mediated Alox5 deletion

To evaluate the safety of focal Alox5-Cas9 delivery, measurement of body weight throughout 84 days of experiment and a battery of tests including RBT, hepatic function, renal function, RUT and analysis of inflammatory factors (IL-1β, IL-6 and TNFα) was conducted in normal mice as summarized in Fig. 8A. The body weight of each animal in Ctrl-Cas9 or Alox5-Cas9 groups was monitored every week for twelve consecutive weeks. No statistical significance was observed in terms of body weight (Fig. 8B), weight gain (Fig. 8C) and weight growth rate (Fig. 8D). Furthermore, none of mice were dead in both Alox5-Cas9 and Ctrl-Cas9 groups, suggesting no influence of Alox5 deletion on animals’ survival (Fig. 8E). Besides, multiple biochemical tests including RBT (WBC, RBC, PLT, HGB, MCV and MCH), hepatic function (ALT and AST), renal function (CREA and BUN) and RUT (PRO, KET, UBG and BIL) were analyzed and found to be comparable between Alox5-Cas9 and Ctrl-Cas9 groups (Fig. 8F-I). Moreover, inflammatory factors including IL-1β, IL-6 and TNFα in hippocampal tissues and cortex samples were also detected by western blot. It was noteworthy that no indication of inflammation was seen in the brains 84 days after Alox5-Cas9 or Ctrl-Cas9 injection (Fig. 8J-K and Supplementary Fig. 18). Collectively, these results suggest that focal Alox5-Cas9 delivery by AAV has satisfactory biosafety in vivo.Fig. 8 Evaluation of the biosafety of CRISPR-Cas9-mediated Alox5 deletion. (A) Experimental timeline. Red arrows indicate the time points which measure the body weight; (B) Time course of effects of Alox5 deletion on the body weight from day 1 to day 84 for one week each; (C) Effect of Alox5-Cas9 on weight gain in normal mice during the 84-day period; (D) Analysis of weight growth rate for every week in normal mice after treatment with Alox5-Cas9; (E) Effect of Alox5-Cas9 on animals’ survival by Kaplan-Meier analysis; (F) Analysis of hematological indices including WBC, RBC, PLT, HGB, MCV and MCH in normal mice 84 d after Alox5-Cas9 delivery; (G) Evaluation of liver function by analysis of AST and ALT in serum of normal mice 84 d after Alox5-Cas9 delivery; (H-I) Evaluation of renal function by analysis of CREA and BUN in serum and key indices in urine sample such as PRO, KET, UBG and BIL 84 d after Alox5-Cas9 delivery; (J-K) Detection of inflammatory factors (IL-1β, IL-6 and TNFα) in the hippocampus of normal mice 84 d after Alox5-Cas9 delivery by western blot. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Discussion

Our present work showed that Alox5 deletion via AAV-mediated CRISPR-Cas9 exerts benefits on epilepsy and associated comorbidities. First, neuron-specific deletion of Alox5 possessed anticonvulsant property in two TLE mouse models. Second, hippocampal Alox5 deletion exerted anti-epileptogenic potential against Pilo-induced TLE mouse model and reversed molecular pathologies involved in epileptogenesis, especially suppressions of neuronal loss, neurodegeneration, astrogliosis and mossy fiber sprouting. Third, neuron-specific deletion of Alox5 also improved diverse neuropsychiatric comorbidities, especially anxiety, cognitive deficit and autistic-like behavior. In the aspect of anxiety evaluation, we noticed that there was a remarkable decrease of center entries and reduction of time spent in center area in Pilo-induced epilepsy mouse model. “Center entries” [50], [51], [52] and “Time spent in center area” [53], [54], [55], [56] are well-known indices for assessing anxiety-related behavior. Generally, both of the decrease of center entries and reduction of time spent in center area indicate a high level of anxiety. Consistently, several other investigations also support a high level of anxiety in Pilo mice model [53], [54], [55], [56] via analysis of the index “Time spent in center area”. On the contrary, increase of center entries was found in Pilo-treated rats [57], [58], [59], we speculate that the discrepancy is possible due to different animal strains. Fourth, the preliminary results demonstrated that the possible mechanism underlying the antagonistic effect on epilepsy after Alox5 deletion may be associated with decrease of calcium concentration and subsequent blockade of CAMKII-mediated p-Syn ISer603, finally reducing glutamate level. Fifth, the results of a battery of tests including RBT, hepatic function, renal function, RUT and analysis of inflammatory factors (IL-1β, IL-6 and TNFα) illustrated that focal Alox5-Cas9 delivery by AAV has satisfactory biosafety in vivo. These findings indicate the feasibility of neuron-targeted Alox5 deletion by CRISPR-Cas9 in epilepsy treatment.

Alox5 is a rate-limiting enzyme which uses arachidonic acid as substrate for catalyzing the biosynthesis of multiple inflammatory mediators especially leukotrienes [60]. Critical role of Alox5 has been reported in a variety of neurological disorders including epilepsy [61], [62], [63]. Alox5 level was up-regulated KA-induced seizure gerbil model, which was accompanied by leukotriene formation [61]. Pharmacological inhibition of Alox5 by phenidone significantly reversed this phenomenon [61]. Additionally, application of the cyclooxygenase and lipoxygenase inhibitor BW755C was also found to reduce seizure severity and seizure-associated brain lesion in KA rat model [64]. Our previous study also revealed that treatment with zileuton, an approved drug specifically inhibiting Alox5, shows evident protection against neuronal injury and epileptic seizures in a KA mouse model [10]. However, zileuton possesses a variety of side effects such as hepatic toxicity [65]. This is possible due to the wide distribution of Alox5 in multiple cell types and living organisms. We speculate that cell type-specific inhibition of Alox5 may overcome the disadvantage for Alox5-targeting drugs. As Alox5 is widely distributed in neurons [66], deletion of Alox5 in neuron was conducted by CRISPR-Cas9 method. Our results confirmed the Alox5 deficiency in neuron and validated the inhibition of its enzyme activity by detecting the levels of its active metabolites 5-HETE and LTB4 [40], [67]. Furthermore, neuron-specific deletion of Alox5 reduced seizure severity and inhibited epileptogenesis without undesirable side effects. It indicates that CRISPR-Cas9-mediated neuronal deletion of Alox5 likely serves as a promising therapeutic avenue for epilepsy treatment.

Repetitive seizures in epilepsy often lead to neuron loss and glial pathology [7]. These abnormalities can also increase seizure severity and exacerbate epileptic progression [68], which forms vicious circle between brain pathology and epileptogenesis. It indicates that designation of a therapeutic regiment for simultaneously targeting neuron loss and glial dysfunction may well obviate the detrimental effect of seizures on the brain and/or delay the progression of epilepsy. Our current work demonstrated that Alox5 deletion in hippocampal neuron by CRISPR-Cas9 technology evidently improved neuronal survival in TLE model as Nissl-positive neurons were increased and neurodegeneration was diminished according to FJB staining result in Pilo mouse model when treatment with Alox5-Cas9. In fact, our previous work revealed that pharmacological inhibition of Alox5 by zileuton alleviates neuronal impairment in KA mouse seizure model [10], which altogether support the inhibitory role of neuron loss in epilepsy by blockade of Alox5. Recent study also points towards the contribution of Alox5 phosphorylation at serine 663 residue to ferroptosis process in dopaminergic neuron in Parkinson’s disease mouse model and treatment with an alkaloid (−)-Clausenamide exert a protective effect against this disease [63], which is also partly consistent with our findings. Besides, our present work also demonstrated that astrogliosis in hippocampus, especially CA1 subregion, of TLE model was obviously suppressed by focal Alox5-Cas9 delivery. In agreement with these findings, overexpression of Alox5 in the brain resulted in astrocyte activation and memory deficits in P301S mice, a transgenic mouse model of tauopathy [40]. These observations altogether support that neuron-specific deletion of Alox5 in hippocampus reverses neuron loss and glial pathology in particular astrogliosis in TLE model.

Our work also further explores the potential molecular mechanism underlying the antagonistic effect of Alox5 deletion in hippocampal neuron against epilepsy. There is previous evidence supporting that 12-HPETE, the metabolite of Alox12, reduces the number of synaptic vesicle, leading to inhibition of glutamate release evoked by membrane depolarization from hippocampal mossy fiber synaptosomes [47]. A negative role for Alox12 metabolite in mediating synaptic vesicle secretion is also validated by the results that administration of the lipoxygenase inhibitor nordihydroguaiaretic acid enhances membrane depolarization-induced glutamate release [48]. It suggests that the lipoxygenase product can modulate the neurotransmitter level. Results from our current work illustrated that glutamate level is elevated in Pilo-induced TLE mouse model. However, focal Alox5 sgRNA delivery by CRISPR-Cas9 method significantly reverses these indices, indicating that the anti-epileptic effect by Alox5 gene manipulation is achieved by preventing the increase of glutamate level to restore excitatory/inhibitory (E/I) balance. The contradictory role of the metabolites of Alox5 and Alox12 in modulating glutamate level may be due to different subunits of lipoxygenase and distinct biological settings. It is well established that the neurotransmitter level is tightly manipulated by Syn I phosphorylation. With respect to the modulation of neurotransmitter level by lipoxygenase product, it has been demonstrated that CAMKII-mediated Syn I phosphorylation at serine 603 residue can be diminished by 12-HPETE, which subsequently inhibits glutamate level. There is also prior work supporting that Syn I can be phosphorylated by different kinases at distinct sites: Ser9 by PKA and Ser603 by CAMKII, both of which are critical for synaptic vesicle secretion [49]. It indicates that phosphorylation of Syn I by PKA at Ser9 and CAMKII at Ser603 may play an important role for the biological function of Syn I. Our present study depicted that Alox5 depletion in hippocampal neuron remarkably reduces CAMKII-dependent Syn ISer603 while no obvious effect is observed on serine 9 phosphorylation by PKA in Pilo mouse model. These data support the inhibitory effect on glutamate level by Alox5 genetic manipulation is associated with prevention of CAMKII-mediated phosphorylation of Syn I at serine 603 residue.

Of course, there are some limitations in our current work. First, it is essential to assess the long-term effect of Alox5 gene therapy on epilepsy; Second, as Alox5 are also distributed in other cell types such as glial cells [66], it is theoretically feasible to achieve glia-specific deletion of Alox5 under the control of the promoter of astrocyte (GFAP) or microglia (Cx3cr1). However, whether targeting glial Alox5 can alleviate epileptic symptoms remains unclear; Third, we explored whether neuron-specific deletion of Alox5 can attenuate epilepsy by mediating the neurotransmitter glutamate level, which is only a phenotypical study, and did not further clarify the associated molecular mechanisms.

Conclusions

In summary, our results revealed that neuron-specific deletion of Alox5 by intrahippocampal injection of Alox5-Cas9 virus in TLE mouse models leads to decrease of seizure severity, inhibition of epileptogenesis and amelioration of epilepsy-associated comorbidities especially anxiety, cognitive deficit and autistic-like behavior without undesirable adverse effects. It can also reverse brain pathologies including neuron loss and astrogliosis, which are two major traits of drug-resistant epilepsy. From mechanistic aspect, the antagonistic effect on epilepsy after Alox5 deletion may be linked with decrease of calcium concentration and subsequent blockade of CAMKII-mediated p-Syn ISer603, finally suppressing glutamate level, which alleviates epileptic attacks and disease progression. Genetic inhibition of Alox5 in neuron may therefore offer an alternative therapeutic avenue for TLE, an important type of drug-resistant epilepsy in clinic.

Funding

This work was financially supported by the National Natural Science Foundation of China (Nos. 82274027, 81974502 and 82304637), Postgraduate Scientific Research Innovation Project of Hunan Province (No. CX20220116), Fundamental Research Funds for the Central Universities of Central South University (No. 2022ZZTS0025) and Hunan Provincial Department of Education (No. 22C0678).

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following are the Supplementary data to this article:Supplementary Data 1

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.jare.2024.07.018.
==== Refs
References

1 Stafstrom CE, Carmant L. Seizures and epilepsy: an overview for neuroscientists. Cold Spring Harb Perspect Med 2015;5(6):10.1101/cshperspect.a022426.
2 Devinsky O, Vezzani A, O'Brien TJ, Jette N, Scheffer IE, de Curtis M, et al. Epilepsy. Nat Rev Dis Primers 2018;4(18024. 10.1038/nrdp.2018.24.
3 Pitkänen A. Lukasiuk K. Dudek F.E. Staley K.J. Epileptogenesis Cold Spring Harb Perspect Med 5 2015 10 10.1101/cshperspect.a022822
4 Kwan P. Schachter S.C. Brodie M.J. Drug-resistant epilepsy N Engl J Med 365 10 2011 919 926 10.1056/NEJMra1004418 21899452
5 Varvel NH, Jiang J, Dingledine R. Candidate drug targets for prevention or modification of epilepsy. Annu Rev Pharmacol Toxicol 2015;55(229-247. 10.1146/annurev-pharmtox-010814-124607.
6 Nukala K.M. Lilienthal A.J. Lye S.H. Bassuk A.G. Chtarbanova S. Manak J.R. Downregulation of oxidative stress-mediated glial innate immune response suppresses seizures in a fly epilepsy model Cell Rep 42 1 2023 112004 10.1016/j.celrep.2023.112004
7 Vezzani A. Balosso S. Ravizza T. Neuroinflammatory pathways as treatment targets and biomarkers in epilepsy Nat Rev Neurol 15 8 2019 459 472 10.1038/s41582-019-0217-x 31263255
8 Villasana-Salazar B, Vezzani A. Neuroinflammation microenvironment sharpens seizure circuit. Neurobiol Dis 2023;178(106027. 10.1016/j.nbd.2023.106027.
9 Rådmark O. Werz O. Steinhilber D. Samuelsson B. 5-Lipoxygenase: regulation of expression and enzyme activity Trends Biochem Sci 32 7 2007 332 341 10.1016/j.tibs.2007.06.002 17576065
10 Mao X. Wang X. Jin M. Li Q. Jia J. Li M. Critical involvement of lysyl oxidase in seizure-induced neuronal damage through ERK-Alox5-dependent ferroptosis and its therapeutic implications Acta Pharm Sin B 12 9 2022 3513 3528 10.1016/j.apsb.2022.04.017 36176900
11 You D. Lyn-Cook L.E. Gatti D.M. Bell N. Mayeux P.R. James L.P. Nitrosative Stress and Lipid Homeostasis as a Mechanism for Zileuton Hepatotoxicity and Resistance in Genetically Sensitive Mice Toxicol Sci 175 2 2020 220 235 10.1093/toxsci/kfaa037 32170957
12 Ishino Y. Shinagawa H. Makino K. Amemura M. Nakata A. Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product J Bacteriol 169 12 1987 5429 5433 10.1128/jb.169.12.5429-5433.1987 3316184
13 Jinek M. Chylinski K. Fonfara I. Hauer M. Doudna J.A. Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity Science 337 6096 2012 816 821 10.1126/science.1225829 22745249
14 Cong L. Ran F.A. Cox D. Lin S. Barretto R. Habib N. Multiplex genome engineering using CRISPR/Cas systems Science 339 6121 2013 819 823 10.1126/science.1231143 23287718
15 Hirosawa M. Fujita Y. Parr C.J.C. Hayashi K. Kashida S. Hotta A. Cell-type-specific genome editing with a microRNA-responsive CRISPR-Cas9 switch Nucleic Acids Res 45 13 2017 e118 28525578
16 Miah K.M. Hyde S.C. Gill D.R. Emerging gene therapies for cystic fibrosis Expert Rev Respir Med 13 8 2019 709 725 10.1080/17476348.2019.1634547 31215818
17 Hunker A.C. Soden M.E. Krayushkina D. Heymann G. Awatramani R. Zweifel L.S. Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System Cell Rep 30 12 2020 4303 4316.e4306 10.1016/j.celrep.2020.02.092 32209486
18 Swiech L. Heidenreich M. Banerjee A. Habib N. Li Y. Trombetta J. In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9 Nat Biotechnol 33 1 2015 102 106 10.1038/nbt.3055 25326897
19 Shi J. Xin H. Shao Y. Dai S. Tan N. Li Z. CRISPR-Based KCC2 Upregulation Attenuates Drug-Resistant Seizure in Mouse Models of Epilepsy Ann Neurol 94 1 2023 91 105 10.1002/ana.26656 37014252
20 Atchison R.W. Casto B.C. Hammon W.M. ADENOVIRUS-ASSOCIATED DEFECTIVE VIRUS PARTICLES Science 149 3685 1965 754 756 10.1126/science.149.3685.754 14325163
21 Hoggan M.D. Blacklow N.R. Rowe W.P. Studies of small DNA viruses found in various adenovirus preparations: physical, biological, and immunological characteristics Proc Natl Acad Sci U S A 55 6 1966 1467 1474 10.1073/pnas.55.6.1467 5227666
22 Wang D. Tai P.W.L. Gao G. Adeno-associated virus vector as a platform for gene therapy delivery Nat Rev Drug Discov 18 5 2019 358 378 10.1038/s41573-019-0012-9 30710128
23 Li C. Samulski R.J. Engineering adeno-associated virus vectors for gene therapy Nat Rev Genet 21 4 2020 255 272 10.1038/s41576-019-0205-4 32042148
24 Kotterman MA, Chalberg TW, Schaffer DV. Viral Vectors for Gene Therapy: Translational and Clinical Outlook. Annu Rev Biomed Eng 2015;17(63-89. 10.1146/annurev-bioeng-071813-104938.
25 Mingozzi F. High K.A. Immune responses to AAV vectors: overcoming barriers to successful gene therapy Blood 122 1 2013 23 36 10.1182/blood-2013-01-306647 23596044
26 Yan S. Zheng X. Lin Y. Li C. Liu Z. Li J. Cas9-mediated replacement of expanded CAG repeats in a pig model of Huntington's disease Nat Biomed Eng 7 5 2023 629 646 10.1038/s41551-023-01007-3 36797418
27 Bäck S. Necarsulmer J. Whitaker L.R. Coke L.M. Koivula P. Heathward E.J. Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats Neuron 102 1 2019 105 119.e108 10.1016/j.neuron.2019.01.035 30792150
28 Racine R.J. Modification of seizure activity by electrical stimulation II Motor seizure Electroencephalogr Clin Neurophysiol 32 3 1972 281 294 10.1016/0013-4694(72)90177-0 4110397
29 Zhao J. Zheng Y. Liu K. Chen J. Lai N. Fei F. HMGB1 Is a Therapeutic Target and Biomarker in Diazepam-Refractory Status Epilepticus with Wide Time Window Neurotherapeutics 17 2 2020 710 721 10.1007/s13311-019-00815-3 31802434
30 Chen X. Dong T. Hu Y. De Pace R. Mattera R. Eberhardt K. Intrathecal AAV9/AP4M1 gene therapy for hereditary spastic paraplegia 50 shows safety and efficacy in preclinical studies J Clin Invest 2023
31 Chen X. Wolfe D.A. Bindu D.S. Zhang M. Taskin N. Goertsen D. Functional gene delivery to and across brain vasculature of systemic AAVs with endothelial-specific tropism in rodents and broad tropism in primates Nat Commun 14 1 2023 3345 10.1038/s41467-023-38582-7 37291094
32 Liu C. Wu J. Li M. Gao R. Zhang X. Ye-Lehmann S. Smad7 in the hippocampus contributes to memory impairment in aged mice after anesthesia and surgery J Neuroinflammation 20 1 2023 175 10.1186/s12974-023-02849-z 37507781
33 Wang H.Y. Wu M. Diao J.L. Li J.B. Sun Y.X. Xiao X.Q. Huperzine A ameliorates obesity-related cognitive performance impairments involving neuronal insulin signaling pathway in mice Acta Pharmacol Sin 41 2 2020 145 153 10.1038/s41401-019-0257-1 31213670
34 Mao X. Cao Y. Li X. Yin J. Wang Z. Zhang Y. Baicalein ameliorates cognitive deficits in epilepsy-like tremor rat Neurol Sci 35 8 2014 1261 1268 10.1007/s10072-014-1695-7 24590842
35 Verharen J.P.H. de Jong J.W. Zhu Y. Lammel S. A computational analysis of mouse behavior in the sucrose preference test Nat Commun 14 1 2023 2419 10.1038/s41467-023-38028-0 37105954
36 Patra P.H. Serafeimidou-Pouliou E. Bazelot M. Whalley B.J. Williams C.M. McNeish A.J. Cannabidiol improves survival and behavioural co-morbidities of Dravet syndrome in mice Br J Pharmacol 177 12 2020 2779 2792 10.1111/bph.15003 32321192
37 Li Q. Li Q.Q. Jia J.N. Sun Q.Y. Zhou H.H. Jin W.L. Baicalein Exerts Neuroprotective Effects in FeCl(3)-Induced Posttraumatic Epileptic Seizures via Suppressing Ferroptosis Front Pharmacol 10(638 2019 10.3389/fphar.2019.00638
38 Wu S.H. Li X. Qin D.D. Zhang L.H. Cheng T.L. Chen Z.F. Induction of core symptoms of autism spectrum disorder by in vivo CRISPR/Cas9-based gene editing in the brain of adolescent rhesus monkeys Sci Bull (Beijing) 66 9 2021 937 946 10.1016/j.scib.2020.12.017 36654241
39 Sarnat H.B. Nochlin D. Born D.E. Neuronal nuclear antigen (NeuN): a marker of neuronal maturation in early human fetal nervous system Brain and Development 20 2 1998 88 94 10.1016/s0387-7604(97)00111-3 9545178
40 Vagnozzi A.N. Giannopoulos P.F. Praticò D. Brain 5-lipoxygenase over-expression worsens memory, synaptic integrity, and tau pathology in the P301S mice Aging Cell 17(1):10.1111/acel.12695 2018
41 Bando T. Fujita S. Nagano N. Yoshikawa S. Yamanishi Y. Minami M. Differential usage of COX-1 and COX-2 in prostaglandin production by mast cells and basophils Biochem Biophys Rep 2017 10.1016/j.bbrep.2017.03.004
42 Boileau C. Deforges S. Peret A. Scavarda D. Bartolomei F. Giles A. GluK2 Is a Target for Gene Therapy in Drug-Resistant Temporal Lobe Epilepsy Ann Neurol 2023 10.1002/ana.26723
43 Betjemann J.P. Lowenstein D.H. Status epilepticus in adults Lancet Neurol 14 6 2015 615 624 10.1016/s1474-4422(15)00042-3 25908090
44 Mello L.E. Cavalheiro E.A. Tan A.M. Kupfer W.R. Pretorius J.K. Babb T.L. Circuit mechanisms of seizures in the pilocarpine model of chronic epilepsy: cell loss and mossy fiber sprouting Epilepsia 34 6 1993 985 995 10.1111/j.1528-1157.1993.tb02123.x 7694849
45 Yang Z. Wang K.K. Glial fibrillary acidic protein: from intermediate filament assembly and gliosis to neurobiomarker Trends Neurosci 38 6 2015 364 374 10.1016/j.tins.2015.04.003 25975510
46 Keezer M.R. Sisodiya S.M. Sander J.W. Comorbidities of epilepsy: current concepts and future perspectives Lancet Neurol 15 1 2016 106 115 10.1016/s1474-4422(15)00225-2 26549780
47 Piomelli D. Greengard P. Lipoxygenase metabolites of arachidonic acid in neuronal transmembrane signalling Trends Pharmacol Sci 11 9 1990 367 373 10.1016/0165-6147(90)90182-8 2122564
48 Freeman E.J. Damron D.S. Terrian D.M. Dorman R.V. 12-Lipoxygenase products attenuate the glutamate release and Ca2+ accumulation evoked by depolarization of hippocampal mossy fiber nerve endings J Neurochem 56 3 1991 1079 1082 10.1111/j.1471-4159.1991.tb02032.x 1671585
49 Gitler D. Augustine G.J. Synapsins and Regulation of the Reserve Pool Journal 2009
50 Morel C. Montgomery S.E. Li L. Durand-de Cuttoli R. Teichman E.M. Juarez B. Midbrain projection to the basolateral amygdala encodes anxiety-like but not depression-like behaviors Nat Commun 13 1 2022 1532 10.1038/s41467-022-29155-1 35318315
51 Chen Y.H. Wu J.L. Hu N.Y. Zhuang J.P. Li W.P. Zhang S.R. Distinct projections from the infralimbic cortex exert opposing effects in modulating anxiety and fear J Clin Invest 131(14):10.1172/jci145692 2021
52 Xie L. Wu H. Chen Q. Xu F. Li H. Xu Q. Divergent modulation of pain and anxiety by GABAergic neurons in the ventrolateral periaqueductal gray and dorsal raphe Neuropsychopharmacology 48 10 2023 1509 1519 10.1038/s41386-022-01520-0 36526697
53 Gröticke I. Hoffmann K. Löscher W. Behavioral alterations in the pilocarpine model of temporal lobe epilepsy in mice Exp Neurol 207 2 2007 329 349 10.1016/j.expneurol.2007.06.021 17714705
54 Fernández-García S. Sancho-Balsells A. Longueville S. Hervé D. Gruart A. Delgado-García J.M. Astrocytic BDNF and TrkB regulate severity and neuronal activity in mouse models of temporal lobe epilepsy Cell Death Dis 11 6 2020 411 10.1038/s41419-020-2615-9 32483154
55 Hu H. Zhu T. Gong L. Zhao Y. Shao Y. Li S. Transient receptor potential melastatin 2 contributes to neuroinflammation and negatively regulates cognitive outcomes in a pilocarpine-induced mouse model of epilepsy Int Immunopharmacol 87(106824 2020 10.1016/j.intimp.2020.106824
56 Casalia M.L. Howard M.A. Baraban S.C. Persistent seizure control in epileptic mice transplanted with gamma-aminobutyric acid progenitors Ann Neurol 82 4 2017 530 542 10.1002/ana.25021 28833459
57 Smolensky I.V. Zubareva O.E. Kalemenev S.V. Lavrentyeva V.V. Dyomina A.V. Karepanov A.A. Impairments in cognitive functions and emotional and social behaviors in a rat lithium-pilocarpine model of temporal lobe epilepsy Behav Brain Res 372(112044 2019 10.1016/j.bbr.2019.112044
58 Detour J. Schroeder H. Desor D. Nehlig A. A 5-month period of epilepsy impairs spatial memory, decreases anxiety, but spares object recognition in the lithium-pilocarpine model in adult rats Epilepsia 46 4 2005 499 508 10.1111/j.0013-9580.2005.38704.x 15816943
59 Faure J.B. Akimana G. Carneiro J.E. Cosquer B. Ferrandon A. Geiger K. A comprehensive behavioral evaluation in the lithium-pilocarpine model in rats: effects of carisbamate administration during status epilepticus Epilepsia 54 7 2013 1203 1213 10.1111/epi.12219 23663139
60 Sun Q.Y. Zhou H.H. Mao X.Y. Emerging Roles of 5-Lipoxygenase Phosphorylation in Inflammation and Cell Death Oxid Med Cell Longev 2019(2749173 2019 10.1155/2019/2749173
61 Simmet T. Tippler B. Cysteinyl-leukotriene production during limbic seizures triggered by kainic acid Brain Res 515 1–2 1990 79 86 10.1016/0006-8993(90)90579-z 2357580
62 Song S. Su Z. Kon N. Chu B. Li H. Jiang X. ALOX5-mediated ferroptosis acts as a distinct cell death pathway upon oxidative stress in Huntington's disease Genes Dev 37 5–6 2023 204 217 10.1101/gad.350211.122 36921996
63 Li K. Wang M. Huang Z.H. Wang M. Sun W.Y. Kurihara H. ALOX5 inhibition protects against dopaminergic neurons undergoing ferroptosis Pharmacol Res 193 2023 10.1016/j.phrs.2023.106779
64 Baran H. Vass K. Lassmann H. Hornykiewicz O. The cyclooxygenase and lipoxygenase inhibitor BW755C protects rats against kainic acid-induced seizures and neurotoxicity Brain Res 646 2 1994 201 206 10.1016/0006-8993(94)90078-7 8069664
65 Watkins P.B. Dube L.M. Walton-Bowen K. Cameron C.M. Kasten L.E. Clinical pattern of zileuton-associated liver injury: results of a 12-month study in patients with chronic asthma Drug Saf 30 9 2007 805 815 10.2165/00002018-200730090-00006 17722971
66 Yan M. Zhang S. Li C. Liu Y. Zhao J. Wang Y. 5-Lipoxygenase as an emerging target against age-related brain disorders Ageing Res Rev 69 2021 10.1016/j.arr.2021.101359
67 Tang J. Zhang C. Lin J. Duan P. Long J. Zhu H. ALOX5-5-HETE promotes gastric cancer growth and alleviates chemotherapy toxicity via MEK/ERK activation Cancer Med 10 15 2021 5246 5255 10.1002/cam4.4066 34121352
68 Zhang X. Cui S.S. Wallace A.E. Hannesson D.K. Schmued L.C. Saucier D.M. Relations between brain pathology and temporal lobe epilepsy J Neurosci 22 14 2002 6052 6061 10.1523/jneurosci.22-14-06052.2002 12122066
