
==== Front
Sci Data
Sci Data
Scientific Data
2052-4463
Nature Publishing Group UK London

3715
10.1038/s41597-024-03715-0
Analysis
An integrated analysis of multiple datasets reveals novel gene signatures in human granulosa cells
Dhori Xhulio 12
http://orcid.org/0000-0003-1302-8320
Gioiosa Silvia s.gioiosa@cineca.it

1
http://orcid.org/0000-0002-9392-4258
Gonfloni Stefania sgonf14@gmail.com

2
1 https://ror.org/02f013h18 grid.431603.3 CINECA, Super Computing Applications and Innovation Department, Via dei Tizii 6B, 000185 Roma, Italy
2 grid.7841.a Department of Biology, University of Roma, via della Ricerca Scientifica 00133, Roma, Italy
6 9 2024
6 9 2024
2024
11 9725 1 2024
1 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Granulosa cells (GCs) play crucial roles in oocyte maturation. Through gap junctions and extracellular vesicles, they mediate the exchange of molecules such as microRNAs and messenger RNAs. Different ovarian cell types exhibit unique gene expression profiles, reflecting their specialized functions and stages. By combining RNA-seq data from various cell types forming the follicle, we aimed at capturing a wide range of expression patterns, offering insights into the functional diversity and complexity of the transcriptome regulation across GCs. Herein, we performed an integrated bioinformatics analysis of RNA sequencing datasets present in public databases, with a unique and standardized workflow., By combining the data from different studies, we successfully increased the robustness and reliability of our findings and discovered novel genes, miRNAs, and signaling pathways associated with GCs function and oocyte maturation. Moreover, our results provide a valuable resource for further wet-lab research on GCs biology and their impact on oocyte development and competence.

Subject terms

Reproductive biology
RNA sequencing
Cell signalling
RSA_2021issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Ovarian follicles are the functional units of the ovary. Within the follicle, the bidirectional signaling between somatic cells and the oocyte changes continuously over time to synchronize follicle development and oocyte maturation. Integrated signaling cascades coordinate oocyte maturation, regulating GC proliferation and theca cell differentiation1. Yet, the function and the roles of distinct types of intercellular communications remain poorly clarified. Follicle maturation is a complex dynamic process, tightly controlled through autocrine and paracrine regulatory factors produced principally by theca, granulosa cells and oocytes. In addition, it is controlled by hormones (from the hypothalamic-pituitary-ovarian axis, including pituitary –derived FSH, LH) and steroids secreted by the ovary. GCs play an essential role during oocyte maturation, providing an optimal microenvironment for follicle development2–4. Two major cell types of GCs, named mural and cumulus, surround respectively the follicular antrum and the oocyte. Mural granulosa cells (MGCs), have an endocrine function and promote follicle growth, whereas cumulus cells (CCs) support oocyte maturation and provide essential metabolic and signaling functions5,6. Although MGCs and CCs are closely related granulosa cell types, differences in their function and gene expression profile5 suggest that these significant changes, in gene expression, coordinate the follicle maturation7.

As the oocyte competence is acquired only through bidirectional communication with GCs2, the closely surrounding CCs constitute an attractive biological material for all the molecular analyses finalized to infer on the developmental abilities of the oocyte. This implies that CCs transcriptomic profiling may serve to identify biomarkers for predicting oocyte quality8. Several studies have described gene expression of CCs (matured either in vivo or in vitro) in cumulus-oocyte complex (COC)9 or derived from pre-ovulatory follicles exposed to human chorionic gonadotrophin (hCG)5,10,11.

For example, Yerushalmi et al. (PRJNA216966)12 have reported transcriptional differences between CCs derived from mid-antral follicles (compact cumulus cells) and expanded CCs from metaphase 2 (M2) COC, identifying 1746 Differentially Expressed Genes (DEGs). In addition, they found 89 Differentially Expressed (DE) long noncoding RNAs, a few of them encoded within introns of genes required for GC function. For what concerns transcriptional gene expression profiles within COC, Li et al. (PRJNA649934)13 performed RNA-seq experiments to investigate the transcription gene profile of CCs and Oocytes derived from the same Polycystic Ovary syndrome (PCOS) patient or from age-matched controls. In PCOS oocyte, they found an altered expression of some genes involved in Microtubule-based processes13. Overall, global gene expression in CCs and in oocytes from PCOS patients showed imbalance in other essential signalling pathways underlying Mitochondrial Function and Oxidative Stress.

MicroRNAs (miRNAs) modulate gene expression post-transcriptionally, yet their expression and function within the GC populations remain poorly investigated. Recent reports described and studied the miRNA profile of MGCs and CCs isolated from human pre-ovulatory follicles from healthy women undergoing ovum pick up for in vitro fertilization (IVF). Velthut-Meikas et al. (PRJNA200696)14 found 90 miRNAs differently expressed between CGCs and MGCs, [2 among them were of intronic origin]. In MGCs, some of the DE miRNAs-targets specifically act on extracellular matrix remodeling, Wnt/beta-catenin and Neurotrophin signaling pathways.

A more recent study by Andrei et al. (PRJNA417973)15 reported the miRNA expression profile of human primary MGCs and CCs, in vitro cultured. In this study, the authors found 53 miRNAs differentially expressed between MGCs and CCs, whose targets are enriched in Ubiquitin-like Protein Conjugation genes. Interestingly, the two studies showed a limited overlap in terms of DE miRNAs, mostly because of differences in data analysis strategy.

Nevertheless, the overview of the published studies describing CCs’ transcriptome has provided an extremely limited consensus of “signatures”.

Conversely, by combining RNA-seq data from various cell types, we can capture a wide range of expression patterns, offering insights into the functional diversity and complexity of the transcriptome expression and regulation across the GCs, Secondly, comparative transcriptional profiling of CCs derived from immature or mature COC would help identifying genes that are expressed in the final stages of follicle maturation.

Through a survey of publicly available transcriptomics datasets, we re-analysed the raw RNA-seq data from different “sources”: two GC subpopulations, two CCs samples derived from mature and immature COCs, and from CCs and the oocyte. The original studies laid a solid foundation, but we saw an opportunity to delve deeper, asking new questions that bring out the latent possibilities within these datasets. Thereby, we also focused on Differential Alternative Splicing (DAS) analysis of CCs transcripts, to get insights into alternative splicing events occurring during follicle maturation. By revisiting and reinterpreting the data, we aimed to uncover additional layers of biological insight, providing a richer and more nuanced understanding of the biological landscapes under study. This approach not only maximizes the value of the existing data but also opens new avenues for discovery and innovation, such as the prediction of some biomarkers for measuring the oocyte competence and reproductive potential.

Results

We selected a cohort of samples according to inclusion criteria detailed under the Methods section. The final core dataset consists of 51 samples, (30 miRNAs samples and 21 mRNAs) for a total of 98,82 GB of input data (Table 1, Supplementary Table 1). Raw data from the selected BioProjects were downloaded from Sequence Read Archive (SRA)16 and individually reanalyzed applying the same bioinformatics pipeline depicted in Fig. 1.Table 1 The table shows the main characteristics of each BioProject, including the platform used for coding and non-coding RNA-sequencing, the reference paper and the type of cells analysed.

mRNA Datasets	
BioProject	Article reference	Instrument	Source name	Treatment	
PRJNA216966	Characterization of the human cumulus cell transcriptome during final follicular maturation and ovulation12	HiSeq 2000	Cumulus granulosa GV/M2	Cumulus Cells from Germinal vesicles unstimulated cumulus-oocyte-complex (COC) and from M2 cumulus of expanded/stimulated COC	
PRJNA649934	Molecular Features of PCOS by Transcriptome Analysis of Oocytes and Cumulus Cells13	HiSeq XTen	oocyte/cumulus	non-PCOS controlled ovarian stimulation using the GnRH antagonist protocols	
PRJNA200696	Small RNA-seq of Human Granulosa Cells Reveals miRNAs in FSHR and Aromatase Genes14	HiSeq 2000	preovulatory cumulus and mural granulosa cells	Stimulation protocol: GnRH antagonist, rFSH, hCG	
Small RNA Datasets	
PRJNA417973	Differential miRNA Expression Profiles in Cumulus and Mural Granulosa Cells from Human Pre-ovulatory Follicles15	NextSeq 500	Cumulus and Mural Granulosa Cells		
PRJNA200699	Small RNA-seq of Human Granulosa Cells Reveals miRNAs in FSHR and Aromatase Genes14	Genome Analyzer IIx	preovulatory Cumulus and Mural granulosa cells	Stimulation protocol: GnRH antagonist, rFSH, hCG	

Fig. 1 Workflow diagram of the RNA-seq analysis. Overview of the data analysis pipeline. The pipeline begins with the acquisition of raw reads in FASTQ format. These reads are then assessed for quality using the FastQC program. Terminal low-quality bases and adapter sequences are subsequently trimmed off. Mapped files in BAM format are then generated from the processed reads and raw read counts are quantified. The pipeline proceeds with differential gene expression analysis. The resulting differentially expressed genes (DEGs) are analysed for Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment. Starting from BAM input files, the pipeline also includes a parallel branch analysis for identifying Differential Alternative Spliced Genes (DAS), enriched by a splicing events distribution analysis and a GO- and KEGG- enrichment analysis for DAS. Finally, miRNA analysis is conducted as part of the small-RNA seq process. This comprehensive pipeline provides a robust approach to RNA-Seq data analysis, from raw reads to functional insights..

In the present study, three RNA-sequencing datasets from GCs were reanalyzed to identify DEGs (Differentially Expressed Genes) and DAS (Differentially Alternatively Spliced Genes). In addition, to evaluate the miRNAs profile of granulosa cells we re-analyzed and integrated two further Bioprojects treating small-RNASeq data (Table 1).

Results

Actin-binding proteins (ABPs) play crucial roles in granulosa cell function and oocyte maturation

For cumulus cells, three different bioprojects were analyzed for Gene Expression Analysis (Table 1).

Firstly, in PRJNA216966, we identified 3093 DEGs, nearly double the number of DEGs previously reported12, with 1662 genes up-regulated and 1431 down-regulated in Germinal Vesicle stage CC compared to M2-expanded CCs (Supplementaty Fig. 1a,b).

Secondly, in PRJNA200696, 2242 DEGs were identified, consisting of 1201 up-regulated and 1041 down-regulated genes in CCs compared to MGCs (Supplementaty Fig. 2a,b).

Lastly, in PRJNA649934, the differential expression analysis detected 7253 DEGs, with 3609 genes up-regulated and 3644 down-regulated in Oocytes compared to CCs (Supplementaty Fig. 3a,b).

As a first step, an intra-Bioproject functional enrichment analysis was performed. This approach ensured that the biological context of each specific dataset was considered independently, minimizing the potential confounding effects of combining disparate conditions. Supplementary figures illustrate these analyses (Fig S1 1c, 1d, S2 2c, 2d, S3c, 3d).

Beyond the individual project re-analysis, we performed a comparative analysis to understand the distribution of DEGs across different cell types, including cumulus cells, oocytes, and mural cells. This comparative approach was carefully designed to highlight both the unique and the shared pathways/biological processes among the different cell types. This approach helped us identify critical pathways and mechanisms that might be overlooked if we only focused on one direction of gene regulation.

Therefore, an inter-bioprojects comparison of functional profiles was executed to gain insights into the biological roles of DEGs emerging from the three BioProjects. By including both up- and down-regulated genes in the gene set enrichment analysis, we could better understand how these regulatory changes impact the biological functions and communication networks essential for follicle development. This analysis allowed us both to find a functional consensus and, at the same time, to highlight any differential functional module specific for each data set (Fig. 2a).Fig. 2 Analysis and comparison of enriched GO terms for DEGs. (a) Dotplot shows enriched GO terms over the 3 BioProjects, highlighting the first twelve most significantly over-represented GO terms in biological processes. The x-axis reports the Bioproject name and the n. of DEGs involved in those GO processes reported in parenthesis. The y-axis shows significantly enriched GO terms. The size of each dot indicates the number of genes associated with that GO term in the respective cluster (gene count). The color scale represents the adjusted p-value, with darker colors indicating higher statistical significance. Only GO terms with an adjusted p-value < 0.05 are shown. (b) Upset plot of the intersection of DEGs across BioProjects. The horizontal bar graph on the left shows the total number of DEGs for each BioProject. The upper black bar graphs show the number of DEGs for each overlapping combination and black connected dots indicate which BioProjects are involved in each intersection. Plot shows the number of shared DEGs among 3 Bioprojects (n = 236, herein defined as “core set”), among at least two BioProjects (n = 390, 521 and 1229) and BioProject-specific (n = 1095, 1236 and 5267). (c) PPI network of the core set of 236 shared DEGs. The network nodes represent proteins. Colored nodes highlighted in red (n = 160) are proteins known to be involved in “Alternative splicing” with a great statistical significance (p-adj < 0.05).

The functional consensus analysis highlighted “Actin binding” as the GO Term shared among all comparisons, while the other GO Terms are more BioProject-specific or denote CC-specific GO Terms. Of note, CCs collected at two different developmental stages (GV-M2 CCs) are placed along a middle ground between pre-ovulatory CCs vs MCGs and expanded CCs vs Oocyte (Fig. 2a).

To further elucidate the gene expression patterns within different cell types, we examined the distribution of up-regulated genes (Fig. S4), which advised our subsequent focus on CCs. Therefore, we performed a functional enrichment analysis solely on genes that were up regulated in CCs (taken at different stages of follicle maturation) and results are reported in Fig. S5. This targeted approach ensured the functional analysis to be cumulus-specific, without contamination from markers of mural GCs or oocytes. Results of this more focused analysis highlighted roughly the same enriched categories, like “actin binding” and different terms related to cell-cell communication and metabolic activity, which are known to be critical in CC function and oocyte maturation. Additionally, we identified both shared and unique pathways across different stages of cumulus cell development.

PPI analysis reveals a coreset of 236 DEGs potentially involved in alternative splicing processes

We were also interested in using a complementary approach to GO-enrichment analysis for finding a consensus list of proteins which could be key interactors and regulators of different developmental stages of CCs. As shown in the upset plot in Fig. 2b, there is a coreset of 236 DEGs shared by the three Bioprojects (Fig. 2b, first bar in the upset plot; the whole list of overlappings is supplied17.

To this end, we used STRING database18 which focuses on experimentally validated and literature-derived protein-protein interactions. It provides insights into how proteins interact and form functional complexes, highlighting biological processes and pathways that might not be as apparent in GO analysis. Intriguingly, by applying a PPI (Protein-Protein Interaction) network analysis on the core set, the “Alternative Splicing” pattern resulted enormously enriched with an FDR of 9.96e-05 (Fig. 2c, red nodes) thus suggesting that, besides individual peculiarities of each Bioproject, these 236 DEGs could have strong consequences on Alternative splicing variations in GCs.

Unraveling the impact of alternative splicing events on transcription regulators

Previous analyses of RNA-seq data in GCs subpopulations have largely focused on gene expression rather than alternative splicing. Nevertheless, the results obtained in our PPI analysis strongly encouraged us to investigate the extent to which alternative splicing contributes to transcriptomic variation between each data subsets.

In CCs from the GV cumulus-oocyte-complexes (COCs) and from the M2 expanded COCs (PRJNA216966), Differential Alternative Splicing analysis identified 1402 DAS (Supplementary Table 2), including 104 transcription factors (TFs).

In pre-ovulatory follicles, (CCs vs MCGs) (PRJNA200696), we identified 378 DAS events (Supplementary Table 2), involving 45 TFs. In stimulated vs unstimulated CCs (PRJNA649934), we detected 924 DAS events (Supplementary Table 2), 72 of which are TFs.

Regarding the splicing event distribution of each Bioproject (Fig. 3a), we found more similarity between PRJNA200696 and PRJNA216966, probably because both bioprojects share as source the same granulosa cells type. Particularly, Intron Retention (IR) and Multiple Exon Skipping (MES) events seem to have a great role in AS events occurring in GCs. Conversely, in PRJNA649934 we found a greater enrichment in terms of Alternative Last Exons (ALE).Fig. 3 Analysis of splicing event distribution and comparison of enriched GO terms and KEGGs for DAS. (a) Splicing distribution events over the DAS detected in the three mRNA bioprojects showing cumulative percentage in the histogram. The categories are: IR (Intron Retention); ALE/AFE (Alternative Last/First Exon); MES (Multiple Exon skipping); MXE (Mutually Exclusive Exons); alt3′ (alternative 3′ exon); alt5′ (alternative 5′ exon). (b) A dotplot that shows the common enriched GO terms for DAS in the three bioprojects. The x-axis represents different CC clusters, while the y-axis shows significantly enriched GO terms. The size of each dot indicates the number of genes associated with that GO term in the respective cluster (gene count). The color scale represents the adjusted p-value, with darker colors indicating higher statistical significance. Only GO terms with an adjusted p-value < 0.05 are shown. (c) The cnet-plot shows common GO Terms and highlights the identity of the DAS that contributes to the enrichment of that specific category. (d) The cnet-plot shows common KEGG Pathways and highlights the identity of the DAS that contributes to the enrichment of that specific category.

As consequence, a cluster comparison of Gene Ontology and KEGG enrichment analysis of the DAS lists shows greater similarities between PRJNA200696 and PRJNA216966, while PRJNA649934 has specific enriched GO terms (Supplementary Table 3). In pre-ovulatory follicles, CCs versus MCGs, and in stimulated versus unstimulated CCs, alternative splicing affects genes involved in “retinoic acid receptor binding” (GO:0042974), “nuclear hormone receptor binding” (GO:0035257) (Fig. 3b,c) and “Ubiquitin mediated proteolysis” (hsa04120) Kegg pathways (Fig. 3d).

On the other hand, “Cadherin binding” GO term results strongly enriched for DAS in Cumulus Cells from GV cumulus-oocyte-complex (COC) and from M2 expanded COC and in stimulated versus unstimulated CCs (Fig. 3b,c).

Specific pathways uniquely enriched in PRJNA216966, are “Ubiquitin binding”, “DNA-binding transcription factor binding” and “RNA polymerase II-specific DNA-binding transcription factor binding” (Fig. 3b). Therefore, given the high impact that this last category of DAS (n = 104) could have on transcription, we analyzed in greater detail the expression of downstream targets. By applying a GO enrichment analysis over the DEGs targeted by the 104 TF-DAS, we found some terms in common with the ontological DEGs analysis (GO:0001816 cytokine production, GO:0030155, regulation of cell adhesion) and intriguingly some unique terms like “female sex differentiation” (GO:0046660), “ovarian follicle development” (GO:0001541) and “reproductive structure development” (GO:0048608).

Given the impact on transcription highlighted in Fig. 3c, we wondered whether we could observe significant changes in terms of log2FC on the target genes of DAS Transcription Regulators. Although we have found some cases in which DAS Transcription Regulators seemed to have an effect over the cumulative gene expression of its target genes (Suppl. Figure 6a), our analysis pointed out that Differential Splicing of TFs may not be the only event to determine effects on downstream transcription.

Nevertheless, to identify potentially interesting genes for future studies, we used the VOILA web-based application to focus our attention on the AS events affecting some TFs which resulted interesting from the Supplementary Fig. 6a. We observed that many DAS events fall in regions transcribing functional protein domains associated with epigenetic modifications, notably histone modification.

We performed an additional GO enrichment analysis on DEG targets of DAS Transcription Factors for each Bioproject.

Interestingly we found “Transcription coregulator activity” and “Transcription factor binding” largely enriched in PRJNA216966 in Fig. 3c. Alternative splicing is a fine-tuning regulatory mechanism that can vary significantly between similar cell types or different maturation stages. In fact, in the previously mentioned dataset comparing cumulus cells at GV (germinal vesicle) and M2 (metaphase II) stages, we found numerous GO terms related to key processes such as “ovarian follicle development,” “response to follicle-stimulating hormone,” and different terms related to cell differentiation (Fig. S6b). These findings highlight the role of alternative splicing in regulating the genes involved in these critical biological processes and the importance of transcription regulators in orchestrating the complex events leading to ovulation. Enrichment results of the PRJNA200696 and PRJNA649934 are shown in Figure S6c,d. Among the DAS-TFs found in PRJNA216966, [CCs in two developmental stages, GV-M2], GATA4 (GATA Binding Protein 4), GATA6 (GATA Binding Protein 6), NR5A1 (nuclear receptor subfamily 5 group A member 1), NR5A2 (nuclear receptor subfamily 5 group A member 2), all these TFs play a crucial role in follicle maturation (Fig. 4).Fig. 4 Splicegraph analysis and dPSI of functional splicing events occurring in transcriptional regulators in PRJNA216966. Each plot provides a visual representation of a splicegraph along with the differential Percent Spliced In (dPSI) values for a specific splice junction. The plot emphasizes splice junctions exhibiting significant dPSI values, with annotations indicating their associated biological functions within the highlighted region. The splice graph is a directed acyclic graph representing alternative splicing events in a gene. It illustrates connections between exons and introns: exons are denoted by numbered nodes enclosed in boxes, while intron retention events are represented by smaller boxes lacking numerical labels. Raw read counts for each specific splicing event are displayed on both nodes and edges. At the top of each plot, the genomic coordinates of the splicing junctions are indicated. At the bottom of the plot, a violin plot is presented, illustrating the distribution of differential Percent Spliced In (dPSI) values associated with the highlighted junction. The width of the violin plot conveys the probability density of different dPSI values, offering insights into the variability of splicing patterns. (a) GATA6. (b) GATA4. (c) NR5A1. (d) NR5A2.

miRNA DE analysis reveals a core set of 12 DEMs which may influence cell cycle progression and nucleic acids metabolism

Both the bioprojects (PRJNA417973; PRJNA200699) have investigated the miRNA transcriptome landscape of CCs and MGCs. This allowed us to make an integrated complete comparison for searching either meta-signatures of differentially expressed miRNAs (DEMs) or common DEMs to use for GO and KEGG enrichment analysis.

In detail, the analysis of PRJNA417973 highlighted 46 DEMs, half of which (23) up-regulated and the other half down-regulated (Fig. 5a); while in PRJNA200699 we found more DEMs in CCs compared to MCs: 82 DEMs (Fig. 5b), 48 among them up-regulated and 34 down-regulated.Fig. 5 PRJNA200699 and PRJNA417973 small RNA-seq analysis. (a) Heatmap of differential expressed miRNAs in PRJNA200699. (b) Heatmap of differential expressed miRNAs in PRJNA417973. (c) Venn diagram illustrating miRNAs that have the same expression pattern between the two bioprojects (intersection, herein indicated as DEM-core set, n = 12) and Bioproject-specific DEMs. (d) Common enriched GO terms over the target DEGs of DEM-core set. (e) PRJNA200699 network shows DEM-core set and targets which are differentially expressed. Spheres represent miRNAs colored by log2FC, from red up-regulation to blue down-regulation.

Intersecting the two lists of DEMs, we found 12 common DEMs which interestingly share the same pattern of expression, unveiling cell type specific “signatures”. In MGCs hsa-miR-30a-5p, hsa-miR-30a-3p, hsa-miR-142-5p, hsa-miR-148a-3p, hsa-miR-10b-5p, hsa-miR-144-5p and hsa-miR-146a-5p are up-regulated while hsa-miR-92a-1-5p, hsa-miR-145-5p, hsa-miR-149-5p, hsa-miR-129-5p and hsa-miR-196a-5p are all up-regulated in CCs.

Since the pattern of expression was extremely coherent in the two granulosa cell types, we exerted a GO enrichment analysis over the predicted target genes of the 12 shared DEMs to enlighten downstream pathways modulated by such miRNA core set within the two GC populations. The GO analysis highlighted common enriched GO-terms with statistical significance, first among them, “histone modification (GO:0016570)”, “regulation of mRNA metabolic process (GO:1903311)”, “regulation of DNA metabolic process (GO:0051052)”, “regulation of translation (GO:0006417)”, “response to decreased oxygen (GO:0036293)”, “mitotic cell cycle phase transition (GO:)”(Fig. 5d).

Moreover, access to an independent gene expression dataset (PRJNA200696) that compares mural and cumulus cells provided a significant advantage in our analysis. This dataset enabled direct evaluation and validation of whether the pathways regulated by miRNA in cumulus and mural cells do exhibit corresponding changes at the mRNA level. Our analysis revealed a significant overlap in Gene Ontology (GO) terms between the targets of the identified miRNAs and the mRNA expression data from the independent dataset (Fig. S8) thus indicating that the pathways regulated by these miRNAs in cumulus and mural cells are also reflected at the mRNA level in the independent dataset.

To further elucidate the regulatory network of miRNAs and their target genes, we constructed a miRNA-mRNA interaction network based on our differential expression analyses results (Fig. 5e). The resulting network was visualized using the Fruchterman-Reingold algorithm, a force-directed layout that positions nodes based on their connections. In this visualization, miRNA positioning reflects the number of edges (target connections), with more centrally located miRNAs typically having a higher number of target mRNAs. Notably, neighboring miRNAs in the network tend to share more common mRNA targets, suggesting potential co-regulatory relationships. This network approach allowed us to identify key miRNA regulators, based on their connectivity, and to discern patterns of miRNA-mRNA interactions that may be biologically relevant to our experimental conditions.

Discussion

Our study investigates various cell types under their physiological conditions, with a particular focus on the interactions between mural/cumulus cells and the oocyte within the follicle. These cells communicate to coordinate follicle maturation and other essential processes. Consequently, we examined the entire follicle system, analyzing  how genes are upregulated or downregulated within these cells, ultimately contributing to key biological processes involved in follicle maturation.

To identify specific signatures associated with each granulosa cell type, we reanalyzed raw data obtained from several selected publicly available bioprojects using a standardized transcriptomic computational workflow. We aimed to analyze different datasets to gain insights into the enrichment of differentially expressed genes between human MGCs and CCs from distinct stages [in the Germinal Vesicle stage cumulus cells (GV-CCs) compared to the M2 expanded cumulus cells (M2-CCs) and the oocyte compared to the CCs].

After obtaining the list of DEGs specific for each Bioproject, a biological theme comparison was used to compare functional profiles from different conditions. Our rationale for including both up- and down-regulated genes in the GO enrichment analysis was to capture a comprehensive view of the regulatory mechanisms at play which could be crucial for the maturation and function of the follicle. Up-regulated genes can indicate processes that are being promoted or activated, while down-regulated genes can indicate processes that are being repressed or modulated.However, many processes are more complex than that: up and down regulated genes can participate in the same process simultaneously. Together, they provide a holistic picture of the cellular environment and the interactions between different cell types within the follicle.

Results indicate that the functional consensus module “Actin binding” is the GO-Term shared among all comparisons. To address the concern about potential cross-contamination from other cell types, we also focused exclusively on up-regulated genes in cumulus cells and conducted a thorough functional enrichment analysis (Fig. S5). “Actin Binding” was correctly remarked in this analysis as well, thus ensuring that the functional relevance of our results can be accurately attributed to cumulus cells. Remarkably, actin filaments are involved in multiple cellular processes such as cytoskeleton organization, nuclear positioning, germinal vesicle breakdown, spindle migration, chromosome segregation and polar body extrusion in oocyte mammalian meiosis19.

ABPs modulate the polymerization and depolymerization of actin filaments, thereby controlling the structure and dynamics of the actin cytoskeleton, and the secretory and endocytic pathway20. This regulation is vital for maintaining the structural integrity and shape of granulosa cells and oocytes21. Furthermore, during folliculogenesis, the development of ovarian follicles, granulosa cells proliferate and differentiate. ABPs help in remodeling the actin cytoskeleton, which is necessary for the migration, proliferation, and differentiation of granulosa cells, thus supporting follicle development22.

ABPs are involved in the formation and maintenance of gap junctions, ensuring proper signaling between GCs and oocytes. At the same time, the secretion of signaling molecules ensures nutrient exchange, which is critical for oocyte growth and maturation1.

MGCs, when stimulated to differentiate through FSH and insulin-like growth factors23,24, are involved in the endocrine function necessary for supporting the development of the follicle.

Notably, our comparative analysis of DEGs from pre-ovulatory MGCs vs CCs (Supplementary Fig. 2c,d) has highlighted the following GO terms: “extracellular matrix structural constituent”, “extracellular matrix binding”, “glycosaminoglycan binding” and “collagen binding”17. This comparison reveals a clear correlation between these DEGs and the physiological events underlying the follicle maturation.

The extracellular matrix (ECM) plays a critical role in mammalian ovarian function and oogenesis25–28, while the MGCs line the antrum, the CCs surround the oocyte, being regulated by oocyte secreted factors (OSFs)29. In the pre-ovulatory follicle maturation process, CCs produce hyaluronic acid that is deposited into the extracellular matrix and later stabilized by secreted proteins30,31. This newly formed ECM connects the oocyte and cumulus cells together. The growing oocyte then derives most of its substrates for energy metabolism and biosynthesis from the surrounding CCs32,33.

Gap junctions transmit metabolites, nutrients, and intracellular signalling molecules and all the OSFs that are required for the expansion of CCs34. In turn, CCs synchronize nuclear and cytoplasm maturation of the oocyte and regulate meiosis resumption by providing many factors and regulatory molecules to oocytes34. Cumulus expansion is an important aspect in the final steps of follicle maturation, which culminates in the formation of a mature cumulus-oocyte complex arrested at the metaphase of the second meiotic division (M2) and ready for ovulation and its subsequent fertilization35.

Among the key factors that affect the “oocyte competence” are the cytoplasmic synthesis/degradation of maternal mRNA together with an ordered distribution of organelles36–39. The outcome of both processes affects fertilization and embryonic development1,40–44. Abnormal mitochondrial rearrangement impairs the oocyte quality and maturation and chromosomal separation during meiosis45,46. Cytoplasmic oocyte development also includes maturation of cortical granules47,48 (membranous organelles derived from Golgi complexes) and cytoskeleton (microtubules and microfilaments network49) as well as of the endoplasmic reticulum (ER), the latter being responsible for the storage and release of free calcium, essential for the calcium reaction at fertilization50,51. Compelling evidence indicates that Actin, Microtubule and Organelle Dynamics as well as Golgi distribution are fundamental for oocyte maturation52,53. By comparing GV oocyte-vs-CCs and CCs GV-vs-M2, we found the following enriched GO terms “Microtubule binding”, “tubulin binding”, “catalytic activity, acting on DNA”. Conversely, GO terms like “histone binding”, and “transcription co-regulator activity” were enriched only when comparing GV_Oocyte versus CCs. The GO term “histone binding” points out that epigenetic modifications play important roles following meiotic maturation of mammalian oocytes54.

In our search for key regulators of different developmental stages in CCs, we identified a core set of 236 DEGs, shared by the three Bioprojects.

We are aware that much of the complexity within cells arises from functional and regulatory interactions among proteins, therefore we wanted to conduct a complementary approach to GO-term analysis, namely the Protein-Protein Interaction (PPI) analysis. Interestingly, PPI network analysis of the core set indicates that the “Alternative Splicing” pattern resulted  in being significantly enriched. We investigated the extent to which alternative splicing contributes to transcriptomic differences within all data sets.

To this end, we used the STRING database which focuses on experimentally validated and literature-derived protein-protein interactions. It provides insights into how proteins interact and form functional complexes, highlighting biological processes and pathways that might not be as apparent in GO analysis. The enrichment of “alternative splicing” term in STRING might indicate that the proteins involved in this process are highly interconnected and functionally significant within the shared coreset of 236 DEGs because many proteins interact directly in this process.

On the other hand, the solely GO enrichment analysis was not able to capture this important feature, probably because while it provides a broad view of functional categories, it might not always capture specific processes if they are not the main factor distinguishing these clusters.

Because of this result, we were strongly encouraged to perform a Differential Alternative Splicing (DAS) analysis on these data, which is something that none of the authors of the three Bioprojects have investigated in their published papers.

Regarding the DAS analysis we first wanted to describe the overall splicing changes in the three datasets, categorizing them into 8 categories and reporting cumulative frequencies. We observed a similar splicing event distribution when comparing the two bioprojects (PRJNA200696 and PRJNA216966), both based on a common granulosa cells source. In contrast, DAS events, in PRJNA649934, reveal a greater enrichment in terms of Alternative Last Exons (ALE) and, at the same time, a lower percentage of Mutually Exclusive Exons and Intron Retention events (IR). This observation could be linked to the mechanisms by which maternal mRNAs are stored in oocytes and gradually consumed with initiation of meiotic resumption. Alternative 3′ UTR isoforms enable inclusion or exclusion of cis-regulatory elements either for RNA binding proteins or microRNAs that can influence transcript abundance, stability, subcellular localization, and translation efficiency55. A large amount of maternal mRNA exists in mature oocytes at the GV stage although as dormant transcripts until meiotic maturation56,57. Compelling evidence supports the existence of stringent mRNA stabilizing mechanisms within GV-Oocytes, while the selective degradation of maternal mRNA is required for the activation of zygotic genome39,58. Regulation of maternal mRNA translation and degradation occurs during oocyte maturation and such events are essential for the oocyte competence necessary to accomplish maternal zygotic transition36,59. In maturing oocytes, cytoplasmic polyadenylation of the 3′-UTR is linked to mRNA stability and mRNA translation60. As such, we analyzed DAS events involving transcription regulators, including NR5A1, NR5A2, GATA4 and GATA6, and found that they affect domains of such TFs associated with epigenetic modification (i.e. histone modification). We have used differentially alternative spliced transcription factors (DAS-TFs) and their targets, which are differentially expressed genes (DEGs) within each dataset, for GO enrichment analysis. Our analysis revealed that many of the enriched GO terms are directly related to follicle development. The analysis was conducted on each individual dataset. This approach was necessary because alternative splicing is a fine-tuning regulatory mechanism that can vary significantly between similar cell types or different maturation stages. In fact, in our dataset comparing cumulus cells at GV (germinal vesicle) and M2 (metaphase II) stages, we found numerous GO terms related to key processes such as “ovarian follicle development,” “response to follicle-stimulating hormone,” and different terms related to cell differentiation. These findings highlight the role of alternative splicing in regulating the genes involved in these critical biological processes and the importance of transcription regulators in orchestrating the complex events leading to ovulation. Among the DAS-TFs, comparing cumulus cells at two developmental stages (GV_M2), we found GATA4, GATA6, NR5A1, NR5A2 (see Fig. 4). Compelling evidence indicates that GATA4 and GATA6 play a crucial role in folliculogenesis61. Although they do not contribute equally to ovarian function, as assessed by experiments performed with conditional knockout mice. Experimental results indicate that GATA4 regulates directly or indirectly more genes than GATA6. In particular, the expression of FSHR (which is essential for the differentiation of GCs) decreases only in GATA4 knockout mice. However, the role of GATA factors in promoting the expression of genes for extracellular matrix organization, steroid metabolism and ovulation has been clearly demonstrated using microarrays analysis. NR5A1 and NR5A2 are master regulators of steroidogenesis62,63. Defects in steroid hormone production impair follicular development and fertility. Experiments performed with conditional knockout mice indicate that the lack of expression of NR5A1 in postnatal ovary causes infertility64. Interestingly, also the overexpression of NR5A1 affects female fertility and metabolism, confirming the importance of a fine-tuned control of NR5A1 for female reproductive and metabolic functions62. Despite the structure similarity, NR5A1 and NR5A2 exert different effects in human granulosa cells. It has been proposed that the fine-tuning of steroidogenesis in the ovarian follicles is achieved through BMP-15 signaling that induces NR5A -target genes expression while suppressing NR5A2-linked genes63.

Interestingly, “Cadherin binding” GO terms result in being strongly enriched for DAS in stimulated versus unstimulated CCs and in CCs from GV-M2 COC. As mentioned above, folliculogenesis strictly depends on the contact of the surrounding granulosa cells and the oocyte. Cadherins are a group of membrane proteins involved in cell adhesion. They assure adhesion between adjacent cells by the homotypic interactions of cells exposing similar sets of cadherins at their surfaces65. Cadherins contribute to tissue integrity66, regulating cell migration, cell differentiation and the control size of a specific cell population67. Cadherin-catenin complexes also act as receptors for signaling molecules. Compelling evidence indicates that E- and N–cadherin together with associated catenin take part in NF-kb-mediated signaling, RhoA GTPase signaling, and Hippo, Yap1, RTK and Hedgehog pathways68–71. Interestingly, the Wnt4/beta-catenin cascade is crucial for ovary development in mice and other vertebrates72. Although it can be assumed that cadherins take part in the follicle maturation, since they constitute the core of adherens junctions, little is known about the signaling pathways regulated by cadherins during oocyte development. Therefore, our findings suggest a new deeper investigation of Alternative Splicing events in Cadherin-signaling associated genes. Despite the indirect suggestions of enriched follicle development function from DEGs only GO enrichment analysis, DAS analysis reported a significant enrichment of the ovarian follicle development category (GO:0001541)73.

How do maternal mRNAs remain stable during completion of meiosis or in initial stages of embryo development and how dormant transcripts are activated and degraded later? Likely, RNA-binding proteins are accumulated in fully grown oocytes for stabilizing and degrading mRNAs together with other components required for regulating protein synthesis and degradation. Interestingly, we observed several DAS genes involved in mRNA surveillance pathways by comparing GV_Oocyte vs CCs (Fig. 3d). We found genes encoding RNA binding proteins that are components of multi protein Exon Junction Complex (EJC) placed at the splice junction on mRNAs (MAGOHB, RNPS1, ACIN1) and involved in the nonsense-mediated decay (NMD) of mRNAs (MAGOHB, RNPS1). RNPS1 participates in mRNA 3′-end cleavage and mediated an increase in RNA abundance and translational efficiency. DAS genes encode proteins that bind with high affinity to nascent poly(A) tails and stimulate poly (A) addition (PABPN1, FIPL1) and are involved in nucleocytoplasmic trafficking. Furthermore, CSTF1 and CSTF3 (Cleavage Stimulation Factor Subunit 1 and 3 respectively) genes encode two of the three subunits forming the cleavage stimulation factors (CSTF), which are involved in polyadenylation and cleavage of 3′ end of mammalian pre-mRNAs. Among DAS genes, we also found GSPT1 (G1 to S phase transition 1) gene that is involved in regulation of translation termination and predicted to be part of translation release factor complex74.

Furthermore, we found regulatory components of phosphorylation-mediated signaling involved in the negative control of cell growth and division (Protein Phosphatase 2 Regulatory Subunit B gamma, PPP2R3C and Protein Phosphatase 2 Scaffold Subunit Abeta, PPP2R1B, both genes present alternative splice transcript variants).

Several DAS genes associated with Ubiquitin mediated proteolysis were shared by comparing both GV_Oocyte vs CCs and CCs GV vs M2 COC. The ubiquitination/deubiquitination process is important for degradation of proteins, transcriptional regulation, and cell cycle progression75 which are also crucial for the oocyte maturation. APC (anaphase-promoting complex) initiates the metaphase to anaphase transition by promoting cyclin B and securin degradation76. Among DAS genes, we found several core subunits of APC, like ANAPC5, ANAPC7, ANAPC10, ANAPC13 (which are large E3 ubiquitin ligases), controlling cell progression by targeting cyclin B for 26 S proteasome-mediated degradation. Through comparison of DAS between CCs_vs M2_CCs we found ANAPC13, ANPC7 and ANAPC5. Interestingly, multiple transcript variants for ANAPC5 gene have been described, resulting in shorter isoforms due to downstream AUG sites. Compelling evidence supports that ubiquitin E3 ligases mediate specific protein degradation, crucial in the progress of both meiotic and mitotic cell cycle77. Cullin ring-finger ubiquitin ligase 4 is one of the E3 ligase members that play multiple functions both in oocyte survival and in the meiotic cell cycle progression76. In line with this, among DAS shared by both groups (GV_Oocyte vs CCs and CCs_vs M2_CCs), we found CUL4A, ELOC, TRIP12M MGRN1, CDC27. The latter (together with CDC16) is a component of the anaphase-promoting complex (APC) that catalyzes the formation of cyclin B-ubiquitin conjugate ending in the ubiquitin-mediated proteolysis of B-type cyclins. TRIP12 is an E3 ubiquitin ligase implicated in the degradation of p19ARF/ARF isoform of CDKN2A and in the DNA Damage Response by regulating UP7 stability and by doing so of p53. Interestingly, among DAS shared by comparing CCs GV_M2 and GV_Oocyte vs CCs, we found several members of E2 Ubiquitin-conjugating enzyme E2 family (UBE2D3, UBE3B, UBE2E2, UBE2N, UBE2G). UBE2E2 is involved in positive regulation of G1/S transition of mitotic cell cycle, UBE2N can interact with UBE2V1/UBE2V2, catalyzing the synthesis of non-canonical Lys 63-coupled poly-ubiquitin chains. This type of poly-ubiquitination does not lead to protein degradation while mediating transcriptional activation of target genes. UBE2G2 mediates endoplasmic reticulum-associated degradation (ERAD)78, such as the sterol-induced ubiquitination of 3-hydroxy-3-methylglytaryl CoA reductase79. Among DAS genes derived from GV oocyte-vs-CCs comparison we found several E3 ubiquitin ligases. FBXW11 (F-box and WD Repeat Domain Containing 11), a substrate component of a SCF (SKPI-CUL1-F-box protein) that mediates the ubiquitination of phosphorylated proteins, allowing transcriptional activation. BIRC2 (Baculoviral IAP Repeat Containing 2), an E3 ubiquitin ligase that modulates mitogenic kinase signaling, cell proliferation and apoptosis. In addition, BIRC2 can stimulate the transcriptional activity of E2F1 and can also function as an E3 ligase for the NEDD8 conjugation pathway of effector caspases. SYVN1 (Synoviolin 1) E3 ubiquitin ligase, component of the reticulum quality control system (ERAD) involved in ubiquitin dependent degradation of misfolded endoplasmic reticulum proteins80,81. RPS27A (Ribosomal Protein 27a) a fusion protein consisting of ubiquitin at the N terminus and the ribosomal protein 27a at the C-terminus], and RPS40 (Ribosomal Protein 40), implicated in maintenance of chromatin structure.

Compelling data support the role of SUMOylation in maturing oocytes, deletion of SUMO-component UBE2I disrupts meiotic maturation and causes defects in spindle organization82. Deletion of UBE2I impaired the communication with granulosa cells and caused a defective resumption of meiosis and meiotic progression83. As DAS gene, we also found SAE (SUMO1 Activating Enzyme Subunit 1) that mediates ATP-dependent activation of SUMO protein on a conserved cysteine residue on UBA2.

DAS genes from CCs GV-vs-M2 comprise several Small Ubiquitin-like modifier (SUMO) ligases: PIAS2 (Protein Inhibitor of activated STAT 2) and PIAS3 both stabilize the interaction with UBE2I and the substrate. PIAS2 play a crucial role as transcriptional co-regulator in the p53 pathway and the steroid hormone signalling pathway. PIAS3 directly binds to several transcription factors, blocking or enhancing their activity.

By comparing CCs GV-M2 we found several DAS E3 ubiquitin ligases: MDMD2, STUB1, HUWE1, HERC2, TRIM37, CBLB, CUL4B. Pathways regulated by TRIM (Tripartite Motif Containing) 37 are epigenetic transcriptional repression (mono-ubiquitination of histone H2A)84, centriole duplication85, peroxisome biogenesis86. While HERC2 (HECT and RLD Domain Containing Ubiquitin Protein Ligase 2) regulates small ubiquitin-dependent retention of repair proteins on damaged chromosome87. DDB2 (damage specific DNA binding protein 2) in complex with CUL4 may ubiquinate histones, facilitating their removal from nucleosome and promoting subsequent DNA repair88,89. HUWE1 (HECT E6AP type E3 ubiquitin protein ligase) targets the p53 tumour suppressor90, core histones91,92 and DNA polymerase beta, playing a role in base-excision repair93. STUB1 (STIP1 Homology and U-Box containing Protein 1) mediates poly-ubiquitination of DNA polymerase beta (POLB), amplifying the HUWE1/ARF-BP1 dependent POLB-degradation by the proteasome93. In addition, STUB1 act as a co-chaperone for HSPA1A and HSPA1B chaperone proteins and promotes protein degradation94. CUL4B (Cullin 4B) is required for ubiquitination of cyclin E and consequently for normal G1 cell cycle progression95,96 and for the proteolysis of several regulators of DNA replication. CUL4B regulates the mammalian target-of-rapamycin (mTOR) pathways implicated in the control of cell growth and metabolism97. Lastly, MDM2 (mouse double minute 2 homolog) a nuclear-localized E3 ubiquitin ligase, inhibits p53-mediated cell cycle arrest, promotes degradation of retinoblastoma RB1 protein98. Together these findings highlight that cumulus expansion is fundamental for oocyte maturation, as many DAS genes are involved in cell cycle control, DNA replication and repair.

Finally, comparison of CCs GV-M2 reveals multiple DAS genes encoding for spliceosome components. SRSF2, SRSF3, SRSF4, SRSF5, SRSF7 (Serine and Arginine Rich Splicing Factor 2, 3, 4, 5 and 7) are splicing factors that promote exon-inclusion during alternative splicing as well as mRNA nuclear export99–101. SNRPG (Small Nuclear Ribonucleoprotein Polypeptide G) is a component of precursors of the spliceosome like U1, U2, U4, U5 and U7 small nuclear ribonucleoprotein complexes. U5SNRNP70 (Small Nuclear Ribonucleoprotein U1 Subunit 70) is a component of the spliceosome U1 snRNP102,103. THOC2 (THO Complex Subunit 2) is a component of the TREX complex which is involved in mRNA processing and nuclear export.

PRPF38B (Pre-mRNA Processing Factor 38B), PRPF40A (Pre-mRNA Processing Factor 40 A) PRPF40B (Pre-mRNA Processing Factor 40B) are RNA binding protein involved in mRNA splicing and in several processes, including cytoskeleton organization, regulation of cell shape, regulation of cytokinesis. TRA2A (Transformer 2 Alpha Homolog) and TXNL4A (Tiredoxin like 4A) are RNA binding proteins involved in pre-mRNA splicing. RBM17 (RNA Binding Motif Protein 17) is a splice factor that binds to the single stranded 3′AG at the exon/intron border, also involved in the regulation of alternative splicing and the utilization of cryptic splice sites. NCBP2 (Nuclear Cap Binding Protein Subunit 2) is a component of cap-binding complex associated with pre-mRNA splicing, translational regulation, non-sense-mediated mRNA decay, RNA-mediated gene silencing by microRNAs and mRNA export. HNRNPA1 is a member of heterogeneous nuclear ribonucleoproteins (hnRNPS) associated with pre-mRNAs in the nucleus and pre-mRNAs packaging and processing. PQPB1 (Polyglutamine Binding Protein 1) is an intrinsically disordered protein that act as scaffold in different processes like pre-mRNA splicing, transcription regulation. Through its disordered region, PQPB1 regulates alternative splicing of specific pre-mRNAs molecules104–107. DHX38 (Dead- Box Helicase 38) is involved in pre-mRNA splicing as component of spliceosome. U2AF1 (U2 small Nuclear RNA A10uxiliary Factor 1) and U2AF1L4 (U2 small Nuclear RNA Auxiliary Factor 1 like 4) take part in protein-protein interactions and protein-RNA interactions required for an accurate 3′ splice site selection, while TCERG1 (Transcription Elongation Regulator 1) is a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing.

In the last part of our study, we focused on miRNAs and their target genes. In fact, it is known that several miRNAs are intricately involved in the regulation of granulosa cell processes, crucial for ovarian function and folliculogenesis108,109.

Interestingly, by comparing the lists of DEMs shared by the two GC types, we found 12 DEMs showing a similar expression profile. A further GO analysis indicated significant common enriched terms associated with cell division, proliferation and metabolism, revealing a complex and powerful regulatory network within the two GC subpopulations.

Lastly, we built a co-expression miRNA-mRNA network to infer some potential regulatory relationships. A total of 12 common miRNAs were analyzed in the context of DE-mRNAs. In line with earlier studies, we found that miR-129-5p is the most connected in the miRNA-mRNA network109, while the two couples miR-30a-5p/miR-148a and miR-30a-3p/miR-196a-5p may act on common target genes. Interestingly, miR-129 is down-regulated in GCs of PCOS patients, whereas the overexpression of miR-129 increases P4 (Progesterone) and E2 (17-beta-estradiol) secretion, thus promoting GCs proliferation in PCOS110.

As previously reported, the miR-146a-5p expression, higher in MGCs compared to CCs, promotes apoptosis by targeting IRAK1 in MGCs15.

MiR-30a-3p and miR-30a-5p, belonging to the same miR-30 family, are both up-regulated in MGCs in contrast to miR-148a and miR-196-5p. The MiR-30 family is highly expressed in mammalian gonads, associated with the Homeobox protein and Zn transport111 and with the regulation of ubiquitin-mediated pathways112. MiR-30a expression in ovarian cancer results in being significantly up-regulated113,114 and further bioinformatics analysis indicates that miR-30a play a crucial role in ovarian cancer biology115. Alteration of miRNA expression profiles is associated with PCOS; miR-30a was detected in human follicular fluid and used as biomarkers (in tandem with miR-140 and let-7b) to discriminate between PCOS and normal ovarian reserve with a high specificity and sensitivity116.

Recent data show a significant dysregulation of miR-144117 in ovarian tissues of animal model of PCOS and of miR-145 in granulosa cells118 and miR-142119 in follicular fluid, respectively, of PCOS patients.

Compelling evidence shows that miR-148a-3p modulates the Wnt/beta-catenin signaling pathway120 and Serpin family E member 1 (SERPINE1) expression121.

In granulosa cells, SERPINE1 expression can influence follicular development by regulating matrix degradation and tissue remodeling processes necessary for follicle growth and ovulation. Aberrant expression of SERPINE1 can disrupt these processes, leading to reproductive issues such as PCOS122. Furthermore, miR-148a-3p is implicated in the regulation of steroidogenesis and cell proliferation within chicken granulosa cells, targeting genes vital for these processes123.

In addition, hsa-miR-196a-5p regulates granulosa cell apoptosis, affecting cell survival pathways crucial for follicular development by repressing Rho Associated Coiled-coil Containing Protein Kinase 1 (ROCK1)124. ROCK1, a key regulator of the actin cytoskeleton and cell polarity, ensures that apoptotic signals are properly localized within the cell, facilitating the efficient execution of the apoptotic program125.

MiR-145 targets Crkl and through the JNK/p38 MAPK pathway promotes cell proliferation, differentiation, and steroidogenesis126 by regulating the cytoskeleton remodeling127.

The expression of miR-10b is higher in MGCs compared to CCs, while for miR-92a-1-5 it is the opposite. Recent data demonstrate that miR-10b represses BDNF expression in granulosa cells, by targeting the 3′ UTR128. The miR-10b expression is controlled by hormones and growth factors in the follicle, such as FSH, FGF9 and some ligands of the TGF-beta pathway. On the other hand, the miR-10 family inhibits many key genes of TGF-beta signaling axis, suggesting the existence of a negative feedback loop129. SMAD4 is a transcription factor of the CYP19A1 gene (encoding aromatase, a key enzyme in E2 synthesis), that in turn stimulates E2 release and inhibits cell apoptosis in porcine GCs. In contrast, miR-10b might act as a pro-apoptotic factor, directly interacting with 3′-UTR of porcine CYP19A1 mRNA, inhibiting its expression and function130. On the other hand, recent data demonstrate that miR-92a inhibits GCs apoptosis in pig ovaries, by targeting SMAD7 directly131. Very recent reports have highlighted the emerging role of miRNAs in regulating ovarian angiogenesis, follicular communication and in regulatory networks of cumulus-oocyte complex (COC) linked to fertilization132,133. The miRNA common network, herein identified, might likely work to fine tune various aspects of follicle maturation [i.e. cumulus cell survival/expansion, cumulus-oocyte communication, follicular microenvironment, angiogenesis]. Interestingly, miRNA profiling from human GC and follicular fluid has revealed the presence miRNAs, involved in the regulation of main pathways underlying folliculogenesis (like Wnt signaling134, mitogen-activated protein kinase135 and phosphatidylinositol 3 kinase-protein kinase B136 pathways respectively). Among these miRNAs, miRNA-10b-5p that we found upregulated in MGCs137. Furthermore, analysis of the follicular fluid from bovine ovaries unveiled a role of few miRNAs in global DNA demethylation138. By targeting DNMT, miRNA-148a that we found upregulated in MGCs, may impact on DNA methylation, thus improving embryonic development138. MiRNA profiling of exosomes derived either from follicular fluid (FF) or from human GCs seem to show a remarkable overlap137. Our study goes in the same direction, since we have identified a shared miRNA signature within GCs. Emerging in-depth analysis of miRNA profiles from exosomes (derived from FF and GCs) will allow soon to better define the miRNA signature and its positive effect on follicle development and activation.

In conclusion, these results have overcome the limitations of individual studies, enabling the identification of new candidates, genes, miRNAs, and signaling routes within the mature follicle. Such new molecular signatures can be used to study the mechanisms underlying GCs function, and as potential biomarkers of oocyte quality.

Methods

Data source

RNA-seq and small RNA-seq datasets related to granulosa cells and oocyte were retrieved by consulting the Sequence Read Archive (SRA) according to Search and Incorporation criteria detailed below.

Search criteria

A systematic search strategy was employed to identify relevant datasets in the SRA archive. The search was performed using keywords such as “granulosa cells”, “cumulus cells and oocyte” and “mural and granulosa cells” ensuring the specificity of the results. Then a filter for homo sapiens species was applied. The SRA archive’s web interface or command-line tools (e.g., SRA Toolkit) were utilized to execute the search queries. The search queries were constructed to include the relevant keywords and any additional filters or parameters deemed necessary.

Incorporation criteria

The identified datasets were evaluated based on specific selection criteria to ensure their suitability for the research project. Criteria considered may include data quality, experimental design, sample size (at least three replicates), tissue source, and relevant metadata. Only standard RNA-seq data was considered, single cell dataset was excluded. An important criterion was the platform of sequencing, indeed only sequencing data from the Illumina platform were chosen to ensure that the same pipeline could be set up and applied to the selected Bioprojects to harmonize all datasets before executing downstream integrated analyses.

Data selection

Three bioprojects of interest have been found in the Sequence Read Archive (SRA) for mRNA sequencing experiments on human granulosa cells, and two bioprojects for small RNA sequencing experiments have been found to evaluate the miRNAs profile of these cells. Data selection was focused on experiments that included also the cumulus cells (CCs).

Briefly, from the article by Yerushalmi et al.12 were analyzed CCs in two stages to get insight into different maturation phases of the COC, it was linked to PRJNA216966, which has 2 samples of CCs from germinal vesicles unstimulated COC, and 3 samples from M2 cumulus of expanded/stimulated COC.

Li et al.13 focused on Polycystic Ovary Syndrome. To discover what characterizes cumulus cells from oocytes and find new insight into intercellular communication, the analysis was only performed considering the control groups. From PRJNA649934, 6 control oocyte samples and 4 control cumulus cells samples.

In the article by Velthut-Meikas et al.14, two bioprojects were linked PRJNA200696 and PRJNA200699 respectively RNA-seq and small RNA-seq experiments on Cumulus and Mural cells in the preovulatory stage. All samples were treated with the standard stimulation protocol: GnRH antagonist, rFSH, hCG. The former has 6 samples total, 3 for CCs and 3 for mural cells (MCs), the latter has 12 samples, 6 for CCs and 6 for MCs.

Completing the small RNA-seq data on granulosa cells is PRJNA41797315. 24 runs total, 12 for CCs (3 samples, 4 runs per sample) and 12 for MCs (3 samples) have been analyzed.

In our analysis, we observed a substantial disproportion in the number of PCOS datasets compared to control and standard treatment datasets. We did not prioritize the analysis of PCOS datasets (like PRJNA762274, PRJEB46048, PRJNA576435, PRJNA576231) since our primary objective was to investigate and characterize the transcriptome of Cumulus Cells under control conditions. To mitigate the inherent bias caused by the unequal distribution of datasets, we employed stringent criteria for dataset selection. We prioritized datasets with well-defined metadata, rigorous experimental design, and a balanced representation of PCOS cases, control subjects, and standard treatment groups. Datasets lacking essential information or exhibiting a skewed distribution were regrettably excluded from our analysis to ensure the robustness and validity of our findings.

Data download

The selected datasets were downloaded from the SRA archive using SRA toolkit v3.0.0. The chosen dataset’s accession numbers or unique identifiers were recorded for future reference. The whole metadata are reported under supplementary table 1.

mRNA-Seq data processing

Quality control and trimming

A first quality control was performed on the FASTQ files using FASTQC (version 0.11.9), low-quality reads and adapters were removed using Trimmomatic v.0.39 (installed in g100). For adapter trimming were used the TrueSeq adapters for paired end:

>PrefixPE/1

TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PrefixPE/2

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE1

TACACTCTTTCCCTACACGACGCTCTTCCGATCT

>PE1_rc

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

>PE2

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

>PE2_rc

AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

For single end:

>TruSeq 3_IndexedAdapter

AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

>TruSeq 3_UniversalAdapter

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

Parameters used for trimmomatic for paired-end and single-end reads were LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36.

Alignment and annotation

For the alignment, The HISAT2 aligner software (version 2.2.1)139 was employed for aligning the RNA-Seq reads to the reference genome assembly for Homo Sapiens (hg38). Prior to alignment, the reference genome assembly was indexed using HISAT2’s indexing utility. The alignment of RNA-Seq reads to the reference genome was performed using HISAT2 principal command. Were used both paired and unpaired data after trimming.

The resulting alignment file in SAM format was converted to the binary BAM format for efficient storage and subsequent analysis and to facilitate downstream analysis, the BAM file was sorted by genomic coordinates. The conversion was performed using the SAMtools (version 1.13)140.

If the experiment had multiple runs for the same sample, the BAM files were merged using SAMtools. As a result, there was a BAM file for each sample.

The quantification of gene expression levels based on the aligned reads and a genome annotation file (GTF or GFF) was performed using Stringtie (version 2.1.6)141. This step involved assigning reads to genes and counting the number of reads associated with each gene. The genome annotation file was obtained from hg3819 release and provided in GTF format. The PrepDe python script was used to generate the resulting gene count matrix for differential expression analysis, as described in the StringTie handbook142.

Data quality control before dataset integration

The datasets coming from different bioprojects have been processed using the shared pipeline as described above. This consistent processing helps mitigating some of the variability introduced by differences in library preparation and sequencing depth. However, we recognize that differences in library preparation and sequencing depth can influence gene detection efficiency and expression levels, potentially affecting downstream pathway analysis. To address this, we have conducted several quality control measures to assess and account for these differences.

To provide a clearer understanding of the dataset quality and sequencing depth, we have conducted a fastqc analysis, which is reported under the Supplementary Dataset143. The MultiQC report provides a comprehensive overview of the raw fastq data quality, including metrics such as read quality scores, adapter content, and duplication levels before and after trimming. Furthermore, we have conducted a PCA on the count matrices for each bioproject (S7). This analysis helps visualizing the similarity and differences in gene expression profiles. The PCA analysis has clearly highlighted distinct sample clustering at dataset level segregating them by cell type and not by potentially confounding batch effects. The subsequent gene-count normalization process operated by DESeq 2 package ensured proper comparisons and a robust final list of DEGs.

mRNA post-processing data analysis

Most post-processing analysis were conducted using R programming language with R studio (version 2022.02.3 Build 492). The raw count data obtained from Stringtie was used as input for differential expression analysis. The DESeq 2 R package (version 1.36.0)144 was used to normalize the raw counts, estimate size factors, and perform statistical tests to identify differentially expressed genes. This analysis aimed to identify genes with significantly different expression levels between experimental conditions or cell types.

Statistical analysis was conducted using DESeq 2. The analysis considered relevant factors such as treatment condition, replicates, and experimental design. Significantly differentially expressed genes were determined based on at least 0.05 adjusted p-values and two-log2 fold change thresholds in up- or down-regulation.

Gene Ontology (GO) enrichment analysis was performed using the clusterProfiler R package (version 4.7.1.003)145 to gain insights into the functional annotation and enrichment of DEGs within bioprojects. The gene list used for GO analysis consisted of genes that showed significant differential expression both up- or downregulated between experimental conditions or cell types, as determined by the differential expression analysis using DESeq 2.

We acknowledge that DEGs from two of the three datasets might include markers specific to mural GCs and oocytes, which could influence the functional analysis results. To address this, we conducted a detailed analysis to show the up-regulated and down-regulated genes separately in each cell type across multiple datasets (Fig. S4).

Before conducting GO-analysis, if necessary, the gene identifiers in the input gene list were converted to a common identifier system, such as Entrez Gene IDs or official gene symbols, using available annotation database org.Hs.eg.db146.

The gene list was annotated with GO terms using the enrichGO function from clusterProfiler. The annotation was based on the specific organism’s GO database (org.Hs.eg.db). The enrichGO function was used to identify significantly enriched GO terms within the gene list. This function performed a hypergeometric test to determine if a particular GO term was overrepresented in the input gene list compared to the genome background. The p-values were adjusted for multiple testing using the appropriate method Benjamini-Hochberg correction method.

The results of the GO enrichment analysis were visualized using various plotting functions from clusterProfiler. To remove redundancy of enriched GO terms the simplify function from the clusterProfiler package. This step provided a more concise and interpretable representation of the enriched GO terms.

To perform KEGG pathway enrichment analysis the clusterProfiler package was used following the same steps of the GO enrichment analysis except for the database was downloaded locally due to known problems with clusterProfiler connecting to KEGG DB, loading the “KEGG.db” downloaded from the create_kegg_db(“hsa”) command, using the “createKEGGdb” R package.

In parallel, to reveal the hidden patterns of common biological processes, the R package clusterProfiler was also used in compareCluster modality, where the complete lists of DEGs from each Bioproject are used simultaneously as input.

Protein Protein Interaction network was built using the webAPP STRING v12.0 using the coreset of 236 shared DEGs as input.

Differential alternative splicing analysis

To investigate differential alternative splicing events between experimental conditions or treatments, MAJIQ (version 2.4) was employed147,148. The MAJIQ software was downloaded from the official website149 and installed via Conda. The required dependencies and reference annotations were obtained according to the MAJIQ documentation. A MAJIQ configuration file was created to specify the experimental design and sample information. This file included details such as the input BAM files for each condition or treatment, sample groupings, and experimental factors.

MAJIQ “build” command was used to detect and quantify alternative splicing events from the aligned RNA-Seq data in BAM format. Furthermore, a gene annotation file in gff3 format was required, the file used for the analysis is available on genecode. The output is a.majiq file for each sample, which is used as input for the “deltapsi” command to identify differentially spliced events between conditions or cell type.

The output of the differential splicing analysis provided the differential splicing events, including their psi values (percent spliced-in) and statistical significance.

MAJIQ calculates differential alternative splicing over local splicing variations (LSVs), not on the entire gene. These results make it so that even small LSVs variations (20%) can strongly affect the differential splicing, thus this filtering criterion, in conjunction with q < 0.05, was used to produce filtered lists of LSVs.

Various visualization tools and packages, such as Voila: a visualization package that combines the output of MAJIQ Builder (“build”) and MAJIQ Quantifier(“deltapsi”) using interactive D3 components and HTML5. Then the Modulizer tool was used to categorize different splicing event types. To get the distribution of each alternative splicing category in each Bioproject, a custom script was built.

To gain insights into the biological functions and pathways associated with the differentially alternative splicing (DAS), GO Enrichment Analysis was performed on DAS transcription regulators. The DAS genes can be linked to their corresponding gene annotations or functional databases to determine enriched terms or pathways. The enrichGO function was used to identify significantly enriched GO terms within the gene list. Additional analysis on transcription regulator DAS and their targets was performed using the TRRUST database. Targets were filtered to only the differentially expressed genes, then a GO enrichment analysis was performed on the filtered target list150.

The violin plot implemented in the Fig. S4 serves as an exploratory visualization tool. Its primary input consists of the lists of DEGs associated with each TF within individual bioprojects. The plot is further annotated to identify instances where genes exhibit both being TF and DAS. This visualization is created using the GGplot2 R package.

Small RNA-seq analysis

For PRJNA200699 was used miRDeep2 (version 0.1.2)151 to trim, detect and quantify miRNAs expression.

For PRJNA417973 a specific adapter trimming was required due to the library construction152, Cutadapt v4.2 was employed with the following commands: cutadapt–discard-untrimmed–minimum-length = 18–maximum-length = 35 -a NNNNTGGAATTCTCGGGTGCCAAGGNNNN -o clipped_SAMN08013076.fastq -j 0 -O 11 SAMN08013076.fastq.

Gene ontology enrichment analysis was performed as previously described the gene list for the enrichment is the list of differential expressed miRNAs target genes (experimentally validated only). Then a venn diagram has been plotted to represent the shared DEMs between the two bioprojects using ggVenn from ggplot2 and VennDiagram R package153.

An interaction network was built selecting differentially expressed miRNAs shared in both projects and their target DEGs from PRJNA200696 using igraph R package, and Fruchterman-Reingold algorithm for graph visualization. miRNA-targets were downloaded using multiMiR R package154, applying the validated target filter.

List of abbreviations and acronyms used in the paper

GCs (Granulosa Cells); CCs (Cumulus Cells); miRNAs (microRNAs); mRNAs (messenger RNAs); DEM (Differentially expressed miRNAs); DEGs (Differentially expressed Genes); DAS (Differential alternative splicing); cumulus-oocyte complex (COC); human chorionic gonadotrophin (hCG); metaphase 2 (M2); Polycystic Ovary syndrome (PCOS); Differentially Expressed (DE); Sequence Read Archive (SRA); Gene Ontology (GO); Kyoto Encyclopedia of Genes and Genomes (KEGG); transcription regulator (TR); ALE/AFE (Alternative Last/First Exon); MES (Multiple Exon skipping); MXE (Mutually Exclusive Exons); alt3′ (alternative 3′ exon); alt5′ (alternative 5′ exon).

Supplementary information

Supplementary figures

Supplementary material 9

Supplementary Table 1

Supllementary table2

Supplementary table3

Supplementary table4

Supplementary information

The online version contains supplementary material available at 10.1038/s41597-024-03715-0.

Acknowledgements

We acknowledge CINECA for the availability of high-performance computing resources and specialist support. This research was funded by the University of Rome “Tor Vergata”-Progetto di Ateneo 2021.

Author contributions

S. Gio. and S. Go. conceived the study. X.D., S. Gio. and S. Go. contributed to sample preparation and metadata retrieval. X.D. and S. Gio. performed bioinformatics analysis, designed the figures, tables and supplementary materials. S. Gio. verified the analytical methods and supervised the work from a bioinformatics perspective and S. Go. from a biological point of view. All authors contributed to the interpretation of the results, provided critical feedback, and contributed to the final version of the manuscript.

Data availability

Normalized gene expression count tables, DEGs/DEMs/DAS lists and any other relevant sample metadata were deposited on the repository Figshare17,73,143,155.

Code availability

The workflow and a detailed list of command lines was deposited on the repository https://github.com/Xhulio-99/RNAseq_analysis_code_for_human_granulosa_cells_paper.

Competing interests

The authors declare no competing interests.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Silvia Gioiosa, Stefania Gonfloni.
==== Refs
References

1. Li R Albertini DF The road to maturation: somatic cell interaction and self-organization of the mammalian oocyte Nat. Rev. Mol. Cell Biol. 2013 14 141 152 10.1038/nrm3531 23429793
Li, R. & Albertini, D. F. The road to maturation: somatic cell interaction and self-organization of the mammalian oocyte. Nat. Rev. Mol. Cell Biol. 14, 141–152 (2013).23429793 10.1038/nrm3531
2. Turathum, B., Gao, E. M. & Chian, R. C. The Function of Cumulus Cells in Oocyte Growth and Maturation and in Subsequent Ovulation and Fertilization. Cells 10 (2021).
3. Da Broi MG Influence of follicular fluid and cumulus cells on oocyte quality: clinical implications J. Assist. Reprod. Genet. 2018 35 735 751 10.1007/s10815-018-1143-3 29497954
Da Broi, M. G. et al. Influence of follicular fluid and cumulus cells on oocyte quality: clinical implications. J. Assist. Reprod. Genet. 35, 735–751 (2018).29497954 10.1007/s10815-018-1143-3
4. Dumesic DA Meldrum DR Katz-Jaffe MG Krisher RL Schoolcraft WB Oocyte environment: follicular fluid and cumulus cells are critical for oocyte health Fertil. Steril. 2015 103 303 316 10.1016/j.fertnstert.2014.11.015 25497448
Dumesic, D. A., Meldrum, D. R., Katz-Jaffe, M. G., Krisher, R. L. & Schoolcraft, W. B. Oocyte environment: follicular fluid and cumulus cells are critical for oocyte health. Fertil. Steril. 103, 303–316 (2015).25497448 10.1016/j.fertnstert.2014.11.015
5. Grøndahl ML Specific genes are selectively expressed between cumulus and granulosa cells from individual human pre-ovulatory follicles Mol. Hum. Reprod. 2012 18 572 584 10.1093/molehr/gas035 22923488
Grøndahl, M. L. et al. Specific genes are selectively expressed between cumulus and granulosa cells from individual human pre-ovulatory follicles. Mol. Hum. Reprod. 18, 572–584 (2012).22923488 10.1093/molehr/gas035
6. Khan DR Meta-analysis of gene expression profiles in granulosa cells during folliculogenesis Reproduction 2016 151 R103 R110 10.1530/REP-15-0594 26980808
Khan, D. R. et al. Meta-analysis of gene expression profiles in granulosa cells during folliculogenesis. Reproduction 151, R103–R110 (2016).26980808 10.1530/REP-15-0594
7. Wigglesworth, K., Lee, K. B., Emori, C., Sugiura, K. & Eppig, J. J. Transcriptomic diversification of developing cumulus and mural granulosa cells in mouse ovarian follicles. Biol. Reprod. 92 (2015).
8. Uyar A Torrealday S Seli E Cumulus and granulosa cell markers of oocyte and embryo quality Fertil. Steril. 2013 99 979 997 10.1016/j.fertnstert.2013.01.129 23498999
Uyar, A., Torrealday, S. & Seli, E. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil. Steril. 99, 979–997 (2013).23498999 10.1016/j.fertnstert.2013.01.129
9. Ouandaogo ZG Differences in transcriptomic profiles of human cumulus cells isolated from oocytes at GV, MI and MII stages after in vivo and in vitro oocyte maturation Hum. Reprod. 2012 27 2438 2447 10.1093/humrep/des172 22617121
Ouandaogo, Z. G. et al. Differences in transcriptomic profiles of human cumulus cells isolated from oocytes at GV, MI and MII stages after in vivo and in vitro oocyte maturation. Hum. Reprod. 27, 2438–2447 (2012).22617121 10.1093/humrep/des172
10. Péquignot Y Clarke PGH Reduction in the death and cytolamination of developing neurons by tetrodotoxin in the axonal target region Brain Res. Dev. Brain Res. 1991 60 94 98 10.1016/0165-3806(91)90159-G 1914148
Péquignot, Y. & Clarke, P. G. H. Reduction in the death and cytolamination of developing neurons by tetrodotoxin in the axonal target region. Brain Res. Dev. Brain Res. 60, 94–98 (1991).1914148 10.1016/0165-3806(91)90159-G
11. De Los Santos MJ Hormonal and molecular characterization of follicular fluid, cumulus cells and oocytes from pre-ovulatory follicles in stimulated and unstimulated cycles Hum. Reprod. 2012 27 1596 1605 10.1093/humrep/des082 22451503
De Los Santos, M. J. et al. Hormonal and molecular characterization of follicular fluid, cumulus cells and oocytes from pre-ovulatory follicles in stimulated and unstimulated cycles. Hum. Reprod. 27, 1596–1605 (2012).22451503 10.1093/humrep/des082
12. Yerushalmi GM Characterization of the human cumulus cell transcriptome during final follicular maturation and ovulation Mol. Hum. Reprod. 2014 20 719 735 10.1093/molehr/gau031 24770949
Yerushalmi, G. M. et al. Characterization of the human cumulus cell transcriptome during final follicular maturation and ovulation. Mol. Hum. Reprod. 20, 719–735 (2014).24770949 10.1093/molehr/gau031
13. Li, J. et al. Molecular Features of Polycystic Ovary Syndrome Revealed by Transcriptome Analysis of Oocytes and Cumulus Cells. Front. cell Dev. Biol. 9 (2021).
14. Velthut-Meikas A Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes Mol. Endocrinol. 2013 27 1128 1141 10.1210/me.2013-1058 23660593
Velthut-Meikas, A. et al. Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes. Mol. Endocrinol. 27, 1128–1141 (2013).23660593 10.1210/me.2013-1058
15. Andrei D Differential miRNA Expression Profiles in Cumulus and Mural Granulosa Cells from Human Pre-ovulatory Follicles MicroRNA (Shariqah, United Arab Emirates) 2019 8 61 67 30207252
Andrei, D. et al. Differential miRNA Expression Profiles in Cumulus and Mural Granulosa Cells from Human Pre-ovulatory Follicles. MicroRNA (Shariqah, United Arab Emirates) 8, 61–67 (2019).30207252
16. Home - SRA - NCBI. https://www.ncbi.nlm.nih.gov/sra.
17. Dhori X Gioiosa S Gonfloni S 2024 mRNA Analysis (Gene counts, DEGs, GOs, KEGGs)DNA-seq and RNA-seq Study Figshare 10.6084/m9.figshare.23816205.v2
Dhori, X. Gioiosa, S. & Gonfloni, S. mRNA Analysis (Gene counts, DEGs, GOs, KEGGs). Figshare10.6084/m9.figshare.23816205.v2 (2024).10.6084/m9.figshare.23816205.v2
18. Szklarczyk D The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest Nucleic Acids Res. 2023 51 D638 D646 10.1093/nar/gkac1000 36370105
Szklarczyk, D. et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 51, D638–D646 (2023).36370105 10.1093/nar/gkac1000
19. Duan X Sun SC Actin cytoskeleton dynamics in mammalian oocyte meiosis Biol. Reprod. 2019 100 15 24 10.1093/biolre/ioy163 30010726
Duan, X. & Sun, S. C. Actin cytoskeleton dynamics in mammalian oocyte meiosis. Biol. Reprod. 100, 15–24 (2019).30010726 10.1093/biolre/ioy163
20. Chakrabarti R Lee M Higgs HN Multiple roles for actin in secretory and endocytic pathways Curr. Biol. 2021 31 R603 R618 10.1016/j.cub.2021.03.038 34033793
Chakrabarti, R., Lee, M. & Higgs, H. N. Multiple roles for actin in secretory and endocytic pathways. Curr. Biol. 31, R603–R618 (2021).34033793 10.1016/j.cub.2021.03.038
21. Gunning P O’Neill G Hardeman E Tropomyosin-based regulation of the actin cytoskeleton in time and space Physiol. Rev. 2008 88 1 35 10.1152/physrev.00001.2007 18195081
Gunning, P., O’Neill, G. & Hardeman, E. Tropomyosin-based regulation of the actin cytoskeleton in time and space. Physiol. Rev. 88, 1–35 (2008).18195081 10.1152/physrev.00001.2007
22. Rasmussen CG Wright AJ Müller S The role of the cytoskeleton and associated proteins in determination of the plant cell division plane Plant J. 2013 75 258 269 10.1111/tpj.12177 23496276
Rasmussen, C. G., Wright, A. J. & Müller, S. The role of the cytoskeleton and associated proteins in determination of the plant cell division plane. Plant J. 75, 258–269 (2013).23496276 10.1111/tpj.12177
23. Baumgarten SC IGF1R signaling is necessary for FSH-induced activation of AKT and differentiation of human Cumulus granulosa cells J. Clin. Endocrinol. Metab. 2014 99 2995 3004 10.1210/jc.2014-1139 24848710
Baumgarten, S. C. et al. IGF1R signaling is necessary for FSH-induced activation of AKT and differentiation of human Cumulus granulosa cells. J. Clin. Endocrinol. Metab. 99, 2995–3004 (2014).24848710 10.1210/jc.2014-1139
24. Stocco C Genome-wide interactions between FSH and insulin-like growth factors in the regulation of human granulosa cell differentiation Hum. Reprod. 2017 32 905 914 10.1093/humrep/dex002 28158425
Stocco, C. et al. Genome-wide interactions between FSH and insulin-like growth factors in the regulation of human granulosa cell differentiation. Hum. Reprod. 32, 905–914 (2017).28158425 10.1093/humrep/dex002
25. Huet C Monget P Pisselet C Monniaux D Changes in extracellular matrix components and steroidogenic enzymes during growth and atresia of antral ovarian follicles in the sheep Biol. Reprod. 1997 56 1025 1034 10.1095/biolreprod56.4.1025 9096887
Huet, C., Monget, P., Pisselet, C. & Monniaux, D. Changes in extracellular matrix components and steroidogenic enzymes during growth and atresia of antral ovarian follicles in the sheep. Biol. Reprod. 56, 1025–1034 (1997).9096887 10.1095/biolreprod56.4.1025
26. Huet C Chronology of events accompanying follicular atresia in hypophysectomized ewes. Changes in levels of steroidogenic enzymes, connexin 43, insulin-like growth factor II/mannose 6 phosphate receptor, extracellular matrix components, and matrix metalloproteinases Biol. Reprod. 1998 58 175 185 10.1095/biolreprod58.1.175 9472939
Huet, C. et al. Chronology of events accompanying follicular atresia in hypophysectomized ewes. Changes in levels of steroidogenic enzymes, connexin 43, insulin-like growth factor II/mannose 6 phosphate receptor, extracellular matrix components, and matrix metalloproteinases. Biol. Reprod. 58, 175–185 (1998).9472939 10.1095/biolreprod58.1.175
27. Huet C Pisselet C Mandon-Pépin B Monget P Monniaux D Extracellular matrix regulates ovine granulosa cell survival, proliferation and steroidogenesis: relationships between cell shape and function J. Endocrinol. 2001 169 347 360 10.1677/joe.0.1690347 11312151
Huet, C., Pisselet, C., Mandon-Pépin, B., Monget, P. & Monniaux, D. Extracellular matrix regulates ovine granulosa cell survival, proliferation and steroidogenesis: relationships between cell shape and function. J. Endocrinol. 169, 347–360 (2001).11312151 10.1677/joe.0.1690347
28. Berkholtz CB Lai BE Woodruff TK Shea LD Distribution of extracellular matrix proteins type I collagen, type IV collagen, fibronectin, and laminin in mouse folliculogenesis Histochem. Cell Biol. 2006 126 583 592 10.1007/s00418-006-0194-1 16758163
Berkholtz, C. B., Lai, B. E., Woodruff, T. K. & Shea, L. D. Distribution of extracellular matrix proteins type I collagen, type IV collagen, fibronectin, and laminin in mouse folliculogenesis. Histochem. Cell Biol. 126, 583–592 (2006).16758163 10.1007/s00418-006-0194-1
29. Diaz FJ Wigglesworth K Eppig JJ Oocytes determine cumulus cell lineage in mouse ovarian follicles J. Cell Sci. 2007 120 1330 1340 10.1242/jcs.000968 17389684
Diaz, F. J., Wigglesworth, K. & Eppig, J. J. Oocytes determine cumulus cell lineage in mouse ovarian follicles. J. Cell Sci. 120, 1330–1340 (2007).17389684 10.1242/jcs.000968
30. Eppig JJ Intercommunication between mammalian oocytes and companion somatic cells Bioessays 1991 13 569 574 10.1002/bies.950131105 1772412
Eppig, J. J. Intercommunication between mammalian oocytes and companion somatic cells. Bioessays 13, 569–574 (1991).1772412 10.1002/bies.950131105
31. Richards JAS Russell DL Ochsner S Espey LL Ovulation: new dimensions and new regulators of the inflammatory-like response Annu. Rev. Physiol. 2002 64 69 92 10.1146/annurev.physiol.64.081501.131029 11826264
Richards, J. A. S., Russell, D. L., Ochsner, S. & Espey, L. L. Ovulation: new dimensions and new regulators of the inflammatory-like response. Annu. Rev. Physiol. 64, 69–92 (2002).11826264 10.1146/annurev.physiol.64.081501.131029
32. Eppig JJ Pendola FL Wigglesworth K Pendola JK Mouse oocytes regulate metabolic cooperativity between granulosa cells and oocytes: amino acid transport Biol. Reprod. 2005 73 351 357 10.1095/biolreprod.105.041798 15843493
Eppig, J. J., Pendola, F. L., Wigglesworth, K. & Pendola, J. K. Mouse oocytes regulate metabolic cooperativity between granulosa cells and oocytes: amino acid transport. Biol. Reprod. 73, 351–357 (2005).15843493 10.1095/biolreprod.105.041798
33. Hu YC Subfertility and defective folliculogenesis in female mice lacking androgen receptor Proc. Natl. Acad. Sci. USA 2004 101 11209 11214 10.1073/pnas.0404372101 15277682
Hu, Y. C. et al. Subfertility and defective folliculogenesis in female mice lacking androgen receptor. Proc. Natl. Acad. Sci. USA 101, 11209–11214 (2004).15277682 10.1073/pnas.0404372101
34. Van Soom A Tanghe S De Pauw I Maes D De Kruif A Function of the cumulus oophorus before and during mammalian fertilization Reprod. Domest. Anim. 2002 37 144 151 10.1046/j.1439-0531.2002.00345.x 12071888
Van Soom, A., Tanghe, S., De Pauw, I., Maes, D. & De Kruif, A. Function of the cumulus oophorus before and during mammalian fertilization. Reprod. Domest. Anim. 37, 144–151 (2002).12071888 10.1046/j.1439-0531.2002.00345.x
35. Guzeloglu-Kayisli O Embryonic poly(A)-binding protein (EPAB) is required for oocyte maturation and female fertility in mice Biochem. J. 2012 446 47 58 10.1042/BJ20120467 22621333
Guzeloglu-Kayisli, O. et al. Embryonic poly(A)-binding protein (EPAB) is required for oocyte maturation and female fertility in mice. Biochem. J. 446, 47–58 (2012).22621333 10.1042/BJ20120467
36. Schellander, K., Hoelker, M. & Tesfaye, D. Selective degradation of transcripts in mammalian oocytes and embryos. Theriogenology 68 Suppl 1 (2007).
37. Massey P Intravenous nutrient therapy eliminated androgen deprivation therapy-induced hot flashes in two men with prostate cancer J. Soc. Integr. Oncol. 2006 4 153 156 10.2310/7200.2006.024 17022923
Massey, P. Intravenous nutrient therapy eliminated androgen deprivation therapy-induced hot flashes in two men with prostate cancer. J. Soc. Integr. Oncol. 4, 153–156 (2006).17022923 10.2310/7200.2006.024
38. Walser CB Lipshitz HD Transcript clearance during the maternal-to-zygotic transition Curr. Opin. Genet. Dev. 2011 21 431 443 10.1016/j.gde.2011.03.003 21497081
Walser, C. B. & Lipshitz, H. D. Transcript clearance during the maternal-to-zygotic transition. Curr. Opin. Genet. Dev. 21, 431–443 (2011).21497081 10.1016/j.gde.2011.03.003
39. Yu C Oocyte-expressed yes-associated protein is a key activator of the early zygotic genome in mouse Cell Res. 2016 26 275 287 10.1038/cr.2016.20 26902285
Yu, C. et al. Oocyte-expressed yes-associated protein is a key activator of the early zygotic genome in mouse. Cell Res. 26, 275–287 (2016).26902285 10.1038/cr.2016.20
40. Sirard MA Resumption of meiosis: mechanism involved in meiotic progression and its relation with developmental competence Theriogenology 2001 55 1241 1254 10.1016/S0093-691X(01)00480-0 11327682
Sirard, M. A. Resumption of meiosis: mechanism involved in meiotic progression and its relation with developmental competence. Theriogenology 55, 1241–1254 (2001).11327682 10.1016/S0093-691X(01)00480-0
41. Chen J Somatic cells regulate maternal mRNA translation and developmental competence of mouse oocytes Nat. Cell Biol. 2013 15 1415 1423 10.1038/ncb2873 24270888
Chen, J. et al. Somatic cells regulate maternal mRNA translation and developmental competence of mouse oocytes. Nat. Cell Biol. 15, 1415–1423 (2013).24270888 10.1038/ncb2873
42. Pan ZN RAB7 GTPase regulates actin dynamics for DRP1-mediated mitochondria function and spindle migration in mouse oocyte meiosis FASEB J. 2020 34 9615 9627 10.1096/fj.201903013R 32472654
Pan, Z. N. et al. RAB7 GTPase regulates actin dynamics for DRP1-mediated mitochondria function and spindle migration in mouse oocyte meiosis. FASEB J. 34, 9615–9627 (2020).32472654 10.1096/fj.201903013R
43. Sun, M. H. et al. Citrinin exposure disrupts organelle distribution and functions in mouse oocytes. Environ. Res. 185 (2020).
44. Xu, Y. et al. Nonylphenol exposure affects mouse oocyte quality by inducing spindle defects and mitochondria dysfunction. Environ. Pollut. 266 (2020).
45. Van Blerkom J Mitochondria in human oogenesis and preimplantation embryogenesis: engines of metabolism, ionic regulation and developmental competence Reproduction 2004 128 269 280 10.1530/rep.1.00240 15333778
Van Blerkom, J. Mitochondria in human oogenesis and preimplantation embryogenesis: engines of metabolism, ionic regulation and developmental competence. Reproduction 128, 269–280 (2004).15333778 10.1530/rep.1.00240
46. Dumollard R Duchen M Sardet C Calcium signals and mitochondria at fertilisation Semin. Cell Dev. Biol. 2006 17 314 323 10.1016/j.semcdb.2006.02.009 16574440
Dumollard, R., Duchen, M. & Sardet, C. Calcium signals and mitochondria at fertilisation. Semin. Cell Dev. Biol. 17, 314–323 (2006).16574440 10.1016/j.semcdb.2006.02.009
47. Liu, M., Sims, D. A., Calarco, P. & Talbot, P. Biochemical heterogeneity, migration, and pre-fertilization release of mouse oocyte cortical granules. Reprod. Biol. Endocrinol. 1 (2003).
48. Liu, M. The biology and dynamics of mammalian cortical granules. Reprod. Biol. Endocrinol. 9 (2011).
49. Verlhac MH Lefebvre C Guillaud P Rassinier P Maro B Asymmetric division in mouse oocytes: with or without Mos Curr. Biol. 2000 10 1303 1306 10.1016/S0960-9822(00)00753-3 11069114
Verlhac, M. H., Lefebvre, C., Guillaud, P., Rassinier, P. & Maro, B. Asymmetric division in mouse oocytes: with or without Mos. Curr. Biol. 10, 1303–1306 (2000).11069114 10.1016/S0960-9822(00)00753-3
50. Machaca K Ca2+ signaling differentiation during oocyte maturation J. Cell. Physiol. 2007 213 331 340 10.1002/jcp.21194 17620315
Machaca, K. Ca2+ signaling differentiation during oocyte maturation. J. Cell. Physiol. 213, 331–340 (2007).17620315 10.1002/jcp.21194
51. FitzHarris G Marangos P Carroll J Changes in endoplasmic reticulum structure during mouse oocyte maturation are controlled by the cytoskeleton and cytoplasmic dynein Dev. Biol. 2007 305 133 144 10.1016/j.ydbio.2007.02.006 17368610
FitzHarris, G., Marangos, P. & Carroll, J. Changes in endoplasmic reticulum structure during mouse oocyte maturation are controlled by the cytoskeleton and cytoplasmic dynein. Dev. Biol. 305, 133–144 (2007).17368610 10.1016/j.ydbio.2007.02.006
52. Kan R Regulation of mouse oocyte microtubule and organelle dynamics by PADI6 and the cytoplasmic lattices Dev. Biol. 2011 350 311 322 10.1016/j.ydbio.2010.11.033 21147087
Kan, R. et al. Regulation of mouse oocyte microtubule and organelle dynamics by PADI6 and the cytoplasmic lattices. Dev. Biol. 350, 311–322 (2011).21147087 10.1016/j.ydbio.2010.11.033
53. Sun, M. H. et al. Ral GTPase is essential for actin dynamics and Golgi apparatus distribution in mouse oocyte maturation. Cell Div. 16 (2021).
54. He, M., Zhang, T., Yang, Y. & Wang, C. Mechanisms of Oocyte Maturation and Related Epigenetic Regulation. Front. cell Dev. Biol. 9 (2021).
55. Arora, A. et al. The Role of Alternative Polyadenylation in the Regulation of Subcellular RNA Localization. Front. Genet. 12 (2022).
56. Piccioni F Zappavigna V Verrotti AC Translational regulation during oogenesis and early development: the cap-poly(A) tail relationship C. R. Biol. 2005 328 863 881 10.1016/j.crvi.2005.05.006 16286077
Piccioni, F., Zappavigna, V. & Verrotti, A. C. Translational regulation during oogenesis and early development: the cap-poly(A) tail relationship. C. R. Biol. 328, 863–881 (2005).16286077 10.1016/j.crvi.2005.05.006
57. Chen J Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition Genes Dev. 2011 25 755 766 10.1101/gad.2028911 21460039
Chen, J. et al. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, 755–766 (2011).21460039 10.1101/gad.2028911
58. Su YQ Selective degradation of transcripts during meiotic maturation of mouse oocytes Dev. Biol. 2007 302 104 117 10.1016/j.ydbio.2006.09.008 17022963
Su, Y. Q. et al. Selective degradation of transcripts during meiotic maturation of mouse oocytes. Dev. Biol. 302, 104–117 (2007).17022963 10.1016/j.ydbio.2006.09.008
59. Sha QQ Zhang J Fan HY A story of birth and death: mRNA translation and clearance at the onset of maternal-to-zygotic transition in mammals† Biol. Reprod. 2019 101 579 590 10.1093/biolre/ioz012 30715134
Sha, Q. Q., Zhang, J. & Fan, H. Y. A story of birth and death: mRNA translation and clearance at the onset of maternal-to-zygotic transition in mammals†. Biol. Reprod. 101, 579–590 (2019).30715134 10.1093/biolre/ioz012
60. Yang Y Maternal mRNAs with distinct 3′ UTRs define the temporal pattern of Ccnb1 synthesis during mouse oocyte meiotic maturation Genes Dev. 2017 31 1302 1307 10.1101/gad.296871.117 28808066
Yang, Y. et al. Maternal mRNAs with distinct 3′ UTRs define the temporal pattern of Ccnb1 synthesis during mouse oocyte meiotic maturation. Genes Dev. 31, 1302–1307 (2017).28808066 10.1101/gad.296871.117
61. Bennett J Baumgarten SC Stocco C GATA4 and GATA6 silencing in ovarian granulosa cells affects levels of mRNAs involved in steroidogenesis, extracellular structure organization, IGF-I activity, and apoptosis Endocrinology 2013 154 4845 4858 10.1210/en.2013-1410 24064357
Bennett, J., Baumgarten, S. C. & Stocco, C. GATA4 and GATA6 silencing in ovarian granulosa cells affects levels of mRNAs involved in steroidogenesis, extracellular structure organization, IGF-I activity, and apoptosis. Endocrinology 154, 4845–4858 (2013).24064357 10.1210/en.2013-1410
62. Rotgers, E. et al. Constitutive expression of Steroidogenic factor-1 (NR5A1) disrupts ovarian functions, fertility, and metabolic homeostasis in female mice. FASEB J. 35 (2021).
63. Suyama A Roles of NR5A1 and NR5A2 in the regulation of steroidogenesis by Clock gene and bone morphogenetic proteins by human granulosa cells Endocr. J. 2021 68 1283 1291 10.1507/endocrj.EJ21-0223 34176817
Suyama, A. et al. Roles of NR5A1 and NR5A2 in the regulation of steroidogenesis by Clock gene and bone morphogenetic proteins by human granulosa cells. Endocr. J. 68, 1283–1291 (2021).34176817 10.1507/endocrj.EJ21-0223
64. Jeyasuria P Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function Mol. Endocrinol. 2004 18 1610 1619 10.1210/me.2003-0404 15118069
Jeyasuria, P. et al. Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function. Mol. Endocrinol. 18, 1610–1619 (2004).15118069 10.1210/me.2003-0404
65. Halbleib JM Nelson WJ Cadherins in development: cell adhesion, sorting, and tissue morphogenesis Genes Dev. 2006 20 3199 3214 10.1101/gad.1486806 17158740
Halbleib, J. M. & Nelson, W. J. Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev. 20, 3199–3214 (2006).17158740 10.1101/gad.1486806
66. Maître, J. L. & Heisenberg, C. P. Three functions of cadherins in cell adhesion. Curr. Biol. 23 (2013).
67. St. Croix B E-Cadherin-dependent growth suppression is mediated by the cyclin-dependent kinase inhibitor p27(KIP1) J. Cell Biol. 1998 142 557 571 10.1083/jcb.142.2.557 9679152
St. Croix, B. et al. E-Cadherin-dependent growth suppression is mediated by the cyclin-dependent kinase inhibitor p27(KIP1). J. Cell Biol. 142, 557–571 (1998).9679152 10.1083/jcb.142.2.557
68. Klezovitch, O. & Vasioukhin, V. Cadherin signaling: Keeping cells in touch. F1000Research 4 (2015).
69. Kim NG Koh E Chen X Gumbiner BM E-cadherin mediates contact inhibition of proliferation through Hippo signaling-pathway components Proc. Natl. Acad. Sci. USA 2011 108 11930 11935 10.1073/pnas.1103345108 21730131
Kim, N. G., Koh, E., Chen, X. & Gumbiner, B. M. E-cadherin mediates contact inhibition of proliferation through Hippo signaling-pathway components. Proc. Natl. Acad. Sci. USA 108, 11930–11935 (2011).21730131 10.1073/pnas.1103345108
70. Silvis, M. R. et al. α-catenin is a tumor suppressor that controls cell accumulation by regulating the localization and activity of the transcriptional coactivator Yap1. Sci. Signal. 4 (2011).
71. Stepniak, E., Radice, G. L. & Vasioukhin, V. Adhesive and signaling functions of cadherins and catenins in vertebrate development. Cold Spring Harb. Perspect. Biol. 1 (2009).
72. Piprek RP Molecular mechanisms underlying female sex determination–antagonism between female and male pathway Folia Biol. (Praha). 2009 57 105 113 10.3409/fb57_3-4.105-113
Piprek, R. P. Molecular mechanisms underlying female sex determination–antagonism between female and male pathway. Folia Biol. (Praha). 57, 105–113 (2009).10.3409/fb57_3-4.105-113
73. Dhori X Gioiosa S Gonfloni S 2024 Alternative Splicing dataset. Figshare 10.6084/m9.figshare.23822445.v2
Dhori, X., Gioiosa, S. & Gonfloni, S. Alternative Splicing dataset. Figshare10.6084/m9.figshare.23822445.v2 (2024).10.6084/m9.figshare.23822445.v2
74. Molecular Cloning of a Novel Member of the Eukaryotic Polypeptide Chain-Releasing Factors (eRF). Journal of Biological Chemistry 273(35), 22254–22259 10.1074/jbc.273.35.22254 (1998).
75. Bassermann F Eichner R Pagano M The ubiquitin proteasome system - implications for cell cycle control and the targeted treatment of cancer Biochim. Biophys. Acta 2014 1843 150 162 10.1016/j.bbamcr.2013.02.028 23466868
Bassermann, F., Eichner, R. & Pagano, M. The ubiquitin proteasome system - implications for cell cycle control and the targeted treatment of cancer. Biochim. Biophys. Acta 1843, 150–162 (2014).23466868 10.1016/j.bbamcr.2013.02.028
76. Jones KT Anaphase-promoting complex control in female mouse meiosis Results Probl. Cell Differ. 2011 53 343 363 10.1007/978-3-642-19065-0_15 21630152
Jones, K. T. Anaphase-promoting complex control in female mouse meiosis. Results Probl. Cell Differ. 53, 343–363 (2011).21630152 10.1007/978-3-642-19065-0_15
77. Huo LJ Regulation of ubiquitin-proteasome pathway on pig oocyte meiotic maturation and fertilization Biol. Reprod. 2004 71 853 862 10.1095/biolreprod.104.028134 15115724
Huo, L. J. et al. Regulation of ubiquitin-proteasome pathway on pig oocyte meiotic maturation and fertilization. Biol. Reprod. 71, 853–862 (2004).15115724 10.1095/biolreprod.104.028134
78. Sato T STT3B-dependent posttranslational N-glycosylation as a surveillance system for secretory protein Mol. Cell 2012 47 99 110 10.1016/j.molcel.2012.04.015 22607976
Sato, T. et al. STT3B-dependent posttranslational N-glycosylation as a surveillance system for secretory protein. Mol. Cell 47, 99–110 (2012).22607976 10.1016/j.molcel.2012.04.015
79. Jo Y Hartman IZ DeBose-Boyd RA Ancient ubiquitous protein-1 mediates sterol-induced ubiquitination of 3-hydroxy-3-methylglutaryl CoA reductase in lipid droplet-associated endoplasmic reticulum membranes Mol. Biol. Cell 2013 24 169 183 10.1091/mbc.e12-07-0564 23223569
Jo, Y., Hartman, I. Z. & DeBose-Boyd, R. A. Ancient ubiquitous protein-1 mediates sterol-induced ubiquitination of 3-hydroxy-3-methylglutaryl CoA reductase in lipid droplet-associated endoplasmic reticulum membranes. Mol. Biol. Cell 24, 169–183 (2013).23223569 10.1091/mbc.e12-07-0564
80. Kaneko M Ishiguro M Niinuma Y Uesugi M Nomura Y Human HRD1 protects against ER stress-induced apoptosis through ER-associated degradation FEBS Lett. 2002 532 147 152 10.1016/S0014-5793(02)03660-8 12459480
Kaneko, M., Ishiguro, M., Niinuma, Y., Uesugi, M. & Nomura, Y. Human HRD1 protects against ER stress-induced apoptosis through ER-associated degradation. FEBS Lett. 532, 147–152 (2002).12459480 10.1016/S0014-5793(02)03660-8
81. Nadav E A novel mammalian endoplasmic reticulum ubiquitin ligase homologous to the yeast Hrd1 Biochem. Biophys. Res. Commun. 2003 303 91 97 10.1016/S0006-291X(03)00279-1 12646171
Nadav, E. et al. A novel mammalian endoplasmic reticulum ubiquitin ligase homologous to the yeast Hrd1. Biochem. Biophys. Res. Commun. 303, 91–97 (2003).12646171 10.1016/S0006-291X(03)00279-1
82. Yuan YF SUMO-1 plays crucial roles for spindle organization, chromosome congression, and chromosome segregation during mouse oocyte meiotic maturation Mol. Reprod. Dev. 2014 81 712 724 10.1002/mrd.22339 25123474
Yuan, Y. F. et al. SUMO-1 plays crucial roles for spindle organization, chromosome congression, and chromosome segregation during mouse oocyte meiotic maturation. Mol. Reprod. Dev. 81, 712–724 (2014).25123474 10.1002/mrd.22339
83. Rodriguez, A. et al. Loss of the E2 SUMO-conjugating enzyme Ube2i in oocytes during ovarian folliculogenesis causes infertility in mice. Development 146 (2019).
84. Bhatnagar S TRIM37 is a new histone H2A ubiquitin ligase and breast cancer oncoprotein Nature 2014 516 116 120 10.1038/nature13955 25470042
Bhatnagar, S. et al. TRIM37 is a new histone H2A ubiquitin ligase and breast cancer oncoprotein. Nature 516, 116–120 (2014).25470042 10.1038/nature13955
85. Balestra FR Strnad P Flückiger I Gönczy P Discovering regulators of centriole biogenesis through siRNA-based functional genomics in human cells Dev. Cell 2013 25 555 571 10.1016/j.devcel.2013.05.016 23769972
Balestra, F. R., Strnad, P., Flückiger, I. & Gönczy, P. Discovering regulators of centriole biogenesis through siRNA-based functional genomics in human cells. Dev. Cell 25, 555–571 (2013).23769972 10.1016/j.devcel.2013.05.016
86. Wang W Xia ZJ Farré JC Subramani S TRIM37, a novel E3 ligase for PEX5-mediated peroxisomal matrix protein import J. Cell Biol. 2017 216 2843 2858 10.1083/jcb.201611170 28724525
Wang, W., Xia, Z. J., Farré, J. C. & Subramani, S. TRIM37, a novel E3 ligase for PEX5-mediated peroxisomal matrix protein import. J. Cell Biol. 216, 2843–2858 (2017).28724525 10.1083/jcb.201611170
87. Danielsen JR DNA damage-inducible SUMOylation of HERC2 promotes RNF8 binding via a novel SUMO-binding Zinc finger J. Cell Biol. 2012 197 179 187 10.1083/jcb.201106152 22508508
Danielsen, J. R. et al. DNA damage-inducible SUMOylation of HERC2 promotes RNF8 binding via a novel SUMO-binding Zinc finger. J. Cell Biol. 197, 179–187 (2012).22508508 10.1083/jcb.201106152
88. Wang H Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage Mol. Cell 2006 22 383 394 10.1016/j.molcel.2006.03.035 16678110
Wang, H. et al. Histone H3 and H4 ubiquitylation by the CUL4-DDB-ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol. Cell 22, 383–394 (2006).16678110 10.1016/j.molcel.2006.03.035
89. Kapetanaki MG The DDB1-CUL4ADDB2 ubiquitin ligase is deficient in xeroderma pigmentosum group E and targets histone H2A at UV-damaged DNA sites Proc. Natl. Acad. Sci. USA 2006 103 2588 2593 10.1073/pnas.0511160103 16473935
Kapetanaki, M. G. et al. The DDB1-CUL4ADDB2 ubiquitin ligase is deficient in xeroderma pigmentosum group E and targets histone H2A at UV-damaged DNA sites. Proc. Natl. Acad. Sci. USA 103, 2588–2593 (2006).16473935 10.1073/pnas.0511160103
90. Yoon SY Over-expression of human UREB1 in colorectal cancer: HECT domain of human UREB1 inhibits the activity of tumor suppressor p53 protein Biochem. Biophys. Res. Commun. 2005 326 7 17 10.1016/j.bbrc.2004.11.004 15567145
Yoon, S. Y. et al. Over-expression of human UREB1 in colorectal cancer: HECT domain of human UREB1 inhibits the activity of tumor suppressor p53 protein. Biochem. Biophys. Res. Commun. 326, 7–17 (2005).15567145 10.1016/j.bbrc.2004.11.004
91. Liu Z Oughtred R Wing SS Characterization of E3Histone, a novel testis ubiquitin protein ligase which ubiquitinates histones Mol. Cell. Biol. 2005 25 2819 2831 10.1128/MCB.25.7.2819-2831.2005 15767685
Liu, Z., Oughtred, R. & Wing, S. S. Characterization of E3Histone, a novel testis ubiquitin protein ligase which ubiquitinates histones. Mol. Cell. Biol. 25, 2819–2831 (2005).15767685 10.1128/MCB.25.7.2819-2831.2005
92. Chen D ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor Cell 2005 121 1071 1083 10.1016/j.cell.2005.03.037 15989956
Chen, D. et al. ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 121, 1071–1083 (2005).15989956 10.1016/j.cell.2005.03.037
93. Parsons JL Ubiquitin ligase ARF-BP1/Mule modulates base excision repair EMBO J. 2009 28 3207 3215 10.1038/emboj.2009.243 19713937
Parsons, J. L. et al. Ubiquitin ligase ARF-BP1/Mule modulates base excision repair. EMBO J. 28, 3207–3215 (2009).19713937 10.1038/emboj.2009.243
94. Rajarajan P Gil SE Brennand KJ Akbarian S Spatial genome organization and cognition Nat. Rev. Neurosci. 2016 17 681 691 10.1038/nrn.2016.124 27708356
Rajarajan, P., Gil, S. E., Brennand, K. J. & Akbarian, S. Spatial genome organization and cognition. Nat. Rev. Neurosci. 17, 681–691 (2016).27708356 10.1038/nrn.2016.124
95. Higa LA Involvement of CUL4 ubiquitin E3 ligases in regulating CDK inhibitors Dacapo/p27Kip1 and cyclin E degradation Cell Cycle 2006 5 71 77 10.4161/cc.5.1.2266 16322693
Higa, L. A. et al. Involvement of CUL4 ubiquitin E3 ligases in regulating CDK inhibitors Dacapo/p27Kip1 and cyclin E degradation. Cell Cycle 5, 71–77 (2006).16322693 10.4161/cc.5.1.2266
96. Zou Y Characterization of nuclear localization signal in the N terminus of CUL4B and its essential role in cyclin E degradation and cell cycle progression J. Biol. Chem. 2009 284 33320 33332 10.1074/jbc.M109.050427 19801544
Zou, Y. et al. Characterization of nuclear localization signal in the N terminus of CUL4B and its essential role in cyclin E degradation and cell cycle progression. J. Biol. Chem. 284, 33320–33332 (2009).19801544 10.1074/jbc.M109.050427
97. Ghosh P Wu M Zhang H Sun H mTORC1 signaling requires proteasomal function and the involvement of CUL4-DDB1 ubiquitin E3 ligase Cell Cycle 2008 7 373 381 10.4161/cc.7.3.5267 18235224
Ghosh, P., Wu, M., Zhang, H. & Sun, H. mTORC1 signaling requires proteasomal function and the involvement of CUL4-DDB1 ubiquitin E3 ligase. Cell Cycle 7, 373–381 (2008).18235224 10.4161/cc.7.3.5267
98. Hu, L., Zhang, H., Bergholz, J., Sun, S. & Xiao, Z. X. J. MDM2/MDMX: Master negative regulators for p53 and RB. Mol. Cell. Oncol. 3 (2016).
99. Animal welfare problems arising as a result of FMD: short-term solutions - PubMed. https://pubmed.ncbi.nlm.nih.gov/11338712/.
100. Hautbergue GM Hung ML Golovanov AP Lian LY Wilson SA Mutually exclusive interactions drive handover of mRNA from export adaptors to TAP Proc. Natl. Acad. Sci. USA 2008 105 5154 5159 10.1073/pnas.0709167105 18364396
Hautbergue, G. M., Hung, M. L., Golovanov, A. P., Lian, L. Y. & Wilson, S. A. Mutually exclusive interactions drive handover of mRNA from export adaptors to TAP. Proc. Natl. Acad. Sci. USA 105, 5154–5159 (2008).18364396 10.1073/pnas.0709167105
101. Roundtree, I. A. et al. YTHDC1 mediates nuclear export of N6-methyladenosine methylated mRNAs. Elife 6 (2017).
102. Pomeranz Krummel DA Oubridge C Leung AKW Li J Nagai K Crystal structure of human spliceosomal U1 snRNP at 5.5 A resolution Nature 2009 458 475 480 10.1038/nature07851 19325628
Pomeranz Krummel, D. A., Oubridge, C., Leung, A. K. W., Li, J. & Nagai, K. Crystal structure of human spliceosomal U1 snRNP at 5.5 A resolution. Nature 458, 475–480 (2009).19325628 10.1038/nature07851
103. Kondo, Y., Oubridge, C., van Roon, A. M. M. & Nagai, K. Crystal structure of human U1 snRNP, a small nuclear ribonucleoprotein particle, reveals the mechanism of 5′ splice site recognition. Elife 4 (2015).
104. Waragai M PQBP-1, a novel polyglutamine tract-binding protein, inhibits transcription activation by Brn-2 and affects cell survival Hum. Mol. Genet. 1999 8 977 987 10.1093/hmg/8.6.977 10332029
Waragai, M. et al. PQBP-1, a novel polyglutamine tract-binding protein, inhibits transcription activation by Brn-2 and affects cell survival. Hum. Mol. Genet. 8, 977–987 (1999).10332029 10.1093/hmg/8.6.977
105. Okazawa H Interaction between mutant ataxin-1 and PQBP-1 affects transcription and cell death Neuron 2002 34 701 713 10.1016/S0896-6273(02)00697-9 12062018
Okazawa, H. et al. Interaction between mutant ataxin-1 and PQBP-1 affects transcription and cell death. Neuron 34, 701–713 (2002).12062018 10.1016/S0896-6273(02)00697-9
106. Wang Q Moore MJ Adelmant G Marto JA Silver PA PQBP1, a factor linked to intellectual disability, affects alternative splicing associated with neurite outgrowth Genes Dev. 2013 27 615 626 10.1101/gad.212308.112 23512658
Wang, Q., Moore, M. J., Adelmant, G., Marto, J. A. & Silver, P. A. PQBP1, a factor linked to intellectual disability, affects alternative splicing associated with neurite outgrowth. Genes Dev. 27, 615–626 (2013).23512658 10.1101/gad.212308.112
107. Tapia VE Y65C missense mutation in the WW domain of the Golabi-Ito-Hall syndrome protein PQBP1 affects its binding activity and deregulates pre-mRNA splicing. J. Biol. Chem. 2010 285 19391 19401 10.1074/jbc.M109.084525 20410308
Tapia, V. E. et al. Y65C missense mutation in the WW domain of the Golabi-Ito-Hall syndrome protein PQBP1 affects its binding activity and deregulates pre-mRNA. splicing. J. Biol. Chem. 285, 19391–19401 (2010).20410308 10.1074/jbc.M109.084525
108. Zhang, B. et al. MicroRNA Mediating Networks in Granulosa Cells Associated with Ovarian Follicular Development. Biomed Res. Int. 2017 (2017).
109. Gong Z Yang J Bai S Wei S MicroRNAs regulate granulosa cells apoptosis and follicular development - A review. Asian-Australasian J. Anim. Sci. 2020 33 1714 1724
Gong, Z., Yang, J., Bai, S. & Wei, S. MicroRNAs regulate granulosa cells apoptosis and follicular development - A review. Asian-Australasian. J. Anim. Sci. 33, 1714–1724 (2020).
110. Zhu HL Chen YQ Zhang ZF Downregulation of lncRNA ZFAS1 and upregulation of microRNA-129 repress endocrine disturbance, increase proliferation and inhibit apoptosis of ovarian granulosa cells in polycystic ovarian syndrome by downregulating HMGB1 Genomics 2020 112 3597 3608 10.1016/j.ygeno.2020.04.011 32320818
Zhu, H. L., Chen, Y. Q. & Zhang, Z. F. Downregulation of lncRNA ZFAS1 and upregulation of microRNA-129 repress endocrine disturbance, increase proliferation and inhibit apoptosis of ovarian granulosa cells in polycystic ovarian syndrome by downregulating HMGB1. Genomics 112, 3597–3608 (2020).32320818 10.1016/j.ygeno.2020.04.011
111. Madison-Villar MJ Michalak P Misexpression of testicular microRNA in sterile Xenopus hybrids points to tetrapod-specific microRNAs associated with male fertility J. Mol. Evol. 2011 73 316 324 10.1007/s00239-011-9478-8 22207500
Madison-Villar, M. J. & Michalak, P. Misexpression of testicular microRNA in sterile Xenopus hybrids points to tetrapod-specific microRNAs associated with male fertility. J. Mol. Evol. 73, 316–324 (2011).22207500 10.1007/s00239-011-9478-8
112. Hadden JW Steroid hormones and cancer Clin. Bull. 1980 10 121 126 6256096
Hadden, J. W. Steroid hormones and cancer. Clin. Bull. 10, 121–126 (1980).6256096
113. Wang L Zhao S Yu M Mechanism of Low Expression of miR-30a-5p on Epithelial-Mesenchymal Transition and Metastasis in Ovarian Cancer DNA Cell Biol. 2019 38 341 351 10.1089/dna.2018.4396 30839226
Wang, L., Zhao, S. & Yu, M. Mechanism of Low Expression of miR-30a-5p on Epithelial-Mesenchymal Transition and Metastasis in Ovarian Cancer. DNA Cell Biol. 38, 341–351 (2019).30839226 10.1089/dna.2018.4396
114. Wang Y FOXD1 is targeted by miR-30a-5p and miR-200a-5p and suppresses the proliferation of human ovarian carcinoma cells by promoting p21 expression in a p53-independent manner Int. J. Oncol. 2018 52 2130 2142 29620165
Wang, Y. et al. FOXD1 is targeted by miR-30a-5p and miR-200a-5p and suppresses the proliferation of human ovarian carcinoma cells by promoting p21 expression in a p53-independent manner. Int. J. Oncol. 52, 2130–2142 (2018).29620165
115. Lu, W. et al. Bioinformatics analysis of prognostic value and prospective pathway signal of miR-30a in ovarian cancer. J. Ovarian Res. 13 (2020).
116. Scalici, E. et al. Circulating microRNAs in follicular fluid, powerful tools to explore in vitro fertilization process. Sci. Rep. 6 (2016).
117. Xu X Xu X Wang X Shen L Baicalin suppress the development of polycystic ovary syndrome via regulating the miR-874-3p/FOXO3 and miR-144/FOXO1 axis Pharm. Biol. 2023 61 878 885 10.1080/13880209.2023.2208636 37272921
Xu, X., Xu, X., Wang, X. & Shen, L. Baicalin suppress the development of polycystic ovary syndrome via regulating the miR-874-3p/FOXO3 and miR-144/FOXO1 axis. Pharm. Biol. 61, 878–885 (2023).37272921 10.1080/13880209.2023.2208636
118. Naji M Expression of miR-15a, miR-145, and miR-182 in granulosa-lutein cells, follicular fluid, and serum of women with polycystic ovary syndrome (PCOS) Arch. Gynecol. Obstet. 2018 297 221 231 10.1007/s00404-017-4570-y 29071578
Naji, M. et al. Expression of miR-15a, miR-145, and miR-182 in granulosa-lutein cells, follicular fluid, and serum of women with polycystic ovary syndrome (PCOS). Arch. Gynecol. Obstet. 297, 221–231 (2018).29071578 10.1007/s00404-017-4570-y
119. Li Y Dysregulated miR-142, -33b and -423 in granulosa cells target TGFBR1 and SMAD7: a possible role in polycystic ovary syndrome Mol. Hum. Reprod. 2019 25 638 646 10.1093/molehr/gaz014 30865275
Li, Y. et al. Dysregulated miR-142, -33b and -423 in granulosa cells target TGFBR1 and SMAD7: a possible role in polycystic ovary syndrome. Mol. Hum. Reprod. 25, 638–646 (2019).30865275 10.1093/molehr/gaz014
120. Ashmawy AM Crosstalk between liver-related microRNAs and Wnt/β-catenin pathway in hepatocellular carcinoma patients Arab J. Gastroenterol. 2017 18 144 150 10.1016/j.ajg.2017.09.001 28958640
Ashmawy, A. M. et al. Crosstalk between liver-related microRNAs and Wnt/β-catenin pathway in hepatocellular carcinoma patients. Arab J. Gastroenterol. 18, 144–150 (2017).28958640 10.1016/j.ajg.2017.09.001
121. Hu B MicroRNA-148a-3p Directly Targets SERPINE1 to Suppress EMT-Mediated Colon Adenocarcinoma Progression Cancer Manag. Res. 2021 13 6349 6362 10.2147/CMAR.S302777 34408494
Hu, B. et al. MicroRNA-148a-3p Directly Targets SERPINE1 to Suppress EMT-Mediated Colon Adenocarcinoma Progression. Cancer Manag. Res. 13, 6349–6362 (2021).34408494 10.2147/CMAR.S302777
122. Bai L Aberrant elevation of GDF8 impairs granulosa cell glucose metabolism via upregulating SERPINE1 expression in patients with PCOS Mol. Ther. Nucleic Acids 2020 23 294 309 10.1016/j.omtn.2020.11.005 33425488
Bai, L. et al. Aberrant elevation of GDF8 impairs granulosa cell glucose metabolism via upregulating SERPINE1 expression in patients with PCOS. Mol. Ther. Nucleic Acids 23, 294–309 (2020).33425488 10.1016/j.omtn.2020.11.005
123. Xu, Z. et al. miRNA profiling of chicken follicles during follicular development. Sci. Rep. 14 (2024).
124. Chen, P. et al. MiR196a-5p in extracellular vesicles released from human nasopharyngeal carcinoma enhance the phagocytosis and secretion of microglia by targeting ROCK1. Exp. Cell Res. 411 (2022).
125. Sebbagh M Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane blebbing Nat. Cell Biol. 2001 3 346 352 10.1038/35070019 11283607
Sebbagh, M. et al. Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane blebbing. Nat. Cell Biol. 3, 346–352 (2001).11283607 10.1038/35070019
126. Wang, S. et al. MiR-145 regulates steroidogenesis in mouse primary granulosa cells through targeting Crkl. Life Sci. 282 (2021).
127. Ma L MiR-145 regulates steroidogenesis in mouse primary granulosa cells by targeting Arpc5 and subsequent cytoskeleton remodeling J. Reprod. Dev. 2023 69 154 162 10.1262/jrd.2022-137 37081667
Ma, L. et al. MiR-145 regulates steroidogenesis in mouse primary granulosa cells by targeting Arpc5 and subsequent cytoskeleton remodeling. J. Reprod. Dev. 69, 154–162 (2023).37081667 10.1262/jrd.2022-137
128. Peng JY MicroRNA-10b suppresses goat granulosa cell proliferation by targeting brain-derived neurotropic factor Domest. Anim. Endocrinol. 2016 54 60 67 10.1016/j.domaniend.2015.09.005 26513157
Peng, J. Y. et al. MicroRNA-10b suppresses goat granulosa cell proliferation by targeting brain-derived neurotropic factor. Domest. Anim. Endocrinol. 54, 60–67 (2016).26513157 10.1016/j.domaniend.2015.09.005
129. Jiajie, T., Yanzhou, Y., Hoi-Hung, A. C., Chen, Z. J. & Wai-Yee, C. Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Sci. Rep. 7 (2017).
130. Li Q Du X Pan Z Zhang L Li Q The transcription factor SMAD4 and miR-10b contribute to E2 release and cell apoptosis in ovarian granulosa cells by targeting CYP19A1 Mol. Cell. Endocrinol. 2018 476 84 95 10.1016/j.mce.2018.04.012 29723543
Li, Q., Du, X., Pan, Z., Zhang, L. & Li, Q. The transcription factor SMAD4 and miR-10b contribute to E2 release and cell apoptosis in ovarian granulosa cells by targeting CYP19A1. Mol. Cell. Endocrinol. 476, 84–95 (2018).29723543 10.1016/j.mce.2018.04.012
131. Liu J MiR-92a inhibits porcine ovarian granulosa cell apoptosis by targeting Smad7 gene FEBS Lett. 2014 588 4497 4503 10.1016/j.febslet.2014.10.021 25448599
Liu, J. et al. MiR-92a inhibits porcine ovarian granulosa cell apoptosis by targeting Smad7 gene. FEBS Lett. 588, 4497–4503 (2014).25448599 10.1016/j.febslet.2014.10.021
132. Li X Extraction and identification of exosomes from three different sources of human ovarian granulosa cells and analysis of their differential miRNA expression profiles J. Assist. Reprod. Genet. 2024 41 1371 1385 10.1007/s10815-024-03086-w 38492155
Li, X. et al. Extraction and identification of exosomes from three different sources of human ovarian granulosa cells and analysis of their differential miRNA expression profiles. J. Assist. Reprod. Genet. 41, 1371–1385 (2024).38492155 10.1007/s10815-024-03086-w
133. Wang C Identification of Differentially Expressed mRNAs and miRNAs and Related Regulatory Networks in Cumulus Oophorus Complexes Associated with Fertilization Reprod. Sci. 2024 31 1408 1419 10.1007/s43032-023-01413-7 38216777
Wang, C. et al. Identification of Differentially Expressed mRNAs and miRNAs and Related Regulatory Networks in Cumulus Oophorus Complexes Associated with Fertilization. Reprod. Sci. 31, 1408–1419 (2024).38216777 10.1007/s43032-023-01413-7
134. The role of WNT signaling in adult ovarian folliculogenesis. Reproduction 150(4), R137-R148, 10.1530/REP-14-0685 (2015).
135. Bahrami, A. et al. Dynamic modeling of folliculogenesis signaling pathways in the presence of miRNAs expression. Journal of Ovarian Research 10(1), 10.1186/s13048-017-0371-y (2017).
136. Zheng, W., Nagaraju, G., Liu, Z. & Liu, K. Functional roles of the phosphatidylinositol 3-kinases (PI3Ks) signaling in the mammalian ovary. Molecular and Cellular Endocrinology 356(1–2), 24–30, 10.1016/j.mce.2011.05.027 (2012).
137. Zhou Q miRNA profiling of granulosa cell-derived exosomes reveals their role in promoting follicle development J. Cell. Physiol. 2024 239 20 35 10.1002/jcp.31140 38149730
Zhou, Q. et al. miRNA profiling of granulosa cell-derived exosomes reveals their role in promoting follicle development. J. Cell. Physiol. 239, 20–35 (2024).38149730 10.1002/jcp.31140
138. Aoki, S. et al. miRNAs in Follicular and Oviductal Fluids Support Global DNA Demethylation in Early-Stage Embryos. Int. J. Mol. Sci. 25 (2024).
139. Kim D Paggi JM Park C Bennett C Salzberg SL Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Nat. Biotechnol. 2019 37 907 915 10.1038/s41587-019-0201-4 31375807
Kim, D., Paggi, J. M., Park, C., Bennett, C. & Salzberg, S. L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37, 907–915 (2019).31375807 10.1038/s41587-019-0201-4
140. Danecek, P. et al. Twelve years of SAMtools and BCFtools. Gigascience 10 (2021).
141. Kovaka, S. et al. Transcriptome assembly from long-read RNA-seq alignments with StringTie2. Genome Biol. 20 (2019).
142. StringTie. http://ccb.jhu.edu/software/stringtie/index.shtml?t=manual.
143. Dhori X Gioiosa S Gonfloni S 2014 Supplementary Materials Figshare 10.6084/m9.figshare.26245832.v3
Dhori, X. Gioiosa, S. & Gonfloni, S. Supplementary Materials. Figshare10.6084/m9.figshare.26245832.v3 (2014).10.6084/m9.figshare.26245832.v3
144. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq 2. Genome Biol. 15 (2014).
145. Wu, T. et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innov. (Cambridge 2 (2021).
146. Bioconductor - org.Hs.eg.db. https://bioconductor.org/packages/release/data/annotation/html/org.Hs.eg.db.html.
147. Vaquero-Garcia, J. et al. RNA splicing analysis using heterogeneous and large RNA-seq datasets. Nat. Commun. 14 (2023).
148. Vaquero-Garcia, J. et al. A new view of transcriptome complexity and regulation through the lens of local splicing variations. Elife 5 (2016).
149. MAJIQ | Welcome. https://majiq.biociphers.org/.
150. Csárdi, G. & Nepusz, T. The igraph software package for complex network research. (2006).
151. Friedländer MR MacKowiak SD Li N Chen W Rajewsky N miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades Nucleic Acids Res. 2012 40 37 52 10.1093/nar/gkr688 21911355
Friedländer, M. R., MacKowiak, S. D., Li, N., Chen, W. & Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 40, 37–52 (2012).21911355 10.1093/nar/gkr688
152. NEXTFLEX Small RNA-Seq v3 legacy - PerkinElmer Applied Genomics. https://perkinelmer-appliedgenomics.com/home/products/library-preparation-kits/small-rna-library-prep/nextflex-small-rna-seq-kit-v3-legacy/.
153. CRAN - Package VennDiagram. https://cran.r-project.org/web/packages/VennDiagram/index.html.
154. Ru Y The multiMiR R package and database: integration of microRNA–target interactions along with their disease and drug associations Nucleic Acids Res. 2014 42 e133 e133 10.1093/nar/gku631 25063298
Ru, Y. et al. The multiMiR R package and database: integration of microRNA–target interactions along with their disease and drug associations. Nucleic Acids Res. 42, e133–e133 (2014).25063298 10.1093/nar/gku631
155. Dhori X Gioiosa S Gonfloni S 2024 Small RNA-seq analysis datasets Figshare 10.6084/m9.figshare.23822448.v1
Dhori, X., Gioiosa, S. & Gonfloni, S. Small RNA-seq analysis datasets. Figshare10.6084/m9.figshare.23822448.v1 (2024).10.6084/m9.figshare.23822448.v1
