
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

71518
10.1038/s41598-024-71518-9
Article
Investigation of genes involved in scent and color production in Rosa damascena Mill
Kiani Hoda Sadat 1
Noudehi Manijeh Sabokdast 1
Shokrpour Majid 2
Zargar Meisam 3
Naghavi Mohammad Reza mnaghavi@ut.ac.ir

13
1 https://ror.org/05vf56z40 grid.46072.37 0000 0004 0612 7950 Division of Biotechnology, Department of Agronomy and Plant Breeding, College of Agricultural and Natural Resources, University of Tehran, Karaj, Iran
2 https://ror.org/05vf56z40 grid.46072.37 0000 0004 0612 7950 Department of Horticulture Science, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran
3 https://ror.org/02dn9h927 grid.77642.30 0000 0004 0645 517X Department of Agrobiotechnology, Institute of Agriculture, RUDN University, Moscow, Russia 117198
4 9 2024
4 9 2024
2024
14 2057613 5 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Rosa damascena Mill., commonly known as the King Flower, is a fragrant and important species of the Rosaceae family. It is widely used in the perfumery and pharmaceutical industries. The scent and color of the flowers are significant characteristics of this ornamental plant. This study aimed to investigate the relative expression of MYB1, CCD1, FLS, PAL, CER1, GT1, ANS and PAR genes under two growth stages (S1 and S2) in two morphs. The CCD1 gene pathway is highly correlated with the biosynthesis of volatile compounds. The results showed that the overexpression of MYB1, one of the important transcription factors in the production of fragrance and color, in the Hot pink morph of sample S2 increased the expression of PAR, PAL, FLS, RhGT1, CCD1, ANS, CER1, and GGPPS. The methyl jasmonate (MeJA) stimulant had a positive and cumulative effect on gene expression in most genes, such as FLS in ACC.26 of the S2 sample, RhGT1, MYB1, CCD1, PAR, ANS, CER1, and PAL in ACC.1. To further study, a comprehensive analysis was performed to evaluate the relationship between the principal volatile compounds and colors. Our data suggest that the rose with pink flowers had a higher accumulation content of flavonoids and anthocyanin. To separate essential oil compounds, GC/MS analysis identified 26 compounds in four samples. The highest amount of geraniol, one of the main components of damask rose, was found in the Hot pink flower, 23.54%, under the influence of the MeJA hormone.

Keywords

Color
Flower scent
Gene expression
GC/MS
q-PCR
R. damascena
Subject terms

Genetics
Plant sciences
University of Tehran54345 Naghavi Mohammad Reza issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Rose (Rosa damascena Mill.) is a cultivar of rose growing in most parts of Iran and is known for its floral fragrance and excellent color characteristics. It is the most economically valuable rose species in the production of aromatic compounds, which contains high levels of monoterpene alcohols such as geraniol, citronellol, and nerol, as well as phenyl ethyl alcohol1. The essential oil of R. damascena is a complex mixture of various compounds with a wide range of uses and in the food industry, it prevents food spoilage due to its harmless natural oil and antioxidant, antifungal, and antibacterial properties2. In the aromatic materials and perfumery industries, R. damascena essential oil is used to create higher-quality perfumes3,4. Additionally, due to its unique properties, R. damascena is a suitable choice for studying the different compounds of biosynthesis5.

R. damascena is divided into two main flowering groups; summer damascene and autumn damascene. The latter has white flowers and less fragrance, while the former has more popularity, more use, and higher economic value6,7. In this study, multiple genotypes of R. damascena in Iran are specified, but the exact number is not stated in the given context3. Despite limited information on the regulation of floral fragrance biosynthesis, only a few transcription factors, ODORANT1, EOBII, and PhMYB are involved in the regulation of volatile molecule biosynthesis in flowers8. The most abundant transcription factors in rose are the MYB family9. The MYB1 gene is involved in the biosynthesis of rose fragrance10, regulation of the relative expression of PAR (Phenylacetaldehyde Reductase), and the production of the 2-PE (2-Phenylethanol) component are also involved in the suppression or expression of target genes in color and smell11. Certain studies suggested that MYB is an important TF that regulates anthocyanin synthesis in ornamental flowers12–14. Sagawa et al.15 stated that a transcription factor called R2R3-MYB in the Mimulus lewisii plant plays an essential role in carotenoid metabolism.

The GGPPS (Geranylgeranyl diphosphate synthase) gene may be involved in the biosynthesis of volatile monoterpenes in the flowers of R. damascena. This gene can be important for adjusting the secondary metabolism of the aromatic components of R. damascena16. The CCD1 (Carotenoid Cleavage Dioxygenase 1) gene pathway is closely related to the biosynthesis of volatile compounds17. Increasing the expression of the CCD1 gene in the petals leads to discoloration and an increase in the amount of ketone compounds in the essential oil11. The CER1 (ECERIFERUM1) gene is an aldehyde decarboxylase encoder18, resistant to cold and drought stress, and the up regulation of the expression of this gene corresponds to an increase in the content of alkanes19. This gene is involved in the synthesis of the precursor aromatic compounds (VLC (very-long-chain) fatty acids) in the endoplasmic reticulum (ER)20.

ANS and RhGT1 are key genes in anthocyanin biosynthesis19. Glycosylation is a prerequisite for anthocyanin biosynthesis, and RhGT1, as a new glycosyltransferase, shows a novel pathway for anthocyanin biosynthesis21. Anthocyanin and other flavonoid components are produced through the phenylpropanoid pathway. Phenylalanine, the main precursor of flavonoids, is converted into required derivatives by the enzyme Phenylalanine ammonia-lyase (PAL). Dihydroflavonols can be transformed into flavonols and anthocyanins. The production of flavonols is catalyzed by the enzyme flavonol synthase (FLS), while dihydro flavonol 4-red case (DFR) is the first enzyme that takes part in the step-by-step cascade of anthocyanin synthesis. Stabilization and alteration of anthocyanin molecules affect the final color of the flower22. In addition, ANS gene is a major gene in anthocyanin biosynthesis, and overexpression of this gene may increase anthocyanin pigments in petals11. The main secondary metabolites of R. damascena are phenolic acids (gallic, caffeic, chlorogenic, and coumaric) and flavonoids (rutin, quercetin, kaempferol, and apigenin)23. Kanani et al. reported that the highest content of flavonoids was estimated in the fully open flower stage. In addition, the activity of PAL enzyme showed a positive association with the production of some flavonoids24.

Jasmonic acid (JA) and its derivatives are key messenger molecules and play an important role in many biological processes, such as growth inhibition, senescence, and plant defense25. MeJA has been used to increase the production of secondary metabolites by inducing defense responses in many species, such as volatile terpenoids in Amomum villosum26, triterpenes in Euphorbia pekinensis27 and Tropane alkaloids in Hyoscyamus niger28.

With these considerations in mind, the current study aimed to investigate the effectiveness of the mevalonic acid (MVA) and methylerythritol phosphate (MEP) pathway genes in the biosynthesis of aromatic compounds and the coloration of roses during two critical stages of flower development: bud and fully open flower. The study examined the effects of two different concentrations of MeJA on these processes. Additionally, the relative expression levels of the PAL, PAR, FLS, MYB1, CER1, GT1, CCD1, ANS, and GGPPS genes were measured in the treated samples. To gain a deeper understanding of the changes occurring during flower growth, gas chromatography-mass spectrometry (GC–MS) and real-time PCR techniques were employed to analyze the phytochemical and molecular alterations.

Materials and methods

Plant materials

The petal samples were collected from two morphs of R. damascena, in two colors, white and Hot pink, grown at the research station on the Agricultural Campus of the University of Tehran (35°48'N, 51°23'E, elevation 1305 m). Flower buds were harvested at two important flower developmental stages (S1 = budding stage, S2 = full opening stage) )Table 1). Both white and Hot pink morphs of R. damascena were grown under identical environmental conditions (mean temperature 25 ± 2°C, relative humidity 60 ± 5%, and 16/8 h light/dark photoperiod) in the orchard section of the faculty's farm. Uniform cultivation practices, including drip irrigation (4 L/plant/day), fertilization (NPK 20:20:20, 5 g/plant/month), and integrated pest management, were applied to both rose types. These measures ensured consistent climatic conditions and minimized abiotic stress differences between the morphs throughout the study period.Table 1 Characteristics R. damascena in two stages of flower growth (S1 = bud, S2 = full open flower).

The photographs were taken by one of the authors using their own camera.

To investigate the effect on gene expression, MeJA treatment was applied at two concentrations: 0 μM (control) and 300 μM, both prepared in a 0.1% (v/v) ethanol solution. Control plants were sprayed with distilled water containing 0.1% (v/v) ethanol. The solutions were applied using a handheld sprayer (2 mL per plant) at dawn to minimize evaporation. Samples were collected 48 h post-treatment. The harvested petals were immediately placed in sterile paper bags and transported to the laboratory in an aseptically maintained portable cooler at 4°C for essential oil extraction and physiological evaluation. For molecular analyses, petal samples were flash-frozen in liquid nitrogen on-site and subsequently stored in an ultra-low temperature freezer (Thermo Scientific™ Forma™ 88,000 Series, -80°C) for future processing 29–31.

Determination of total flavonoid content (TFC)

Total Flavonoid Content (TFC) was calculated based on the method introduced by Khorasani Esmaeili et al. (2015) with slight modifications. Solutions of 4% NaOH, 5% NaNO2, and 10% AlCl3 in distilled water were used to test. AlCl3 solution was prepared by gradually adding AlCl3 to distilled water under a the the Laminar Hood (Model NU-437-400E, NuAire, USA) carefully and steadily32. 25 μL of each sample solution, 100 μL of distilled water, and 7.5 μL of 5% NaNO2 solution (in eight replicates) were added to a 96-well plate (Corning, Catalog Number 3596). After 6 min, 7.5 μL of 10% AlCl3, 100 μL of 4% NaOH, and 0 μL of distilled water were added to each well. The plate was covered with aluminum foil, and the absorbance of the solutions was read after 15 min using a spectrophotometer. Absorbance was measured at 510 nm with an ELISA microplate reader (Model 680, Bio-Rad, Software version 1.2). TFC was expressed as mg of rutin equivalents (CTE) per gram of extract dry matter, using a calibration curve prepared with concentrations ranging from 0 to 100 μg/mL.

Determination of total anthocyanin content (TAC)

100 mg of petal tissue was dissolved in 100 ml of acidic methanol (methanol and hydrochloric acid at a volume ratio of 99:1) using a porcelain mortar and pestle. The desired solution was kept in the dark for 24 h at a temperature of 25°C. Subsequently, it was centrifuged (Hettich Universal 320R) for 15 min at 4000 rpm, and the absorbance of the supernatant was measured at a wavelength of 530 nm using a Thermo Scientific™ Evolution 201 UV–Visible spectrophotometer with Vision Pro Software version 4.0. Using the formula, A = εbc and considering the extinction coefficient (ε) equal to 33,000 mol2cm-1, concentration of the results was presented in μM per gram of fresh weight. In this formula, A = absorption of the high solution, b = cuvette path length, which is equal to 1, and c = concentration of anthocyanin per mole of fresh weight of the sample33.

Essential oil (EO) extraction and gas chromatography-mass spectrometry (GC/MS) analysis of the EOs compounds

To extract the essential oil by hydro-distillation method, 250 g of fresh petals were separated using Clevenger Apparatus (Quickfit, England) according to the method recommended by34. Then, the volatile oil layer on top of the aqueous layer was collected in a glass vial. The amount of essential oil was obtained based on the percentage ratio (v/w). The percentage of each component of the essential oil was determined using The GC–MS instrument, Agilent 7890A gas chromatograph coupled with a 5975C mass spectrometer detector (Agilent Technologies, USA), equipped with a mass spectrometer detector and CTC CombiPAL for liquid and headspaces. In the present study, a silica column (Resteck HP-5MS) made of 5% phenyl methyl silox and injector temperature of 325 °C were used with the following features: 60 m length, 320 µm diameter, and 0.25 µm of particle size. The injector ran in the splitless mode with a temperature of 280 °C. The temperature of the oven was set at 50 °C for 2 min, following an increased slope of 3 °C min−1 to 240 °C for 12 min, and then held to 290 °C at a rate of 20 °C min−1. The chromatographic separation was performed using a specific solvent system with a delayed solvent peak, resulting in a total run time of 79.833 min. The carrier gas was helium (purity 99.999%) flowing at a rate of 1.0 mL min−1. Peaks were analyzed with Mass lab software at one scan per second speed. Using the calculation of the Quartz coefficient (injection of normal n-alkane hydrocarbons (c11-c28) under the same conditions as the injection of essential oils), identifying essential oil compounds and checking the mass spectrum proposed by the GC–MS libraries, including "NIST05a.L & wiley7n.l ", were compared 35–37.

Extraction of ribonucleic acid (RNA), cDNA synthesis, and design of primers

Extraction of total ribonucleic acid from the tissues of young flower petals and buds was conducted using the manual CTAB method according to the slightly modified instructions38 and was treated with DNaseI (Qiagen, Germany) to remove genomic contamination. The quantity of RNA was assessed using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, USA), and the quality was evaluated by 1% agarose gel electrophoresis. To synthesize cDNA from RNA, Parstos cDNA synthesis kit (Pars Tous Biotechnology, Iran) was used Primers were designed for the Actin gene (as reference gene: KT965025.1), using Primer3 software (version 4.1.0). The proposed primers were evaluated using Oligo Analyzer online (Integrated DNA Technologies, USA) software to have key features (Self-Dimer, Hetero-Dimer, and Hairpin) and primer binding temperature. The pair of primers for the actin gene as a housekeeping gene and the primer for the studied genes are given in Table 2.Table 2 Characteristics of primers used in molecular expression by qRT-PCR.

Accession Number (Gene Bank)	Sequence in 5′-3’direction	Gene name	
KT965025.1	F: GTATCCATGAGACCACCTACAAC

R: GTCAGCAATACCAGGGAACATA

	Actin	
AB201048.1	F: TCACAATCCTCGCCTCAACT

R: AGGACTTGGAGGATGTTGGG

	RhGT1	
MG922976.1	F: GAGTACAGGAAGCCAGTGGT

R: CCACCATAGCTGTCCGTACCCTT

	PAL	
AB426519	F: ACAGACCCAAAGGCAGAAC

R: TCATCAACCACTACATCAGGAG

	PAR	
AB038247.1	F: AAGGGTGGGTGGATCATCTG

R: CATCACCACCAACTGCCTTC

	FLS	
XM_024319816.2	F: GGGAGATGGGTTGGTCATGA

R: CGATCAACAGAGTTGCCACC

	CER1	
EU082130.1	F: CTATGTCAAGACTCGCACGC

R: CAACGAGTGCAGGTGAGATG

	MYB1	
EU327776.1	F: CGAAAATTGAGGTTGGAGGA

R: GCATGGAACCCATATGGAAC

	CCD1	
BI977949	F: GCTCGTCAACAAGGAGAAGG

R: GGTAGAGGCGAGAGCTTCCT

	ANS	
KX661005.1	F: CACAAAACTGCGGCTCTTCT

R: AGTCCTTCCCAGCAGTCTTC

	GGPPS	

Real-time PCR analysis

The SYBR® Green Real-Time PCR Master Mix kit (Parstous, Iran), which has Syber-green, fluorescent dye, was used to perform the qRT-PCR test. The real-time PCR reaction was performed using the Rotor Q-gene device (Qiagen, Germany), according to the instructions kit. The Actin housekeeping gene was considered as internal control and for data normalization. The reaction program included 95°C for 15 min and 40 cycles: 95°C for 15 s, 60°C for 20 s, and 72°C for 20 s. All reactions were mixed, each with two technical replicates for statistical analysis, and the relative expression of genes was calculated using the formula39.

Plotting heatmap and dendrogram

In this study, cluster analysis was conducted to investigate the relationship between physiological parameters and genetic variables. For clustering, the heatmap package (version 3.1.3) in the R software (version 4.4.1) was used, and the distance matrix was calculated using the Ward method40. Information related to genes was placed in columns and samples in rows. Row clustering was represented with a dendrogram, and subsequently, different colors were assigned to genes to display expression values. Ultimately, a heatmap was drawn based on the data matrix and clusters. Colors were adjusted based on data values to make patterns and differences easily observable41.

Result

Extraction of essential oils and evaluation of volatile organic compounds (VOCs)

The essential oil extracted from 250 g of fresh R. damascena flowers had a delightful smell, which plays a significant role in attracting insects for pollination and is used in the perfumery and cosmetics industries. Separation and identification of essential oil compounds were conducted using GC/MS analysis. The Total Ion Chromatogram (TIC) of both white and Hot pink R. damascena flowers (Fig. 1) offers a comprehensive profile of the volatile compounds detected in the samples. In general, 26 compounds were identified in four samples (Table 3). Ten volatile compounds were found in the full opening stage of R. damascena, with the principal components being linalool, nerol, β-citronellol, geraniol, nonadecene, and heneicosane. Geraniol, linalool, and nerol are classified as acyclic monoterpenoids, which are a subgroup of terpenoids characterized by their linear structure without cyclic rings. Minor components included α-pinene, geranyl acetate, tricosane, and pentacosane. Although 13 species of monoterpenes and sesquiterpenes were detected, their overall abundance was lower compared to the more prevalent aliphatic components. Only a small number of monoterpenes and sesquiterpenes were found, whereas a large number of aliphatic components were found. The effect of MeJA treatment led to an increase in the volatile compounds such as α-Pinene, geraniol, β-citronellol, nerol, linalool, β-myrcene, β-pinene, sabinene, and geranyl acetate in white flowers, and geraniol and geranyl acetate in pink flowers (Fig. 2). The essential oil components have been classified into two main categories: major and minor, based on two primary criteria: first, the relative abundance of the components in the samples, and second, their impact on the floral aroma profile and industrial applications. Compounds such as linalool, although present in smaller absolute quantities, are categorized as major components due to their significant role in the overall scent of the flower. This classification considers not only the absolute amounts but also the importance of the compounds in various applications such as perfumery and attracting insects for pollination. Since minor components also play a crucial role in completing the aromatic profile and exerting biological effects, a comprehensive analysis of all identified compounds can provide a better understanding of the complex mechanisms underlying floral scent formation.Fig. 1 Total Ion Chromatogram (TIC) of white and Hot pink of R. damascena Mill fresh petals.

Table 3 Percentage composition of the essential oils isolated from samples of R. damascena petals.

No	Compound	RT (min)	White	Methyl white	Hot pink	Methyl pink	
% Area WR	% Area MW	% Area PR	% Area MP	
1	α-Pinene	15.286	1.57	4.60	2.56	1.87	
2	Sabinene	17.1	0.03	0.10	0.09	0.06	
3	β-Pinene	17.324	0.30	0.94	0.54	0.37	
4	β-Myrcene	17.836	0.20	0.54	0.48	0.33	
5	Linalool	23.477	0.65	0.93	1.67	1.59	
6	Phenethyl alcohol	24.546	0.24	0.44	0.53	0.48	
7	Nerol	29.792	0.81	0.8	3.38	1.94	
8	β-Citronellol	30.158	4.17	1.92	7.98	6.42	
9	Geraniol	31.372	9.22	11.94	21.98	23.54	
10	Geranyl acetate	36.711	3.59	6.55	5.29	5.88	
11	α-Humulene	40.004	0.05	0.08	0.08	0.06	
12	GERMACRENE-D	41.159	0.32	1.04	1.16	1.22	
13	δ-Cadinene	42.717	0.1	0.14	0.06	0.06	
14	n-Hexadecane	45.188	0.08	0.11	0.14	0.10	
15	n-Heptadecane	49.202	2.41	3.94	4.55	4.48	
16	2z,6e Farnesol	50.372	1.23	0.88	0.36	0.39	
17	n-Octadecane	52.550	0.13	0.13	0.19	0.17	
18	1-Nonadecene	55.370	3.73	5.07	3.69	4.09	
19	n-Nonadecane	56.649	18.80	16.39	19.40	16.67	
20	n-Eicosane	59.306	0.78	0.80	0.98	1.25	
21	n-Heneicosane	62.809	12.46	11.11	6.68	8.09	
22	n-Docosane	65.296	0.28	0.18	0.18	0.23	
23	9-Tricosene	67.396	3.51	3.40	0.53	0.67	
24	n-Tricosane	67.698	8.58	5.43	2.53	3.53	
25	n-Tetracosane	68.946	0.33	0.16	0.07	0.12	
26	n-Pentacosane	70.441	3.94	2.23	0.70	1.59	
WR: White flower, MW: MeJA-treated white flower, PR: Hot pink flower, MP: MeJA-treated Hot pink flower.

Fig. 2 Total Ion Chromatogram (TIC) of white and HotPink of R. damascena Mill. Fresh petals were treated with methyl jasmonate (MeJA) ) 300 µM for 48 h).

The results showed that the production rate of monoterpene compounds was 28.32%, sesquiterpene 2.14%, and aliphatic 48.95% in white petals after 48 h of the application of the MeJA. Similarly, the application of this hormone in Hot pink petals led to a decrease of 42.73% in terpenoid compounds and an increase of 40.99% in aliphatic compounds. The highest number of volatile compounds, including linalool (1.68%), β-citronellol (7.98%), and nerol (3.38%), were obtained in pink flowers. Meanwhile, the highest amount of geraniol (23.54%) was obtained from pink flowers under the influence of the MeJA hormone, which may have potential applications in various industries.

Total flavonoid content (TFC)

The total flavonoid content of the essential oil was determined according to42 using the aluminum chloride colorimetric method with slight modifications and rutin as the standard. The results were expressed as mg of rutin equivalents per every gram of dry weight of the plant (mg RE/g Dw). According to the results, the total flavonoid content (Fig. 3) in the Hot pink and white R. damascena petals were 133.20 and 79.30 mg RE/g Dw, respectively, showing a significant difference between the two morph. This difference is clearly demonstrated in Fig. 3, which shows higher flavonoid content in Hot pink petals compared to white petals.Fig. 3 Content of total flavonoid and anthocyanin in white and Hot pink petals of R. damascena.

Total anthocyanin content (TAC)

The results of the total anthocyanin content showed that the amount of TAC in Hot pink petals (37.48 µmol/g DW) and white petals (2.12 µmol/g DW) were significantly different. While the flavonoid content in pink petals was higher than that of white ones (Fig. 3), it's important to note that flavonoid content and anthocyanin content, although related, are not directly proportional. The amount of anthocyanin in pink petals was 18 times higher than that of white petals, which suggests a complex relationship between total flavonoid content and specific anthocyanin levels. This complexity suggests that although higher levels of flavonoids may be associated with a higher content of anthocyanins, they do not necessarily predict it.

Gene expression analysis

To evaluate the differences among the groups (S1, S2, TS1, and TS2) for each petal color, a one-way ANOVA followed by Duncan's multiple range test was performed. The results of the variance analysis are summarized in Table 4. The results of the ANOVA revealed significant differences among the treatment groups for several dependent variables. Specifically, the mean square values for ANS (11.844), PAR (1.741), CCD1 (310.66), PAL (2.851), FLS (39.623), CER1 (149.84), MYB1 (1258.29), and GT1 (9.453) were significantly higher compared to the error mean squares (1.98, 0.44, 0.1, 2.05, 0.66, 0.64, 9.86, 121.67, 0.91 respectively), indicating that the treatment groups had a significant effect on these variables (p < 0.01 or p < 0.05).Table 4 Analysis of variance (ANOVA) results for gene expression levels.

Sources	DF	Mean square	
ANS	GGPPS	PAR	CCD1	PAL	FLS	CER1	MYB1	RhGT1	
Gene Expression	7	11.844**	0.454 ns	1.741**	310.66**	2.851**	39.623**	149.84**	1258.29**	9.453**	
Error	16	1.98	0.44	0.1	2.05	0.66	0.64	9.86	121.67	0.91	
CV	23	94.08	67.99	46.05	28.78	78.46	38.86	100.77	121.76	49.05	
** and * indicate significant differences at the 1% and 5% levels, respectively, while ns denotes no significant difference.

Expression of genes (MYB1, CCD1, GGPPs) involved in fragrance and color in petals in two growth stages

The expression pattern of the CCD1 gene in two different morphs was found to be almost identical. The expression of this gene in ACC.1 was higher than in ACC.26, and the highest amount of expression was recorded for S1 stage under the influence of MeJA stimulus (30-fold increase). A highly significant effect of treatments on CCD1 was observed, with data analysis revealing a substantial interaction effect (P > 0.01) between genotype and different growth stages (S1 and S2). These results were in accordance with the biochemical data, as the number of flavonoids and anthocyanins in ACC.1 petal organ was higher compared to ACC.26. Furthermore, the expression of the CCD1 gene was found to be positively correlated with the number of ketone compounds in the petals. Volatile terpenoids synthesized from carotenoid cleavage contribute significantly to the aroma of roses, particularly in species like Rosa damascena, known for its distinct fragrance used in perfume production. Additionally, carotenoid-derived compounds can influence petal color through their effects43. The analysis of MYB1 gene expression revealed a decrease in ACC.26 and an increase in ACC.1 at the S2 stage compared to the control, suggesting enhanced fragrance and color. The treatments significantly impacted MYB1 levels, indicating a substantial influence of these treatments on this transcription factor. In ACC.1, the TS1 stage exhibited a threefold increase in expression compared to the control (S1), while the TS2 stage showed an eightfold increase. However, the effect of MeJA treatment was not as straightforward as initially interpreted. A comparison between the S2 stage (59-fold increase) and the MeJA-treated TS2 stage (eightfold increase) revealed a decrease in MYB1 expression. This decrease may be attributed to complex interactions between the developmental stage and internal gene regulation mechanisms rather than a direct negative effect of MeJA. It is important to note that the apparent decrease from S2 to TS2 could reflect the natural progression of gene expression during petal development, with MeJA potentially modulating this process rather than simply enhancing expression. There was no significant effect of the treatments on GGPPS, suggesting that the treatments did not significantly influence the GGPPS levels. On the other hand, in ACC.26, the relative expression of the GGPPS gene only experienced a slight rise in the S2 under the influence of MeJA treatment, whereas the effect of MeJA on gene expression was reduced in the first growth stage (Fig. 4).Fig. 4 Quantitative real-time PCR analysis of relative expression level of CCD1, GGPPS, MYB1 (scent and color biosynthetic gene) during flower development (S1 and S2) of two accession numbers (ACC.26 and ACC.1) in R. damascena. Relative expression was calculated based on the threshold cycle (CT) method after normalization to the beta-actin gene. Bud stage (S1) was selected as a reference for white (ACC.26) and Hot pink (ACC.1) petals. Vertical bars represent standard deviations (n = 3). [Abbreviations = S1:bud, S2: Full open flower, TS1: MeJA-treated bud, TS2: MeJA-treated Full open flower]. Error bars represent the values of the mean ± standard error (SE), with n = 3. Different letters (a and b) indicate significant differences (p < 0.05) among S1, S2, TS1, and TS2 for each petal color, as determined by one-way ANOVA followed by Duncan's multiple range test.

Expression of PAL, CER1, and PAR genes (involved in aroma) during two flower developmental stages

The results of analyzing the gene expression regarding scent in two control conditions (without MeJA treatment) and the conditions treated with MeJA (300 μM concentration 48 h before harvest) in R. damascena showed that in ACC.26 )white flowers(, The highest expression of the PAL gene was observed in the bud stage, with MeJA treatment having no significant effect on gene expression at this stage. In contrast, in ACC.1 (Hot pink petals), PAL gene expression was notably higher in the S2 stage. Moreover, the application of MeJA treatment in both biological stages increased PAL gene expression. Sample TS1 had the highest relative expression (2-folds) compared to the control in the PAR gene. MeJA elicitor was effective in the bud growth stage of ACC.1 while relative expression experienced a decrease compared to the control in other samples. The relative expression level of all CER1 gene samples decreased in comparison with the control, except for sample TS2, which had an increase in the biological stage of fully open flower in Hot pink morph under the influence of MeJA treatment. The frequency of the CER1 gene transcript, which is predicted to function in the synthesis of alkanes, was highly induced (20-Folds) by MeJA treatment (Fig. 5).Fig. 5 Quantitative real-time PCR analysis of relative expression level of PAL, CER1, PAR (aroma biosynthetic gene) during flower development (S1 and S2) of two accession numbers (Acc.26 and ACC.1) in R. damascena. Relative expression was calculated based on the threshold cycle (CT) method after normalization to the beta-actin gene. Bud stage (S1) was selected as a reference for white (Acc.26) and Hot pink (ACC.1) petals. Vertical bars represent standard deviations (n = 3). [Abbreviations = S1:bud, S2: Full open flower, TS1: MeJA-treated bud, TS2: MeJA-treated Full open flower]. Error bars represent the values of the mean ± standard error (SE), with n = 3. Different letters (a and b) indicate significant differences (p < 0.05) among S1, S2, TS1, and TS2 for each petal color, as determined by one-way ANOVA followed by Duncan's multiple range test.

Expression of FLS, GT1, and ANS genes (involved in petal color) in two growth stages

Anthocyanin, synthesized by the ANS gene, plays a crucial role in the coloration of Rosa damascena. In the S2 developmental stage without elicitor application, the relative expression of ANS significantly increased in the ACC.1 sample, reaching a peak with a sixfold elevation. Upon elicitor application during the TS2 stage, the relative expression of ANS increased twofold compared to the control in ACC.1. In contrast, the ACC.26 sample showed consistently low relative expression of the ANS gene across all developmental stages, with minimal variation. These molecular findings align with biochemical data, indicating that ACC.1, characterized by Hot pink petals, exhibits higher anthocyanin content relative to ACC.26. Additionally, the peak relative expression of the FLS gene was observed in the TS2 sample, showing an 11-fold increase. Analysis of the data demonstrated elevated FLS expression levels during the fully open flower growth stage in response to MeJA in ACC.1 (Hot pink morph). However, in ACC.26 (white morph), the expression of FLS was not enhanced by MeJA treatment. There was a highly significant effect of the treatments on FLS, indicating a substantial impact of the treatments on this variable in ACC.26. A comparison between samples Acc.26 and ACC.1 revealed differential expression levels of the GT1 gene during the S2 growth stage, with higher expression observed in the Hot pink morph (ACC.1) and lower expression in the white morph (Acc.26). The treatments had a significant effect on GT1 gene expression during stage S2, indicating a substantial influence on the gene's expression during this developmental stage. Specifically, MeJA treatment induced a positive and incremental effect exclusively in ACC.1 during stage S2, where gene expression progressively increased across stages S2, TS1, and TS2, particularly enhanced by MeJA. In contrast, gene expression in Acc.26 during stage S2 showed a slight decrease and minimal change under MeJA treatment. It is important to note that the expression of GT1 was not affected by MeJA treatment in the white morph (ACC.26) at any developmental stage (Fig. 6).Fig. 6 Quantitative real-time PCR analysis of Relative expression level of FLS, GT1, ANS (color biosynthetic gene) during flower development (S1 and S2) of two Accession numbers (Acc.26 and ACC.1) in R. damascena. Relative expression was calculated based on the threshold cycle (CT) method after normalization to the beta-actin gene. Bud stage (S1) was selected as a reference for white (Acc.26) and Hot pink (ACC.1) petals. Vertical bars represent standard deviations (n = 3). [Abbreviations = S1:bud, S2: Full open flower, TS1: MeJA-treated bud, TS2: MeJA-treated Full open flower]. Error bars represent the values of the mean ± standard error (SE), with n = 3. Different letters (a and b) indicate significant differences (p < 0.05) among S1, S2, TS1, and TS2 for each petal color, as determined by one-way ANOVA followed by Duncan's multiple range test.

Correlation and relationship between genes and parameters

Cluster analysis

The heatmap analysis revealed a categorization of the studied genes into two main clusters, prominently visible at the top and bottom. Despite the lack of a clear segregating pattern for these clusters or conditions, the need for enhanced visual analysis was underscored. The first cluster encompassed four genes (GT1, GGPPS, MYB1, and ANS), while the second cluster included five genes (CER1, PAL, CCD1, PAR, and FLS), all grouped based on their high gene expression. The horizontal cluster analysis, comprising five groups, indicated that white (W) and pink (P) petals each corresponded to a distinct cluster, albeit with exceptions. For instance, PS1, representing the bud stage of pink petals, was grouped with white petals, exhibiting low and negligible gene expression, akin to other white petals. An exception was observed in a white petal sample that demonstrated an increase in FLS gene expression, potentially attributable to the influence of the MeJA stimulant. Clustering based on the impact of the MeJA stimulant revealed that the genes FLS, CER1, PAL, CCD1, and PAR all fell within a single group, exhibiting the highest gene expression. In conclusion, the findings underscore the complexity of gene expression regulation in response to MeJA. They also highlight the variability in gene expression patterns among different samples, exemplified by the white petal sample exhibiting an anomalous increase in FLS gene expression. The PS2 sample emerged as the superior specimen, characterized by a substantial upregulation in the expression of genes GT1, GGPPS, MYB1, and ANS. (Fig. 7).Fig. 7 Shows the heatmap and cluster analysis of gene expression in distinct samples of white and pink petals under the influence of applied and unapplied MeJA-treatment. (PS2: Young stage pink flower; PT2: Young stage pink flower by MeJA-treatment ; PT1: Bud stage pink flower by MeJA-treatment ; WTS2: Young stage white flower by MeJA-treatment; WTS1: Bud stage white flower by MeJA-treatment; WS2: Young stagewhite flower; WS1: Bud stage white flowe; PS1:Bud stage pink flower ).

Discussion

The essential oil compounds of R. damascena were analyzed using GC/MS. Key components included linalool, nerol, β-citronellol, geraniol, nonadecene, and heneicosane, while α-pinene, geranyl acetate, tricosane, and pentacosane were minor. MeJA treatment notably increased α-pinene, geraniol, β-citronellol, nerol, linalool, β-myrcene, β-pinene, sabinene, and geranyl acetate in white flowers, and geraniol and geranyl acetate in Hot pink flowers. Geraniol and linalool are acyclic monoterpenoids, while nerol is an acyclic monoterpenoid alcohol found in numerous plants' essential oils. These compounds are widely used in the cosmetics and perfume industries due to their desirable scent. Valid medicinal properties, such as tumor cell growth inhibition in geraniol, antifungal effect in nerol, and anticonvulsant, antimicrobial, anti-inflammatory, and neuroprotective properties in linalool, have been reported for these compounds44.

Studies have shown that the amount of geraniol varies from 10 to 45 percent, and the climatic conditions, stresses, and growth stages of the plant effectively synthesize this substance in the R. damascena petal organ45,46. In the current study, we perceived a 1.5% increase for geraniol under the effect of elicitor compared to the condition without elicitor in the pink flower. Therefore, it is concluded that this treatment had a positive and increasing effect on the amount of geraniol.

Citronellol is a precursor to the aromatic composition of rose oxide and contributes to the sweet smell of essential oil. This compound is more important than geraniol in the perfumery industry47. A study on the volatile compounds of roses showed that the principal compounds of these oils are citronellol, geraniol, nerol, nonadecane, henicosan, and linalool. The study also demonstrated that the growth and location of flowers, i.e., climatic conditions, have a significant impact on the production of essential oils (volatile compounds)48.

The analysis of gene expression in the white morph shows that MeJA markedly increases the expression of FLS and ANS genes, independently of other environmental factors or external stimuli. These genes are pivotal in anthocyanin and flavonol biosynthesis, directly impacting the production and release of VOCs like α-pinene, geraniol, β-citronellol, nerol, linalool, β-myrcene, β-pinene, sabinene, and geranyl acetate49–51. This underscores the complex network of plant metabolism essential for coloration, defense, and environmental interactions52. Additionally, MeJA upregulates the expression of CCD1 and MYB1 genes in the pink morph. Specifically, CCD1 and MYB1 are upregulated at both the TS1 (bud stage) and TS2 (fully open flower stage) under MeJA treatment. CER1 is upregulated at the TS2 stage, and PAR is upregulated at the TS1 bud stage. This stimulation also results in elevated concentrations of geraniol and geranyl acetate in pink flowers, thereby supporting the biochemical analyses. These genes and enzymes play essential roles in biosynthetic pathways and regulatory networks that generate essential oil components and other metabolites. They enable diverse plant functions and adaptations to environmental signals and stressors53,54.

The analysis of Trachyspermum ammi L. essential oil compounds showed that the production rate of alpha terpene, the precursor of monoterpenes, increased after 24 h of applying the MeJA hormone. The MeJA elicitor stimulates the biosynthesis pathway of secondary compounds and affects the expression level of the MEP pathway genes one day after the hormone application, which increases the production of monoterpenes55–57. Previous research has shown that citronellol, geraniol, nerol, linalyl acetate, and dihydro citronellol acetate are the main components of rose essential oil, and their amount increases during the flower development process. The quantity of these compounds decreases at the end of flowering during flower aging16, which is consistent with the studies conducted during this review.

Anthocyanins, which are one of the six broad groups of plant phenols, are the main flower pigments in higher plants58,59. As flavonoids, these water-soluble pigments have a wide range of biological functions and positive effects on human health60,61. In natural conditions, anthocyanins are often found in the form of anthocyanin glycosides60 and are biosynthesized through the phenylpropanoid pathway, a branch of the shikimate pathway62. The color stability of anthocyanins is influenced by various factors, including the structure of the pigment, pH, temperature, oxygen, light, and water activity. The alteration of the anthocyanin structure is pH-dependent63, and the color change of anthocyanin-containing extracts ranges from purple to red in acidic solutions and from green to yellow in alkaline solutions64. In our experiment, the extract from pink petals was bright red (acidic), while the extract from white petals was yellowish, indicating the presence of a significant amount of anthocyanin in the tested samples. This observation indicates a significant presence of anthocyanins in the tested samples. Additionally, variations in carotenoid content may also contribute to the observed color differences, as carotenoids typically impart yellow to red hues, and their interaction with anthocyanins can further alter the perceived color. Therefore, the color differences observed in the extracts can be attributed to variations in anthocyanin content, the pH of the extracts, and potentially the carotenoid content. According to a report by Zvi et al. (2008), the production of volatile phenylpropanoid/benzenoid compounds in petunia increased tenfold with anthocyanin pigment65. Additionally, the results obtained from Chroho et al. on improving color retention without affecting the gustatory quality of strawberries show that the addition of polyphenols from R. damascena petals leads to an increase in the half-life and a decrease in the thermal degradation of strawberry anthocyanins66.

The Rosa damascena carotenoid cleavage dioxygenase 1 (RdCCD1) protein contributes to the formation of constituents of the rose aroma67. The CCD1 gene C13 nor isoprenoids such as β-damascenone, β-damaskone, and β-ionone are the key flavor compounds in rose essential oil, which are obtained from carotenoid degradation. Additionally, the CCD1 gene generates carotenoid-derived volatiles with fruity fragrance, using carotenoids as substrates, using carotenoids as substrates, through the Carotenoid Cleavage Dioxygenase (CCD) enzymes68. The carotenoid cleavage dioxygenase pathway, which is located downstream of the terpenoid biosynthesis pathway, is closely related to the biosynthesis of volatile compounds17. Transcription factors (TFs) act as the main regulators of cellular processes 69 and control gene expression in plants70. MYB transcription factors play a crucial role in the positive regulation of many secondary metabolites at the transcriptional level, including flower color formation, flavonoid synthesis71, and anthocyanin biosynthesis regulation72. GGPPS is responsible for the production of geranylgeranyl pyrophosphate (GGPP), which provides a platform for post-translational modification (geranylgeranylation) of proteins73. GGPPS is an essential enzyme in the isoprenoid biosynthesis pathway (IBP) and is involved in isoprenoid biosynthesis and metabolism74. GGPPS plays a key role in cytoskeleton regulation, signaling pathways, intracellular transport, and protein prenylation75.

Previous studies have shown that the MYB transcription factor, a key regulator, has the highest expression during petunia's release of flower scent compounds in the full flowering stage76. Additionally, the MYB transcription factor plays an important role in the aroma formation of pear fruit77. Several candidate transcription factors, such as MYB1, have been linked to metabolite flux in the phenylpropanoid pathway, resulting in the production of flavonols/anthocyanin in monocytogenes, which then produces fragrant white flowers of Narcissus and fragrant orange corollas of Narcissus tazetta8. Increasing the expression of the CCD1 gene also increases the amount of ketone compounds in the essential oil78. Earlier studies have shown that with the increase in the expression of CCD1 genes, the petals become colorless, which is consistent with our studies. Therefore, in the white morph , the petals become increasingly pale due to the increase in the growth stage. However, the Hot pink morph the S2 stage, under the influence of MeJA, led to increased gene activity and the relative paleness of the petals. Yu et al. demonstrated that the increase in geraniol content is directly influenced by the high expression of GGPPS in the petals of 'Old Blush' (OB, with intense aroma). The combination of IPP and DMAPP is the primary source for the synthesis of geranylgeranyl pyrophosphate (GGPP), farnesyl diphosphate (FPP), and geranyl pyrophosphate (GPP), which are from the terpene family49. GGPPS functions as a protein that plays a key role in cytoskeleton regulation, signaling pathways, intracellular transport, and protein prenylation 75.

As a key regulator, PAL catalyzes the first step in the biosynthesis of the phenylpropanoid pathway, which is the trans-cinnamic acid production from the deamination of phenylalanine79,80. PAL plays an important role in the biosynthesis of flavonoids81, the synthesis of phenylpropanoid/benzenoid volatiles in flowers82, and the biosynthesis of secondary metabolic pathways in higher plants83. PAR catalyzes the reduction of 2-phenylethylamine to produce 2-phenyl ethanol, a constituent of floral scent in petals84. The advantage of PAR is the reduction of the required ketone substrates, which is done by the regeneration of NADH and the oxidation of secondary alcohols, such as 2-propanol85. CER1, the main gene of the alkane biosynthesis pathway, is an alkane-forming enzyme86,87 that converts VLC aldehydes into alkanes88 and encodes aldehyde decarboxylase89, wax biosynthesis86 and plant flexibility in response to biotic and abiotic stresses90. The CER1 gene encodes a protein localized to the endoplasmic reticulum (ER) and plays a crucial role in the biosynthesis of VLC alkanes, which are integral components of plant cuticular waxes20,91. While the gene product does not directly synthesize aromatic compounds, the resulting long-chain alkanes can contribute to the VOCs profile of flowers. These compounds, although not aromatic per se, can influence floral scent composition and emission patterns49,92. The involvement of CER1 in alkane biosynthesis thus indirectly affects the overall olfactory characteristics of flowers, highlighting the complex interplay between seemingly unrelated metabolic pathways in determining floral volatile emissions. Cuticular wax also consists of VLC aliphatic fatty acid derivatives and aromatic compounds 93. CER1-mediated wax production on the petal organ is necessary for the synthesis of aliphatic components of the pollen wall87 and the "petal effect"94. Previous studies have shown that the CER1 gene leads to the production of 2-phenyl ethanol, which creates a pleasant scent in the petals85,95. The discrepancy between the increased expression of the CER1 gene and the slight increase in alkane content in Hot pink R. damascena following MeJA treatment can be attributed to several factors. First, the regulation of alkane biosynthesis is complex, involving multiple genes and enzymatic steps beyond CER1 expression, including post-transcriptional, translational, and post-translational modifications. Second, the availability of precursor molecules and metabolic flux through the alkane biosynthetic pathway can limit alkane production despite elevated CER1 levels. Third, MeJA's effects on gene expression and metabolite levels are influenced by environmental, physiological, and genetic conditions, which may vary across different experimental setups. Additionally, the presence of inhibitory or competitive pathways might also play a role in modulating the final alkane content. Therefore, the interplay of these factors likely explains the observed non-compliance between CER1 expression and alkane levels17,96,97. The studies demonstrated that the highest PAR transcript peaked in the petal and at the unfurling stage (fully open flower)98; also, PAR is classified as a short-chain dehydrogenase reductase (SDR). Some researchers have revealed that olive (Olea Europaea) is a rich source of bioactive polyphenols that can produce hydroxytyrosol, an important precursor of acetonide99–101. In this regard, PAR is one of the genes related to the synthesis of hydroxytyrosol. The results of the above-mentioned phenethylamine transcript study supply a basis for analyzing the acteoside synthesis pathway and extracting regulatory genes and key enzymes.

The ANS gene is a key gene responsible for synthesizing the final stage of anthocyanins. The enzyme encoded by this gene catalyzes the conversion of anthocyanidin precursors into colorless anthocyanidins54,102. Anthocyanin biosynthesis is carried out by a branch of the flavonoid biosynthesis pathway that is also responsible for isoflavonoid and flavonol biosynthesis103 .Glycosyltransferases (GT1) is another key gene involved in anthocyanin biosynthesis19. The main important aromatic and color compounds in R. damascena are 2-PE alcohol and anthocyanins, which are synthesized by PAR and ANS genes, respectively11. RhGT1 enzyme plays a role in anthocyanin biosynthesis by glycosylating precursors, which stabilizes the critical molecule21,104, that has an important function in the glycosylation of secondary metabolites and hormone regulation in plants. FLS is another key enzyme gene related to flower color105 and the biosynthesis pathway of flavonoids17. It catalyzes the production of flavonol from dihydro flavonol106 and plays a role in determining the synthesis of flavonol glycosides, which is one of the main branches of the flavonoid pathway107.

Different studies have been conducted on the expression of the ANS gene, which is a key gene in anthocyanin biosynthesis.Zhao et al. found that increasing ANS gene expression in Paeonia led to an increase in anthocyanin content in petals108, which is consistent with the results of the present study in ACC.1. Moreover, it was observed that there was no color change in Lisianthus plants due to the low expression of the ANS gene109, which is consistent with the results of the present study in ACC.26. Xu et al.110 confirmed that the reddening of leaves in red maple is regulated by the GT1 family genes, which affect anthocyanin accumulation. These findings are consistent with previous studies on the high expression of the FLS gene in white flowers of tobacco, which leads to the predominant accumulation of flavonol and a lack of anthocyanin111. Furthermore, Hu et al. studied three different colors of Scutellaria baicalensis petals (white, pink, and purple) and determined that the reduction in anthocyanin biosynthesis in white petals was due to the decreased activity of certain promoter regions of the ANS gene. This clarifies the mechanisms behind the color loss phenotype in the white flower of this plant112. Previous studies investigated molecular and phytochemical changes in four landraces of R. damascena in three growth stages and found that high expression of the RhANS gene, the key gene in anthocyanin biosynthesis, leads to an increase in anthocyanin pigments in petals. The highest amount of anthocyanin was observed in growth (stage b), while an increase in cell acidity in growth (stage c) led to a decrease in anthocyanin content11.

The clustering of network genes provides valuable insights into gene interactions, practical topics, and potential regulatory networks. Further investigation of these genes and their roles in specific pathways will enhance our understanding of cellular processes. The grouping of MYB1, ANS, GT1 and GGPPS genes into a single cluster could suggest analogous expression trends or operational correlations. The shared expression patterns could be attributed to similar regulatory mechanisms, overlapping biological pathways, or interactions within cellular processes. Studies have indicated that the interplay between the MYB1 and ANS genes might have a regulatory effect on the biosynthesis of anthocyanins in onions, thereby influencing the coloration of the onion tissue113. The GGPPS gene holds a crucial role in the carotenoid biosynthesis pathway. This gene instigates the production of ketonic compounds, specifically C13-norisoprenoids, which are a result of the CCD1 gene's activity. Interestingly, flowering plants determine the color or aroma of their flowers through mutual relationships among their biosynthetic pathways, aligning with the growth of the petals. In this study, a connection is observed between the CCD1 and GGPPS genes, placing them in the same group. The CCD1 gene is responsible for altering petal color and increasing the amount of carotenoid components. Similarly, the GGPPS gene could potentially be responsible for the production of volatile components and the development of carotenoid pigments. In multiple studies, shared genes that have experienced significant upregulation or downregulation have been used to explore biological, molecular, and cellular pathways. Broadly speaking, this collection of genes may influence color, aroma, and certain pathways that are instrumental in the operational process of this characteristic. The findings from these studies could enhance our comprehension of genetic control in plants and their stress reaction.

Conclusion

The findings of this research suggest that the MYB1 and CCD1 genes play an important role in determining the scent and color of rose flowers. The overexpression of the MYB1 transcription factor was found to significantly increase the expression of the ANS gene, indicating that MYB1 positively regulates ANS. Additionally, the application of the MeJA treatment was found to have a positive effect on the relative expression of most genes, except GGPPS. The study also showed that there were 26 different compounds in four samples using GC/MS analysis. The production of monoterpenes, sesquiterpenes, and aliphatic compounds in white flowers was found to increase after 48 h of MeJA application. In contrast, the application of MeJA to pink flowers led to a decrease in terpenoid compounds and an increase in aliphatic compounds. Further research is needed to fully understand the mechanisms behind the association between MeJA treatment and gene expression. The heatmap analysis revealed that the PS2 sample, representing the fully open flower stage of pink petals, is a superior specimen due to its substantial upregulation in the expression of genes GT1, GGPPS, MYB1, and ANS. While this study highlights the genetic potential of PS2 for enhanced essential oil production, future research should include detailed metabolite profiling, particularly focusing on citronellol, to fully validate PS2’s potential for the perfumery industry.

Data availability statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Acknowledgements

The authors would like to acknowledge the University of Tehran for the support of this work. Moreover, this study was supported by the RUDN University Strategic Academic Leadership Program.

Author contributions

Hoda Sadat Kiani—Conducting the entire experiments, data collection, literature search and manuscript writing. Manijeh Sabokdast Noudehi and Majid Shokrpour- Designing a part of the phytochemical experiments. Meisam Zargar & Mohammad Reza Naghavi*- Develop the idea, Project administration, overall supervision of the experiment, and Funding acquisition.

Funding

University of Tehran and RUDN University, 54345.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Baldermann S Volatile constituents in the scent of roses Floriculture Ornamental Biotechnol 2009 3 1 89 97
Baldermann, S. et al. Volatile constituents in the scent of roses. Floriculture Ornamental Biotechnol 3(1), 89–97 (2009).
2. Tabaei, A. S., et al., Genetic variation analysis of different populations of Rosa damascena in NW. Iran using rapd markers. 2006.
3. Babaei E Reduction of dc voltage sources and switches in asymmetrical multilevel converters using a novel topology Electric Power Syst Res 2007 77 8 1073 1085 10.1016/j.epsr.2006.09.012
Babaei, E. et al. Reduction of dc voltage sources and switches in asymmetrical multilevel converters using a novel topology. Electric Power Syst Res 77(8), 1073–1085 (2007).10.1016/j.epsr.2006.09.012
4. Nasery S Accurate prediction of solubility of hydrogen in heavy oil fractions J. Mol. Liq. 2016 222 933 943 10.1016/j.molliq.2016.07.083
Nasery, S. et al. Accurate prediction of solubility of hydrogen in heavy oil fractions. J. Mol. Liq. 222, 933–943 (2016).10.1016/j.molliq.2016.07.083
5. Figueiredo LH Non-aromatic hydrocarbons in recent sediments of Sepetiba and Ilha Grande Bays, Brazil J. Braz. Chem. Soc. 2008 19 516 527 10.1590/S0103-50532008000300020
Figueiredo, L. H. et al. Non-aromatic hydrocarbons in recent sediments of Sepetiba and Ilha Grande Bays, Brazil. J. Braz. Chem. Soc. 19, 516–527 (2008).10.1590/S0103-50532008000300020
6. Kumar R Variation in essential oil content and composition of damask rose (Rosa damascena mill) flowers by salt application under mid hills of the western Himalayas J Essential Oil Bearing Plants 2016 19 2 297 306 10.1080/0972060X.2016.1153985
Kumar, R. et al. Variation in essential oil content and composition of damask rose (Rosa damascena mill) flowers by salt application under mid hills of the western Himalayas. J Essential Oil Bearing Plants 19(2), 297–306 (2016).10.1080/0972060X.2016.1153985
7. Tehranifar, A., et al. Effects of seven substrates on qualitative and quantitative characteristics of three strawberry cultivars under soilless culture. In XXVII international horticultural congress-IHC2006: International Symposium on Advances in Environmental Control, Automation 761. 2006.
8. Yang J Transcriptome-based WGCNA analysis reveals regulated metabolite fluxes between floral color and scent in Narcissus tazetta flower Int. J. Mol. Sci. 2021 22 15 8249 10.3390/ijms22158249 34361014
Yang, J. et al. Transcriptome-based WGCNA analysis reveals regulated metabolite fluxes between floral color and scent in Narcissus tazetta flower. Int. J. Mol. Sci. 22(15), 8249 (2021).34361014 10.3390/ijms22158249
9. Yang, L., et al., Diurnal fluctuation of volatile compounds emitted from four seasons rose (Rosa damascena Mill.) cultivated in Beijing. J. Appl. Bot. Food Qual., 2014. 87.
10. Yan H Isolation and identification of a putative scent-related gene RhMYB1 from rose Mol. Biol. Rep. 2011 38 4475 4482 10.1007/s11033-010-0577-1 21132535
Yan, H. et al. Isolation and identification of a putative scent-related gene RhMYB1 from rose. Mol. Biol. Rep. 38, 4475–4482 (2011).21132535 10.1007/s11033-010-0577-1
11. Rasouli O Ahmadi N Monfared SR Molecular characterization and expression pattern of RhPAR, RhMYB1 and RhANS genes involving in scent and color production in Rosa damascena Sci. Hortic. 2020 272 109399 10.1016/j.scienta.2020.109399
Rasouli, O., Ahmadi, N. & Monfared, S. R. Molecular characterization and expression pattern of RhPAR, RhMYB1 and RhANS genes involving in scent and color production in Rosa damascena. Sci. Hortic. 272, 109399 (2020).10.1016/j.scienta.2020.109399
12. Feng S Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10 Planta 2010 232 245 255 10.1007/s00425-010-1170-5 20422209
Feng, S. et al. Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10. Planta 232, 245–255 (2010).20422209 10.1007/s00425-010-1170-5
13. Nakatsuka T Temporal expression of flavonoid biosynthesis-related genes regulates flower pigmentation in gentian plants Plant Sci. 2005 168 5 1309 1318 10.1016/j.plantsci.2005.01.009
Nakatsuka, T. et al. Temporal expression of flavonoid biosynthesis-related genes regulates flower pigmentation in gentian plants. Plant Sci. 168(5), 1309–1318 (2005).10.1016/j.plantsci.2005.01.009
14. Yokoi, M. Colour and pigment distribution in ornamental plants: V. Anthocyanin distribution in rose cultivars. Chiba University Faculty of Horticulture Academic Report, 1975. 22: p. 13–24.
15. Sagawa JM An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers New Phytologist 2016 209 3 1049 1057 10.1111/nph.13647 26377817
Sagawa, J. M. et al. An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers. New Phytologist 209(3), 1049–1057 (2016).26377817 10.1111/nph.13647
16. Rasouli O Physiological, phytochemicals and molecular analysis of color and scent of different landraces of Rosa damascena during flower development stages Sci. Horticult. 2018 231 144 150 10.1016/j.scienta.2017.12.010
Rasouli, O. et al. Physiological, phytochemicals and molecular analysis of color and scent of different landraces of Rosa damascena during flower development stages. Sci. Horticult. 231, 144–150 (2018).10.1016/j.scienta.2017.12.010
17. Ji, F., Wu, J., Zhang, Z. Identification and characterization of CCD gene family in rose (Rosa chinensis Jacq.‘Old Blush’) and gene co-expression network in biosynthesis of flower scent. Horticulturae, 2023. 9(1): p. 115.
18. Bourdenx B Overexpression of arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses Plant Physiol. 2011 156 1 29 45 10.1104/pp.111.172320 21386033
Bourdenx, B. et al. Overexpression of arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant Physiol. 156(1), 29–45 (2011).21386033 10.1104/pp.111.172320
19. Gao Y Genome-wide identification of the CER1 gene family in apple and response of MdCER1-1 to drought stress Funct. Integr. Genomics 2023 23 1 17 10.1007/s10142-022-00940-x
Gao, Y. et al. Genome-wide identification of the CER1 gene family in apple and response of MdCER1-1 to drought stress. Funct. Integr. Genomics 23(1), 17 (2023).10.1007/s10142-022-00940-x
20. Wang D Poa pratensis ECERIFERUM1 (PpCER1) is involved in wax alkane biosynthesis and plant drought tolerance Plant Physiol. Biochem. 2021 159 312 321 10.1016/j.plaphy.2020.12.032 33421907
Wang, D. et al. Poa pratensis ECERIFERUM1 (PpCER1) is involved in wax alkane biosynthesis and plant drought tolerance. Plant Physiol. Biochem. 159, 312–321 (2021).33421907 10.1016/j.plaphy.2020.12.032
21. Ogata J Anthocyanin biosynthesis in roses Nature 2005 435 7043 757 758 10.1038/nature435757a 15944692
Ogata, J. et al. Anthocyanin biosynthesis in roses. Nature 435(7043), 757–758 (2005).15944692 10.1038/nature435757a
22. Moradi S Combination effects of preharvest tree net-shading and postharvest fruit treatments with salicylic acid or hot water on attributes of pomegranate fruit Sci. Horticulturae 2022 304 111257 10.1016/j.scienta.2022.111257
Moradi, S. et al. Combination effects of preharvest tree net-shading and postharvest fruit treatments with salicylic acid or hot water on attributes of pomegranate fruit. Sci. Horticulturae 304, 111257 (2022).10.1016/j.scienta.2022.111257
23. Önder S Investigation of phenological, primary and secondary metabolites changes during flower developmental of Rosa damascena Plant Physiol. Biochem. 2022 192 20 34 10.1016/j.plaphy.2022.09.032 36201984
Önder, S. et al. Investigation of phenological, primary and secondary metabolites changes during flower developmental of Rosa damascena. Plant Physiol. Biochem. 192, 20–34 (2022).36201984 10.1016/j.plaphy.2022.09.032
24. Yousefi Kanani, A., Rennie, A. E., Abd Rahim, S. Z. B. Additively manufactured foamed polylactic acid for lightweight structures. Rapid Prototyping J. 29(1), 50–66 (2023).
25. Wasternack, C., Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development: An update to the 2007 review in Annals of Botany. Ann. Bot., 111(6), 1021–1058 (2013).
26. Wang QJ Cloning and characterization of an elicitor-responsive gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase involved in 20-hydroxyecdysone production in cell cultures of Cyanotis arachnoidea Plant Physiol. Biochem. 2014 84 1 9 10.1016/j.plaphy.2014.08.021 25232679
Wang, Q. J. et al. Cloning and characterization of an elicitor-responsive gene encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase involved in 20-hydroxyecdysone production in cell cultures of Cyanotis arachnoidea. Plant Physiol. Biochem. 84, 1–9 (2014).25232679 10.1016/j.plaphy.2014.08.021
27. Zhang Y Comparisons of the pharmacokinetic profile of four bioactive components after oral administration of gan-sui-ban-xia decoction plus-minus gansui and gancao drug combination in normal rats Molecules 2015 20 5 9295 9308 10.3390/molecules20059295 26007184
Zhang, Y. et al. Comparisons of the pharmacokinetic profile of four bioactive components after oral administration of gan-sui-ban-xia decoction plus-minus gansui and gancao drug combination in normal rats. Molecules 20(5), 9295–9308 (2015).26007184 10.3390/molecules20059295
28. Zhang L Tropane alkaloids production in transgenic Hyoscyamus niger hairy root cultures over-expressing putrescine N-methyltransferase is methyl jasmonate-dependent Planta 2007 225 887 896 10.1007/s00425-006-0402-1 17004056
Zhang, L. et al. Tropane alkaloids production in transgenic Hyoscyamus niger hairy root cultures over-expressing putrescine N-methyltransferase is methyl jasmonate-dependent. Planta 225, 887–896 (2007).17004056 10.1007/s00425-006-0402-1
29. Cocetta G Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum) Physiologia Plantarum 2015 153 2 269 283 10.1111/ppl.12243 24943920
Cocetta, G. et al. Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum). Physiologia Plantarum 153(2), 269–283 (2015).24943920 10.1111/ppl.12243
30. Concha CM Methyl jasmonate treatment induces changes in fruit ripening by modifying the expression of several ripening genes in Fragaria chiloensis fruit Plant Physiol. Biochem. 2013 70 433 444 10.1016/j.plaphy.2013.06.008 23835361
Concha, C. M. et al. Methyl jasmonate treatment induces changes in fruit ripening by modifying the expression of several ripening genes in Fragaria chiloensis fruit. Plant Physiol. Biochem. 70, 433–444 (2013).23835361 10.1016/j.plaphy.2013.06.008
31. Mehrjerdi MZ Effects of exogenous methyl jasmonate and 2-isopentenyladenine on artemisinin production and gene expression in Artemisia annua Turkish J. Botany 2013 37 3 499 505
Mehrjerdi, M. Z. et al. Effects of exogenous methyl jasmonate and 2-isopentenyladenine on artemisinin production and gene expression in Artemisia annua. Turkish J. Botany 37(3), 499–505 (2013).
32. Khorasani Esmaeili, A., et al. Antioxidant activity and total phenolic and flavonoid content of various solvent extracts from in vivo and in vitro grown Trifolium pratense L. (Red Clover). BioMed Res. Int. 2015(1), 643285 (2015).
33. Nadernejad, N., et al. Evaluation of PAL activity, phenolic and flavonoid contents in three pistachio (Pistacia vera L.) cultivars grafted onto three different rootstocks. J. Stress Physiol. Biochem. 9(3), 84–97 (2013).
34. Mirzaei M Plant growth promoting rhizobacteria (PGPR) improve plant growth, antioxidant capacity, and essential oil properties of lemongrass (Cymbopogon citratus) under water stress Iran. J. Plant Physiol. 2020 10 2 3155 3166
Mirzaei, M. et al. Plant growth promoting rhizobacteria (PGPR) improve plant growth, antioxidant capacity, and essential oil properties of lemongrass (Cymbopogon citratus) under water stress. Iran. J. Plant Physiol. 10(2), 3155–3166 (2020).
35. Adams, R. P. Identification of Essential oils by Ion Trap Mass Spectroscopy. Academic Press (2012).
36. McLafferty FW Stauffer DB The Wiley/NBS registry of mass spectral data 1989 Wiley
McLafferty, F. W. & Stauffer, D. B. The Wiley/NBS registry of mass spectral data Vol. 1 (Wiley, 1989).
37. Umano K Shibamoto T Analysis of headspace volatiles from overheated beef fat J. Agric. Food Chem. 1987 35 1 14 18 10.1021/jf00073a004
Umano, K. & Shibamoto, T. Analysis of headspace volatiles from overheated beef fat. J. Agric. Food Chem. 35(1), 14–18 (1987).10.1021/jf00073a004
38. Khan SY Mutations of the RDX gene cause nonsyndromic hearing loss at the DFNB24 locus Hum. Mutation 2007 28 5 417 423 10.1002/humu.20469
Khan, S. Y. et al. Mutations of the RDX gene cause nonsyndromic hearing loss at the DFNB24 locus. Hum. Mutation 28(5), 417–423 (2007).10.1002/humu.20469
39. Pfaffl, M. W., Relative quantification. In Real-time PCR. 2007, Taylor & Francis, 89–108.
40. Hervada-Sala C Jarauta-Bragulat E A program to perform Ward's clustering method on several regionalized variables Comput. Geosci. 2004 30 8 881 886 10.1016/j.cageo.2004.07.003
Hervada-Sala, C. & Jarauta-Bragulat, E. A program to perform Ward’s clustering method on several regionalized variables. Comput. Geosci. 30(8), 881–886 (2004).10.1016/j.cageo.2004.07.003
41. Mofidi SSH Effect of drought stress on natural rubber biosynthesis and quality in Taraxacum kok-saghyz roots Plos one 2024 19 1 e0295694 10.1371/journal.pone.0295694 38252676
Mofidi, S. S. H. et al. Effect of drought stress on natural rubber biosynthesis and quality in Taraxacum kok-saghyz roots. Plos one 19(1), e0295694 (2024).38252676 10.1371/journal.pone.0295694
42. Khorasani Esmaeili, A., et al. Antioxidant activity and total phenolic and flavonoid content of various solvent extracts from in vivo and in vitro grown Trifolium pratense L. (Red Clover). BioMed Res. Int. 2015 (2015).
43. Stra A Carotenoid metabolism: New insights and synthetic approaches Front. Plant Sci. 2023 13 1072061 10.3389/fpls.2022.1072061 36743580
Stra, A. et al. Carotenoid metabolism: New insights and synthetic approaches. Front. Plant Sci. 13, 1072061 (2023).36743580 10.3389/fpls.2022.1072061
44. Liu, T., Kang, J., Liu, L. Thymol as a critical component of Thymus vulgaris L. essential oil combats Pseudomonas aeruginosa by intercalating DNA and inactivating biofilm. Lwt. 136, 110354 (2021).
45. Önder, D. G., Önder, S., and Karakurt, Y.: Identification and molecular characterization of geraniol and linalool synthase genes related to monoterpene biosynthesis in Damask rose (Rosa damascena Mill.), several genes for little scent. J. Essential Oil Bearing Plants. 24(4), 910–924 (2021).
46. Sadraei H Asghari G Emami S Inhibitory effect of Rosa damascena Mill flower essential oil, geraniol and citronellol on rat ileum contraction Res. Pharm. Sci. 2013 8 1 17 24459472
Sadraei, H., Asghari, G. & Emami, S. Inhibitory effect of Rosa damascena Mill flower essential oil, geraniol and citronellol on rat ileum contraction. Res. Pharm. Sci. 8(1), 17 (2013).24459472
47. Hüsnü Can Bașer, K., Buchbauer, G. Handbook of Essential Oils: Science, Technology, and Applications. Handbook of essential oils: Science, technology, and applications., 2015(Ed. 2).
48. Verma N Bansal MC Kumar V Pea peel waste: a lignocellulosic waste and its utility in cellulase production by Trichoderma reesei under solid state cultivation Bioresources 2011 6 2 1505 1519 10.15376/biores.6.2.1505-1519
Verma, N., Bansal, M. C. & Kumar, V. Pea peel waste: a lignocellulosic waste and its utility in cellulase production by Trichoderma reesei under solid state cultivation. Bioresources 6(2), 1505–1519 (2011).10.15376/biores.6.2.1505-1519
49. Dudareva N Biosynthesis, function and metabolic engineering of plant volatile organic compounds New Phytologist 2013 198 1 16 32 10.1111/nph.12145 23383981
Dudareva, N. et al. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytologist 198(1), 16–32 (2013).23383981 10.1111/nph.12145
50. Vogt T Phenylpropanoid biosynthesis Mol Plant 2010 3 1 2 20 10.1093/mp/ssp106 20035037
Vogt, T. Phenylpropanoid biosynthesis. Mol Plant 3(1), 2–20 (2010).20035037 10.1093/mp/ssp106
51. Weisshaar B Jenkins GI Phenylpropanoid biosynthesis and its regulation Curr. Opinion Plant Biol. 1998 1 3 251 257 10.1016/S1369-5266(98)80113-1
Weisshaar, B. & Jenkins, G. I. Phenylpropanoid biosynthesis and its regulation. Curr. Opinion Plant Biol. 1(3), 251–257 (1998).10.1016/S1369-5266(98)80113-1
52. Baldwin IT Preston CA The eco-physiological complexity of plant responses to insect herbivores Planta 1999 208 2 137 145 10.1007/s004250050543
Baldwin, I. T. & Preston, C. A. The eco-physiological complexity of plant responses to insect herbivores. Planta 208(2), 137–145 (1999).10.1007/s004250050543
53. Mithöfer A Boland W Plant defense against herbivores: chemical aspects Annu. Rev. Plant Biol. 2012 63 1 431 450 10.1146/annurev-arplant-042110-103854 22404468
Mithöfer, A. & Boland, W. Plant defense against herbivores: chemical aspects. Annu. Rev. Plant Biol. 63(1), 431–450 (2012).22404468 10.1146/annurev-arplant-042110-103854
54. Zvi MMB PAP1 transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers New Phytologist 2012 195 2 335 345 10.1111/j.1469-8137.2012.04161.x 22548501
Zvi, M. M. B. et al. PAP1 transcription factor enhances production of phenylpropanoid and terpenoid scent compounds in rose flowers. New Phytologist 195(2), 335–345 (2012).22548501 10.1111/j.1469-8137.2012.04161.x
55. Kianersi F Effect of methyl jasmonate on thymol, carvacrol, phytochemical accumulation, and expression of key genes involved in thymol/carvacrol biosynthetic pathway in some Iranian Thyme species Int. J. Mol. Sci. 2021 22 20 11124 10.3390/ijms222011124 34681782
Kianersi, F. et al. Effect of methyl jasmonate on thymol, carvacrol, phytochemical accumulation, and expression of key genes involved in thymol/carvacrol biosynthetic pathway in some Iranian Thyme species. Int. J. Mol. Sci. 22(20), 11124 (2021).34681782 10.3390/ijms222011124
56. Perreca E Effect of drought and methyl jasmonate treatment on primary and secondary isoprenoid metabolites derived from the MEP pathway in the white spruce Picea glauca Int. J. Mol. Sci. 2022 23 7 3838 10.3390/ijms23073838 35409197
Perreca, E. et al. Effect of drought and methyl jasmonate treatment on primary and secondary isoprenoid metabolites derived from the MEP pathway in the white spruce Picea glauca. Int. J. Mol. Sci. 23(7), 3838 (2022).35409197 10.3390/ijms23073838
57. Soleymani, F., Taheri, H., and Shafeinia, A. Relative expression of genes of menthol biosynthesis pathway in peppermint (Mentha piperita L.) after chitosan, gibberellic acid and methyl jasmonate treatments. Russian J. Plant Physiol., 64, 59–66 (2017).
58. Dai J Mumper RJ Plant phenolics: Extraction, analysis and their antioxidant and anticancer properties Molecules 2010 15 10 7313 7352 10.3390/molecules15107313 20966876
Dai, J. & Mumper, R. J. Plant phenolics: Extraction, analysis and their antioxidant and anticancer properties. Molecules 15(10), 7313–7352 (2010).20966876 10.3390/molecules15107313
59. Ahadi, H. Essential oil, flavonoids and anthocyanins profiling of some Iranian damask rose (Rosa damascena Mill.) genotypes. Industrial Crops & Products, 2023. 205: p. 117579.
60. Liu, Y., et al. Natural bioactive flavonoids as promising agents in alleviating exercise-induced fatigue. Food Bioscience, 2023; p. 102360.
61. Torusdağ, M. B., Kutlu, M., and Selcuk, A. A. Evaluation of social bot detection models. Turk. J. Electr. Eng. Comput. Sci. 30(4), 1269–1283 (2022).
62. Majetic, C. J., Raguso, R. A., and Ashman, T.-L. The impact of biochemistry vs. population membership on floral scent profiles in colour polymorphic Hesperis matronalis. Ann. Bot. 102(6): 911–922 (2008).
63. Saptarini, N. M., Herawati, I. E. Extraction methods and varieties affect total anthocyanins content in acidified extract of papery skin of onion (Allium cepa L.). Drug Invention Today. 10(4) (2018).
64. Rein, M., Copigmentation reactions and color stability of berry anthocyanins (2005).
65. Zvi MMB Interlinking showy traits: co-engineering of scent and colour biosynthesis in flowers Plant Biotechnol J 2008 6 4 403 415 10.1111/j.1467-7652.2008.00329.x 18346094
Zvi, M. M. B. et al. Interlinking showy traits: co-engineering of scent and colour biosynthesis in flowers. Plant Biotechnol J 6(4), 403–415 (2008).18346094 10.1111/j.1467-7652.2008.00329.x
66. Chroho M Phenolic composition, antioxidant and antibacterial activities of extract from flowers of Rosa damascena from morocco Separations 2022 9 9 247 10.3390/separations9090247
Chroho, M. et al. Phenolic composition, antioxidant and antibacterial activities of extract from flowers of Rosa damascena from morocco. Separations 9(9), 247 (2022).10.3390/separations9090247
67. Huang F-C Molnár P Schwab W Cloning and functional characterization of carotenoid cleavage dioxygenase 4 genes J. Exp. Bot. 2009 60 11 3011 3022 10.1093/jxb/erp137 19436048
Huang, F.-C., Molnár, P. & Schwab, W. Cloning and functional characterization of carotenoid cleavage dioxygenase 4 genes. J. Exp. Bot. 60(11), 3011–3022 (2009).19436048 10.1093/jxb/erp137
68. Nagegowda DA Gupta P Advances in biosynthesis, regulation, and metabolic engineering of plant specialized terpenoids Plant Sci. 2020 294 110457 10.1016/j.plantsci.2020.110457 32234216
Nagegowda, D. A. & Gupta, P. Advances in biosynthesis, regulation, and metabolic engineering of plant specialized terpenoids. Plant Sci. 294, 110457 (2020).32234216 10.1016/j.plantsci.2020.110457
69. Ambawat S MYB transcription factor genes as regulators for plant responses: An overview Physiol. Mol. Biol. Plants 2013 19 307 321 10.1007/s12298-013-0179-1 24431500
Ambawat, S. et al. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 19, 307–321 (2013).24431500 10.1007/s12298-013-0179-1
70. Martin GM Genetics and the pathobiology of ageing Philos. Trans. R Soc. Lond. Ser. B: Biol. Sci. 1997 352 1363 1773 1780 10.1098/rstb.1997.0161 9460060
Martin, G. M. Genetics and the pathobiology of ageing. Philos. Trans. R Soc. Lond. Ser. B: Biol. Sci. 352(1363), 1773–1780 (1997).9460060 10.1098/rstb.1997.0161
71. Gu C LC-ESI-QTOF/MS characterisation of phenolic acids and flavonoids in polyphenol-rich fruits and vegetables and their potential antioxidant activities Antioxidants 2019 8 9 405 10.3390/antiox8090405 31533286
Gu, C. et al. LC-ESI-QTOF/MS characterisation of phenolic acids and flavonoids in polyphenol-rich fruits and vegetables and their potential antioxidant activities. Antioxidants 8(9), 405 (2019).31533286 10.3390/antiox8090405
72. Koes R Verweij W Quattrocchio F Flavonoids: A colorful model for the regulation and evolution of biochemical pathways Trends Plant Sci. 2005 10 5 236 242 10.1016/j.tplants.2005.03.002 15882656
Koes, R., Verweij, W. & Quattrocchio, F. Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10(5), 236–242 (2005).15882656 10.1016/j.tplants.2005.03.002
73. Ruiz-Sola MÁ Arabidopsis GERANYLGERANYL DIPHOSPHATE SYNTHASE 11 is a hub isozyme required for the production of most photosynthesis-related isoprenoids New Phytologist 2016 209 1 252 264 10.1111/nph.13580 26224411
Ruiz-Sola, M. Á. et al. Arabidopsis GERANYLGERANYL DIPHOSPHATE SYNTHASE 11 is a hub isozyme required for the production of most photosynthesis-related isoprenoids. New Phytologist 209(1), 252–264 (2016).26224411 10.1111/nph.13580
74. Dong C Rational design of geranylgeranyl diphosphate synthase enhances carotenoid production and improves photosynthetic efficiency in Nicotiana tabacum Sci. Bull. 2022 67 3 315 327 10.1016/j.scib.2021.07.003
Dong, C. et al. Rational design of geranylgeranyl diphosphate synthase enhances carotenoid production and improves photosynthetic efficiency in Nicotiana tabacum. Sci. Bull. 67(3), 315–327 (2022).10.1016/j.scib.2021.07.003
75. Muehlebach ME Holstein SA Geranylgeranyl diphosphate synthase: Role in human health, disease and potential therapeutic target Clin. Translat. Med. 2023 13 1 e1167 10.1002/ctm2.1167
Muehlebach, M. E. & Holstein, S. A. Geranylgeranyl diphosphate synthase: Role in human health, disease and potential therapeutic target. Clin. Translat. Med. 13(1), e1167 (2023).10.1002/ctm2.1167
76. Ramya M MYB1 transcription factor regulation through floral scent in Cymbidium cultivar ‘Sael Bit’ Phytochemistry Lett. 2019 32 181 187 10.1016/j.phytol.2019.06.007
Ramya, M. et al. MYB1 transcription factor regulation through floral scent in Cymbidium cultivar ‘Sael Bit’. Phytochemistry Lett. 32, 181–187 (2019).10.1016/j.phytol.2019.06.007
77. Shi M A conserved MYB transcription factor is involved in regulating lipid metabolic pathways for oil biosynthesis in green algae New Phytologist 2022 235 2 576 594 10.1111/nph.18119 35342951
Shi, M. et al. A conserved MYB transcription factor is involved in regulating lipid metabolic pathways for oil biosynthesis in green algae. New Phytologist 235(2), 576–594 (2022).35342951 10.1111/nph.18119
78. Rasoli M Effects of reviewing childbirth scenarios on choice of delivery type: A randomized controlled trial Turk. J. Obstet. Gynecol. 2019 16 1 15 10.4274/tjod.galenos.2019.92260 31019835
Rasoli, M. et al. Effects of reviewing childbirth scenarios on choice of delivery type: A randomized controlled trial. Turk. J. Obstet. Gynecol. 16(1), 15 (2019).31019835 10.4274/tjod.galenos.2019.92260
79. Dong NQ Lin HX Contribution of phenylpropanoid metabolism to plant development and plant–environment interactions J. Integr. Plant Biol. 2021 63 1 180 209 10.1111/jipb.13054 33325112
Dong, N. Q. & Lin, H. X. Contribution of phenylpropanoid metabolism to plant development and plant–environment interactions. J. Integr. Plant Biol. 63(1), 180–209 (2021).33325112 10.1111/jipb.13054
80. Xiujun W Comparative transcriptome analysis linked to key volatiles reveals molecular mechanisms of aroma compound biosynthesis in Prunus mume BMC Plant Biol. 2022 22 1 1 19 10.1186/s12870-022-03779-3 34979920
Xiujun, W. et al. Comparative transcriptome analysis linked to key volatiles reveals molecular mechanisms of aroma compound biosynthesis in Prunus mume. BMC Plant Biol. 22(1), 1–19 (2022).34979920 10.1186/s12870-022-03779-3
81. Kong J-Q Phenylalanine ammonia-lyase, a key component used for phenylpropanoids production by metabolic engineering RSC Adv. 2015 5 77 62587 62603 10.1039/C5RA08196C
Kong, J.-Q. Phenylalanine ammonia-lyase, a key component used for phenylpropanoids production by metabolic engineering. RSC Adv. 5(77), 62587–62603 (2015).10.1039/C5RA08196C
82. Barman M Mitra A Floral maturation and changing air temperatures influence scent volatiles biosynthesis and emission in Jasminum auriculatum Vahl Environ. Exp. Bot. 2021 181 104296 10.1016/j.envexpbot.2020.104296
Barman, M. & Mitra, A. Floral maturation and changing air temperatures influence scent volatiles biosynthesis and emission in Jasminum auriculatum Vahl. Environ. Exp. Bot. 181, 104296 (2021).10.1016/j.envexpbot.2020.104296
83. Wang X Comparative proteomics and physiological analyses reveal important maize filling-kernel drought-responsive genes and metabolic pathways Int. J. Mol. Sci. 2019 20 15 3743 10.3390/ijms20153743 31370198
Wang, X. et al. Comparative proteomics and physiological analyses reveal important maize filling-kernel drought-responsive genes and metabolic pathways. Int. J. Mol. Sci. 20(15), 3743 (2019).31370198 10.3390/ijms20153743
84. Chan H-L Wang H-L Sinus pathology and anatomy in relation to complications in lateral window sinus augmentation Implant Dentistry 2011 20 6 406 412 10.1097/ID.0b013e3182341f79 21986451
Chan, H.-L. & Wang, H.-L. Sinus pathology and anatomy in relation to complications in lateral window sinus augmentation. Implant Dentistry 20(6), 406–412 (2011).21986451 10.1097/ID.0b013e3182341f79
85. Makino T Optical properties of excitons in ZnO-based quantum well heterostructures Semicond. Sci. Technol. 2005 20 4 S78 10.1088/0268-1242/20/4/010
Makino, T. et al. Optical properties of excitons in ZnO-based quantum well heterostructures. Semicond. Sci. Technol. 20(4), S78 (2005).10.1088/0268-1242/20/4/010
86. Aarts M Molecular characterization of the CER1 gene of arabidopsis involved in epicuticular wax biosynthesis and pollen fertility Plant Cell 1995 7 12 2115 2127 8718622
Aarts, M. et al. Molecular characterization of the CER1 gene of arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7(12), 2115–2127 (1995).8718622
87. Ni, E., et al. OsCER1 plays a pivotal role in very-long-chain alkane biosynthesis and affects plastid development and programmed cell death of tapetum in rice (Oryza sativa L.). Front. Plant Sci. 9, 1217 (2018).
88. Saeed-Akbari A Derivation and variation in composition-dependent stacking fault energy maps based on subregular solution model in high-manganese steels Metall. Mater. Trans. A 2009 40 3076 3090 10.1007/s11661-009-0050-8
Saeed-Akbari, A. et al. Derivation and variation in composition-dependent stacking fault energy maps based on subregular solution model in high-manganese steels. Metall. Mater. Trans. A 40, 3076–3090 (2009).10.1007/s11661-009-0050-8
89. Sakuradani E The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1 Planta 2013 237 731 738 10.1007/s00425-012-1791-y 23117394
Sakuradani, E. et al. The CER22 gene required for the synthesis of cuticular wax alkanes in Arabidopsis thaliana is allelic to CER1. Planta 237, 731–738 (2013).23117394 10.1007/s00425-012-1791-y
90. Pascal S Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex Plant Physiol. 2019 179 2 415 432 10.1104/pp.18.01075 30514726
Pascal, S. et al. Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex. Plant Physiol. 179(2), 415–432 (2019).30514726 10.1104/pp.18.01075
91. Jiang H Single-molecule real-time sequencing of full-length transcriptome and identification of genes related to male development in cannabis sativa Plants 2022 11 24 3559 10.3390/plants11243559 36559671
Jiang, H. et al. Single-molecule real-time sequencing of full-length transcriptome and identification of genes related to male development in cannabis sativa. Plants 11(24), 3559 (2022).36559671 10.3390/plants11243559
92. Lücker J Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases Eur. J. Biochem. 2002 269 13 3160 3171 10.1046/j.1432-1033.2002.02985.x 12084056
Lücker, J. et al. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases. Eur. J. Biochem. 269(13), 3160–3171 (2002).12084056 10.1046/j.1432-1033.2002.02985.x
93. Yang H QTL analysis reveals the effect of CER1-1 and CER1-3 to reduce fruit water loss by increasing cuticular wax alkanes in citrus fruit Postharvest Biol. Technol. 2022 185 111771 10.1016/j.postharvbio.2021.111771
Yang, H. et al. QTL analysis reveals the effect of CER1-1 and CER1-3 to reduce fruit water loss by increasing cuticular wax alkanes in citrus fruit. Postharvest Biol. Technol. 185, 111771 (2022).10.1016/j.postharvbio.2021.111771
94. Feng L Petal effect: a superhydrophobic state with high adhesive force Langmuir 2008 24 8 4114 4119 10.1021/la703821h 18312016
Feng, L. et al. Petal effect: a superhydrophobic state with high adhesive force. Langmuir 24(8), 4114–4119 (2008).18312016 10.1021/la703821h
95. Chan J Laser cooling of a nanomechanical oscillator into its quantum ground state Nature 2011 478 7367 89 92 10.1038/nature10461 21979049
Chan, J. et al. Laser cooling of a nanomechanical oscillator into its quantum ground state. Nature 478(7367), 89–92 (2011).21979049 10.1038/nature10461
96. Li C Jasmonate signaling pathway modulates plant defense, growth, and their trade-offs Int. J. Mol. Sci. 2022 23 7 3945 10.3390/ijms23073945 35409303
Li, C. et al. Jasmonate signaling pathway modulates plant defense, growth, and their trade-offs. Int. J. Mol. Sci. 23(7), 3945 (2022).35409303 10.3390/ijms23073945
97. Zhang X The plant fatty acyl reductases Int. J. Mol. Sci. 2022 23 24 16156 10.3390/ijms232416156 36555796
Zhang, X. et al. The plant fatty acyl reductases. Int. J. Mol. Sci. 23(24), 16156 (2022).36555796 10.3390/ijms232416156
98. Chen X-M Functional characterization of rose phenylacetaldehyde reductase (PAR), an enzyme involved in the biosynthesis of the scent compound 2-phenylethanol J. Plant Physiol. 2011 168 2 88 95 10.1016/j.jplph.2010.06.011 20650544
Chen, X.-M. et al. Functional characterization of rose phenylacetaldehyde reductase (PAR), an enzyme involved in the biosynthesis of the scent compound 2-phenylethanol. J. Plant Physiol. 168(2), 88–95 (2011).20650544 10.1016/j.jplph.2010.06.011
99. Sánchez-Gutiérrez, M., et al. Valorisation of Olea europaea L. olive leaves through the evaluation of their extracts: Antioxidant and antimicrobial activity. Foods, 10(5), 966 (2021).
100. Dimitrios B Sources of natural phenolic antioxidants Trends Food Sci. Technol. 2006 17 9 505 512 10.1016/j.tifs.2006.04.004
Dimitrios, B. Sources of natural phenolic antioxidants. Trends Food Sci. Technol. 17(9), 505–512 (2006).10.1016/j.tifs.2006.04.004
101. Tomé-Sánchez I Bioprocessed wheat ingredients: Characterization, bioaccessibility of phenolic compounds, and bioactivity during in vitro digestion Front. Plant Sci. 2021 12 790898 10.3389/fpls.2021.790898 35003179
Tomé-Sánchez, I. et al. Bioprocessed wheat ingredients: Characterization, bioaccessibility of phenolic compounds, and bioactivity during in vitro digestion. Front. Plant Sci. 12, 790898 (2021).35003179 10.3389/fpls.2021.790898
102. Heller W Enzymatic reduction of (+)-dihydroflavonols to flavan-3, 4-cis-diols with flower extracts from Matthiola incana and its role in anthocyanin biosynthesis Planta 1985 165 2 284 287 10.1007/BF00395052 24241054
Heller, W. et al. Enzymatic reduction of (+)-dihydroflavonols to flavan-3, 4-cis-diols with flower extracts from Matthiola incana and its role in anthocyanin biosynthesis. Planta 165(2), 284–287 (1985).24241054 10.1007/BF00395052
103. Yeh, C.-l., Making an American Festival: Chinese New Year in San Francisco’s Chinatown. 2008: University of California Press.
104. Rahimi VB Cytotoxicity and apoptogenic properties of the standardized extract of Portulaca oleracea on glioblastoma multiforme cancer cell line (U-87): A mechanistic study EXCLI J. 2019 18 165 31217780
Rahimi, V. B. et al. Cytotoxicity and apoptogenic properties of the standardized extract of Portulaca oleracea on glioblastoma multiforme cancer cell line (U-87): A mechanistic study. EXCLI J. 18, 165 (2019).31217780
105. Du F Identification of differentially expressed genes in flower, leaf and bulb scale of Lilium oriental hybrid ‘Sorbonne’and putative control network for scent genes BMC Genom. 2017 18 1 14 10.1186/s12864-017-4303-4
Du, F. et al. Identification of differentially expressed genes in flower, leaf and bulb scale of Lilium oriental hybrid ‘Sorbonne’and putative control network for scent genes. BMC Genom. 18, 1–14 (2017).10.1186/s12864-017-4303-4
106. Jariani P Molecular and phytochemical characteristics of flower color and scent compounds in Dog Rose (Rosa canina L.) Molecules 2024 29 3145 10.3390/molecules29133145 38999097
Jariani, P. et al. Molecular and phytochemical characteristics of flower color and scent compounds in Dog Rose (Rosa canina L.). Molecules 29, 3145 (2024).38999097 10.3390/molecules29133145
107. Liu Q Quercetin-derivatives painting the yellow petals of American lotus (Nelumbo lutea) and enzymatic basis for their accumulation Horticult. Plant J. 2023 9 1 169 182 10.1016/j.hpj.2022.02.001
Liu, Q. et al. Quercetin-derivatives painting the yellow petals of American lotus (Nelumbo lutea) and enzymatic basis for their accumulation. Horticult. Plant J. 9(1), 169–182 (2023).10.1016/j.hpj.2022.02.001
108. Zhao, D., Hao, Z., Tao, J. Effects of shade on plant growth and flower quality in the herbaceous peony (Paeonia lactiflora Pall.). Plant Physiol. Biochem. 61, 187–196 (2012).
109. Shimizu, K., et al. A 94-bp deletion of anthocyanidin synthase gene in acyanic flower lines of lisianthus [Eustoma grandiflorum (Raf.) Shinn.]. J. Japan. Soc. Horticult. Sci. 80(4), 434–442 (2011).
110. Xu, H., Zhu, Q., Lu, X. Systematic analysis of GT1 family genes and their regulation in anthocyanin metabolism in red maple (2022).
111. Liu C Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis Sci. Rep. 2016 6 1 1 16 28442746
Liu, C. et al. Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis. Sci. Rep. 6(1), 1–16 (2016).28442746
112. Jariani P Characterization of key genes in anthocyanin and flavonoid biosynthesis during floral development in Rosa canina L Int. J. Biol. Macromol. 2024 276 133937 10.1016/j.ijbiomac.2024.133937 39029843
Jariani, P. et al. Characterization of key genes in anthocyanin and flavonoid biosynthesis during floral development in Rosa canina L. Int. J. Biol. Macromol. 276, 133937 (2024).39029843 10.1016/j.ijbiomac.2024.133937
113. Schwinn KE The onion (Allium cepa L.) R2R3-MYB gene MYB1 regulates anthocyanin biosynthesis Front Plant Sci. 2016 7 1865 10.3389/fpls.2016.01865 28018399
Schwinn, K. E. et al. The onion (Allium cepa L.) R2R3-MYB gene MYB1 regulates anthocyanin biosynthesis. Front Plant Sci. 7, 1865 (2016).28018399 10.3389/fpls.2016.01865
