
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

71353
10.1038/s41598-024-71353-y
Article
LSD1 inhibits the invasion and migration of breast cancer through exosomes
Zhang Nan
Chen Zhongyu
Xin Benkai
Shi Yueru
Yao Yutong
Yang Jingtong
Wang Xiaoyu
Hu Xin huxin@jlu.edu.cn

https://ror.org/00js3aw79 grid.64924.3d 0000 0004 1760 5735 China-Japan Union Hospital of Jilin University, Jilin University, Changchun, 130033 Jilin China
6 9 2024
6 9 2024
2024
14 2081710 6 2024
27 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Metastasis accounts for almost 90% of breast cancer-related fatalities, making it frequent malignancy and the main reason of tumor mortality globally among women. LSD1 is a histone demethylase, which plays an important role in breast cancer. In order to explore the effect of LSD1 on invasion and migration of breast cancer, we treated breast cancer cells with MCF7 and T47D exosomes knocked down by LSD1, and the invasion and migration of breast cancer cells were significantly enhanced. This phenomenon indicates that LSD1 can inhibit the invasion and migration of breast cancer cells. miR-1290 expression was downregulated in LSD1 knockdown MCF7 exosomes. By analyzing the database of miR-1290 target gene NAT1, we verified that miR-1290 could regulate the expression of NAT1. These data provide fresh insights into the biology of breast cancer therapy by demonstrating how the epigenetic factor LSD1 stimulates the breast cancer cells’ invasion and migration via controlling exosomal miRNA.

Keywords

LSD1
Exosome
miR-1290
Subject terms

Cancer
Molecular biology
Jilin Scientific and Technological Development Program20230508066RC Hu Xin Special Project for Health Research Talents of Jilin Province2022scz04 Hu Xin Norman Bethune Program of Jilin University2022B06 Hu Xin Innovation and Entrepreneurship Talent Funding Project of Jilin province2023QN05 Hu Xin issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

In women, the commonest cancer is breast cancer. It will represent 32% of all new cancer cases in the US in 2024 and increase at a pace of 0.6% annually1. One-quarter of all cancer cases and one-sixth of all cancer-related deaths among women globally are caused by breast cancer2. Although breast cancer’s 5-year relative survival rate is now 90%, metastasis reduces survival chances to about 25%. Some increase in survival is noticed (from 75% for patients diagnosed in the mid-1970s to 90% for patients diagnosed between 2011 and 2017)3,4. Understanding the processes underlying breast cancer metastasis is crucial since it may lead to novel approaches to the disease's treatment.

It was not until the discovery of the histone lysine specific demethylase 1 (LSD1) that there was a renewed awareness of the fact that LSD1-mediated histone demethylation is a gradual, highly coordinated process. Lysine specific demethylase 1 (LSD1) removes methyl groups from monomethylated lysines on histone H3 and from dimethyllysine (H3K4me1/me2)5–7. Breast cancer cells’ type and the stage of differentiation in which it is discovered determine the processes, including invasive metastasis and maintenance of breast cancer cell growth, in which LSD1 is involved8. It has been shown that LSD1 and SIN3A/HDAC complex synergistically inhibit the expression of a series of proto-oncogenes, such as CASP7, TGFB2, p21, etc. The LSD1 and SIN3A complexes are required for growth, epithelial characterisation, and the maintenance of drug sensitivity in breast cancer epithelial cells MCF7. And knockdown of LSD1 and SIN3A leads to increased invasion and migration of MDA-MB-231 cells.9. Moreover, earlier research has demonstrated that the binding of the LSD1/CoREST complex to the luminal-specific transcription factor GATA3 regulates luminal breast cancer cells, MCF7 invasion and migration and prevents tumor metastasis in mice with spontaneous breast cancer6,10.

According to certain theories, cancer cells may be able to undergo an epithelial-mesenchymal transition (EMT) to separate from their primary tumor and enter the vasculature11. Epithelial cells are regulated by gene expression, modifying the expression of cytoskeletal and adhesion proteins as well as cell morphology to exhibit more invasive and migrating characteristics. Ultimately, epithelial cells transform into more motile mesenchymal cells, which are important for development and wound healing as well as unique characteristics of primary tumor formation and metastasis12.

Exosomes are a type of extracellular vesicle that can have a diameter of 40–200 nm (or 30–150 nm). They are created when the cell membrane fuses with a multivesicular body13 and contain several types of nucleic acids14,15. These exosomes are biochemically and functionally unique, and they have the ability to control target cell signaling pathways and protein production by being transported to receiver cells16. In the tumor microenvironment, exosomes contribute to intercellular communication. They also support the development and survival of tumor cells, metastasis, the shift from epithelial to mesenchymal tissue, angiogenesis, and immunosuppression17–20. Through exosomal transfer, breast cancer-derived miRNAs are essential for the genesis and progression of tumors, including the control of breast tumor growth and metastasis21.

Breast, hepatocellular, and stomach cancers are just a few of the malignant tumor types where miR-1290 has been found. Several investigations demonstrate the diverse expression of miR-1290 and its correlation with various molecular models of breast cancer23,24. NAT1, or N-acetyltransferase 1, is an enzyme that breaks down xenobiotics in phase II25,26. High expression of NAT1 is strongly associated with breast cancer that is positive for the estrogen receptor.

The present study elucidated the involvement of exosomes in the invasive migration of breast cancer cells mediated by LSD1. Concurrently, we employed miRNA-seq to detect any differential expression of miR-1290 following LSD1 knockdown, identified the target gene NAT1 through database analysis, and confirmed the regulation of miRNA on the target gene. These findings shed light on the manner in which LSD1 controls breast cancer cells, invasion and migration through exosomes and offer novel therapeutic approaches for the disease.

Method

Cells culture

The ATCC provided the MCF7 and T47D cells. DMEM (Gibco, USA) was used to cultivate MCF7 cells. In order to cultivate MCF7, 10% FBS (BI, Israel) and 100 IU/ml penicillin and streptomycin (Solarbio, China) were added to DMEM. T47D cells were cultivated in RPMI-1640 media (Gibco, USA). 10% FBS (BI, Israel), 100 IU/ml penicillin and streptomycin (Solarbio, China), and 3.2 μg/ml insulin (Sigma, Saint Louis, USA) were added to the medium during T47D cell growth. Human embryonic kidney (HEK) 293 T cells were obtained from ATCC. 293 T cells were maintained with DMEM (Gibco, USA) supplemented with 10% FBS (BI, Israel) and 100 IU/ml penicillin and streptomycin (Solarbio, China).

The transfection of cells

Vectors and LSD1 siRNAs complied with previously published protocols27. Lipofectamine 3000 (Invitrogen USA), was used for the transfections. Utilizing RNAiMAX (Invitrogen, USA) for cell transfection, both miR-1290 mimics and inhibitor were employed. GenePharma (Suzhou, China) provided miR-1290 mimics and inhibitor.

Purification of exosomes

MCF7 cells were grown for 36 h in DMEM without fetal bovine serum. T47D cells were cultivated for 36 h in RPMI 1640 without fetal bovine serum. The conditioned medium was collected and centrifuged at 300×g for 10 min and the resulting supernatant was further centrifuged at 2000×g for 10 min to remove apoptotic bodies and large cellular debris. The conditioned medium was then centrifuged again at 2000×g for 10 min. Supernatants were filtered through 0.22-μm filters (Millipore, MA, USA) and centrifuged again at 5000×g to concentrate exosomes. The total exosome isolation reagent (Invitrogen, NY, USA) was added to the supernatant in one-half volume and the mixture was incubated at 4 °C overnight. The solution was then centrifuged at 10,000×g for 1 h, and the separated exosomes were obtained from the precipitate. For analysis of exosomes biomarker CD63 and TSG101, the exosome pellet was dissolved in radio immunoprecipitation assay (RIPA) lysis buffer for western blot.

PKH67 and Phalloidin staining

For 5 min, exosomes of purified breast cancer cells were labeled by incubating them in PKH67 (Sigma-Aldrich) and diluent C. The addition of serum subsequently stopped the labeling. A 10 kDa filter (Millipore) was used to remove extra dye after the labeled exosomes were introduced to 5 mL of phosphate buffered saline (PBS). The cells were cultured with the PKH67-treated exosomes for a duration of 6 h. After 60 min of Phalloidin-iFluor 555 (Abcam, ab176756) staining the cells, PBS washing was performed, and DAPI counterstaining was performed. Last but not least, pictures were taken with the Olympus IX51 microscope (Olympus Corporation).

The test for wound healing

Grown MCF7 breast cancer cells (80–90% confluence) were moved to serum-free media for six hours. Using a 200 μL cannon tip, monolayers of cells were scraped vertically. Purified exosomes were then introduced to serum-free media and co-cultured with the cells. At 0, 24, and 48 h, images were acquired of cells after wound generation. As the ratio of the migrated distance to the beginning distance, the migration capability was examined.

Invasion study with Matrigel

In a Transwell (Corning, USA) system, precoated polycarbonate membranes containing matrigel (Corning, USA) were used for the upper chamber during invasion tests. Serum-free media was used to mesophilically resuspend the cells, which were then cautiously added to the upper chamber. After adding the medium containing 20% serum to the lower chamber, incubation (48 h at 37 °C) proceeded. The infiltrated cells in the lower membrane layer were fixed with 4% paraformaldehyde, stained with Giemsa for an hour at 37 °C, and the uninfiltrated cells in the upper membrane layer were carefully wiped off. The cells were then imaged using an inverted microscope, and the number of infiltrated cells was determined by counting five randomly chosen fields of view.

Real time polymerase chain reaction

TransGen Biotech, China's TransZol Up was used to extract the cells' total RNA, and Allsheng Instruments Co., Ltd., China's Nanodrop was used to measure the extracted RNA's concentration. Using TransGen Biotech's EasyScript® All-in-One First-Strand cDNA Synthesis SuperMix for RT-PCR, 1 μg of RNA was reverse transcribed into cDNA. One First-Strand cDNA Synthesis SuperMix for RT-PCR (TransGen Biotech, China) was utilized to transcribe 1 μg of RNA into cDNA. TransStart® Green qPCR SuperMix (TransGen Biotech, Beijing, China) was then used to evaluate the cDNA. TransGen Biotech, Beijing, China's TransStart® Green qPCR SuperMix was used to reverse transcribe the cDNA to cDNA. The primer sequences are listed in Tables 1 and 2.Table 1 RT-PCR primer sequences (all sequences from 5′ to 3′).

Primers	Forward	Reverse	
β-actin	ACCAACTGGGACGACATGGA	GGTCTCAAACATGATCTGGGTCAT	
E-cadherin	GCCCCGCCTTATGATTCTC	GCCCCATTCGTTCAAGTAGTC	
α-catenin	AGGAAGGCAACTCGACCTTT	TCCAGTAGCTTCTCCACGGT	
ZEB2	AGCCTCTGTAGATGGTCCAGAAGAA	CACTGTACCATTGTTAATTGCGGTC	
Snail1	CTTGTGTCTGCACGACCTGT	CTTCACATCCGAGTGGGTTT	
NAT1	AGGGCAAAACGCTCAGAAATG	TCCTGAAGATTGCATCATGTCG	

Table 2 miRNAs RT-PCR primer sequences (all sequences from 5′ to 3′).

Primers	Forward	Reverse	
U6	ATTGGAACGA TACAGAGAAGATT	GGAACGCTTCACGAATTTG	
miR-1290	GCGCGTGGATTTTTGGAT	AGTGCAGGGTCCGAGGTATT	

Western blotting

Protease inhibitor containing RIPA lysis buffer was used to extract all of the proteins (BestBio, China). A PVDF membrane (Millipore) was electrically transferred with equal amounts of proteins separated by 10% SDS-PAGE. The membrane was then blocked for 30 min with 5% skim milk powder, and the antibody was incubated at 4 °C for a whole night. The next day, membranes were incubated with horseradish peroxidase (HRP)-labeled secondary antibody for one hour at room temperature. The antibody configuration was as follows: LSD1 (1:1000, Cell Signaling Technology, 2139S), GAPDH (1:5000, Bioworld, AP0063), CD63 (1:500, Abcam, ab59479), TSG101 (1:1000, Abcam, ab83), NAT1 (1:1000, Abcam, ab109114). The Tanon 5200 Chemiluminescent Imaging System (Tanon Science & Technology, Shanghai, China) was used to take the pictures.

Small RNA sequencing

The QIAGEN miRNeasy Mini Kit (Qiagen, Hilden, Germany) was used to extract the total RNA from the exosomes, with an Agilent Bioanalyzer 2100 (Agilent technologies, USA, Santa Clara) utilized to verify the quality of the RNA. Using QIAseq®, sequencing libraries were created. Per the manufacturer's instructions, the VAHTSTM Small RNA Library Prep Kit for Illumina (Vazyme, Nanjing, China) directives. The Illumina Nova seq platform (Illumina, San Diego, USA) was used for the sequencing. Small RNA-seq data were deposited in the GEO database under the accession number GSE266982.

Extraction and miRNA identification

The EasyPure® miRNA Kit (TransGen, Beijing, China's Biotech) was utilized to extract miRNAs from the exosomes. The miRNA reverse transcriptase and RT-PCR primers were manufactured and produced in Shanghai, China at GenePharma Co., Ltd. RT-PCR tests were synthesized in U6 and TransStart® Green qPCR SuperMix (TransGen Biotech, Beijing, China) was employed as the scrambled control for miRNA.

Examination of bioinformatics

For predicting miRNA’s target genes, Targetscan (http://www.targetscan.org/), miR-Walk (http://mirwalk.umm.uni-heidelberg.de), and RNA22 (http://www.cm.jefferson.edu/rna22/) were utilized. The KEGG/GO pathway enrichment analysis was carried out using KOBAS, and the target genes' functions were annotated28–30.

Luciferase reporter assay

The GP-miRGLO plasmid containing wild-type and mutant 3'UTR regions of NAT1 and miR-1290 mimics were co-transfected with Lipofectamine 3000 (Invitrogen, USA) to transfect the cells for 24 h. After 24 h, the luciferase activity was measured using the Dual Luciferase Reporter Analysis System (Promega, USA) to measure luciferase activity, followed by detection of fluorescence intensity in each group using a fluorescent microplate reader (Allsheng Instruments Co., Ltd., Hangzhou, China)..

Examinations of statistics

The information shown is the average ± standard deviation from a minimum of three different experiments. The statistical analysis software program GraphPad Prism 8.0 was utilized for all data analysis. P < 0.05 was regarded as statistically significant, and Student's t test was used for the statistical analyses.

Results

Isolation, characterization, and uptake of exosomes from LSD1 knockdown breast cancer cells

We first created LSD1 knockdown and rescue MCF7 and T47D breast cancer cells by transient transfection in order to examine whether LSD1 controls breast cancer invasion and migration through exosomes. The results of the Western Blot analysis demonstrated that LSD1 was successfully knockdown and rescued in MCF7 and T47D cells (Fig. 1A, B). The exosome markers CD63 and TSG101 in the enriched exosomes were then identified by Western Blot after we had enriched exosomes from the media of both cell cultures (Fig. 1C, D). Afterwards we analyzed the size of the exosomes by NTA at approximately 150 nm and the exosomes were about 6 × 109 particles/mL (Fig. S1). To validate the ability of the enriched exosomes from MCF7 and T47D cells to penetrate the target cell MCF7, we co-incubated the enriched exosomes with MCF7 after performing cell membrane staining with PKH67. The immunofluorescence results demonstrated that the exosomes from MCF7 and T47D cells could effectively penetrate the target cell MCF7 (Fig. 1E, F). Exosomes entering the target cells were detected to be localized in the cytoplasm and nucleus by staining the cytoskeleton with phalloidin (Fig. 1G, H). The results of the above experiments showed that exosomes were successfully recovered from MCF7 and T47D, two types of breast cancer cells in which LSD1 was knocked down and rescued, and that exosomes were able to enter the target cells MCF7.Fig. 1 Exosomes from MCF7 and T47D cells can be taken up by MCF7 cells. LSD1 knockdown was achieved by transfecting LSD1 siRNA into MCF7 (A) and T47D (B) cells. To restore LSD1 expression, the pcDNA3.1-LSD1 plasmid was transfected into MCF7 cells based on the knockdown, and the Western Blot results showed levels of LSD1 in MCF7 (A) and T47D (B). Western Blot results for the expression of exosomal markers TSG101 and CD63 in MCF7 (C) and T47D (D) show simultaneous enrichment of Control, LSD1 KD, and exosomes from Rescue. Immunofluorescence pictures of exosomes tagged with PKH67 that MCF7 (E) and T47D (F) cells can effectively internalize (scale bar = 10 μm; green: PKH67; blue: DAPI). Immunofluorescence pictures of the cytoskeleton labeled with ghost pen cyclic peptide, showing exosomes located in the cytoplasm and nucleus of MCF7 (G) and T47D (H) (Phalloidin is red, DAPI is blue, and PKH67 is green; scale bar = 10 μm).

LSD1 controls exosome-mediated breast cancer’s invasion and migration

We isolated exosomes from two breast cancer cell lines, LSD1 knockdown and rescue, and provided MCF7 cells for co-culture concurrently to validate the function of LSD1 in controlling breast cancer invasion and migration through exosomes. The results of the wound healing assay demonstrated that exosomes from breast cancer cells with LSD1 knockdown, MCF7 (Fig. 2A, B), and T47D (Fig. 2C, D), were able to considerably accelerate the migration of breast cancer cells. Exosomes from LSD1 knockdown MCF7 (Fig. 2E, F) and T47D (Fig. 2G, H) breast cancer cells were then found to considerably enhance MCF7 cell invasion, according to the Transwell assay results. It is believed that cancer cells activate epithelial mesenchymal transition (EMT), which causes epithelial cells to lose polarity, have reduced adhesion ability, and acquire the motility and migration properties of mesenchymal cells31,32. The transcription of the epithelial marker E-cadherin and the related adhesion gene α-catenin were repressed, and the treated MCF7 cells showed increased expression of the marker genes for EMT, ZEB2 and Snail1 (Fig. 2I, J). Our findings demonstrate that LSD1 knockdown exosomes enhance MCF7 cell invasion and migration, as well as modulate the expression of genes involved in cell–cell adhesion regulation and cell-transmitter metabolism.Fig. 2 LSD1 regulates breast cancer invasion and migration via exosomes. Using the wound healing assay, the cell migration rate (B, D) of MCF7 treated with exosomes of MCF7 (A) and T47D (C) cells was assessed. Scale bar: 100 μm. After incubating with exosomes of MCF7 (E,F) and T47D (G,H), cells were planted on Matrigel-coated transwell inserts and the invasion experiment was conducted. Bars of scale: 50 μm. MCF7 cells were incubated with exosomes from T47D (J) and MCF7 (I) cells, and the mRNA expression of E-cadherin, α-catenin, ZEB2, and Snail1 was examined using RT-PCR findings. t test without pairing, *P < 0.05, **P < 0.01, ***P < 0.001.

Differentiated miRNAs in exosomes following LSD1 knockdown examined using miRNA-seq

We have undertaken miRNA high-throughput sequencing studies on LSD1 knockdown and rescue exosomes to explore whether LSD1 knockdown is involved in exosome-regulated breast cancer invasion and migration by modifying which micro RNAs in exosomes. To identify differentially expressed miRNA, we employed fold change (FC) ≥  2 and p < 0.05 as the cutoff value. The sequencing results revealed that 38 miRNAs were located at the intersection of altered miRNA expression in the exosomes of the LSD1 KD vs Rescue group and the Control vs LSD1 KD group (Fig. 3A). 13 of these miRNAs were expressed in the LSD1 KD vs. Control group while none were expressed in the LSD1 KD vs. Rescue group. It is very possible that the expression of LSD1 influenced the alterations in these miRNA levels. (Fig. 3B) displays the outcomes of the heatmap mapping of these 13 miRNAs. A study found a favorable correlation between the tumor grade of breast cancer that was ERα-positive and miR-129024. miR-1290’s expression in exosomes was then confirmed, and it was found that exosomal miR-1290 expression was lowered upon LSD1 knockdown and restored during LSD1 rescue. (Fig. 3C). Using the cell invasion and migration assays, we then looked into the function of miR-1290 in MCF7. MiR-1290 overexpression was seen to hinder cell migration in miR-1290 mimics’ transfected cells (Fig. 3D, E). The findings of transfection of miR-1290 inhibitor demonstrated that it facilitated cell migration and reduced the expression of miR-1290 in cells (Fig. 3D, E). In MCF7 transfected with miR-1290 mimics, cell invasion was consistently decreased (Fig. 3F, G), whereas cell invasion was increased by transfection with miR-1290 inhibitors (Fig. 3F, G). These findings imply that varying levels of miR-1290 in exosomes following LSD1 knockdown may have an impact on MCF7 invasion and migration.Fig. 3 Differentiated miRNAs in exosomes following LSD1 knockdown examined using miRNA-seq. miRNA-seq sequencing technique to analyze differential miRNAs in exosomes after LSD1 knockdown and effect on invasive migration. Venn plots (A) showing the quantity of miRNAs that differed in expression between the exosomes of the Control and LSD1 KD groups, as well as between the LSD1 KD and Rescue groups. (B) A heat map displaying 13 miRNAs that exhibit opposing expression trends in the groups who receive LSD1 KD, Rescue, and LSD1 KD. (C) The miR-1290 highlighted is expressed differently in exosomes of LSD1 KD, Rescue, and Control. Transfection of MCF7 cells with miR-1290 mimics and inhibitors for 24 and 48 h was used for wound healing (D,E) and transwell (F,G) assays. Scale bar: 100 μm. T-test without pairing, *P < 0.05, **P < 0.01, ***P < 0.001.

LSD1-knockdown exosomes from breast cancer cells influence cell invasion and migration through miR-1290

For demonstrating miR-1290’s function in LSD1 deleted breast cancer cells’ exosomes, we first used immunofluorescence to establish that miR-1290 tagged with Cy3 could enter the exosomes and function (Fig. 4A). And following the transfection of miR-1290 mimics, we confirmed by RT-PCR that there was a rise in miR-1290 expression in exosomes (Fig. 4B). Next, we enriched the exosomes for cell wound healing assays after knocking down LSD1 in MCF7, knocking down LSD1 while transfected with miR-1290 mimics, and transfected with miR-1290 inhibitors in MCF7, respectively. The results of the cell scratch assay demonstrated that the LSD1 KD + miR-1290 mimics group's migration ability was significantly lower than that of the LSD1 KD group, and that the Control group's migration ability was also lower than that of the Control + miR-1290 inhibitor group (Fig. 4C, E). We then conducted the same experiments in T47D, and the results again demonstrated significant differences in the migration abilities between the LSD1 KD group and the LSD1 KD + miR-1290 mimics group. The Control group's migration ability was also lower than that of the Control + miR-1290 inhibitor group. (Fig. 4D, F). The aforementioned experimental findings showed that miR-1290-mediated cell invasion and migration were impacted by breast cancer cell exosomes that knocked down LSD1.Fig. 4 Knockdown of LSD1 in breast cancer cell exosomes affects cell invasion and migration via miR-1290. (A) Immunofluorescence pictures of Cy3-labeled miR-1290 that can be accessed by exosomes (DAPI, green, PKH67, and red, miR-1290; scale bar = 10 μm). (B) Real-time PCR analysis confirmed that exosomes express miR-1290. The wound healing experiment was used to observe the exosome-treated MCF7 cell migration assay, as well as the evaluation of cell migration rate following transfection with miR-1290 mimics following LSD1 knockdown in MCF7 (C,E) and T47D (D,F) cells and control transfection with the inhibitor. T-test without pairing, Scale bar: 100 μm. *P < 0.05, **P < 0.01, ***P < 0.001.

miR-1290 regulates the target molecule NAT1

Next, we used Targetscan, RNA22, and miRWalk databases to estimate the target genes of miR-1290. A total of 1617 putative target genes were identified (Fig. 5A). Further KEGG analysis revealed that the putative target genes of miR-1290 concentrated in pathways linked to cell adhesion, influencing cell invasion and migration, and cancer-related pathways (Fig. 5B). Additionally, GO enrichment analysis revealed that the target genes of miR-1290 were enriched in cell adhesion and migration regulatory pathways (Fig. 5C). According to predictions, NAT1 could be a target gene for miR-1290, and it bonded to the 3'UTR region of NAT1 (Fig. 5D). To investigate how miR-1290 affected the expression of NAT1, the potential miR-1290 binding sites on the 3’UTR regions of NAT1 were mutated, and the mutated and wild-type 3’UTR regions were cloned into luciferase reporter vector pmirGLO. These luciferase reporter constructs and miR-1290 were transfected into 293 T cells. miR-1290 significantly reduced the luciferase activities from the pmirGLO-NAT1-wt constructs, and did not affect the luciferase activities from the pmirGLO-NAT1-mut constructs (Fig. 5D). MiR-1290 mimics and inhibitor were then transfected into the MCF7 breast cancer cell line. Following the overexpression and knockdown of miR-1290, NAT1 in cells was confirmed (Fig. 5E, F). The findings demonstrated that NAT1 expression rose following miR-1290 knockdown and fell following miR-1290 overexpression. NAT1 might be a target gene for miR-1290.Fig. 5 miR-1290 regulates the target molecule NAT1. (A) Veen plot of the total number of target genes predicted by miRWalk, RNA22, and Targetscan for miR-1290. (B) KEGG (https://www.kegg.jp/kegg/kegg1.html) pathway analysis of 1617 miR-1290 target genes associated with RNA22, Targetscan, and miRWalk predictions. (D) Schematic depiction of binding locations to miR-1290 in the NAT1 3' UTR. Measure the luciferase activity of NAT1 in 293 T cells using miR-1290 mimics and luciferase expression constructs with wild-type or mutant 3'UTR, (C) GO enrichment analysis of 1617 miR-1290 target genes predicted by Targetscan, RNA22, and miRWalk. The expression of NAT1 in MCF7 cells following transfection with inhibitor, control, and miR-1290 mimics was demonstrated by RT-PCR (E) and Western Blot (F) analysis. ***P < 0.001 for the unpaired t-test.

In conclusion, the exocytosis of breast cancer cells with LSD1 knockdown increases cell invasion and migration by reducing the expression of miR-1290, and it validates that NAT1 is a target gene of miR-1290 (Fig. 6). Created with BioRender.com.Fig. 6 Schematic diagram of LSD1 regulation of breast cancer invasive migration via exosomes.

In breast cancer cells, down-regulation of LSD1 leads to down-regulation of miR-1290 in exosomes, which promotes EMT, invasion and migration of breast cancer cells by targeting NAT1.

Discussion

Breast cancer is a prevalent malignant tumor in women that makes up 20% of all malignant tumors. It has a significant effect on patient survival33, and research has shown that LSD1, the first histone demethylase to be discovered, plays a crucial role in the invasive migration of breast cancer. Through the positive regulation of GATA-binding protein 3 (GATA3) and the inhibition of TRIM37 (tripartite motif-containing 37) expression, it has been discovered that LSD1 inhibits the invasion, migration, and metastasis of luminal breast cancer cells6. LSD1 plays different roles in different cancers. It has been shown that LSD1 is involved in the development of a variety of solid tumors, such as breast, bladder, prostate and non-small cell carcinomas. It is associated with cancer proliferation, migration, invasion and metastasis34. Some studies have shown that LSD1 is overexpressed in a variety of tumor cells and is also associated with poor tumor prognosis, but it has also been shown that down-regulation of LSD1 inhibits the oncogenic role of TRIM37 in breast cancer6.

We have uncovered the mechanism by which LSD1 prevents breast cancer cells from migrating invasively through exosomes. LSD1 KD exosomes stimulated the invasive migration of MCF7 breast cancer cells while modifying the expression of genes linked to cellular EMT. Subsequent investigations revealed that LSD1 controls the miRNA content in the exosomes of breast cancer cells, hence playing a significant role in cell invasion and migration. The expression of miR-1290 was found to be reduced in exosomes of LSD1 KD, as shown by high-throughput sequencing of miRNAs in exosomes. This lowered miR-1290 may influence invasive cell migration and interact with the target gene NAT1 (Fig. 6).

Intercellular signaling regulators are molecules that carry information from one cell to another and are found in large quantities in exosomes. As a signaling molecule, microRNA (miRNA) is a non-coding RNA that is typically loaded into exosomes35. It has been shown that miRNAs are assigned to exosomes in a regulated manner36. In our sequencing data, it was shown that downregulation of LSD1 caused changes in miRNA expression in exosomes of breast cancer cells. And it was also shown that LSD1 deletion caused downregulation of miR-145-5p in exosomes, which affected gastric cancer metastasis37. So downregulation of LSD1 regulates cancer metastasis by modulating changes in levels of contents in exosomes.

Exosomes have been linked to several stages in the metastatic spread of breast cancer, including invasion, extravasation, MET, colonization, migration, and EMT, according to research conducted in recent years38. Exosomes have a crucial role in the promotion of cancer invasion and migration. They are also engaged in a number of important activities, including drug resistance, tumor growth, angiogenesis, tumor microenvironment formation, cell invasion, and metastasis39–41. Furthermore, miRNAs contained in exosomes have a direct bearing on the advancement of breast cancer since they are implicated in numerous cancer processes and have distinct functions during the course of the disease's development. MiR-7-5p targets the RYK gene and influences the phosphorylation of JNK and c-Jun proteins, which increases the expression of EMT transcription factors including ZEB1 and affects breast cancer cells’ invasion and migration in exosomes42. MiR-516a-3p was found to decrease the Pygo2/Wnt/β-catenin signaling pathway, hence inhibiting the proliferation, metastasis, and EMT of breast cancer cells43. Our investigation revealed that the miRNA content contained in MCF7 cells' exosomes at LSD1 KD was changed, with a reduction in miR-1290. miR-1290 has been found in a number of malignant tumors, including breast cancer22. Several investigations have also revealed that there is variability in miR-1290 expression and that it is connected to several molecular models23,24. It has been demonstrated by in vitro research that miR-1290 can prevent breast cancer cells from migrating invasively. KEGG and GO studies revealed that the target genes of miR-1290 were connected to the regulatory pathways of cell adhesion and migration after additional investigation into the function and target genes of the protein. According to predictions, NAT1 binds to the 3'UTR region of NAT1 and may be a possible target gene for miR-1290. Exosomes are a crucial conduit for cellular communication. Since the miRNAs located within them do not degrade in the bloodstream, they may be useful for the early detection of malignancies44. The variability of miR-1290, however, suggests that it may be a useful biomarker for the early detection of estrogen receptor α (ERα)-positive breast cancer.

Our findings demonstrate, in summary, that downregulation of LSD1 in breast cancer cells increases invasive migration in estrogen receptor α (ERα)-positive breast cancer by causing downregulation of miR-1290 in the cells' exosomes. Our research broadens the understanding of the function of epigenetic changes in cancer spread.

Supplementary Information

Supplementary Information.

Supplementary Figure S1.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-71353-y.

Author contributions

Nan Zhang: Conceptualization, Data Curation, Fromal Analysis, Investigation, Methodology, Validation, Visualization, Writing-Original Draft, Writing-Review & Editing. Zhongyu Chen: Data Curation, Methodology, Software, Validation, Visualization. Benkai Xin: Fromal Analysis, Investigation, Methodology. Yueru Shi: Data Curation, Validation, Visualization. Yutong Yao: Data Curation, Fromal Analysis. Jingtong Yang: Validation. Xiaoyu Wang: Visualization. Xin Hu: Conceptualization, Finding Acquisition, Project Administration, Supervision, Writing-Review & Editing.

Funding

This work was supported by Jilin Scientific and Technological Development Program [20230508066RC], Special Project for Health Research Talents of Jilin Province [2022scz04], Norman Bethune Program of Jilin University [2022B06] and Innovation and Entrepreneurship Talent Funding Project of Jilin province [2023QN05].

Data availability

The Small RNA-seq data during the current study are available in the GEO repository, GSE266982.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Siegel RL Giaquinto AN Jemal A Cancer statistics, 2024 CA Cancer J. Clin. 2024 74 1 12 49 10.3322/caac.21820 38230766
Siegel, R. L., Giaquinto, A. N. & Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 74(1), 12–49 (2024).38230766 10.3322/caac.21820
2. Sung H Ferlay J Siegel RL Laversanne M Soerjomataram I Jemal A Bray F Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J. Clin. 2021 71 209 249 10.3322/caac.21660 33538338
Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71, 209–249 (2021).33538338 10.3322/caac.21660
3. Miller KD Nogueira L Devasia T Mariotto AB Yabroff KR Jemal A Kramer J Siegel RL Cancer treatment and survivorship statistics, 2022 CA Cancer J. Clin. 2022 72 409 436 10.3322/caac.21731 35736631
Miller, K. D. et al. Cancer treatment and survivorship statistics, 2022. CA Cancer J. Clin. 72, 409–436 (2022).35736631 10.3322/caac.21731
4. Liang Y Zhang H Song X Yang Q Metastatic heterogeneity of breast cancer: Molecular mechanism and potential therapeutic targets Semin. Cancer Biol. 2020 60 14 27 10.1016/j.semcancer.2019.08.012 31421262
Liang, Y., Zhang, H., Song, X. & Yang, Q. Metastatic heterogeneity of breast cancer: Molecular mechanism and potential therapeutic targets. Semin. Cancer Biol. 60, 14–27 (2020).31421262 10.1016/j.semcancer.2019.08.012
5. Shi Y Lan F Matson C Mulligan P Whetstine JR Cole PA Casero RA Shi Y Histone demethylation mediated by the nuclear amine oxidase homolog LSD1 Cell 2004 119 941 953 10.1016/j.cell.2004.12.012 15620353
Shi, Y. et al. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119, 941–953 (2004).15620353 10.1016/j.cell.2004.12.012
6. Hu X Xiang D Xie Y Tao L Zhang Y Jin Y Pinello L Wan Y Yuan GC Li Z LSD1 suppresses invasion, migration and metastasis of luminal breast cancer cells via activation of GATA3 and repression of TRIM37 expression Oncogene 2019 38 7017 7034 10.1038/s41388-019-0923-2 31409898
Hu, X. et al. LSD1 suppresses invasion, migration and metastasis of luminal breast cancer cells via activation of GATA3 and repression of TRIM37 expression. Oncogene 38, 7017–7034 (2019).31409898 10.1038/s41388-019-0923-2
7. Ambrosio S Saccà CD Majello B Epigenetic regulation of epithelial to mesenchymal transition by the lysine-specific demethylase LSD1/KDM1A Biochim. Biophys. Acta Gene Regul. Mech. 2017 1860 905 910 10.1016/j.bbagrm.2017.07.001 28720390
Ambrosio, S., Saccà, C. D. & Majello, B. Epigenetic regulation of epithelial to mesenchymal transition by the lysine-specific demethylase LSD1/KDM1A. Biochim. Biophys. Acta Gene Regul. Mech. 1860, 905–910 (2017).28720390 10.1016/j.bbagrm.2017.07.001
8. Wu Y Zhou BP Epigenetic regulation of LSD1 during mammary carcinogenesis Mol. Cell Oncol. 2014 1 e963426 10.4161/21624011.2014.963426 27308339
Wu, Y. & Zhou, B. P. Epigenetic regulation of LSD1 during mammary carcinogenesis. Mol. Cell Oncol. 1, e963426 (2014).27308339 10.4161/21624011.2014.963426
9. Yang Y Huang W Qiu R Liu R Zeng Y Gao J Zheng Y Hou Y Wang S Yu W Leng S Feng D Wang Y LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast cancer J. Mol. Cell Biol. 2018 10 285 301 10.1093/jmcb/mjy021 29741645
Yang, Y. et al. LSD1 coordinates with the SIN3A/HDAC complex and maintains sensitivity to chemotherapy in breast cancer. J. Mol. Cell Biol. 10, 285–301 (2018).29741645 10.1093/jmcb/mjy021
10. Li L Liu X He L Yang J Pei F Li W Liu S Chen Z Xie G Xu B Ting X Zhang Z Jin T Liu X Zhang W Yuan S Yang Z Wu C Zhang Y Yang X Yi X Liang J Shang Y Sun L ZNF516 suppresses EGFR by targeting the CtBP/LSD1/CoREST complex to chromatin Nat. Commun. 2017 8 691 10.1038/s41467-017-00702-5 28947780
Li, L. et al. ZNF516 suppresses EGFR by targeting the CtBP/LSD1/CoREST complex to chromatin. Nat. Commun. 8, 691 (2017).28947780 10.1038/s41467-017-00702-5
11. Thiery JP Acloque H Huang RY Nieto MA Epithelial–mesenchymal transitions in development and disease Cell 2009 139 871 890 10.1016/j.cell.2009.11.007 19945376
Thiery, J. P., Acloque, H., Huang, R. Y. & Nieto, M. A. Epithelial–mesenchymal transitions in development and disease. Cell 139, 871–890 (2009).19945376 10.1016/j.cell.2009.11.007
12. Nieto MA Huang RY Jackson RA Thiery JP Emt: 2016 Cell 2016 166 21 45 10.1016/j.cell.2016.06.028 27368099
Nieto, M. A., Huang, R. Y., Jackson, R. A. & Thiery, J. P. Emt: 2016. Cell 166, 21–45 (2016).27368099 10.1016/j.cell.2016.06.028
13. Gurunathan S Kang MH Jeyaraj M Qasim M Kim JH Review of the isolation, characterization, biological function, and multifarious therapeutic approaches of exosomes Cells 2019 8 307 10.3390/cells8040307 30987213
Gurunathan, S., Kang, M. H., Jeyaraj, M., Qasim, M. & Kim, J. H. Review of the isolation, characterization, biological function, and multifarious therapeutic approaches of exosomes. Cells 8, 307 (2019).30987213 10.3390/cells8040307
14. Yang E Wang X Gong Z Yu M Wu H Zhang D Exosome-mediated metabolic reprogramming: the emerging role in tumor microenvironment remodeling and its influence on cancer progression Signal Transduct. Target Ther. 2020 5 242 10.1038/s41392-020-00359-5 33077737
Yang, E. et al. Exosome-mediated metabolic reprogramming: the emerging role in tumor microenvironment remodeling and its influence on cancer progression. Signal Transduct. Target Ther. 5, 242 (2020).33077737 10.1038/s41392-020-00359-5
15. Doyle LM Wang MZ Overview of extracellular vesicles, their origin, composition, purpose, and methods for exosome isolation and analysis Cells 2019 8 727 10.3390/cells8070727 31311206
Doyle, L. M. & Wang, M. Z. Overview of extracellular vesicles, their origin, composition, purpose, and methods for exosome isolation and analysis. Cells 8, 727 (2019).31311206 10.3390/cells8070727
16. He C Zheng S Luo Y Wang B Exosome Theranostics: Biology and translational medicine Theranostics 2018 8 237 255 10.7150/thno.21945 29290805
He, C., Zheng, S., Luo, Y. & Wang, B. Exosome Theranostics: Biology and translational medicine. Theranostics 8, 237–255 (2018).29290805 10.7150/thno.21945
17. Xu Z Chen Y Ma L Chen Y Liu J Guo Y Yu T Zhang L Zhu L Shu Y Role of exosomal non-coding RNAs from tumor cells and tumor-associated macrophages in the tumor microenvironment Mol. Ther. 2022 30 3133 3154 10.1016/j.ymthe.2022.01.046 35405312
Xu, Z. et al. Role of exosomal non-coding RNAs from tumor cells and tumor-associated macrophages in the tumor microenvironment. Mol. Ther. 30, 3133–3154 (2022).35405312 10.1016/j.ymthe.2022.01.046
18. Wortzel I Dror S Kenific CM Lyden D Exosome-mediated metastasis: Communication from a distance Dev. Cell 2019 49 347 360 10.1016/j.devcel.2019.04.011 31063754
Wortzel, I., Dror, S., Kenific, C. M. & Lyden, D. Exosome-mediated metastasis: Communication from a distance. Dev. Cell 49, 347–360 (2019).31063754 10.1016/j.devcel.2019.04.011
19. Mashouri L Yousefi H Aref AR Ahadi AM Molaei F Alahari SK Exosomes: Composition, biogenesis, and mechanisms in cancer metastasis and drug resistance Mol. Cancer 2019 18 75 10.1186/s12943-019-0991-5 30940145
Mashouri, L. et al. Exosomes: Composition, biogenesis, and mechanisms in cancer metastasis and drug resistance. Mol. Cancer 18, 75 (2019).30940145 10.1186/s12943-019-0991-5
20. Whiteside TL Exosomes and tumor-mediated immune suppression J. Clin. Invest. 2016 126 1216 1223 10.1172/JCI81136 26927673
Whiteside, T. L. Exosomes and tumor-mediated immune suppression. J. Clin. Invest. 126, 1216–1223 (2016).26927673 10.1172/JCI81136
21. Yuan X Qian N Ling S Li Y Sun W Li J Du R Zhong G Liu C Yu G Cao D Liu Z Wang Y Qi Z Yao Y Wang F Liu J Hao S Jin X Zhao Y Xue J Zhao D Gao X Liang S Li Y Song J Yu S Li Y Breast cancer exosomes contribute to pre-metastatic niche formation and promote bone metastasis of tumor cells Theranostics 2021 11 1429 1445 10.7150/thno.45351 33391543
Yuan, X. et al. Breast cancer exosomes contribute to pre-metastatic niche formation and promote bone metastasis of tumor cells. Theranostics 11, 1429–1445 (2021).33391543 10.7150/thno.45351
22. Guz M Jeleniewicz W Cybulski M An insight into miR-1290: An oncogenic miRNA with diagnostic potential Int. J. Mol. Sci. 2022 23 1234 10.3390/ijms23031234 35163157
Guz, M., Jeleniewicz, W. & Cybulski, M. An insight into miR-1290: An oncogenic miRNA with diagnostic potential. Int. J. Mol. Sci. 23, 1234 (2022).35163157 10.3390/ijms23031234
23. Hamam R Ali AM Alsaleh KA Kassem M Alfayez M Aldahmash A Alajez NM microRNA expression profiling on individual breast cancer patients identifies novel panel of circulating microRNA for early detection Sci. Rep. 2016 6 25997 10.1038/srep25997 27180809
Hamam, R. et al. microRNA expression profiling on individual breast cancer patients identifies novel panel of circulating microRNA for early detection. Sci. Rep. 6, 25997 (2016).27180809 10.1038/srep25997
24. Endo Y Toyama T Takahashi S Yoshimoto N Iwasa M Asano T Fujii Y Yamashita H miR-1290 and its potential targets are associated with characteristics of estrogen receptor alpha-positive breast cancer Endocr. Relat. Cancer 2013 20 91 102 10.1530/ERC-12-0207 23183268
Endo, Y. et al. miR-1290 and its potential targets are associated with characteristics of estrogen receptor alpha-positive breast cancer. Endocr. Relat. Cancer 20, 91–102 (2013).23183268 10.1530/ERC-12-0207
25. Millner LM Doll MA Stepp MW States JC Hein DW Functional analysis of arylamine N-acetyltransferase 1 (NAT1) NAT1*10 haplotypes in a complete NATb mRNA construct Carcinogenesis 2012 33 348 355 10.1093/carcin/bgr273 22114069
Millner, L. M., Doll, M. A., Stepp, M. W., States, J. C. & Hein, D. W. Functional analysis of arylamine N-acetyltransferase 1 (NAT1) NAT1*10 haplotypes in a complete NATb mRNA construct. Carcinogenesis 33, 348–355 (2012).22114069 10.1093/carcin/bgr273
26. Carlisle SM Trainor PJ Hong KU Doll MA Hein DW CRISPR/Cas9 knockout of human arylamine N-acetyltransferase 1 in MDA-MB-231 breast cancer cells suggests a role in cellular metabolism Sci. Rep. 2020 10 9804 10.1038/s41598-020-66863-4 32555504
Carlisle, S. M., Trainor, P. J., Hong, K. U., Doll, M. A. & Hein, D. W. CRISPR/Cas9 knockout of human arylamine N-acetyltransferase 1 in MDA-MB-231 breast cancer cells suggests a role in cellular metabolism. Sci. Rep. 10, 9804 (2020).32555504 10.1038/s41598-020-66863-4
27. Liu Z Zhang N Xin B Shi Y Liang Z Wan Y Hu X Exosomes from LSD1 knockdown breast cancer cells activate osteoclastogenesis and inhibit osteoblastogenesis Int. J. Biol. Macromol. 2023 235 123792 10.1016/j.ijbiomac.2023.123792 36828097
Liu, Z. et al. Exosomes from LSD1 knockdown breast cancer cells activate osteoclastogenesis and inhibit osteoblastogenesis. Int. J. Biol. Macromol. 235, 123792 (2023).36828097 10.1016/j.ijbiomac.2023.123792
28. Kanehisa M Goto S KEGG: Kyoto encyclopedia of genes and genomes Nucleic Acids Res. 2000 28 1 27 30 10.1093/nar/28.1.27 10592173
Kanehisa, M. & Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28(1), 27–30 (2000).10592173 10.1093/nar/28.1.27
29. Kanehisa M Toward understanding the origin and evolution of cellular organisms Protein Sci. 2019 28 11 1947 1951 10.1002/pro.3715 31441146
Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 28(11), 1947–1951 (2019).31441146 10.1002/pro.3715
30. Kanehisa M Furumichi M Sato Y Kawashima M Ishiguro-Watanabe M KEGG for taxonomy-based analysis of pathways and genomes Nucleic Acids Res. 2023 51 D1 D587 D592 10.1093/nar/gkac963 36300620
Kanehisa, M., Furumichi, M., Sato, Y., Kawashima, M. & Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51(D1), D587–D592 (2023).36300620 10.1093/nar/gkac963
31. Lamouille S Xu J Derynck R Molecular mechanisms of epithelial-mesenchymal transition Nat. Rev. Mol. Cell Biol. 2014 15 178 196 10.1038/nrm3758 24556840
Lamouille, S., Xu, J. & Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 15, 178–196 (2014).24556840 10.1038/nrm3758
32. Dongre A Weinberg RA New insights into the mechanisms of epithelial–mesenchymal transition and implications for cancer Nat. Rev. Mol. Cell Biol. 2019 20 69 84 10.1038/s41580-018-0080-4 30459476
Dongre, A. & Weinberg, R. A. New insights into the mechanisms of epithelial–mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol. 20, 69–84 (2019).30459476 10.1038/s41580-018-0080-4
33. Tray N Taff J Adams S Therapeutic landscape of metaplastic breast cancer Cancer Treat. Rev. 2019 79 101888 10.1016/j.ctrv.2019.08.004 31491663
Tray, N., Taff, J. & Adams, S. Therapeutic landscape of metaplastic breast cancer. Cancer Treat. Rev. 79, 101888 (2019).31491663 10.1016/j.ctrv.2019.08.004
34. Zheng YC Ma J Wang Z Li J Jiang B Zhou W Shi X Wang X Zhao W Liu HM A systematic review of histone lysine-specific demethylase 1 and its inhibitors Med. Res. Rev. 2015 35 5 1032 1071 10.1002/med.21350 25990136
Zheng, Y. C. et al. A systematic review of histone lysine-specific demethylase 1 and its inhibitors. Med. Res. Rev. 35(5), 1032–1071 (2015).25990136 10.1002/med.21350
35. Li B Cao Y Sun M Feng H Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy FASEB J. 2021 35 e21916 10.1096/fj.202100294RR 34510546
Li, B., Cao, Y., Sun, M. & Feng, H. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB J. 35, e21916 (2021).34510546 10.1096/fj.202100294RR
36. Garcia-Martin R Wang G Brandão BB Zanotto TM Shah S Kumar Patel S Schilling B Kahn CR MicroRNA sequence codes for small extracellular vesicle release and cellular retention Nature. 2022 601 7893 446 451 10.1038/s41586-021-04234-3 34937935
Garcia-Martin, R. et al. MicroRNA sequence codes for small extracellular vesicle release and cellular retention. Nature. 601(7893), 446–451 (2022).34937935 10.1038/s41586-021-04234-3
37. Zhao LJ Fan QQ Li YY Ren HM Zhang T Liu S Maa M Zheng YC Liu HM LSD1 deletion represses gastric cancer migration by upregulating a novel miR-142-5p target protein CD9 Pharmacol. Res. 2020 159 104991 10.1016/j.phrs.2020.104991 32504836
Zhao, L. J. et al. LSD1 deletion represses gastric cancer migration by upregulating a novel miR-142-5p target protein CD9. Pharmacol. Res. 159, 104991 (2020).32504836 10.1016/j.phrs.2020.104991
38. Danac JMC Uy AGG Garcia RL Exosomal microRNAs in colorectal cancer: Overcoming barriers of the metastatic cascade (review) Int. J. Mol. Med. 2021 47 112 10.3892/ijmm.2021.4945 33907829
Danac, J. M. C., Uy, A. G. G. & Garcia, R. L. Exosomal microRNAs in colorectal cancer: Overcoming barriers of the metastatic cascade (review). Int. J. Mol. Med. 47, 112 (2021).33907829 10.3892/ijmm.2021.4945
39. Kalluri R LeBleu VS The biology, function, and biomedical applications of exosomes Science 2020 367 eaau6977 10.1126/science.aau6977 32029601
Kalluri, R. & LeBleu, V. S. The biology, function, and biomedical applications of exosomes. Science 367, eaau6977 (2020).32029601 10.1126/science.aau6977
40. Wu CY Du SL Zhang J Liang AL Liu YJ Exosomes and breast cancer: A comprehensive review of novel therapeutic strategies from diagnosis to treatment Cancer Gene Ther. 2017 24 6 12 10.1038/cgt.2016.69 27982016
Wu, C. Y., Du, S. L., Zhang, J., Liang, A. L. & Liu, Y. J. Exosomes and breast cancer: A comprehensive review of novel therapeutic strategies from diagnosis to treatment. Cancer Gene Ther. 24, 6–12 (2017).27982016 10.1038/cgt.2016.69
41. Zhang C Ji Q Yang Y Li Q Wang Z Exosome: Function and role in cancer metastasis and drug resistance Technol. Cancer Res. Treat. 2018 17 1533033818763450 10.1177/1533033818763450 29681222
Zhang, C., Ji, Q., Yang, Y., Li, Q. & Wang, Z. Exosome: Function and role in cancer metastasis and drug resistance. Technol. Cancer Res. Treat. 17, 1533033818763450 (2018).29681222 10.1177/1533033818763450
42. Liang Z Liu L Gao R Che C Yang G Downregulation of exosomal miR-7-5p promotes breast cancer migration and invasion by targeting RYK and participating in the atypical WNT signalling pathway Cell Mol. Biol. Lett. 2022 27 88 10.1186/s11658-022-00393-x 36210461
Liang, Z., Liu, L., Gao, R., Che, C. & Yang, G. Downregulation of exosomal miR-7-5p promotes breast cancer migration and invasion by targeting RYK and participating in the atypical WNT signalling pathway. Cell Mol. Biol. Lett. 27, 88 (2022).36210461 10.1186/s11658-022-00393-x
43. Chi Y Wang F Zhang T Xu H Zhang Y Shan Z Wu S Fan Q Sun Y miR-516a-3p inhibits breast cancer cell growth and EMT by blocking the Pygo2/Wnt signalling pathway J. Cell Mol. Med. 2019 23 6295 6307 10.1111/jcmm.14515 31273950
Chi, Y. et al. miR-516a-3p inhibits breast cancer cell growth and EMT by blocking the Pygo2/Wnt signalling pathway. J. Cell Mol. Med. 23, 6295–6307 (2019).31273950 10.1111/jcmm.14515
44. Sun Z Shi K Yang S Liu J Zhou Q Wang G Song J Li Z Zhang Z Yuan W Effect of exosomal miRNA on cancer biology and clinical applications Mol. Cancer 2018 17 147 10.1186/s12943-018-0897-7 30309355
Sun, Z. et al. Effect of exosomal miRNA on cancer biology and clinical applications. Mol. Cancer 17, 147 (2018).30309355 10.1186/s12943-018-0897-7
