
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00716-8
10.1016/j.psj.2024.104137
104137
PHYSIOLOGY AND REPRODUCTION
The role of AdipoQ on proliferation, apoptosis, and hormone Secretion in chicken primary adenohypophysis cells
Wu Xing *1
Tian Yixiang †1
Zhang Na *
Ren Yangguang *
Zhang Zihao *
Zhao Yudian *
Guo Yulong *
Gong Yujie *‡
Zhang Yanhua *‡
Li Donghua *‡
Li Hong *‡
Jiang Ruirui *‡
Li Guoxi *‡
Liu Xiaojun *‡
Kang Xiangtao *‡
Tian Yadong tianyadong@henau.edu.cn
*‡12
⁎ College of Animal Science and Technology, Henan Agricultural University, Zhengzhou 450046, China
† College of Animal Science and Veterinary Medicine, Henan Institute of Science and Technology, Xinxiang 453003, China
‡ Henan Key Laboratory for Innovation and Utilization of Chicken Germplasm Resources, Zhengzhou 450046, China
2 Corresponding author: tianyadong@henau.edu.cn
1 These authors contributed equally to this work.

29 7 2024
10 2024
29 7 2024
103 10 1041371 4 2024
24 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Adiponectin (AdipoQ), an adipokine secreted by adipocytes, has been reported to exist widely in various cell types and tissues, including the adenohypophysis of chickens. However, the molecular mechanism by which AdipoQ regulates the function of chicken adenohypophysis remains elusive. In this study, we investigated the effects of AdipoQ on proliferation, apoptosis, secretion of related hormones (FSH, LH, TSH, GH, PRL and ACTH) and expression of related genes (FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH) in primary adenohypophysis cells of chickens by using real-time fluorescent quantitative PCR (RT-qPCR), cell counting kit-8 (CCK-8), flow cytometry, enzyme-linked immunosorbent assay (ELISA) and Western blot (WB) assays. Our results showed that AdipoQ promoted the proliferation of chicken primary adenohypophysis cells, up-regulated the mRNA expression of proliferation-related genes CDK1, PCNA, CCND1 and P21 (P < 0.05), as well as the increased protein expression of CDK1 and PCNA (P < 0.05). Furthermore, AdipoQ inhibited apoptosis of chicken primary adenohypophysis cells, resulting in down-regulation of pro-apoptotic genes Caspase3, Fas, and FasL mRNA expression, and decreased Caspase3 protein expression (P < 0.05). Moreover, there was an up-regulation of anti-apoptotic gene Bcl2 mRNA and protein expression (P < 0.05). Additionally, AdipoQ suppressed the secretion of FSH, LH, TSH, GH, PRL, and ACTH (P < 0.05), as well as the mRNA expression levels of related genes (P < 0.05). Treatment with AdipoRon (a synthetic substitute for AdipoQ) and co-treatment with RNA interference targeting AdipoQ receptors 1/2 (AdipoR1/2) had no effect on the secretion of FSH, LH, TSH, GH, PRL, and ACTH, as well as the mRNA expression levels of the related genes. This suggests that AdipoQ's regulation of hormone secretion and related gene expression is mediated by the AdipoR1/2 signaling axis. Importantly, we further demonstrated that the mechanism of AdipoQ on FSH, LH, TSH and GH secretion is realized through AMPK signaling pathway. In conclusion, we have revealed, for the first time the molecular mechanism by which AdipoQ regulates hormone secretion in chicken primary adenohypophysis cells.

Key words

adiponectin
primary adenohypophysis cell
AdipoR1/2
AMPK
chicken
==== Body
pmcINTRODUCTION

Adiponectin (AdipoQ), also known as Acrp30, GBP28 or apM1, is a pivotal protein hormone secreted by adipose tissue subsequent to leptin. It plays a crucial role in various physiological processes, including glucose and lipid metabolism, growth and reproduction (Scherer et al., 1995; Kurose et al., 2021; Chen and Whiting 2022; Onodera et al., 2023; Bernardi et al., 2024; Zhou et al., 2024). Extensive research has provided evidence of its ability to enhance insulin sensitivity, ameliorate glucose and lipid metabolism, and reduce body weight in obese individuals (Berg et al., 2002; Straub and Scherer 2019; Tadiotto et al., 2023). Moreover, AdipoQ has been found to inhibit the growth of pancreatic cancer cells and nasopharyngeal carcinoma cells through the β-Catenin and AMPK signaling pathways (Jiang et al., 2019; Zhang et al., 2022). Furthermore, maternal AdipoQ levels have been shown to affect fetal growth (Duval et al., 2016; Qiao et al., 2016). Lastly, AdipoQ has been reported to potentially affect the secretion of reproductive-related hormones such as E2, P4, and GnRH (Grandhaye et al., 2021; Li et al., 2021b; Li et al., 2023).

The physiological effects of AdipoQ are primarily regulated through its interaction with AdipoQ receptors 1 (AdipoR1) and AdipoQ receptors 2 (AdipoR2). Initial studies have demonstrated that AdipoR1 is predominantly expressed in skeletal muscle in various mammals, including humans, mice, and pigs, while AdipoR2 is primarily expressed in the liver (Yamauchi et al., 2003; Lord et al., 2005). Additionally, the expression of AdipoR1 and AdipoR2 has been confirmed in various cell types and tissues, such as cardiomyocytes, pancreatic β cells (Kharroubi et al., 2003), endothelial cells (Motoshima et al., 2004), bone-forming cells (Berner et al., 2004), placenta (Chen et al., 2006). Interestingly, several studies have identified the presence of AdipoQ and its receptors in the adenohypophysis of vertebrates, including chickens (Maddineni et al., 2005; Ramachandran et al., 2007; Kiezun et al., 2013; Kaminska et al., 2020; Li, et al., 2021a). Psilopanagioti et al. (2009) reported the localization of AdipoQ and its receptors, within a specific subpopulation of pituitary cells responsible for the secretion of FSH, LH, GH, and TSH, suggesting a potential role in regulating endocrine function within the pituitary gland.

The upstream pituitary gland is under direct control of the central nervous system and regulated by hypothalamic releasing hormones, including follicle stimulating hormone (FSH), luteinizing hormone (LH), thyroid stimulating hormone (TSH), growth hormone (GH), prolactin (PRL) and adrenocorticotropic hormone (ACTH) (Marshall, 1952; Nagra et al., 1963; Proudman et al., 1999). hese hormones play crucial roles in regulating fundamental physiological functions such as reproduction, growth, development, and metabolism. They are transported to target organs and tissues throughout the body via abundant lymphatic vessels and capillaries surrounding the pituitary gland. This transportation occurs through systemic lymphatic and blood circulation, thereby influencing the activity of downstream endocrine glands. Research has provided evidence that AdipoQ exerts regulatory effects on the pituitary gland in mammals. For instance, studies have shown that AdipoQ can stimulate FSH release from porcine pituitary cells and enhance GnRH/insulin-induced FSH and LH release (Kiezun et al., 2014). A study conducted by Rodriguez-Pacheco et al. (2007) on rat pituitary cells demonstrated the inhibition of GH and LH release following a short-term (4h) treatment with AdipoQ. Another study by Sarmento-Cabral et al. (2017) on baboon pituitary cells revealed that AdipoQ inhibited ACTH release and promoted PRL release. These findings further support the regulatory role of AdipoQ in the mammalian pituitary endocrine system.

However, the molecular mechanisms by which AdipoQ regulates the physiological functions of the poultry adenohypophysis remain unknown. Therefore, the purpose of this study was to investigate the effects of AdipoQ on the proliferation, apoptosis, hormone secretion (FSH, LH, TSH, GH, PRL and ACTH) and expression of related genes (FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH) in chicken primary adenohypophysis cells, and to further reveal its potential signaling pathways.

MATERIALS AND METHODS

Ethics Approval

All experimental protocols in this study strictly followed the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Henan Agricultural University, with approval number 19-0068.

Isolation and Culture of Chicken Primary Adenohypophysis Cells

Intact adenohypophysis tissue were isolated from 16-embryo-old Hy-Line brown embryos and to washed three times in PBS containing 10% bull serum albumin (BSA) (Solarbio, Beijing, China) and 1% double antibody (Solarbio, Beijing, China). Neuropituitaries were carefully discarded and the remaining adenopituitaries were transferred to 1.5 mL EP tubes. The adenopituitaries were aseptically cut into pieces and digested with 0.25% trypsin (Solarbio, Beijing, China) at 37 °C for 10 min. Afterwards, the digested tissue were immediately transferred to a DEME (Gibco, Grand Island, USA) containing 10% BSA, 5% fetal bovine serum (FBS) (Solarbio, Beijing, China), 5 μg/mL bovine insulin (Solarbio, Beijing, China), 5 μg/mL transferrin (Solarbio, Beijing, China), and 1% double antibody to halt the digestion process. The cell suspension was filtered through a 200-mesh cell sieve to remove undigested tissues and cell aggregates, followed by centrifugation at 1,500 rpm/min for 10 min. The resulting cell precipitate was then diluted to a concentration of 5×106 cells/mL in DEME supplemented with 10% BSA, 5% FBS, 5 μg/mL bovine insulin, 5 μg/mL transferrin, and 1% double antibody. Finally, the cell suspension was seeded into poly-L-lysine-coated (Sigma, St Louis, MO) 12-well plates and incubated at 37 °C in a 5% CO2 incubator.

Plasmid Construction and Cell Transfection

The AdipoQ gene of chicken was isolated by PCR amplification using gene-specific primers. The resulting PCR products were digested with EcoR I and HindIII, and then cloned into pcDNA3.1 vector after digestion. The modified vector was designated as pcDNA3.1-AdipoQ, while the empty vector pcDNA3.1 served as a negative control. All constructs were verified by sequencing, and plasmids were purified using an endotoxin-free plasmid extraction kit (Tiangen, Beijing, China). Small interfering RNAs (siRNAs) targeting AdipoQ (si-AdipoQ), AdipoR1 (si-AdipoR1), AdipoR2 (si-AdipoR2), and a negative control (NC) were obtained from Gene Pharma (Shanghai, China).

The cells were transfected with LipofectamineTM 3000 Transfection Reagent (Invitrogen, Carlsbad, CA). After seeding, the cells were grown to 70 to 80% confluence before transfection with 1,000 ng of plasmid and 50 nM siRNA. All procedures strictly followed the manufacturer's instructions. At 36 h post-transfection, cells were harvested for RNA and protein extraction, while cell supernatants were collected for ELISA analysis.

RNA Extraction and Real-Time PCR

Total RNA was extracted from chicken primary adenohypophysis cells using TRIzol reagent (Invitrogen, Carlsbad, USA) following the manufacturer's instructions. RT-PCR was performed using 500 ng of total RNA and the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) at 37 °C for 15 min, followed by 85 °C for 5 s. The qRT-PCR was conducted using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) with gene-specific primers. The analysis was performed on the Light Cycler 96 qRT-PCR system (Roche, Basel, Switzerland) with cycling conditions of 95 °C for 5 min, followed by 30 cycles of 95 °C for 10 s and 60 °C for 30 s. The primers used for qRT-PCR are listed in Table 1. The relative expression of each gene was calculated according to the 2-(delta delta Ct) method, and the results were normalized by GAPDH levels (Livak and Schmittgen, 2001; Wang et al., 2011).Table 1 The primers of genes presented in the study.

Table 1Gene	Sequence of nucleotide	Gene ID	Product length (bp)	
Adiponectin	F 5´- GCCAGGTCTACAAGGTGTCA -3´
R 5´- CCATGTGTCCTGGAAATCCT -3´	NM_20691.1	86	
AdipoR1	F 5´- CCAGGAGAAGGTTGTGTTTG-3´
R 5´- TGATCAGCAGTGCAATTCCT-3´	NM_001031027.1	149	
AdipoR2	F 5´- CTGCAACAACACAGACAGCC -3´
R 5´- GGGCTTGTAGAAGGGGTGAC-3´	NM_001007854.1	171	
P21	F 5´- GAAGAGTTGTCCACGATAAGC -3´
R 5´- TTCCAGTCCTCCTCAGTCC -3´	NM_001396336.1	247	
CDK1	F 5´- TAATAGATGACAAAGGGGT -3´
R 5´- GAGTGGAATACAGAGCAGA -3´	NM_205314.2	146	
CCND1	F 5´- CAGAAGTGCGAAGAGGAAGT -3´
R 5´- CTGATGGAGTTGTCGGTGTA -3´	XM_046941491.1	188	
PCNA	F 5´- AGCACCAAATCAGGAAAAG -3´
R 5´- GCACAGGAGATGACAACAG -3´	NM_204170.3	177	
Bcl2	F 5´- CAACGGAGGATGGGATGCC -3´
R 5´- CTTATGTCCAAGATAAGCG -3´	NM_205339.3	145	
Caspase3	F 5´- GGCTACTACTCCTGGAGGA -3´
R 5´- ACACAATGCATGGAATCTG -3´	NM_204725.2	193	
Fas	F 5´- TAACACAGCTGCAGCAGACA -3´
R 5´- TCACAATGTCAGGGACGTGG -3´	NM_001199487.2	101	
FasL	F 5´- CTGGAGAAGCTCATAGGGCAG -3´
R 5´- ACCAGAGACAGGTTCCCACT -3´	NM_001031559.2	120	
FSHβ	F 5´- CTGCGGTGACCATCCTGAAT -3´
R 5´- CTCACAGTGCAGTCAGTGCT -3´	NM_204257.2	96	
LHβ	F 5´- GTGTTGGTGCTGATGACCCT -3´
R 5´- ACCGCCACCGTTACGTTTAT -3´	HQ872606.1	155	
GnRHR	F 5´- GAGCTTCTCCTGCCTCTTCC -3´
R 5´- TAGTAGGGGGTCCAGCAGAG -3´	NM_001012609.1	219	
TSHβ	F 5´- GCCTGGAGTGTATAAAGCACA -3´
R 5´- AGGGACTCATGCTCTTGTCAG -3´	NM_205063.4	115	
GH	F 5´- ACATGGAGCTGCTTCGGTTT -3´
R 5´- AACACTCTGTCTGAGGTGCC -3´	NM_204359.2	115	
PRL	F 5´- GAGTGACCTCCCTGCCAATC -3´
R 5´- AATGAAACCCCGACCCTGAG -3´	NM_205466.3	164	
ACTH	F 5´- GCAGCTCCTCCGCAGTT -3´
R 5´- ACTTGCTGTTCTCCCAGCAT -3´	NM_001398117.1	139	
GAPDH	F 5´- GAACATCATCCCAGCGTCCA-3´
R 5´- CGGCAGGTCAGGTCAACAAC-3´	NM_204305	132	

Cell Viability Assay

Cell viability was assessed using the cell counting kit (CCK)-8 (Dojindo, Japan) according to the manufacturer's protocol. Chicken primary adenohypophysis cells were seeded in 96-well plates and incubated at 37°C with 5% CO2 until transfection completion. At 24 h, 36 h, and 48 h post-transfection, the medium was replaced with fresh medium supplemented with 10% CCK-8 reagent. After an additional 2 h incubation at 37°C, the absorbance was measured at 450 nm.

Apoptosis Assay

Cell apoptosis was detected using the Annexin V-633/PI Apoptosis Detection Kit (Dojindo, Japan). Chicken primary adenohypophysis cells were harvested 36 h post-transfection and labeled with 5 μL Annexin V-633 and 5 μL PI for 15 min at room temperature in the dark. Subsequently, flow cytometry analysis was performed on the labeled cells using a BD Biosciences flow cytometer (BD Biosciences, San Jose, CA).

Cell Cycle Assay

Cells were fixed in 75% cold ethanol and incubated overnight at 4°C. Subsequently, DNA was stained with propidium iodide (PI) (Solarbio, Beijing, China) for 1 h at room temperature in the absence of light. The stained cells were then analyzed using a flow cytometer (BD Biosciences, San Jose, CA).

Western Blot Analysis

After 36 h of transfection, the culture medium was discarded, and the chicken primary adenohypophysis cells were washed with PBS. Total proteins were extracted from the cells using RIPA lysate (Shanghai, China). The protein samples were separated using 10% SDS-PAGE based on their molecular weight and transferred onto a PVDF membrane. To prevent nonspecific binding, the PVDF membrane was blocked with 5% defatted milk powder. Primary antibodies against AdipoQ (1:1,000, Bioss, Beijing, China), p-AMPK (1:1,000, Cell Signaling Technology, Boston, MA), CDK1 (1:1,000, proteintech, Wuhan, China), PCNA (1:2000, abcom, Cambridge, UK), Bcl2 (1:2,000, abcom, Cambridge, UK), Caspase3 (1:2,000, abcom, Cambridge, UK) and GAPDH (1:5,000, Boster, Wuhan, China) were incubated together with the membrane overnight at 4°C. Subsequently, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody (1:3,000, Elabscience, Wuhan, China) for 50 min. Finally, the bands were quantified by measuring the optical density using the AlphaEaseFC program.

Enzyme Linked Immunosorbent Assay

After collecting the cell supernatant, the cells were centrifuged at 3,000 rpm/min for 20 min. The levels of FSH, LH, TSH, GH, PRL and ACTH in the supernatant were measured using a commercial ELISA kit (Jiangsu Meimian Industrial Co., Ltd., Yancheng, China). Briefly, 40 μL of cell supernatant, 10 μL of antibody, and 100 μL of enzyme reagent were added to each well. The plate was then sealed with plate sealing film and incubated at 37°C for 1 h. After incubation, the plates were washed five times with washing solution, and 50 μL of color development solutions A and B were added to each well. The plates were further incubated for 15 min at 37°C in the dark. Subsequently, 50 μL of termination solution was added to each well, and the plates were immediately measured at 450 nm OD using a microreader (Rayto, Shenzhen, China).

Statistical Analysis

All experiments underwent statistical analysis using SPSS version 22.0 (IBM SPSS, Armonk, NY). The data are presented as mean ± standard deviation. Student's t-test was employed for comparisons between two groups, while one-way ANOVA followed by post hoc Duncan's test was used for comparisons involving more than two groups. A p-value of less than 0.05 was considered indicative of a statistically significant difference.

RESULTS

AdipoQ Promoted the Proliferation and Inhibited the Apoptosis of Chicken Primary Adenohypophysis Cells

To investigate the impact of AdiopoQ overexpression and interference on the proliferation and apoptosis of chicken primary adenohypophysis cells, a series of experiments were conducted. The cells were cultured with PCDNA3.1, PCDNA3.1-AdipoQ, NC, and si-AdipoQ for a duration of 36 h. First, qRT-PCR was utilized to detect AdiopoQ expression and confirm the successful overexpression and interference of AdiopoQ (Figures 1A and 1B). Then, the impact of AdipoQ manipulation on cell proliferation and apoptosis in chicken primary adenohypophysis cells was evaluated using various assays, including the CCK-8 assay, flow cytometry, qRT-PCR and WB assay. The results showed that overexpression of AdipoQ significantly increased cell viability in chicken primary adenohypophysis cells (P < 0.01) while interference with AdipoQ significantly decreased cell viability (P < 0.01) at 36 h (Figures 1C and 1D).The cell cycle analysis revealed that overexpression of AdipoQ markedly reduced the number of G0/G1 cells, with a higher number of S-phase cells compared to the control group (P < 0.05) (Figure 1E). Conversely, interference with AdiopoQ increased the number of G0/G1 cells and decreased the number of S-phase cells compared to controls (P < 0.01) (Figure 1F). Moreover, we found that overexpression of AdipoQ markedly upregulated the mRNA expression of proliferation-related genes, including CDK1, PCNA, CCND1 and P21, along with the protein levels of CDK1 and PCNA (P < 0.05) (Figures 1G and 1M). In contrast, interference with AdipoQ resulted in the opposite effect (P<0.05) (Figures 1H and 1N). Additionally, the overexpression of AdiopoQ resulted in a significantly lower percentage of apoptotic cells, whereas interference with AdiopoQ led to a significantly higher percentage when compared to the control group (P < 0.01) (Figures 1I–1J). Similarly, overexpression of AdipoQ significantly up-regulated the mRNA and protein expression of the anti-apoptotic gene Bcl2, while significantly down-regulated the mRNA expression of the pro-apoptosis genes Caspase3, Fas, and FasL as well as the protein expression of the Caspase3 (P < 0.05) (Figures 1K and 1M). Conversely, interference with AdipoQ yielded contrasting results (P < 0.05) (Figures 1L and 1N). Based on these collective findings, it can be concluded that AdipoQ promotes cell proliferation and inhibits apoptosis in chicken primary adenohypophysis cells.Figure 1 Effects of overexpression and interference of AdipoQ on proliferation and apoptosis of chicken primary adenohypophysis cells. (A–B) The overexpression or interference efficiency of AdipoQ was examined by RT‒PCR; (B–C) Cell growth curves determined by the CCK-8 assay following transfection with AdipoQ overexpression or interference in chicken primary adenohypophysis cells; (E–F) Flow cytometry to determine proliferation of treated cells; (G–H) The mRNA expression of key genes related to proliferation following cell treatment; (I–J) Flow cytometry for the apoptotic rate of treated cells; (K–L) The mRNA expression of key genes related to apoptosis following cell treatment.

Figure 1

AdipoQ Inhibits the Expression of Hormone Secretion and Relevant Genes in Chicken Primary Adenohypophysis Cells

To unveil the role of AdipoQ in the regulation of gene expression and hormone secretion associated with chicken primary adenohypophysis cells, we examined the expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH genes as well as hormone secretion after overexpression or interference with AdipoQ by RT-qPCR and ELISA analysis. The results demonstrated that overexpression of the AdipoQ gene in chicken primary adenohypophysis cells led to the downregulation of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH mRNA levels (P < 0.05) (Figure 2A). Similarly, hormone secretion of FSH, LH, TSH, GH, PRL, and ACTH was significantly inhibited (P < 0.05) (Figures 2B–2G). Conversely, interference with AdipoQ resulted in the opposite expression pattern of the aforementioned mRNAs and hormones (P < 0.05) (Figures 2I–2N). In short, AdipoQ inhibits hormone secretion and related gene expression in chicken primary pituitary cells.Figure 2 Effects of overexpression and interference of AdipoQ on hormone secretion and related gene expression of chicken primary adenohypophysis cells. (A) Effect of overexpression of AdipoQ on mRNA expression of related genes; (B–G) Effects on hormone secretion after overexpression of AdipoQ; (C) Effect of interference of AdipoQ on mRNA expression of related genes; (I–N) Effects on hormone secretion after interference of AdipoQ.

Figure 2

Hormone Secretion and Related Gene Expression Following AdipoRon Treatment and AdipoR1/2 Interference

To investigate the influence of AdipoQ on hormone secretion and the mRNA expression of related genes in chicken primary adenohypophysis cells, we employed an AdipoQ analogue called AdipoRon. Co-treatment of AdipoRon with interference of AdipoR1/2 was conducted to determine the receptor through which AdipoQ exerts its effects. Prior to the experiments, we employed the CCK-8 method to determine the safe concentration of AdipoRon that would not significantly affect cell viability in chicken primary adenohypophysis cells. The results indicated that treatment with 5 μg/mL of AdipoRon for 12 h did not cause a significant difference in cell viability compared to the control group. However, cell viability significantly decreased after 24 or 36 h of treatment with 5 μg/mL of AdipoRon (P < 0.05). Furthermore, concentrations of 10 μg/mL and 20 μg/mL of AdipoRon resulted in a significant reduction in cell activity at 12, 24, and 36 h (P < 0.05) (Figure 3A). Based on these findings, we selected the concentration of 5 μg/mL AdipoRon for 12 h for subsequent experiments.Figure 3 Cotreatment of AdipoRon and Interfering AdipoR1/2 on hormone secretion and related gene expression. (A) Effect of different concentrations of AdipoRon on the viability of chicken primary adenohypophysis cells; (B) The effect of AdipoRon cotreatment with interfering AdipoR1 on mRNA expression of related genes; (C) The effect of AdipoRon cotreatment with interfering AdipoR1 on hormone secretion; (D) The effect of AdipoRon cotreatment with interfering AdipoR2 on mRNA expression of related genes; (E) The effect of AdipoRon cotreatment with interfering AdipoR2 on hormone secretion; (F) Effect of cotreatment of AdipoRon with interfering AdipoR1 and interfering AdipoR2 on the mRNA expression of related genes; (G) Effect of cotreatment of AdipoRon with interfering AdipoR1 and interfering AdipoR2 on hormone secretion.

Figure 3

Following interfering with AdipoR1 or AdipoR2, the mRNA expression of AdipoR1 or AdipoR2 was significantly reduced (P < 0.05) (Figures 3B and 3D). Moreover, the mRNA expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH as well as the secretion of FSH, LH, TSH, GH, PRL and ACTH hormones were significantly decreased in si-AdipoR1 or AdipoR2 group (P < 0.05) (Figure 3B–E). Similarly, in the AdipoRon group, there was a significant decrease in the mRNA expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH as well as the secretion of FSH, LH, TSH, GH, PRL and ACTH hormones (P < 0.05) (Figure 3B–E). Compared with the NC group, si-AdipoR1 or si-AdipoR2 plus AdipoRon resulted in a decrease in the mRNA expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH as well as the secretion of FSH, LH, TSH, GH, PRL and ACTH hormones (P < 0.05) (Figure 3B–E). Our results showed that when AdipoR1 was interfered, AdipoQ inhibited the secretion of FSH, LH, TSH, GH, PRL and ACTH by AdipoR2, and vice versa. Additionally, we simultaneously interfered with AdipoR1 and AdipoR2 with the addition of AdipoRon. The results showed that in si-AdipoR1 plus si-AdipoR2 group, the mRNA expression of AdipoR1 and AdipoR2 significantly decreased, while the mRNA expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH as well as the secretion of FSH, LH, TSH, GH, PRL and ACTH were significantly increased (P < 0.05) (3F–G). Interestingly, compared to the NC group, the mRNA expression of AdipoR1 and AdipoR2 significantly increased in the si-AdipoR1 plus si-AdipoR2 plus AdipoRon group (P < 0.05). However, there were no significant differences in the mRNA expression of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH as well as the secretion of FSH, LH, TSH, GH, PRL and ACTH (Figures 3F–3G).These results suggested that AdipoQ analogue, AdipoRon, inhibits the secretion of FSH, LH, TSH, GH, PRL and ACTH hormones as well as the expression of related genes, which was mediated by activating AdipoR1 and AdipoR2.

AdipoQ Regulates Hormone Secretion and Related Gene Expression in Chicken Adenohypophysis Cells Via the AMPK Signaling Pathway

To further explore the regulatory role of AdipoQ in hormone secretion and gene expression in chicken primary adenohypophysis cells through the AMPK signaling pathway, we initially examined the effects of overexpression or interference of AdipoQ on the phosphorylation level of AMPK in these cells. Our results showed a significant up-regulation of AdipoQ protein levels and AMPK phosphorylation in the AdipoQ overexpression group, while a down-regulation was observed in the AdipoQ interference group compared to the control group (P < 0.01) (Figure 4A and B). Subsequently, we employed AMPK pathway inhibitors (Compound C), PCDNA3.1, PCDNA3.1-AdiopoQ, NC and si-AdiopoQ for the next studies. The findings revealed noticeable increases in the mRNA levels of FSHβ, LHβ, GnRHR, TSHβ, and GH in the Compound C group compared to the PCDNA3.1 group or the NC group (P<0.05). accompanied by an elevation in the secretion of FSH, LH, TSH, and GH hormones (P < 0.05). However, the mRNA levels of PRL and ACTH were significantly decreased (P < 0.05), while their hormone levels remained unaffected or down-regulated (Figure 4C–F). PCDNA3.1-AdiopoQ or si-AdiopoQ led to a decrease or increase in the mRNA levels of FSHβ, LHβ, GnRHR, TSHβ, GH, PRL and ACTH, respectively. Additionally, these interventions significantly inhibited or promoted the secretion of FSH, LH, TSH, GH, PRL and ACTH hormones (P < 0.05) (Figure 4C–F). In addition, in the PCDNA3.1-AdipoQ plus Compound C group, the expression of FSHβ, LHβ, GnRHR, TSHβ, GH mRNA as well as the secretion of FSH, LH, TSH, GH hormone was lower than that in the Compound C group but higher than that in the PCDNA3.1-AdiopoQ group (Figure 4C and D). However, in the si-AdipoQ plus Compound C group, there was a significant increase in the expression of FSHβ, LHβ, GnRHR, TSHβ, GH mRNA, and the secretion of FSH, LH, TSH, and GH hormones compared to the Compound C group and the si-AdipoQ group (P < 0.05) (Figure 4E and F). In summary, these data indicated that AdipoQ regulates the secretion of FSH, LH, TSH and GH hormones and the expression of FSHβ, LHβ, TSHβ and GH genes in chicken adenohypophysis cells through the AMPK signaling pathway.Figure 4 AdipoQ regulates hormone secretion and related gene expression in chicken primary adenohypophysis cells through the AMPK signaling pathway. (A–B) Effects of AdipoQ overexpression or interference on AdipoQ and AMPK protein expression; (C) Effect of cotreatment of Compound C with overexpressed AdipoQ on mRNA expression of related genes; (D) Effect of cotreatment of Compound C with overexpressed AdipoQ on hormone secretion; (E) The effect of Compound C cotreatment with interfering AdipoQ on mRNA expression of related genes; (F) The effect of Compound C cotreatment with interfering AdipoQ on hormone secretion.

Figure 4

DISCUSSION

AdipoQ, a protein secreted by adipose tissue, exhibits various effects such as antioxidant stress regulation, glucose and lipid metabolism regulation, and anti-inflammatory properties (Brochu-Gaudreau et al., 2010; Schindler et al., 2017; Singh et al., 2018). Recent studies have shed light on the role of AdipoQ in cell proliferation and apoptosis regulation. For instance, Zhang et al. (2015) found that AdipoQ inhibits the proliferation and promotes apoptosis of endometrial cancer cells by activating AMPK pathway. Similarly, Feng et al. (2018) discovered that AdipoQ promoted the proliferation of ovarian cancer cells through PI3K/Akt and Raf/MEK/ERK pathways. In another study, Zhang et al. (2011) found that AdipoQ promotes the proliferation of hippocampal neural stem cells by activating the p38MAPK/GSK-3β/β-catenin signaling pathway, without affecting apoptosis. These studies collectively indicate that AdipoQ has a wide range of regulatory effects on the process of proliferation and apoptosis of different cell lines, exhibiting cell-specific differences. To investigate the impact of AdipoQ on the proliferation of chicken adenohypophysis cells, we examined cell viability, cell cycle progression, and the expression of P21, CDK1, CCND1, and PCNA genes associated with cell proliferation following AdipoQ overexpression or interference. Cyclin-dependent kinases (CDKs), a vital family of protein kinases, play a critical role in regulating the cell cycle, activating checkpoints, and repairing DNA damage, with CDK1 particularly essential for controlling the entry of cells into mitosis (Nasa et al., 2020). The CCND1 gene encodes a highly conserved cell cycle protein that forms a complex with CDK4 and CDK6, critically influencing the G1/S transition (Liu et al., 2008). Our findings revealed that AdipoQ promotes the proliferation of chicken primary adenohypophysis cells. To explore the effect of AdipoQ on apoptosis of chicken primary adenohypophysis cells, we assessed apoptosis levels and the expression of apoptosis-related genes Bcl2, Fas, FasL and Caspase3, upon AdipoQ overexpression or interference. Fas, a death receptor molecule and member of the tumor necrosis factor (TNF) family, induces apoptosis when bound to FasL, a type II membrane protein (Vickers et al., 2000). The caspase family plays a pivotal role in the morphological and biochemical changes associated with apoptosis, with Caspase3 being a key player. Activated Caspase3 cleaves various intracellular target proteins, triggering nuclear and cytoplasmic morphological alterations that ultimately lead to cell death (Kurokawa and Kornbluth, 2009). Bcl2 protects cells from apoptotic signaling by preventing the release of cytochrome C from mitochondria (an important event in apoptosis) thus inhibiting it (Flaws et al., 2001). Our results demonstrated that AdipoQ inhibits apoptosis in chicken primary adenohypophysis cells. Although the signaling pathway underlying AdipoQ's effects on proliferation and apoptosis in chicken primary adenohypophysis cells remains unclear and requires further investigation, the wealth of research on AdipoQ's effects on proliferation and apoptosis across diverse cell lines provides valuable insights and direction. Notably, AdipoQ has been observed to inhibit the expression of the interleukin-6 (IL-6) gene in porcine adenohypophysis cells (Szeszko et al., 2019). IL-6 is a multifunctional cytokine that plays a crucial role in cell growth regulation. Autocrine IL-6 has been associated with cell senescence, as reported by Sapochnik et al. (2017). This discovery opens a new avenue for investigating the regulatory mechanisms by which AdipoQ influences the proliferation and apoptosis of chicken primary adenohypophysis cells. That is, AdipoQ may promote cell proliferation and inhibit apoptosis in chicken primary adenohypophysis cells by suppressing the expression of the IL-6 gene.

In chicken primary adenohypophysis cells, various hormones are secreted, including FSH, LH, TSH, GH, ACTH, and PRL, which play significant physiological roles in poultry organisms. Among these hormones, FSH, LH and PRL specifically contribute to reproduction. FSH primarily promotes follicular maturation, while LH promotes both follicular maturation and ovulation. Additionally, PRL stimulates the production of follicular LH receptors. TSH and ACTH are primarily involved in body development. TSH supports the growth and function of the thyroid, whereas ACTH maintains the normal morphology and function of the adrenal gland. GH is closely associated with growth and metabolism, promoting bone and organ growth, protein synthesis, and influencing fat and mineral metabolism. It plays a crucial role in overall body growth and development. Our findings demonstrate that AdipoQ indirectly participates in the regulation of reproduction, development, growth, and metabolism by inhibiting the secretion of FSH, LH, TSH, GH, PRL and ACTH by the pituitary gland. Further results obtained from co-treatment with AdipoRon (a synthetic analogue of AdipoQ) and interference of AdipoR1/2 suggest that AdipoQ's regulatory effect on adenohypophysis hormone secretion is mediated through the activation of AdipoR1 and AdipoR2. This view is supported by previous studies. For example, Rodriguez-Pacheco et al. (2007) demonstrated that in short-term (4 h) cultured rat pituitary cells, AdipoQ inhibited the release of GH and LH as well as the secretion of GH and LH induced by ghrelin and GnRH stimulation. This is consistent with the results of our experiment. Other studies have also shown the specific effects of AdipoQ on pituitary endocrine function across different species and physiological stages. In vitro studies conducted by Kiezun et al. (2014) showed that AdipoQ regulated FSH secretion without affecting LH secretion from porcine pituitary cells during estrus, but exhibited different effects at different stages of the estrous cycle. Punyadeera et al. (2005) demonstrated that intravenous injection of adenovirus expressing AdipoQ into male mice reduced serum LH levels while leaving FSH levels unchanged. Moreover, some studies suggest that AdipoQ may influence the secretory function of adenohypophysis cells by down-regulating the expression of IL-6 and interleukin-1α (IL-1α) genes. Szeszko et al. (2019) observed that AdipoQ down-regulated the expression of IL-6 and IL-1α genes in porcine pituitary cells, which are associated with positive regulation of pituitary cell secretion. Fukata et al. (1989) and Spangelo et al. (1989) confirmed that IL-6 induced the secretion of ACTH, GH, and PRL in rat pituitary cells in vivo or in vitro. Braden et al. (1998) found that IL-1α stimulated the release of LH in sheep pituitary cells in vitro. Based on these studies, it can be speculated that AdipoQ may inhibit the secretory function of chicken primary adenohypophysis cells by down-regulating the expression of the IL-6 or IL-1α gene.

Previous studies have widely acknowledged the role of AMPK in maintaining energy homeostasis and facilitating metabolic adaptations. However, recent research has revealed that AMPK may also have significant involvement in other physiological processes, including its participation in the signaling pathway of AdipoQ (Wen et al., 2010; Hu et al., 2022). Lu et al. (2008) showed that AdipoQ increased the phosphorylation level of AMPK and significantly suppressed LH secretion, as well as GnRH-stimulated LH fraction. This finding is partially consistent with our findings that AdipoQ may regulate the secretion of FSH, LH, TSH and GH in chicken adenohypophysis through AMPK signaling pathway. We hypothesize that AMPK, acting as a signal transducer, functions by sensing the body's nutritional status through monitoring ATP concentration and cellular energy levels. Subsequently, it transmits secretory signals to regulate the release of FSH, LH, TSH, and GH, indirectly influencing processes related to reproduction, growth, and development. Notably, an investigation into the impact of AdipoQ on the transcriptional profile of porcine anterior pituitary cells revealed differential expression of genes associated with the AMPK signaling pathway. Specifically, AdipoQ up-regulated the expression of phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (PIK3CG), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (PFKFB1) and glycogen synthase 2 (GYS2) (Szeszko et al., 2019). This suggests that AdipoQ may indirectly affect AMPK signaling pathway by regulating the expression of these three genes.

CONCLUSIONS

The objective of this study was to investigate the potential role of AdipoQ in regulating the proliferation, apoptosis, hormone secretion (FSH, LH, TSH, GH, PRL, and ACTH) and related gene expression of chicken primary adenohypophysis cells. This study revealed that AdipoQ promotes the proliferation and inhibits apoptosis of chicken primary adenohypophysis cells. Furthermore, AdipoQ regulates the hormone secretion (FSH, LH, TSH, GH, PRL, and ACTH) and mRNA expression (FSHβ, LHβ, GnRHR, TSHβ, GH, PRL, and ACTH) in chicken primary adenohypophysis cells by binding to AdipoR1/2. Additionally,the regulatory effect of AdipoQ on hormone secretion (FSH, LH, TSH, and GH) may be mediated through the AMPK signaling pathway (Figure 5). These findings provide a groundbreaking insight into the molecular mechanism underlying AdipoQ's regulation of secretory function in chicken adenohypophysis.Figure 5 A schematic diagram illustrating the role of AdipoQ in the proliferation, apoptosis and hormone secretion function of chicken primary adenohypophysis cells.

Figure 5

DISCLOSURES

The authors declare no conflict of interest.

Appendix Supplementary materials

Supplementary Figure 1. Validation of the isolation and culture of primary adenohypophysis cells. (A) Immunofluorescence identification of primary adenohypophysis cells; (B) Comparison of mRNA levels of hormones secreted by primary adenohypophysis cells and different cells

Image, application 1

ACKNOWLEDGMENTS

The work was supported by the Science and Technology Innovation 2030 Major Projects (2023ZD0405203 ); and the National Natural Science Foundation of China (NO. 32272867 ).

Author Contributions: Xing Wu, Yixiang Tian, Na Zhang, Yangguang Ren, Zihao Zhang, Yudian Zhao, and Yulong Guo performed the experimental process. Xing Wu and Yixiang Tian wrote the manuscript. Na Zhang, Yujie Gong, Yanhua Zhang, Donghua Li, and Hong Li analyzed the data and were involved in the study design. Ruirui Jiang, Guoxi Li, Xiaojun Liu Xiangtao Kang and Yadong Tian critically revised the manuscript for important intellectual content. All authors approved the final manuscript.

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104137.
==== Refs
REFERENCES

Berg A.H. Combs T.P. Scherer P.E. ACRP30/adiponectin: an adipokine regulating glucose and lipid metabolism Trends Endocrinol. Metab. 13 2002 84 89 11854024
Bernardi O. Ramé C. Reverchon M. Dupont J. Adiponectin and visfatin expression profile in extra-embryonic annexes and role during embryo development in layer and broiler chickens Gen. Comp. Endocrinol. 349 2024 114466
Berner H.S. Lyngstadaas S.P. Spahr A. Monjo M. Thommesen L. Drevon C.A. Syversen U. Reseland J.E. Adiponectin and its receptors are expressed in bone-forming cells Bone 35 2004 842 849 15454091
Braden T. Fry C. Sartin J. Effects of interleukins on secretion of luteinizing hormone from ovine pituitary cells Am. J. Vet. Res. 59 1998 1488 1493 9829412
Brochu-Gaudreau K. Rehfeldt C. Blouin R. Bordignon V. Murphy B.D. Palin M.-F. Adiponectin action from head to toe Endocrine 37 2010 11 32 20963555
Chen J. Tan B. Karteris E. Zervou S. Digby J. Hillhouse E.W. Vatish M. Randeva H.S. Secretion of adiponectin by human placenta: differential modulation of adiponectin and its receptors by cytokines Diabetologia 49 2006 1292 1302 16570162
Chen X. Whiting J.A. 1051-P: Elevated cord serum adiponectin concentration is associated with increased risk for fetal overgrowth Diabetes 71 2022 1051 35167652
Duval F. Santos E.D. Poidatz D. Sérazin V. Gronier H. Vialard F. Dieudonné M.-N. Adiponectin inhibits nutrient transporters and promotes apoptosis in human villous cytotrophoblasts: involvement in the control of fetal growth Biol. Reprod. 94 2016 1 12
Feng Y. Hao F. Wan W. Wang X. Adiponectin exhibits proliferative and anti-apoptotic effects on ovarian cancer cells via PI3K/Akt and Raf/MEK/ERK pathways Trop. J. Pharm. Res. 17 2018 2141 2149
Fukata J. Usui T. Naitoh Y. Nakai Y. Imura H. Effects of recombinant human interleukin-1α,-1β, 2 and 6 on ACTH synthesis and release in the mouse pituitary tumour cell line AtT-20 J. Endocrinol. 122 1989 33 39 2549151
Grandhaye J. Hmadeh S. Plotton I. Levasseur F. Estienne A. LeGuevel R. Levern Y. Rame C. Jeanpierre E. Guerif F. The adiponectin agonist, AdipoRon, inhibits steroidogenesis and cell proliferation in human luteinized granulosa cells Mol. Cell. Endocrinol. 520 2021 111080
Hu Q. Wang D. Lin H. Li H. Zhao J. Jiao H.C. Wang X. Adiponectin reduces lipid content in chicken myoblasts by activating AMPK signaling pathway Biosci. Rep. 42 2022 BSR20212549
Jiang J. Fan Y. Zhang W. Shen Y. Liu T. Yao M. Gu J. Tu H. Gan Y. Adiponectin suppresses human pancreatic cancer growth through attenuating the β-catenin signaling pathway Int. J. Biol. Sci. 15 2019 253 264 30745818
Kaminska B. Czerwinska J. Bogacka I. Chojnowska K. Smolinska N. Dobrzyn K. Kiezun M. Zaobidna E. Myszczynski K. Nowakowski J.J. Sex-and season-dependent differences in the expression of adiponectin and adiponectin receptors (AdipoR1 and AdipoR2) in the hypothalamic-pituitary-adrenal axis of the Eurasian beaver (Castor fiber L.) Gen. Comp. Endocrinol. 298 2020 113575
Kharroubi I. Rasschaert J. Eizirik D.L. Cnop M. Expression of adiponectin receptors in pancreatic β cells Biochem. Biophys. Res. Commun. 312 2003 1118 1122 14651988
Kiezun M. Maleszka A. Smolinska N. Nitkiewicz A. Kaminski T. Expression of adiponectin receptors 1 (AdipoR1) and 2 (AdipoR2) in the porcine pituitary during the oestrous cycle Reprod. Biol. Endocrinol. 11 2013 1 9 23302328
Kiezun M. Smolinska N. Maleszka A. Dobrzyn K. Szeszko K. Kaminski T. Adiponectin expression in the porcine pituitary during the estrous cycle and its effect on LH and FSH secretion Am. J. Physiol. Endocrinol. Metab. 307 2014 E1038 E1046 25315693
Kurokawa M. Kornbluth S. Caspases and kinases in a death grip Cell 138 2009 838 854 19737514
Kurose S. Onishi K. Takao N. Miyauchi T. Takahashi K. Kimura Y. Association of serum adiponectin and myostatin levels with skeletal muscle in patients with obesity: a cross-sectional study PLoS One 16 2021 e0245678
Li C. Li Q. Li J. Zhang N. Li Y. Li Y. Li H. Yan F. Kang X. Liu X. Expression and localization of adiponectin and its receptors (AdipoR1 and AdipoR2) in the hypothalamic-pituitary-ovarian axis of laying hens Theriogenology 159 2021 35 44 33113442
Li C. Cao Y. Ren Y. Zhao Y. Wu X. Si S. Li J. Li Q. Zhang N. Li D. The adiponectin receptor agonist, AdipoRon, promotes reproductive hormone secretion and gonadal development via the hypothalamic-pituitary-gonadal axis in chickens Poult. Sci. 102 2023 102319
Li J. Ma X.-J. Wu X. Si S.-J. Li C. Yang P.-K. Li G.-X. Liu X.-J. Tian Y.-D. Kang X.-T. Adiponectin modulates steroid hormone secretion, granulosa cell proliferation and apoptosis via binding its receptors during hens’ high laying period Poult. Sci. 100 2021 101197
Liu Q. Fu H. Sun F. Zhang H. Tie Y. Zhu J. Xing R. Sun Z. Zheng X. miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes Nucleic Acids Res 36 2008 5391 5404 18701644
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method Methods 25 2001 402 408 11846609
Lord E. Ledoux S. Murphy B. Beaudry D. Palin M. Expression of adiponectin and its receptors in swine J. Anim. Sci. 83 2005 565 578 15705753
Lu M. Tang Q. Olefsky J.M. Mellon P.L. Webster N.J. Adiponectin activates adenosine monophosphate-activated protein kinase and decreases luteinizing hormone secretion in LβT2 gonadotropes Mol. Endocrinol. 22 2008 760 771 18006641
Maddineni S. Metzger S. Ocón O. Hendricks G. Ramachandran R. Adiponectin gene is expressed in multiple tissues in the chicken: food deprivation influences adiponectin messenger ribonucleic acid expression Endocrinology 146 2005 4250 4256 15976057
Marshall A. The avian pituitary Nature 170 1952 553
Motoshima H. Wu X. Mahadev K. Goldstein B.J. Adiponectin suppresses proliferation and superoxide generation and enhances eNOS activity in endothelial cells treated with oxidized LDL Biochem. Biophys. Res. Commun. 315 2004 264 271 14766203
Nagra C.L. Birnie J.G. Baum G.J. Meyer R.K. The role of the pituitary in regulating steroid secretion by the avian adrenal Gen. Comp. Endocrinol. 3 1963 274 280 13937178
Nasa I. Cressey L.E. Kruse T. Hertz E.P. Gui J. Graves L.M. Nilsson J. Kettenbach A.N. Quantitative kinase and phosphatase profiling reveal that CDK1 phosphorylates PP2Ac to promote mitotic entry Sci. Signaling. 13 2020 eaba7823
Onodera T. Wang M.-Y. Rutkowski J.M. Deja S. Chen S. Balzer M.S. Kim D.-S. Sun X. An Y.A Field B.C. Endogenous renal adiponectin drives gluconeogenesis through enhancing pyruvate and fatty acid utilization Nat. Commun. 14 2023 6531 37848446
Proudman J. Vandesande F. Berghman L. Immunohistochemical evidence that follicle-stimulating hormone and luteinizing hormone reside in separate cells in the chicken pituitary Biol. Reprod. 60 1999 1324 1328 10330088
Psilopanagioti A. Papadaki H. Kranioti E.F. Alexandrides T.K. Varakis J.N. Expression of adiponectin and adiponectin receptors in human pituitary gland and brain Neuroendocrinology 89 2009 38 47 18698133
Punyadeera C. Zorenc A.H. Koopman R. McAinch A.J. Smit E. Manders R. Keizer H.A. Cameron-Smith D. van Loon L.J. The effects of exercise and adipose tissue lipolysis on plasma adiponectin concentration and adiponectin receptor expression in human skeletal muscle Eur. J. Endocrinol. 152 2005 427 436 15757860
Qiao L. Wattez J.-S. Lee S. Guo Z. Schaack J. Hay W.W. Zita M.M. Parast M. Shao J. Knockout maternal adiponectin increases fetal growth in mice: potential role for trophoblast IGFBP-1 Diabetologia 59 2016 2417 2425 27495989
Ramachandran R. Ocón-Grove O.M. Metzger S.L. Molecular cloning and tissue expression of chicken AdipoR1 and AdipoR2 complementary deoxyribonucleic acids Domest. Anim. Endocrinol. 33 2007 19 31 16697136
Rodriguez-Pacheco F. Martinez-Fuentes A.J. Tovar S. Pinilla L. Tena-Sempere M. Dieguez C. Castano J.P. Malagon M.M. Regulation of pituitary cell function by adiponectin Endocrinology 148 2007 401 410 17038552
Sapochnik M. Fuertes M. Arzt E. Programmed cell senescence: role of IL-6 in the pituitary J. Mol. Endocrinol. 58 2017 R241 R253 28381401
Sarmento-Cabral A. Peinado J.R. Halliday L.C. Malagon M.M. Castaño J.P. Kineman R.D. Luque R.M. Adipokines (leptin, adiponectin, resistin) differentially regulate all hormonal cell types in primary anterior pituitary cell cultures from two primate species Sci. Rep. 7 2017 43537 28349931
Scherer P.E. Williams S. Fogliano M. Baldini G. Lodish H.F. A novel serum protein similar to C1q, produced exclusively in adipocytes J. Biol. Chem. 270 1995 26746 26749 7592907
Schindler M. Pendzialek M. Grybel K.J. Seeling T. Gürke J. Fischer B. Santos A.N. Adiponectin stimulates lipid metabolism via AMPK in rabbit blastocysts Hum. Reprod. 32 2017 1382 1392 28472298
Singh A. Choubey M. Bora P. Krishna A. Adiponectin and chemerin: contrary adipokines in regulating reproduction and metabolic disorders Reprod. Sci. 25 2018 1462 1473 29669464
Spangelo B.L. JUDD A.M. Isakson P.C. MACLEOD R.M. Interleukin-6 stimulates anterior pituitary hormone release in vitro Endocrinology 125 1989 575 577 2544414
Straub L.G. Scherer P.E. Metabolic messengers: adiponectin Nat. Metab. 1 2019 334 339 32661510
Szeszko K. Smolinska N. Kiezun M. Dobrzyn K. Rytelewska E. Kisielewska K. Gudelska M. Kaminski T. Transcriptomic profile of anterior pituitary cells of pigs is affected by adiponectin Anim. Reprod. Sci. 206 2019 17 26 31079943
Tadiotto M.C. Corazza P.R.P. d. Menezes-Junior F.J. d. Moraes-Junior F.B. Tozo T.A.A. Purim K.S.M. Mota J. Leite N. Effects and individual response of continuous and interval training on adiponectin concentration, cardiometabolic risk factors, and physical fitness in overweight adolescents Eur. J. Pediatr. 182 2023 2881 2889 37055629
Vickers S.L. Cowan R.G. Harman R.M. Porter D.A. Quirk S.M. Expression and activity of the Fas antigen in bovine ovarian follicle cells Biol. Reprod. 62 2000 54 61 10611067
Wang F. Wang X. Chen H. Liu J. Cheng Z. The critical time of avian leukosis virus subgroup J-mediated immunosuppression during early stage infection in specific pathogen-free chickens J. Vet. Sci. 12 2011 235 21897096
Wen J.-P. Liu C.-e. Hu Y.-T. Chen G. Lin L.-x. Globular adiponectin regulates energy homeostasis through AMP-activated protein kinase–acetyl-CoA carboxylase (AMPK/ACC) pathway in the hypothalamus Mol. Cell. Biochem. 344 2010 109 115 20625797
Yamauchi T. Kamon J. Ito Y. Tsuchida A. Yokomizo T. Kita S. Sugiyama T. Miyagishi M. Hara K. Tsunoda M. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects Nature 423 2003 762 769 12802337
Zhang D. Guo M. Zhang W. Lu X.-Y. Adiponectin stimulates proliferation of adult hippocampal neural stem/progenitor cells through activation of p38 mitogen-activated protein kinase (p38MAPK)/glycogen synthase kinase 3β (GSK-3β)/β-catenin signaling cascade J. Biol. Chem. 286 2011 44913 44920 22039048
Zhang L. Wen K. Han X. Liu R. Qu Q. Adiponectin mediates antiproliferative and apoptotic responses in endometrial carcinoma by the AdipoRs/AMPK pathway Gynecol. Oncol. 137 2015 311 320 25703675
Zhang Z. Du J. Shi H. Wang S. Yan Y. Xu Q. Zhou S. Zhao Z. Mu Y. Qian C. Adiponectin suppresses tumor growth of nasopharyngeal carcinoma through activating AMPK signaling pathway J. Transl. Med. 20 2022 89 35164782
Zhou Y. Zhang S. Jia Y. Wang X. Liu Y. Zhang H. Yuan Z. Han Y. Weng Q. Regulation and role of adiponectin secretion in rat ovarian granulosa cells Int. J. Mol. Sci. 25 2024 5155 38791193
