
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00729-6
10.1016/j.psj.2024.104150
104150
IMMUNOLOGY, HEALTH AND DISEASE
Co-exposure of bisphenol A and selenium deficiency induces pyroptosis via ROS/NLRP3 pathway in chicken spleen
Xu Tong
Chen Ting
Shi Xu
Ding Jiayi
Chen Shasha
Lin Hongjin linhongjin@neau.edu.cn
1
College of Veterinary Medicine, Northeast Agricultural University, Harbin, Heilongjiang 150030, China
1 Corresponding author: linhongjin@neau.edu.cn
02 8 2024
10 2024
02 8 2024
103 10 10415028 6 2024
27 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Bisphenol A (BPA) is widely applied in plastic products, which will produce immunotoxicity to organisms after spilling in the environment, and become a kind of endocrine disruptor. Selenium (Se) is an essential trace element and plays an important role in maintaining redox homeostasis and immune function. BPA exposure and Se deficiency often occur together in livestock and poultry farming, however, studies on the effects of joint exposure on chicken immunotoxins have not been reported. Therefore, this study established a chicken spleen and MDCC-MSB1 cell model under the combined effects of BPA exposure or/and Se deficiency. Transcriptomic analysis showed that BPA exposure and/or Se deficiency induced differential enrichment of positive regulatory pathways such as NLRP3 inflammatory complex assembly, inflammatory response and cellular oxidative stress response. In the -Se+BPA group, pathological damage was significantly increased, Se content decreased, BPA accumulation, oxidative stress and pyroptosis. Meanwhile, the roles and mechanisms of oxidative stress and pyroptosis in BPA exposure or/and Se deficiency-induced splenic tissue injury were investigated by using IF and qRT-PCR methods. The results showed that joint BPA exposure with Se deficiency resulted in more significant changes in the above outcomes than 1 of them. The oxidative stress inhibitor NAC effectually reduced Se deficiency and BPA-induced oxidative stress and pyroptosis, further suggests that oxidative stress mediated Se deficiency or/and BPA-induced pyroptosis. This study revealed that BPA exposure and Se deficiency induced spleen pyroptosis in chickens via the ROS/NLRP3 pathway. These results provide the theoretical basis for the toxicity of BPA in poultry and enrich the toxicological mechanism of combined exposure of Se deficiency and environmental toxins.

Key words

BPA
Se deficiency
chicken spleen
pyroptosis and oxidative stress
ROS/NLRP3 pathway
==== Body
pmcINTRODUCTION

Bisphenol A (BPA) is a widely used organic chemical material, which is mainly used as a monomer or additive in polycarbonate and other polymer materials (Eddo and Catherine, 2013). As a result of the mass production and widespread use of BPA plastic products, the ensuing environmental pollution problem has become increasingly serious, posing a potential threat to animal and human health. Environmental pollution is a significant source of exposure to BPA, and studies have shown that BPA is present in water bodies in several countries. BPA has been detected in surface water in 4 Asian countries, Japan, Korea, China and India, with the highest concentrations reaching 835 to 1950 ng/L in the Buckingham Canal in India (Eriko et al., 2015). BPA has been reported to be found in vegetables, fruits, and aquatic products in the United States. (Chunyang and Kurunthachalam, 2013). Exposure to low doses of BPA can lead to reproductive toxicity, hepatorenal toxicity, immunotoxicity, etc. Liang et al. found that 10 mg/kg BPA exposure resulted in blurring of the boundary between the cortex and medulla in broiler chickens, a significant reduction of lymphocytes in the medulla, and lymphocytes with nuclear sepsis and nucleolysis (Liang et al., 2022). A variety of paradigm of cell death, such as autophagy, apoptosis, and pyroptosis, found to involved in regulating the immunotoxicity of a variety of environmental pollutants, including BPA. BPA exposure could target the miR-1b-1p/CYP27B3 axis to induce oxidative damage and induced apoptosis in carp splenic lymphocytes via the mitochondrial pathway (Qingqing et al., 2020). An in vitro study indicated that BPA exposure increased reactive oxygen species (ROS) levels and oxidative stress, induced apoptosis, autophagy disorder and immune imbalance in hepatocytes of grass carp (Lu et al., 2022).

ROS is a by-product produced in the process of cell respiration, and excessive ROS accumulation can cause oxidation of lipids, nucleic acids and proteins. In the normal physiological activities of cells, there is a complex antioxidant regulatory system to maintain the proper ROS state, but once this dynamic balance is disrupted, oxidative stress will occur, resulting in tissue damage. (Angel et al., 2010). Many studies have shown that the activation of oxidative stress is an important mechanism for many pesticides, environmental pollutants and nutrient deficiencies to induce body damage. Oxidative stress is recognized as a driver of pyroptosis (Franz et al., 2011; Abais et al., 2015; Zhang et al., 2017). Activation of NLRP3 inflammasome mediates the classical pyroptosis pathway, and ROS plays an key role in NLRP3 inflammasome activation as an upstream signal (Tschopp and Schroder, 2010; Qisheng et al., 2019). Animal studies have shown that IL-1β and Caspase-1 are dependent on ROS activation. (Franchi et al., 2009). Polystyrene microplastics (PS-MP) induced cardiotoxicity found that PS-MPs significantly increased ROS and MDA levels and inhibited the expression of antioxidant enzyme activities, such as GSH, SOD, CAT, and T-AOC, thereby activated the NF-κB/NLRP3/GSDMD pathway to induce cardiomyocyte pyroptosis (Zhang et al., 2022). Animal and cellular experiments have shown that silica nanoparticles induce pyroptosis and cardiac hypertrophy via the ROS/NLRP3/Caspase-1 pathway (Wang et al., 2022). It was found that the oxidative stress inhibitor NAC was able to alleviate ROS-mediated chicken liver and cardiac pyroptosis (Zhang et al., 2022; Shi et al., 2023).

Selenium (Se) deficiency is a global health problem that is prevalent in animals and humans, and Se deficiency has been shown to have negative effects on a variety tissues and organs, including the immune system of animals. BPA enters the body via the food chain or direct contact and can cause dysfunction of multiple systems such as endocrine, reproductive, developmental, nervous and immune systems. Avian species are one of the most important members of the ecosystem involved in the food chain cycle. Se deficiency and BPA exposure often co-occur due to geochemical factors, poultry is closely related to human beings, so it is of great significance to study the effects of Se deficiency and BPA on it. As an important immune organ, spleen is also one of the common target organs of environmental toxin exposure and Se deficiency. However, the mechanism by which Se deficiency and BPA co-induce immunotoxicity in poultry remains unclear. In this study, broiler chickens were used as test animals to establish an animal model of joint exposure to Se deficiency and BPA, and MDCC-MSB1 cells were used to establish the cellular model of combined exposure to BPA and Se deficiency, based on which, the aim was to elucidate the immunotoxicity of Se deficiency and BPA in chickens, and to explore the mechanism of Se deficiency and BPA-induced splenic injury in terms of oxidative stress and pyroptosis, and to further enrich the immunotoxicology study of BPA and provide more scientific basis for the health risk assessment of avian animals.

MATERIALS AND METHODS

Treatment of Experimental Animals

This study utilized healthy 1-day-old AA broilers as experimental animals. Sixty chickens were randomly assigned into: control group (n = 15), BPA group (n = 15), Se deficiency group (SeD group, n = 15), and combination group with Se deficiency and BPA (SeD+BPA group, n = 15). The specific BPA levels and Se content in the diets were detailed in Table 1 (Wu et al., 2024). In the period of the experiment, all broilers had ad libitum access to food and water. After 40 d, spleen tissues were harvested, fixed and stored in 4% paraformaldehyde at 4°C for pathological and immunofluorescence (IF) analysis, while the rest were frozen at -80°C. All animal handling and experimental methods were permitted by the Ethics Committee of NEAU.Table 1 The grouping of experimental chickens.

Table 1Groups	Diet	Se content (mg/kg, from Na2SeO3)	BPA concentration (mg/kg)	
Control	Basic diet	0.278	0	
BPA	Basic diet	0.278	50	
SeD	Se deficient diet	0.039	0	
SeD+BPA	Se deficient diet	0.039	50	
Na2SeO3, Chengdu Longquan Trace Elements Factory, purity ≥ 98%, Cas: GB8254–87; BPA, Macklin reagent company, purity ≥ 99.0%, Cas:80–05–7.

Transcriptomics Analysis

The DESeq software (Anders and Huber, 2010) was used to perform statistical analysis on differentially expressed genes between different groups with a log2|fold change (FC) >1.5 and a false discovery rate (FDR) <0.05. The Gene Ontology (GO) database and were used to analyze the biological functions of the differentially expressed protein genes, the significance was considered when the P-value < 0.05 and FDR < 0.05.

MDCC-MSB1 Cell Culture and Treatment

The MDCC-MSB1 cells was kindly provided by the Harbin Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences. The MDCC-MSB1 cell suspension of BPA was inoculated into RPMI 1640 medium, which contained 10% fetal bovine serum (FBS) and 1% double antibody, maintained at 37°C in a 5% CO2 incubator. Once the MDCC-MSB1 cells reached 80% confluency, they were passaged and used for experiments in their logarithmic growth phase.

Cells were treated for 24 h with either control medium or low Se medium, with or without the addition of BPA/NAC. Control medium formula: RPMI 1640 medium+1% FBS+10 μg/mL insulin (Sigma, CAS: 12,584-58-6) + 5 μg/mL transferrin (Biotopped, CAS: 11096-37-0); Low Se culture medium formula: RMPI 1640+1% FBS+10 μg/mL insulin+5 μg/mL transferrin. Divide into 2 different groups according to different experimental purposes, and the specific groups are as follows:(1) Part 1: Control group, BPA group (100 μM BPA, SeD group, SeD+BPA group (100 μM BPA).

(2) Part 2: Control group, SeD+BPA group (100 μM BPA, SeD+BPA+NAC group (8 mM NAC+100 μM BPA).

ELISA Detection of BPA Content in Chicken Spleen

ELISA kit was used to measure the concentration of BPA in splenic tissue, and strictly according to the protocol. After the reaction, measure the absorbance at 450 nm for each well. Use ELISA data processing software to construct the standard curve and calculate its linear regression equation. Input the measured absorbance values into this equation to determine the BPA concentration in the samples from the 4 treatment groups.

Detection of Se Content in Chicken Spleen

Collect spleen tissue samples from 4 treatment groups of broiler chickens (n = 3), digest 1 g tissue with 1 mL of hydrogen peroxide (2%) and 30 mL of concentrated nitric acid (5%). Filter the digested samples through a filter membrane (0.22 μm) using a syringe before detection with a microwave system. Analyze the Se content in the samples by using ICP-MS.

Observation of Pathological Structure in Chicken Spleen

For histological analysis, collect fresh spleen tissue and fix it in a 4% paraformaldehyde solution at 20× the volume of the sample for at least 24 h. Dehydrate the tissue, embed in paraffin, and section it horizontally into slices 2 to 5 μm thick. Stain the tissue sections with H&E and examine them under a high-resolution panoramic imaging system for image acquisition and analysis, provided by Wuhan Saiweier Company.

CCK8 for Detecting MDCC-MSB1 Cell Viability

BPA solution and NAC solution preparation: Prepare BPA mother liquor with a concentration of 1 M and 500 mM NAC stock solution, then using 0.22 μM filter membrane filtration is packaged and stored at 4°C. Dilute with 1640 culture medium to the required concentration according to subsequent experimental requirements.

Cell Viability Test: Prepare a cell suspension and inoculate 100 μL of this cell suspension at an appropriate density into each well of a 96-well cell culture plate and incubate at 37°C with 5% CO2 reach 75-85% confluence, expose them to media with different concentrations of BPA (0 μM, 50 μM, 100 μM, 150 μM, 200 μM, 250 μM, and 300 μM) or various concentrations of NAC (1 mM, 2 mM, 4 mM, 8 mM, 16 mM, and 32 mM). Incubate for 24 h, with all samples tested in triplicate. Post-treatment, add 10 μL of CCK-8 reagent to each well and incubate the 96-well plate in the dark at 37°C for 3 h. Measure the absorbance (OD value) of each well at 450 nm using a preheated ELISA reader. Calculation formula: Cell viability (%) = (experimental OD value - blank OD value) / (control OD value - blank OD value) × 100%.

IF Detection

Fresh spleen tissue was fixed in 4% paraformaldehyde and embedded in paraffin for sectioning and antigen retrieval. Then blocked outlined area with BSA for 30 min, incubated with diluted primary antibodies against GSDMD (1:200) and NLRP3 (1:200) overnight at 4°C. Fluorescent secondary antibodies (FITC and CY3, 1:1000) were applied and incubated at room temperature in the dark for 1 h. The sections were washed then stained with DAPI in the dark at room temperature for 10 min. An antifluorescence quenching agent was applied to the sections, which were then scanned and analyzed using a high-resolution panoramic imaging system.

Cell slides were prepared in a 6-well plate and coated with 0.1 mg/mL polylysine in order to make cell adhesion preserved at 4°C. The subsequent staining and analysis followed the same steps as those used for tissue IF detection.

Detection of Cellular ROS Levels

Cells were cultured in a 12-well plate, centrifuged to collect cell precipitates, washed twice with PBS, and then labeled with a DFCH-DA fluorescent probe (10 μM) in 1640 serum-free medium. The cells were incubated in the dark at 37°C for 0.5 h, washed twice with PBS, and the cell precipitates were harvested by centrifugation and resuspended in PBS in a 12-well plate. The green fluorescence intensity of DCF was measured at 488 nm using an inverted fluorescence microscope, and images were captured. The fluorescence intensity was quantified using ImageJ software to determine intracellular ROS levels in MDCC-MSB1 cells.

Detection of Oxidative Stress Indicators in Broiler Spleen and MDCC-MSB1 Cells

Each tissue sample was homogenized according to the manufacturer's instructions, then filtered to prepare a 10% tissue homogenization solution. Collect processed cell and subjected to ultrasonic fragmentation, and the supernatant was analyzed. First the BCA method was used to determine the total protein concentration in the spleen tissue and MDCC-MSB1 cell samples of chickens. The levels of oxidative markers MDA, H2O2, T-AOC, SOD, GSH-Px, and CAT, were measured strictly following the microporous plate method detailed in the instructions provided by the Nanjing Jiancheng Biotechnology Research Institute.

Real-Time Fluorescence Quantitative PCR

The trizol method was used to extract total RNA from spleen tissue and MDCC-MSB1 cells, After the total RNA concentration of each group of samples was detected, a reverse transcription system was established according to the instructions of the reverse transcription reagent kit supplier, and cDNA was synthesized. Primer sequences specific to the genes β-actin, NLRP3, ASC, Caspase-1, IL-18, IL-1β, and GSDMD were designed using the Primer tool, based on nucleotide sequences obtained from the NCBI website. Primer specificity was confirmed using the Primer-BLAST tool. All primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The primer sequences are shown in Table 2. Each cDNA sample was diluted tenfold and prepared the RT-qPCR reaction mixture. The reactions were carried out on a real-time fluorescence quantitative PCR (RT-qPCR) instrument, the β-actin was used as a reference for relative quantitative detection. The 2−∆∆Ct method was used to calculate the relative expression level of the target gene.Table 2 The primers sequence used for RT-qPCR.

Table 2Gene	Primer upstream and downstream sequences (5 '→ 3′)	
β-actin	Forward: TTACTCCCACAGCCAGCCAT	
	Reverse: GAAACCGGCCTTGCACATAC	
NLRP3	Forward: CCGTGATGGCAGGAGAAGAA	
Reverse: CCGATGTTCCAGCCTCCTTT	
ASC	Forward: CTGGAGATGTGGTTTGGCCT	
Reverse: TTGGTTCTTGACCATCCGCA	
Caspase-1	Forward: GTGCTGCCGTGGAGACAACATAG	
Reverse: AGGAGACAGTATCAGGCGTGGAAG	
GSDMD	Forward: ACTGAGGTCCACAGCCAAGAGG	
Reverse: GCCACTCGGAATGCCAGGATG	
IL-1β	Forward: TGCCTGCAGAAGAAGCCTCG	
Reverse: CTCCGCAGCAGTTTGGTCAT	
IL-18	Forward: TGATGAGCTGGAATGCGATGCC	
Reverse: TGGACGAACCACAAGCAACTGG	

Western Blot Immunoblotting Analysis

The cell lysis buffer (Beyond Biotechnology, Shanghai, China) containing 1% PMSF was used to extract total proteins from spleen tissue and MDCC-MSB1 cells of different treatment groups. After centrifugation, collect the supernatant as the total protein, mixing 1/4 volume of 5×SDS-PAGE protein loading buffer in total protein and denature the proteins. 8% and 15% SDS-PAGE gel and separation gel were prepared to separate proteins of different sizes under constant voltage of 80V and 120V respectively, and then the corresponding proteins were transferred to nitrocellulose membrane (NC membrane) through membrane transfer device. The membrane was placed in a 5% skim milk sealing solution and sealed in a constant temperature shaker at 37 °C for 1.5 h. After cleaning incubated with primary antibodies overnight at 4°C. The dilution factor information of antibodies used in this study were presentable in Table 3. Finally, incubated with HRP antibody. Protein bands were detected using a gel imaging system coupled with ECL chemiluminescence. β-actin served as an internal reference protein for all target proteins. ImageJ software was used to quantify the grayscale value of the target protein relative to β - actin, which is the relative expression level of the target protein band.Table 3 The antibodies used in this study.

Table 3Antibodies	Dilution factor	
β-actin	1:10000	
NLRP3	1:750	
ASC	1:500	
Caspase-1 p20	1:500	
GSDMD-N	1:1000	
IL-1β	1:750	
IL-18	1:750	

Data Analysis

Data analysis was conducted using SPSS 23.0 software and all results were expressed as means ± SEM. A 1-way ANOVA was conducted to compare the differences among groups and P < 0.05 was considered to be a significant difference.

RESULTS

Se Deficiency Exacerbates Spleen Tissue Damage Exposed to BPA

To explore the impact of BPA exposure and Se deficiency on chicken spleen, tissue sections were performed. H&E staining revealed that after 40 d, BPA exposure induced structural abnormalities in the spleen. As illustrated in Figure 1A, the BPA group displayed indistinct boundaries between the red and white pulp compared to the control group. Additionally, there was notable infiltration of inflammatory cells and evidence of necrosis, such as nuclear fragmentation and lysis, within the red pulp, as indicated by red arrows. In contrast, the SeD group exhibited minimal inflammatory cell infiltration in the red marrow (red arrow). These pathological alterations were worse in the SeD+BPA group, which showed unclear demarcation between the red and white pulp, a decreased lymphocyte count in the white pulp (yellow arrows), increased inflammatory cell infiltration, and pronounced necrotic changes including nuclear fragmentation and lysis.Figure 1 Transcriptomics results of chicken spleens exposed to BPA or/and Se deficiency (A) Histopathological observation of chicken spleen: spleen tissue inflammatory infiltration (red arrow), nuclear fragmentation and lysis (yellow arrow). Scale, 200 μm. (B, C) Inductively coupled plasma mass spectrometry of Se and BPA in spleen. (D) CCK-8 method was used to determine MDCC-MSB1 cells viability under different concentrations of BPA.

Figure 1

Furthermore, the Se levels in the spleen were measured using inductively coupled plasma mass spectrometry. As depicted in Figure 1B, Se concentration was significantly reduced in the SeD group by 52.5% and the BPA group by 88% relative to the control group (P < 0.05). The joint effects of Se deficiency and BPA exposure led to an even more significant decrease in Se levels (P < 0.05). ELISA kits quantified BPA levels in the spleen, revealing that the BPA concentration significantly increased in the BPA group compared to the control group, as shown in Figure 1C. Additionally, Se deficiency further elevated BPA levels (P < 0.05). To examine the effect of Se deficiency on BPA splenic toxicity, MDCC-MSB1 cells were used to model BPA exposure in vitro. Cell viability after BPA exposure was assayed by CCK-8 kit, and 100 μM was determined as the final treatment concentration (Figure 1D).

Effects of BPA Exposure and Se Deficiency on Chicken Spleen Transcriptomics

To investigate the mechanism of BPA exposure and Se deficiency-induced spleen injury at the overall level, we next performed a BPA-labeled proteomic quantitative analysis of chicken spleen tissues. In the petal plot (Figure 2A), BPA exposure induced differential expression of 992 genes in chicken spleen compared to control group, while Se deficiency treatment induced differential expression of 492 genes. In the volcano plot (Figure 2B), BPA exposure induced up-regulation of gene expression of SLC5A12, FABP6, etc., and down-regulation of CAMKIG, TDO2, etc., compared with control group, while Se deficiency treatment induced up-regulation of gene expression of SERPINA1, GRIK1, etc., and down-regulation of gene expression of LGALS, ANGPTL7, etc., compared with control group. In the lollipop plot (Figure 2C), compared to the control group, BPA exposure induced differential enrichment of pathways such as inflammatory response, interleukin-1β production, pyroptosis, positive regulation of NLRP3 inflammasome complex assembly and heat shock protein binding. In the GO chord plot (Figure 2D), compared to the control group, Se deficiency treatment induced cellular response to oxidative stress, antioxidant activity positive regulation of cell death, regulation of macrophage activation and differential enrichment of pathways such as toll-like receptor 4 binding. In Figure 2E, compared with the SeD group, the SeD+BPA group showed differential enrichment of toll-like receptor 4 binding, positive regulation of neutrophil migration, lymphangiogenesis, lymphatic endothelial cell fate commitment, regulation of respiratory burst and other pathways were differentially enriched. In the bubble diagram (Figure 2F), compared with the BPA group, the SeD+BPA group had differential enrichment of heat shock protein binding, positive regulation of interleukin-8 production, response to redox state, spleen development, cytokine production involved in inflammatory response, and positive regulation of neutrophil migration pathways were differentially enriched. In the KEGG circle diagram (Figure 2G), pathways such as citrate cycle, oxidative phosphorylation, IL-17 signaling pathway, and TNF signaling pathway were differentially enriched in the SeD+BPA group compared to the BPA group.Figure 2 Proteomic quantitative analysis of BPA labeling in chicken spleen (A) Petal chart for BPA vs CON, -Se vs CON, -Se+BPA vs CON, BPA vs -Se, -Se+BPA vs BPA and -Se+BPA vs -Se analysis. (B) Volcano plots for BPA vs CON, -Se vs CON, -Se+BPA vs BPA, and -Se+BPA vs -Se analysis. (C) Lollipop chart for BPA vs CON KEGG analysis. (D) String diagram for BPA vs CON GO analysis. (E) Plot for -Se+BPA vs Se GO analysis. (F) Bubble diagram for -Se+BPA vs BPA GO analysis. (G) Circle plot for -Se+BPA vs BPA KEGG analysis.

Figure 2

Se Deficiency Exacerbated Redox Imbalance in Spleen and MDCC-MSB1 Cells by BPA Exposure

To explore the redox status of Se-deficient and BPA exposure in chicken spleen, we assayed the levels of oxidative indicators H2O2 and MDA content and antioxidant markers T-AOC, SOD, CAT, and GSH-Px activities in splenic tissues by using commercially available kits. The assay results were shown in Figure 3A, compare with the control group, the H2O2 and MDA levels in the BPA group or SeD group were significantly higher (P < 0.05), while the activity levels of the antioxidant markers T-AOC, SOD, CAT, and GSH-Px were significantly lower (P < 0.05). In addition, the levels of intracellular H2O2 and MDA with were significantly higher (P < 0.05), while the activities of T-AOC, SOD, CAT, and GSH-Px were significantly lower (P < 0.05) in the SeD+BPA group compared to the BPA group or SeD group.Figure 3 Oxidative stress results in spleen and MDCC-MSB1 cells (A) The contents of oxidative indices H2O2 and MDA and the activities of antioxidant indices T-AOC, SOD, CAT and GSH-Px in spleen tissue. (B) ROS levels in MDCC-MSB1 cells detected by DCFH-DA probe. (C) The contents of oxidative indices H2O2 and MDA and the activities of antioxidant indices T-AOC, SOD, CAT and GSH-Px in MDCC-MSB1 cells.

Figure 3

ROS levels in MDCC-MSB1 cells were assessed using the DCFH-DA probe. Se deficiency further exacerbated ROS levels as well as BPA group (Figure 3B). Subsequently, the antioxidant capacity of MDCC-MSB1 cells was further examined. As shown in Figure 3C, H2O2 and MDA levels of MDCC-MSB1 cells in BPA group were significantly increased (P < 0.05), while the activities of antioxidant enzymes T-AOC, SOD, CAT and GSH-Px were significantly decreased (P < 0.05). The result indicated Se deficiency also exacerbated the redox imbalance of MDCC-MSB1 cells.

Se Deficiency Exacerbated Pyroptosis in Chicken Spleen Exposed to BPA

In order to determine the effect of Se deficiency on pyroptosis in spleen exposed to BPA, the co-localization of coke death markers NLRP3 and GSDMD was detected by IF-double staining. As shown in Figure 4A, compared with the control group, the expression of NLRP3 in green and GSDMD in red and their co-localization (orange) were significantly increased in both exposure groups (BPA and SeD groups) (P < 0.05). Se deficiency further enhanced both colocalization signals after BPA exposure (P < 0.05). Next, the mRNA and protein changes associated with pyroptosis was further examined. As shown in F ig. 4B, compared with the control group, the mRNA expression levels of NLRP3, GSDMD,Caspase-1, ASC, IL-1β and IL-18 markers in BPA group and SeD group were significantly increased (P < 0.05), and Se deficiency further increased the expression of these genes. Protein expression level results were consistent with expectations, and BPA treatment significantly increased the expression level of pyroptosis related proteins (P < 0.05), which was further increased in SeD+BPA group (Figure 4C). It is suggested that Se deficiency can further aggravate spleen pyroptosis caused by BPA exposure.Figure 4 Pyroptosis results in chicken spleen (A) The IF staining results of pyroptosis markers in chicken spleen. DAPI stains the nucleus (blue), GSDMD is located in the cell membrane and cytoplasm (green), and NLRP3 is located in the cytoplasm (red). (B) The mRNA expression levels of factors related to pyroptosis in the chicken spleen. (C) The protein expression levels of factors related to pyroptosis in the chicken spleen.

Figure 4

Se Deficiency Exacerbated Pyroptosis in MDCC-MSB1 Cells by BPA Exposure

IF double staining was used to evaluate the level of pyroptosis marker, the co-localization of NLRP3 with GSDMD in MDCC-MSB1 cells. As shown in Figure 5A, the level of NLRP3 co-localized with GSDMD was significantly enhanced in the BPA group and SeD group compared with the control group (P < 0.05), which was further exacerbated in SeD +BPA group. To further confirm the status of pyroptosis in MDCC-MSB1 cells, we further detected changes in cellular pyroptosis-related mRNA and proteins (Figure 5B). Compared with control group, the mRNA expression levels of factors related to pyroptosis were significantly elevated in BPA group or SeD group (P < 0.05), and Se lacked further elevated the expression of these mRNA. The results of WB were consistent with the expectation that BPA treatment significantly elevated The protein expression levels of factors related to pyroptosis (P < 0.05) and exacerbated in SeD+BPA group (Figure 5C). These results suggest that Se deficiency exacerbated BPA exposure-induced pyroptosis in MDCC-MSB1 cells.Figure 5 Pyroptosis results in MDCC-MSB1 cells (A) The IF staining results of pyroptosis markers in MDCC-MSB1 cells. DAPI stains the nucleus (blue), GSDMD is located in the cell membrane and cytoplasm (green), and NLRP3 is located in the cytoplasm (red). (B) The mRNA expression levels of factors related to pyroptosis in the MDCC-MSB1 cells. (C) The protein expression levels of factors related to pyroptosis in the MDCC-MSB1 cells.

Figure 5

ROS Mediated Pyroptosis in BPA-Induced MDCC-MSB1 Cells During Se Deficiency

The mechanism of ROS in pyroptosis induced by BPA in MDCC-MSB1 cells was further explored by NAC pretreatment. As shown in Figure 6A, NAC significantly weaken the BPA-induced ROS level in SeD+BPA group (P < 0.05). It was clearly observed by IF double staining that NAC treatment significantly reduced the expression and co-localization of NLRP3 with GSDMD fluorescence intensity (Figure 6B). We further examined the expression of pyroptosis-related mRNA and protein levels, and the results were shown in Figure 6C-D, the pyroptosis indicators significantly increased in SeD+BPA group were reversed by NAC treatment. These results suggested that ROS mediated BPA-induced pyroptosis in MDCC-MSB1 cells during Se deficiency.Figure 6 Effect of NAC treatment on the level of pyroptosis in MDCC-MSB1 cells (A) ROS levels in MDCC-MSB1 cells after introducing NAC. (B) The IF staining results of pyroptosis markers in MDCC-MSB1 cells after introducing NAC. (C) The mRNA expression levels of factors related to pyroptosis in the MDCC-MSB1 cells after introducing NAC. (D) The protein expression levels of factors related to pyroptosis in the MDCC-MSB1 cells after introducing NAC. The protein expression levels of factors related to pyroptosis in the MDCC-MSB1 cells after introducing NAC.

Figure 6

DISCUSSION

Environmental endocrine disruptor contamination can spread through the food chain, where it accumulates in organisms and has toxic effects on multiple tissues and organs, including the immune system (Alessandra et al., 2016; Natalie R, 2017). Inadequate supply of Se can negatively affect growth performance, antioxidant status and immune parameters in poultry (Surai and Kochish, 2022). The spleen is an important organ of the animal immune system and a reservoir for immune cells (Vincenzo and Pittet Mikael, 2023), and plays an important function in the humoral and cellular immune response (Suttie, 2006). In the current study, the effects of environmental toxicants BPA and Se nutritional deficiencies on spleen was explored, and transcriptomically identified differential enrichment of positive regulatory pathways for NLRP3 inflammatory complex assembly, cellular oxidative stress response, and pyroptosis. BPA exposure or Se deficiency exposure induced structural damage to splenic structure, reduced Se levels, BPA deposition, oxidative stress, and pyroptosis. And The effect of combined exposure was more significant than that of individual exposure.

Polystyrene nanoplastic exposure caused differential enrichment of NOD-like receptor signaling pathway, inflammatory response and cellular response to interleukin-1 in mouse lung tissues (Yanliang et al., 2022). Co-treatment with Se and C-phycocyanin induced differential enrichment of TNF signaling pathway, NOD-like receptor signaling pathway, Toll-like receptor signaling pathway, NF-κB and HIF-1 pathways in murine lung cancer cells (Jie et al., 2023). In this study, BPA exposure was found to lead to differential enrichment of positive regulation of splenic inflammatory response, interleukin-1β production, and NLRP3 inflammasome complex assembly in chickens. Se-deficient diet caused differential enrichment of cellular responses to oxidative stress and positive regulation of cell death by antioxidant activity. The above results suggested that NLRP3 inflammasome-mediated pyroptosis occurred in BPA- or/and Se-deficient-exposed chicken spleens and that oxidative stress may be involved in regulating this process.

In a study on the combined toxicity of PS-MPs and BPA to carp, BPA was enriched in a variety of tissues and that PS-MPs increased the level of BPA accumulation (Puja et al., 2020). After 4 wk of Se-deficient diet in mice, Se levels in organs such as liver, lungs, kidneys and spleen decreased significantly over time (Akahoshi et al., 2019). In the present study, BPA levels were significantly higher in both BPA and SeD+BPA groups, indicating that the spleen is an important target organ for BPA exposure accumulation. Moreover, the BPA content in the SeD+BPA group was significantly higher than that in the BPA group, suggesting that when the organism is in a Se-deficient state it leads to an increase in BPA accumulation. Additionally, the Se contents in the SeD and SeD+BPA groups were significantly less than that in the Control and BPA groups, suggesting that the spleen is sensitive to dietary Se supply and is one of the important target organs for Se deficiency. It is worth noting that the Se content in the SeD+BPA combined group is significantly lower than that in the low Se group alone, indicating that BPA can reduce the absorption capacity of Se in the spleen. Similar results have been reported. (Xu et al., 2023; Huanyi et al., 2023).

When there is an imbalance between the production and consumption of ROS, this phenomenon is often defined as oxidative stress, and this phenomenon is considered to be an important factor affecting the development of the disease (Nose, 2000; Sies, 2015). BPA has been reported to disrupt the balance of the antioxidant system by inhibiting antioxidant enzyme activities, down-regulating antioxidant gene expression, and increasing free radical production and lipid peroxidation, which can lead to oxidative stress damage in the body and adverse effects (Kaur et al., 2014; Olukole et al., 2019). ROS are also an important target for Se-deficiency-induced tissue damage (Gao et al., 2019; Cai et al., 2019). In vivo and in vitro experiments in this study showed that Se deficiency or/and BPA exposure significantly increased MDA and H2O2 contents and ROS levels in chicken spleen and MDCC-MSB1 cells, and decreased the activities of T-AOC, SOD, GSH-Px and CAT. The changes of the above mention indexes in the combined group were higher than those in the single group, indicating that Se deficiency had a synergistic effect on BPA-induced oxidative stress. However, NAC co-treatment of MDCC-MSB1 cells with Se deficiency and BPA was effective in removing Se deficiency and BPA-induced excess ROS as well as changes in oxidative stress-related indictors. The above results suggest that Se deficiency or/and BPA exposure leads to disruption of redox homeostasis in broiler spleen, which contributes to the high level of ROS and induction of oxidative stress, and that Se deficiency can synergistically promote BPA-induced oxidative stress.

Pyroptosis plays an important role in achieving immunoregulation and in vivo homeostasis in various organ systems and is thought to be a pro-inflammatory programmed death process mediated by the GSDM family of proteins represented by GSDMD. Activated NLRP3 interacts with downstream ASC through the PYD structural domain and recruits pro-Caspase-1 to assemble into inflammasome vesicles through the CARD structural domain of ASC, thereby activating Caspase-1. Activated Caspase-1 cleaves and forms mature IL-1β and IL-18, while cleaving the GSDMD into mature GSDMD -N (Shi et al., 2015). GSDMD-N binds to the cell membrane to form membrane pores for the secretion of pro-inflammatory factors IL-18 and IL-1β, which ultimately leads to pyroptosis (Fink and Cookson, 2010; Kovacs and Miao, 2017). It has been found that Se deficiency or/and BPA exposure can activate broiler trachea (Kexin et al., 2022) and liver (Shi et al., 2023) by increasing the expression of the pyroptosis markers NLRP3 and GSDMD, promoting the expression levels of NLRP3, ASC, Caspase-1, GSDMD, IL-18, and IL-1β. Similar to previous findings, both of in vivo and in vitro assays showed that Se deficiency or/and BPA exposure significantly enhanced the fluorescence intensity of NLRP3 and GSDMD as well as co-localization of the 2 in the spleen, and most significantly in the combined group. In addition, the transcription and protein expression levels of NLRP3, ASC, Caspase-1, GSDMD, IL-18, and IL-1β were significantly increased due to Se deficiency and/or BPA exposure, and the above changes were most pronounced in the combination group. The above results suggest that Se deficiency can synergies with BPA to activate NLRP3 inflammasome and induce pyrotosis in the spleen. The addition of ROS inhibitors (NAC) in vitro further revealed that ROS played an important role in the process of chicken spleen pyroptosis.

In conclusion, Se deficiency or/and BPA exposure induces pyroptosis in chicken spleen tissues by activating the ROS/NLRP3 pathway through the induction of oxidative injury. The present study elucidates for the first time the immunotoxicity of joint Se deficiency and BPA in poultry, and will add a new theoretical basis for the study of Se deficiency and BPA toxicology in avian animals.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

The authors thank the Key Laboratory of the Provincial Education Department of Heilongjiang for Common Animal Disease Prevention and Treatment, College of Veterinary Medicine, Northeast Agricultural University for providing conditions.

Data availability: The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.
==== Refs
REFERENCES

Abais J.M. Xia M. Zhang Y. Boini K.M. Li P.L. Redox regulation of NLRP3 inflammasomes: ROS as trigger or effector? J. Antioxid. Redox Signal. 22 2015 1111 1119
Akahoshi N. Anan Y. Hashimoto Y. Tokoro N. Mizuno R. Hayashi S. Yamamoto S. Shimada K.i I. Kamata S. Ishii I. Dietary selenium deficiency or selenomethionine excess drastically alters organ selenium contents without altering the expression of most selenoproteins in mice J. Nutr. Biochem 69 2019 120 129 31078905
Alessandra C. Carmen G. Fabiana A. Ilaria C. Dario B. ‘Human Peripheral Blood Mononuclear Cell Function and Dendritic Cell Differentiation Are Affected by Bisphenol-A Exposure’ J PLOS One 11 2016 e0161122
Anders S. Huber W. Differential expression analysis for sequence count data Genome Biol. 11 2010 R106 20979621
Angel I. Bar A. Horovitz T. Taler G. Krakovsky M. Resnitsky D. Rosenberg G. Striem S. Friedman J.E. Kozak A. Metal ion chelation in neurodegenerative disorders Drug Dev. Res. 56 2010 300 309
Cai J. Yang J. Liu Q.i Gong Y. Zhang Y. Zheng Y. Yu D. Zhang Z. Mir-215-5p induces autophagy by targeting PI3K and activating ROS-mediated MAPK pathways in cardiomyocytes of chicken J. Inorg. Biochem. 193 2019 60 69 30684759
Chunyang L. Kurunthachalam K. Concentrations and profiles of bisphenol A and other bisphenol analogues in foodstuffs from the United States and their implications for human exposure J. Agric. Food Chem. 61 2013 4655 4662 23614805
Eddo J. Catherine S. Release of bisphenol A from polycarbonate: A review Crit. Rev. Food Sci. Nutr. 53 2013 386 402 23320909
Eriko Y. Nobuyoshi Y. Sachi T. James L. S L.P.K. Hyo-Bang M. Yunsun J. Pranav K. Hema A. Natesan M. Kurunthachalam K. Bisphenol A and other bisphenol analogues including BPS and BPF in surface water samples from Japan, China, Korea India', Ecotoxicol Environ. Saf. 122 2015 565 572 26436777
Fink S.L. Cookson B.T. Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages Cell. Microbiol 8 2010 1812 1825
Franchi L. Eigenbrod T. Muoz-Planillo R. Nuez G. The inflammasome: A caspase-1-activation platform that regulates immune responses and disease pathogenesis Nat. Immunol. 10 2009 241 247 19221555
Franz B. Eva B. Anna R. Luigi F. Gabriel N. Veit H. Cutting edge: Reactive oxygen species inhibitors block priming, but not activation, of the NLRP3 inflammasome J. Immunol. 187 2011 613 617 21677136
Gao X.J. Tang B. Liang H.H. Yi L.i Wei Z.i G. Selenium deficiency inhibits micRNA-146a to promote ROS-induced inflammation via regulation of the MAPK pathway in the head kidney of carp Fish Shellfish Immunol 91 2019 284 292 31125664
Huanyi L. Hongjin L. Tong X.u Xu S. Yujie Y. Ahmed K.P. Zhihui J. Shiwen X.u New insights into brain injury in chickens induced by bisphenol A and selenium deficiency-Mitochondrial reactive oxygen species and mitophagy-apoptosis crosstalk homeostasis Sci. Total Environ 905 2023 166890
Jie S. Haidong X. Xiaojing Z. Lei Z. Qian G. Kan H.e Dahai L. Bei H. Selenium enhances photodynamic therapy of C-phycocyanin against lung cancer via dual regulation of cytotoxicity and antioxidant activity Acta. Biochim. Biophys. Sin 55 2023 1925 1937 37994159
Kaur K. Chauhan V. Gu F. Chauhan A. Bisphenol A induces oxidative stress and mitochondrial dysfunction in lymphoblasts from children with autism and unaffected siblings Free Rad. Biol. Med. 76 2014 25 33 25101517
Kexin Y. Xinyue S. Yaxin Z. Wenyue Z. Hongjin L. Bisphenol A exacerbates selenium deficiency-induced pyroptosis via the NF-κB/NLRP3/Caspase-1 pathway in chicken trachea Comp. Biochem. Physiol. C Toxicol. Pharmacol. 263 2022 109488
Kovacs S.B. Miao E.A. Gasdermins: Effectors of pyroptosis Trend. Cell. Biol 27 2017 673 684
Liang G. Dan L. Dan W.u Qi S. Yang L. Deliang W. Lihong J. Effects of mammalian target of rapamycin and aryl hydrocarbon receptor-mediating autophagy signaling on the balance of Th17/Treg cells during perinatal bisphenol A exposure in female offspring mice Environ. Toxicol 37 2022 1781 1789 35357751
Lu C. Dayong T. Fuchang Y.u Tian W. Meng Q.i Shiwen X.u Cineole regulates Wnt/β-catenin pathway through Nrf2/keap1/ROS to inhibit bisphenol A-induced apoptosis, autophagy inhibition and immunosuppression of grass carp hepatocytes Fish Shellfish Immunol 131 2022 30 41 36195267
Natalie R G. Induction of oxidative stress by bisphenol A and its pleiotropic effects Environ. Mol. Mutagen 58 2017 60 71 28181297
Nose K. Role of reactive oxygen species in the regulation of physiological functions Biol. Pharm. Bull 23 2000 897 903 10963291
Olukole S.G. Lanipekun D.O. Ola-Davies E.O. Oke B.O. Melatonin attenuates bisphenol A-induced toxicity of the adrenal gland of Wistar rats Environ. Sci. Pollut. Res. Int 26 2019 5971 5982 30613877
Puja S. Chandrakala S. Rucha P. Shrimati S. Differential response to FEIBA is strongly associated with the prothrombotic microparticles Blood Cells Mol. Dis 84 2020 102441
Qingqing L. Wei W. Yiming Z. Yuan C. Shiwen X.u Shu L.i Bisphenol A regulates cytochrome P450 1B1 through miR-27b-3p and induces carp lymphocyte oxidative stress leading to apoptosis Fish Shellfish Immunol 102 2020 489 498 32430284
Qisheng L. Shu L.i Na J. Xinghua S. Minfang Z. Haijiao J. Zhen Z. Jianxiao S. Yijun Z. Wenyan Z. Leyi G.u Renhua L.u Zhaohui N.i PINK1-parkin pathway of mitophagy protects against contrast-induced acute kidney injury via decreasing mitochondrial ROS and NLRP3 inflammasome activation Redox Biol 26 2019 101254
Shi J. Huang H. Xuyan W. Wang K. Shao F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death' Nature 526 2015 660 665 26375003
Shi X.u Xu T. Li X. Sun X. Zhang W. Liu X. Wang Y. Zhang Y. Xu S. ROS mediated pyroptosis-M1 polarization crosstalk participates in inflammation of chicken liver induced by bisphenol a and selenium deficiency Environm. Pollut. 354 2023 121392
Sies H. Oxidative stress: A concept in redox biology and medicine Redox Biol. 4 2015 180 183 25588755
Surai P.F. Kochish I. Nutritional modulation of the antioxidant capacities in poultry: the case of selenium Poultry Sci. 98 2022 4231 4239
Suttie W.A. Histopathology of the spleen Toxicol. Pathol 34 2006 466 503 17067940
Tschopp J. Schroder K. NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat. Rev. Immunol. 10 2010 210 215 20168318
Vincenzo B. Pittet Mikael J. The spleen in local and systemic regulation of immunity Immunity 56 2023 806 818
Wang F. Liang Q. Ma Y. Sun M. Li T. Lin L. Sun Z. Duan J. Silica nanoparticles induce pyroptosis and cardiac hypertrophy via ROS/NLRP3/Caspase-1 pathway Free Radical. Bio. Med. 182 2022 171 181 35219847
Wu D.i Su Y. Hu G. Lin X.u Bisphenol A and selenium deficiency exposure induces pyroptosis and myogenic differentiation disorder in chicken muscle stomach Poult. Sci. 103 2024 103641
Yanliang W.u Yongrong Y. Hangjia B. Kuniyoshi S. Renshi L.i Chaofeng Z. Investigation of pulmonary toxicity evaluation on mice exposed to polystyrene nanoplastics: The potential protective role of the antioxidant N-acetylcysteine Sci. Total Environ. 855 2022 158851
Zhang Y. Su S.S. Zhao S. Yang Z. Zhong C.Q.i Chen X. Cai Q. Yang Z.H. Huang D. Wu R. RIP1 autophosphorylation is promoted by mitochondrial ROS and is essential for RIP3 recruitment into necrosome Nat. Commun. 8 2017 14329 28176780
Zhang Y. Yin K. Wang D. Wang Y.u. Lu H. Zhao H. Xing M. Polystyrene microplastics-induced cardiotoxicity in chickens via the ROS-driven NF-κB-NLRP3-GSDMD and AMPK-PGC-1α axes Sci. Total Environ. 840 2022 156727
