
==== Front
Ann Surg
Ann Surg
SLA
Annals of Surgery
0003-4932
1528-1140
Lippincott Williams & Wilkins Hagerstown, MD

38975668
ANNSURG-D-24-00751
10.1097/SLA.0000000000006436
00004
3
Papers of the 144th ASA Annual Meeting
Codon-Optimized and de novo–Synthesized E-Selectin/AAV2 Dose–Response Study for Vascular Regeneration Gene Therapy
Voza Francesca A. MD fav38@med.miami.edu
*
Byrne Barry J. MD, PhD †barry.byrne@ufl.edu

Ortiz Yulexi Y. BS yyo2@med.miami.edu
*
Li Yan BS *yli3@med.miami.edu

Le Nga MS *‡ntl21@miami.edu

Osafo Lucy MS *‡lxo302@miami.edu

Ribieras Antoine C. MD *antoine.ribieras@med.miami.edu

Shao Hongwei PhD *hshao2@med.miami.edu

Huerta Carlos Theodore MD *cth62@med.miami.edu

Wei Yuntao MD *ywei@med.miami.edu

Falero-Diaz Gustavo PhD *gxf309@med.miami.edu

Franco-Bravo Andres BS rao85@miami.edu
*‡
Lassance-Soares Roberta M. PhD *roberta.soares@med.miami.edu

Vazquez-Padron Roberto I. PhD rvazquez@med.miami.edu
*‡
Liu Zhao-Jun MD, PhD zliu@med.miami.edu
*‡
Velazquez Omaida C. MD ovelazquez@med.miami.edu
*‡
* DeWitt Daughtry Family Department of Surgery, University of Miami School of Medicine, Miami, FL
† Powell Gene Therapy Center, University of Florida, Gainesville, FL
‡ Department of Biochemistry & Molecular Biology, University of Miami School of Medicine, Miami, FL
ovelazquez@med.miami.edu; zliu@med.miami.edu.
10 2024
08 7 2024
280 4 570583
Copyright © 2024 The Author(s). Published by Wolters Kluwer Health, Inc.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0/

Objective:

This study focuses on dose–response investigation using a codon-optimized and de novo–synthesized E-Selectin/AAV2 (E-Sel/AAV2) vector in preparation for Investigational New Drug enabling of subsequent clinical studies.

Background:

Gene therapy is a potential solution for patients suffering from chronic limb-threatening ischemia. Understanding the dose for effective gene delivery is crucial for future Investigational New Drug–enabling studies.

Methods:

Expression of the codon-optimized E-Selectin gene was assessed by flow cytometry following in vitro cell transfection assay and RT-qPCR for murine limbs injected in vivo with AAV-m-E-Selectin (E-Sel/AAV2). Dose–response studies involved 3 cohorts of FVB/NJ mice (n=6/group) with escalating log doses of E-Selectin/AAV2 injected intramuscularly in divided aliquots, ranging from 2 × 109 VG to 2 × 1011 VG, into ischemic limbs created by left femoral artery/vein ligation/excision and administration of nitric oxide synthase inhibitor, L-NAME. Limb perfusion, extent of gangrene free limb, functional limb recovery, and therapeutic angiogenesis were assessed.

Results:

Codon-optimized E-Sel/AAV2 gene therapy exhibits a superior expression level than WT E-Sel/AAV2 gene therapy both in vitro and in vivo. Mice treated with a high dose (2 × 1011 VG) of E-Sel/AAV2 showed significantly improved perfusion indices, lower Faber scores, increased running stamina, and neovascularization compared with lower doses tested with control groups, indicating a distinct dose-dependent response. No toxicity was detected in any of the animal groups studied.

Conclusions:

E-Sel/AAV2 Vascular Regeneration Gene Therapy holds promise for enhancing the recovery of ischemic hindlimb perfusion and function, with the effective dose identified in this study as 2 × 1011 VG aliquots injected intramuscularly.

Keywords:

gene therapy
regenerative medicine
E-selectin
chronic limb-threatening ischemia
hindlimb ischemia
OPEN-ACCESSTRUE
SDCT
==== Body
pmcCritical limb-threatening ischemia (CLTI), the most severe complication of peripheral arterial disease (PAD), affects over 10% of PAD patients, leading to substantial morbidity and mortality.1,2 In the United States, approximately 8.5 million individuals suffer from PAD, with an annual cost exceeding USD 21 billion.2–4 Despite advancements in current treatments, many patients exhibit a poor response, resulting in a nearly 30% amputation rate with a 50% mortality risk at 5 years postamputation.1,5,6

Novel gene therapy holds promise for therapeutic angiogenesis to address this medical need.4 While previous approaches on naked plasmids utilizing soluble angiogenic factors, such as vascular endothelial growth factor, fibroblast growth factor, or hepatocyte growth factor, showed limited clinical efficacy and faced safety concerns,7–10 the new generation of Adeno-associated virus (AAV) vectors has shown remarkable safety profiles, exemplified by the FDA’s approval for vision loss gene therapy.11–16 Selectins, such as the inducible E-Selectin (E-Sel), are adhesion molecules that facilitate leukocytes tethering to the vascular endothelium during injury response.17,18 The role of E-Sel in recruiting endothelial progenitor cells to sites of neovascularization through a process known as “homing” was previously revealed.19 We therefore hypothesized that upregulating membrane-bound E-Sel in compromised ischemic tissue would enhance angiogenesis and wound healing by increasing stem/progenitor cell homing and demonstrated that E-Sel can be an effective therapeutic target to activate and leverage therapeutic response within ischemic tissues.20–23 We recently showed proof-of-concept using the wild-type (WT) E-Sel/AAV2 designed for therapeutic angiogenesis.24 Here, we set out to create a codon-optimized (CO) and de novo–synthesized E-Sel gene, inserted into an AAV vector for potential human trials. This study investigates dose–response relationships, critical for initiating Investigational New Drug (IND)-enabling studies ahead of future first-in-human clinical testing for Vascular Regeneration Gene Therapy (VRGT). We utilized an ischemic/gangrene mouse model to evaluate therapeutic neovascularization, reperfusion, and limb/tissue preservation.25

METHODS

Design of de novo–Synthesized and CO Mouse E-Sel AAV Vector

CO mouse AAV-m-E-Selectin plasmid was synthesized by GenScript using its gene optimization algorithm GenSmart Codon Optimization tool (https://www.genscript.com/gensmart-free-gene-codon-optimization.html?src=google_sitelinks&utm_source=google&utm_medium=cpc&jiraid=12194&gad_source=1&gclid=Cj0KCQjw3ZayBhDRARIsAPWzx8oQ4IdMjb_s6DCE-dQbEzjuVyLUkoXH1-2QiD1ZyyObbH64P8evL6IaAoHEALw_wcB), and inserted into multiple cloning sites in the pTR2 vector modified to carry CMV promoter and dual drug-resistance gene (AmpR and KanR) which is necessary for AAV production (Supplemental Content Fig. 1, Supplemental Digital Content 1, http://links.lww.com/SLA/F189). CO cDNA was confirmed by gene sequencing.

Production of AAV-mouse-E-Selectin

AAV-m-E-Selectin (E-Sel/AAV2) and AAV-CMV-GFP (GFP/AAV2) were manufactured by Powell Gene Therapy Center at the University of Florida according to its SOP for production by a triple plasmid transfection into human embryonic kidney 293 (HEK293) cells using the helper-virus–free method.26 Release testing of the final product was dictated by a series of requirements and predetermined specifications to determine safety, purity, concentration, identity, potency, and stability of the product.27

293T Cell Transfection

293T cells were seeded to be 70% to 90% confluent at transfection which was performed, as previously described.24 Briefly, 293T cells were incubated with DNA-lipid complexes using lipofectamine (#18324-012) for 6 hours. The medium was then replaced with regular DMEM 10% FBS.

Flow Cytometry and ELISA

293T cells were kept in culture, then detached 72 hours after transfection using Accutase (STEMCELL Technologies, Vancouver, Canada) and stained for marker CD62E/E-Selectin BD Pharmingen (551145) antibody. Cell analysis was performed on a FACSAria II cell sorter using FACSDiva Version 6.1.1 (BD Biosciences) or FlowJo Version 7.6.4 (TreeStar) software. The cell lysates were prepared and used for enzyme-linked immunosorbent assay (ELISA) quantification of E-Selectin protein levels per the kit protocol (ab201279 Abcam).

Hindlimb Ischemia and Gangrene Induction

FVB/NJ mice were utilized for the surgical critical limb ischemia model. Femoral artery and vein ligation/excision (FAVLE) and intraperitoneal (IP) injections (40 mg/kg) of Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME) (N5751, Sigma-Aldrich, St. Louis, MO), a pan-inhibitor of nitric oxide synthase were performed on FVB/NJ mice as previously described.21,24,28 Postoperative analgesia was ensured by administering 3.25 mg/kg SC q72hr of Ethiqa XR (buprenorphine 1.3 mg/mL extended-release injectable suspension) subcutaneously.

Administration of E-Sel/AAV2 Gene Therapy

Three groups of FVB/NJ mice (9–12 wk old), male and female at 1:1 ratio (001800; Jackson Laboratory), received intramuscular (IM) injections in the thigh under anesthesia, with either E-Sel/AAV2 or GFP/AAV2 as previously described.21,24,29 Three different escalating log doses of E-Sel/AAV2 (N=6/ group) and GFP/AAV2 (N=6/group) viral genome (VG) were administered with 2 × 109 VG as low dose (LD), 2 × 1010 VG as medium dose (MD), and 2 × 1011 VG as high dose (HD), across the 3 days.

Quantitative Assays RT-qPCR

Thigh and calf muscles were harvested from limbs at specified time points post FAVLE and injection of E-Sel/AAV2 versus WT E-Sel/AAV2. Total RNA extraction and real-time reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were performed as previously described24 using RT2 SYBR Green qPCR Mastermix (330500, Qiagen). Primers include that for CO mouse E-Sel (Fwd: GAAGCACTCTCCGTCCTATTAC, Rev: TTGCGCCTCCTCTGTTAAA), for WT mouse E-Sel (NM_007393, assay ID Mm.PT.39a22214835) and Rplp0 (NM_007475, assay ID Mm.PT.39a22214835) as housekeeping gene (Integrated DNA Technologies, Coralville, IA). Data were analyzed using the ΔCt method (2−ΔΔCt) method. −ΔCt values were analyzed for differential expression using R “limma,” and raw P values based on empirical Bayes moderated t-statistics were adjusted for multiple testing with Benjamini & Hochberg false discovery rate correction.30

Histological Examination

Tissue embedding, sectioning, and H&E staining were performed after hindlimb muscle harvest on postoperative day (POD) 21 as described previously.24 Slides were imaged with a Leica DFC295 (Leica Microsystems) under × 20 (20 µm) and × 40 (50 µm) magnification and myofiber cross-sectional areas were measured as previously described with a Zeiss Axio Observer inverted microscope (ZEISS, Oberkochen, Germany).24

Laser Doppler Perfusion Imaging

Laser Doppler imaging (LDI) measurements were obtained using a Moor laser Doppler perfusion imaging device running version 5 software (Moor Instruments, Wilmington, DE) as described,24,31,32 to assess hindlimb perfusion preoperatively, immediately after procedure, then at POD 7, 14, and 21. The ratio of mean flux values normalized to pre-op from the left/ischemic perfusion index relative to the right/nonischemic limb within each mouse was calculated to obtain the hindlimb relative perfusion index (RPI).

Faber Hindlimb Ischemia Score

Tissue loss and footpad gangrene were assessed through Faber hindlimb ischemia scoring on POD 1, 3, 7, 14, and 21. Faber scores (FS), ranging from 0 to 12, indicate the severity of ischemia, with 1 to 5 corresponding to the number of ischemic nails, 6 to 10 indicating ischemic digits, and 11 to 12 reflecting partial or complete footpad autoamputation33. Severity of gangrene was classified into 3 categories such as mild (FS 1–4), moderate (FS 5–8), and severe (FS 9-12).

Treadmill Exhaustion Testing

After randomization in the different groups (N=6 /group), mice underwent a familiarization phase and were trained to run on an Exer 3/6 treadmill (Columbus Instruments, Columbus, OH) during 8 separate sessions spanning over 2 weeks preoperatively. Subsequently, treadmill exhaustion testing occurred on POD 7, 10, 14, and 21 as previously described.24,29 End point was defined by reaching 40 shocks, at which point shocks were disabled, and the total distance achieved was recorded.

Whole-body DiI Perfusion and Footpad Confocal Microscopy

To evaluate neovascularization in the footpad, intracardiac perfusion of the lipophilic carbocyanine dye 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) was conducted on POD 22 (N=5/group). The DiI solution (D282, Invitrogen/Thermo Fisher Scientific, Waltham, MA), diluent, and fixative were prepared, and the perfusion apparatus was assembled following established protocols.24,34 Perfusion under anesthesia and subsequent harvest of footpads were performed as previously described.24 Imaging of tissues under × 5 magnification was conducted using a Leica TCS SP5 (Leica Microsystems, Wetzlar, Germany) inverted confocal microscope. To standardize technical variability during perfusion, bilateral footpads were imaged, and the ratio of vessel density between left/ischemic and right/nonischemic footpads within the same mouse was calculated. Quantification of tissue vascularity was carried out in Fiji (National Institutes of Health, Bethesda, MD).

Statistics

Statistical analyses were conducted utilizing GraphPad Prism software (version 9.0.1, GraphPad Software, San Diego, CA). Normal distribution of continuous data was evaluated through the Shapiro-Wilk test, and comparisons were made using Student t test for 2 variables and ANOVA for more than 2 variables. χ2 test was employed for comparing categorical outcomes between 2 groups. The data are expressed as mean±SEM and null hypotheses were rejected for data with a P value ≤0.05.

RESULTS

CO and de novo–Synthesized E-Sel/AAV2 Gene Exhibits a Higher Level of Gene Expression Than Wild-type E-Sel

To assess the expression of the CO and de novo–synthesized E-Sel cDNA construct in vitro, we analyzed its protein level by flow cytometry after 293T cell transfection with CO E-Sel versus WT E-Sel versus GFP control plasmid. Expression of all these genes was driven by CMV promoter. Compared with WT E-Sel, CO E-Sel construct exhibits a 10-fold increase in protein expression (Fig. 1A). Quantification of cell lysates by ELISA further revealed a significantly higher concentration of E-Selectin protein in the CO E-Selectin/AAV plasmid transfected cells compared with the WT E-Sel/AAV2 and GFP/AAV2 plasmid transfected cells (P<0.05). We further quantified the mRNA expression level of E-Sel in vivo by RT-qPCR, from combined ischemic limb tissues harvested POD 21 after FAVLE/ L-NAME of three mice that were treated with 2 × 1011 VG of either CO E-Sel/AAV2 or WT E-Sel/AAV2 and their respective GFP/AAV2 controls (Fig. 1B). Limb tissues from mice treated with CO E-Sel/AAV2 exhibit a gene expression level significantly higher by 2.5-fold (50.91±1.20) compared with WT E-Sel/AAV2-treated mice (19.47±2.44) as measured relative to endogenous levels of E-Sel from GFP controls (P<0.0001). These data demonstrate that CO E-Sel transgene results in higher levels of expression in vitro and in vivo.

FIGURE 1 Enhanced gene expression of codon-optimized over wild-type mouse E-Sel gene in vitro and in vivo. A, in vitro 293T cell transfection using equal amounts of codon-optimized (CO) E-Sel versus wild-type (WT) E-Sel versus GFP cDNA plasmids. Analysis by flow cytometry 3 days after cell transfection shows an increased expression level of E-Sel in a fraction of 293T cells transfected with CO E-Sel plasmid versus WT E-Sel plasmid vs GFP control. B, ELISA quantification of transfected cell lysates revealed a significantly higher concentration of E-Sel protein in CO E-Sel/AAV2 transfected cells versus WT E-Sel/AAV2 and GFP/AAV2 transfected cells. Data presented as mean±SD (P<0.05) C, mRNA expression level of E-Sel gene achieved in ischemic limb tissue treated with CO E-Sel/AAV2 is 2.5-fold higher than achieved with WT E-Sel/AAV2. Levels of E-Sel mRNA were assessed by quantitative RT-PCR. Total RNA was extracted from 3 limb tissues in each group and mixed with equal ratio to do RT-PCR. P values are from Student t test. Data are presented as mean±SEM where ****P<0.0001.

High-Dose E-Sel/AAV2 VRGT Improves Footpad Reperfusion

We evaluated the efficacy and dose–response of E-Sel/AAV2 gene therapy on footpad reperfusion utilizing LDI in the 3 randomized cohorts of mice treated with escalating log dose of E-Sel/AAV2 including HD, MD, LD, and their corresponding log doses of GFP/AAV2. Footpad RPI, expressed as the ratio of blood flow between the left/ischemic and right/nonischemic limb, relative to baseline was analyzed to account for any potential baseline variations between groups before ischemia/gangrene induction by FAVLE/L-NAME. Footpad RPI was significantly improved with HD E-Sel/AAV2 gene therapy compared with HD GFP/AAV2 control on POD 21 (0.408±0.046 versus 0.205±0.022, P<0.05) (Fig. 2A–C). In addition, comparing the RPI fold change of each E-Sel/AAV2 group compared with their respective GFP controls (set as 1), we observed that while reperfusion of ischemic footpad in the HD E-Sel/AAV2 group was more than 2-fold higher than GFP control (2.227±0.047, P<0.0001), the MD E-Sel/AAV2 group exhibited a lower fold increase (1.651±0.100, P<0.001) and LD E-Sel/AAV2 group had no significant increase compared with GFP controls (Fig. 2D, E). These findings indicate that E-Sel/AAV2 VRGT enhances footpad reperfusion in the ischemic limb in a dose-dependent manner with the most effective dose at 2 × 1011 VG.

FIGURE 2 Efficiency and dose–response assessment of codon-optimized E-Sel/AAV2 in Hindlimb reperfusion using LDI. Hindlimb reperfusion is improved by HD codon-optimized E-Sel/AAV2 VRGT. A, Representative LDI perfusion images at different time points pre- vs postoperatively with left/ischemic limb (labeled as L) after femoral artery and vein cauterization, and right/nonischemic limb (labeled as R). B, LDI perfusion images at POD 21, showing better recovery of all 6 mice treated with high dose (HD) E-Sel/AAV2 compared with GFP/AAV2 (N=6 mice/group). C, Quantification of relative perfusion indices, demonstrating significantly improved recovery of limb perfusion in mice treated with HD E-Sel/AAV2 compared with HD GFP/AAV2 at POD 21 (N=6 mice/group). Relative perfusion indices are defined as the ratio of mean flux from the left/ischemic perfusion index relative to the right/nonischemic limb within each mouse, relative to pre-op indices. D, Representative LDI perfusion images show mice treated with HD, MD or LD E-Sel/AAV2 vs GFP/AAV2 controls at POD 21. E, Quantification of perfusion indices demonstrating improved recovery of limb perfusion in mice treated with HD E-Sel/AAV2 versus HD GFP/AAV2 and MD E-Sel/AAV2 versus MD GFP/AAV2, but no significant difference between LD E-Sel/AAV2 and its GFP control group at POD 21 (N=6 mice/group). Footpads treated with GFP/AAV2 are set as 1, and relative folds changed in footpads treated with E-Sel/AAV2 are shown normalized to GFP controls. Data are presented as mean±SEM where *P < 0.05, ***P < 0.001, ****P < 0.0001, and ns (not significant) (P>0.05).

High-Dose E-Sel/AAV2 VRGT Leads to Faster Recovery of Limb Function and Preserves Muscle Histological Integrity

The mouse treadmill exhaustion test was performed to estimate the limb function recovery following FAVLE/L-NAME induction in the 3 different groups treated with E-Sel/AAV2 compared with their respective GFP/AAV2 controls. All groups showed mean relative walking/running distance improvement by POD 21. However, HD E-Sel/AAV2-treated mice showed significantly greater improvement compared with HD GFP/AAV2 controls (1.125±0.097 vs 0.658±0.085, P<0.05), returning to or exceeding preoperative capacity (Fig. 3A). When comparing fold change in each group with respective GFP controls (set as 1), HD E-Sel/AAV2 showed over 50% increase (1.709±0.147, P<0.01) compared with MD E-Sel/AAV2 or LD E-Sel/AAV2, which did not significantly differ from GFP/AAV2 controls (Fig. 3B). These data reveal faster hindlimb function recovery with E-Sel/AAV2 VGRT in a dose–response fashion with the most effective dose tested being 2 × 1011 VG. Increased absolute myofiber size assessed by H&E staining histological analysis of the hindlimb at POD21 revealed better-preserved myocyte integrity in the E-Sel/AAV2-treated group compared to the control group and that relative to nonischemic calf muscle (92.2±5.0 vs 72.9±17.6 0, P<0.05).

FIGURE 3 Efficiency and dose-response assessment of codon-optimized E-Sel/AAV2 in limb function and preserved myofiber integrity using treadmill exhaustion test. Functional recovery in ischemic hindlimb is improved with HD codon-optimized E-Sel/AAV2 VRGT demonstrated by (A) mean relative distance walked on treadmill exhaustion testing of mice treated with HD E-Sel/AAV2 compared with HD GFP/AAV2 control at various time points postoperatively (N=6 mice/group). Distance on treadmill pre-op is set as 1, and relative folds changed post-op are showed normalized to pre-op. B, Mean relative walking distance on treadmill exhaustion testing of mice treated with HD, MD, and LD E-Sel/AAV2 vs HD, MD, LD GFP/AAV2, respectively at POD 21 (N=6 mice/group). Footpads treated with GFP/AAV2 are set as 1, and relative folds changed in footpads treated with E-Sel/AAV2 are shown normalized to GFP controls. C, Representative H&E sections demonstrating better-preserved muscle integrity with larger myofiber size (dashed yellow line) and peripherally located nuclei (pointed arrowhead) in E-Sel/AAV2-treated muscle compared to shrunken (dashed yellow line), eosinophilic necrotic fibers and centrally located nuclei (diamond arrowheads) observed in muscle treated with control AAV. Scale bars represent 20 μm. D, Measurement of myofiber cross-sectional area demonstrating reduced myofiber size in E-Sel/AAV2-treated ischemic muscle compared with control group. Nonischemic myofiber size is comparable across groups. C, Relative myofiber size in ischemic muscle compared with nonischemic muscle is significantly larger after treatment with E-Sel/AAV2 compared with control group. Data are presented as mean±SEM where *P<0.05, **P<0.01, and ns (not significant) (P>0.05).

High-Dose E-Sel/AAV2 VRGT Reduces Tissue Loss and Incidence of Severe Gangrene With Autoamputation in Ischemic Limb

Tissue loss severity, gangrene formation, and autoamputation were assessed using the Faber hindlimb ischemia scoring system across the three different dose groups of mice and corresponding GFP controls24,32 (Fig. 4A). HD E-Sel/AAV2-treated mice exhibited significantly lower mean ischemia severity index compared with HD GFP control (3.17±1.25 vs 9.5±1.23, P<0.01) at POD21 (Fig. 4B–D). Moderate gangrene was less prevalent in the HD (33%) compared with MD (66%) or LD (50%) groups. No severe gangrene was observed in the HD group while 16% of both MD and LD groups exhibited severe gangrene. One case of severe gangrene in the HD group was detected but excluded from the study due to an exposed tendon. However, total recovery of tissue loss over the exposed tendon was observed instead of disease progression as observed in other groups (Supplemental Material Fig. 2, Supplemental Digital Content 2, http://links.lww.com/SLA/F190). Overall, these findings demonstrate that a therapeutic dose for the prevention of tissue loss after severe ischemia by FAVLE/L-NAME using E-Sel/AAV2 VRGT is achieved at 2 × 1011 VG.

FIGURE 4 Efficiency and dose–response assessment of codon-optimized E-Sel/AAV2 in hindlimb tissue loss and gangrene using Faber Ischemia Scores. Tissue loss and incidence of severe gangrene in ischemic limb are reduced by HD E-Sel/AAV2 VRGT. A, Illustrative images of Faber scores (FS) 1–12 in mice from this study. B, Representative images of footpads obtained at various time points in mice treated with HD E-Sel/AAV2 and GFP/AAV2 with left/ischemic limb (labeled as L) after femoral artery and vein cauterization, and right/nonischemic limb (labeled as R) (N=6 mice/group). C, Images of footpads obtained at POD21 in all 6 mice treated with HD E-Sel/AAV2 versus HD GFP/AAV2 (N=6 mice/group). D, Mean FS after induction of hindlimb ischemia are significantly lower in mice treated with HD E-Sel/AAV2 compared with HD GFP/AAV2 (N=6 mice/group). E, Representative images of footpads obtained at POD21 in mice treated with HD, MD, LD E-Sel/AAV2, and their respective GFP controls at POD 21. F, Proportion of mice with mild (FS 1–4), moderate (FS 5–8), or severe gangrene (FS 9–12) on POD 21. Data are presented as mean±SEM where **P<0.01, ***P<0.001.

High-Dose E-Sel/AAV2 VRGT Enhances Hindlimb Revascularization and Angiogenesis

Through high-resolution, 3-dimensional visualization of vascular density using whole-body DiI perfusion with subsequent confocal microscopy imaging at POD 22, we analyzed the vessel density of the ischemic footpads. The mean vessel density index, expressed as the ratio between vessel density of the ischemic left limb and nonischemic right limb, was significantly higher in the HD E-Sel/AAV2 (0.874±0.116) group compared with the GFP control group (0.350±0.089) (P=0.01) (Fig. 5A, B). When comparing footpad vascular density indices among the 3 doses of E-Sel/AAV2 group versus GFP controls (normalized to 1), the HD group displayed an ~2.5-fold elevation compared with its GFP control (2.497±0.331) (P<0.01), whereas both MD and LD did not exhibit a significant increase relative to their respective GFP controls (Fig. 5C, D). This further demonstrates that E-Sel/AAV2 VRGT is proangiogenic, augmenting footpad reperfusion and vessel density in treated ischemic limbs in a dose-dependent response effective at 2 × 1011 VG.

FIGURE 5 Efficiency and dose–response assessment of codon-optimized E-Sel/AAV2 in revascularization using DiI perfusion and confocal microscopy. Hindlimb revascularization and angiogenesis are enhanced by HD E-Sel/AAV2. A, Representative confocal microscopy images of footpads following whole-body perfusion with DiI to stain the peripheral vasculature on POD 22 of mice treated with HD E-Sel/AAV2 compared with HD GFP/AAV2 with left/ischemic limb (labeled as L) after femoral artery and vein cauterization, and right/nonischemic limb (labeled as R). B, Quantification of mean vascular density index revealing higher restoration of vascular density in HD E-Sel/AAV2 compared with HD GFP/AAV2 (N=5 mice/group). Vascular density indices are defined as the ratio of mean flux from the left/ischemic perfusion index relative to the right/nonischemic limb within each mouse. C, Representative confocal microscopy images of footpads following whole-body perfusion with DiI on POD 22 of mice treated with HD, MD, LD E-Sel/AAV2 versus GFP controls with left/ischemic foot and right/nonischemic foot control. D, Quantification of relative mean vasculature density displaying improved recovery of vasculature in mice treated with HD E-Sel/AAV2 compared with HD GFP/AAV2, whereas no significant difference was observed for MD and LD E-Sel/AAV2 compared with their respective MD and LD GFP controls at POD 22 (N=5 mice/group). Vascular density in footpads treated with GFP/AAV2 is set as 1 and relative folds changed in footpads treated with E-Sel/AAV2 are shown normalized to GFP controls. Data are presented as mean±SEM where **P<0.01, ***P<0.001, and ns (not significant) (P>0.05).

DISCUSSION

Recent studies in therapeutic angiogenesis for PAD/CLTI have focused on investigating novel molecular targets and safer, more efficacious gene delivery methods. The membrane-bound E-Sel has emerged as a promising candidate exhibiting favorable outcomes in various studies, offering greater stability and localized action, compared with soluble factors more prone to degradation and off-target side effects.21,24,35 Furthermore, utilization of AAV in gene therapy provides efficient gene delivery with minimal pathogenicity compared with traditional approaches with naked plasmids or adenoviral vectors.36

In our recent study, we demonstrated the feasibility of WT E-Sel/AAV2 gene therapy for therapeutic angiogenesis in a mouse model using local VRGT, as well as safety and therapeutic efficacy through PCR array analysis, revealing the upregulation of angiogenesis genes in ischemic limbs. This supports its potential to enhance perfusion, function, and reduce tissue loss severity, while also inducing myogenesis through in vivo local VRGT.24,29 Here, we designed a de novo–synthesized and CO E-Sel transgene with the goal of optimizing potential therapeutic effects and seamlessly transitioning the biologic product to IND-enabling studies. The impact of synonymous mutations in protein translation and conformation across diseases, favoring the development of codon optimization strategies that enhance protein stability and translation efficiency was highlighted.37,38 Nevertheless, while the safety, potency, and functionality of a novel human CO construct for gene therapy currently in clinical trials was demonstrated, codon optimization does not always guarantee improved protein functionality.39,40 A comprehensive review by Paremskaia et al41 underscores the increasing prevalence of codon optimization in recent therapeutical breakthroughs and emphasizes the need for establishing metrics and acknowledging the limitations of the tool. On the basis of these findings, our study aimed to evaluate the potency of CO E-Selectin compared with the WT sequence. E-Selectin construct exhibits elevated mRNA and protein expression levels, both in vitro and in vivo when compared with WT, resulting in an enhanced biological response in our mouse limb ischemia model. This suggests that the CO E-selectin gene encodes a functional protein with high protein expression yield. These results align with those of Koblan et al42 where codon optimization using the Genscript tool increased biologic activity. However, further IND-enabling biodistribution and toxicology studies are necessary to assess the long-term effects and toxicity of CO E-selectin gene therapy thoroughly. Moreover, dual drug-resistance genes were included in the E-Sel/AAV2 vector to meet more stringent and essential standards required for IND-enabling studies.

We then proceeded to a dose–response study using E-Sel/AAV2. Determining human doses for investigational drugs based on preclinical data presents a challenge in translational medicine. Unlike traditional pharmaceuticals using allometric scaling, gene therapy requires careful extrapolation from preclinical to clinical doses, which has prompted recent FDA guidelines.43,44 Dose-escalation preclinical studies are thus pivotal in determining optimal dosage for effectiveness without causing undue harm. Whereas the effective dose defines the concentration for desired effects, the optimal dosage encompasses a broader spectrum including safety and overall efficacy. In this work, we conducted a dose-escalation test to lock in the effective dose of E-Sel/AAV2 VRGT, targeting restoration of perfusion, function, tissue integrity, and neovascularization. This study reveals the precise DNA map and lowest effective dose, 2 critical findings for the subsequent design of IND-enabling studies.

When assessing tissue loss severity, we did not account for the systemic effects of L-NAME targeting various extremities and sites. Notably, all mice were scored 0 bilaterally preoperatively due to the absence of tissue loss signs before FAVLE/L-NAME or VRGT administration. However, the use of L-NAME resulted in mild ischemia (FS 1–4) bilaterally for several mice within the first-week postinjection. Since this effect resolved on the noninduced ischemic limb within a week, we still considered FS 0 for the nonischemic right limb during the experiment. In addition, it is crucial to acknowledge the subjectivity of FS, particularly at higher levels. While counting gangrenous toes yields relatively accurate results, assessing atrophic hindlimb stumps post-autoamputation presents challenges due to varying lengths. Using a range of scores for severity classification enabled a clearer differentiation and analysis among the groups. Lastly, the occurrence of tissue loss reversal in a mouse with an exposed tendon within the HD E-Sel/AAV2 group was a unique yet promising event warranting further investigation with increased statistical power from additional mice.

During the evaluation of running stamina, variations among mice were observed and were partially mitigated by employing a 1:1 ratio of male-to-female mice in each during randomization, as females demonstrated greater stamina than males. Each mouse’s postoperative travel distance was normalized to its preoperative travel distance to address variations and achieve greater result accuracy.

Considering the inherent variations and subjectivity in assessments, a thorough evaluation of treatment effectiveness by incorporating multiple tests, including LDI and DiI perfusion is necessary. Consistently positive outcomes across all assessments in this study indicated that the therapeutic threshold was achieved at a dosage of 2 × 1011 VG (Table 1). Therefore, we can confidently conclude that the CO and de novo–synthesized E-Sel/AAV2 gene therapy studied promotes postnatal neovascularization, restores limb perfusion and function, and preserves hindlimb tissue integrity. Consistent with our several prior studies, we have not detected any evidence of obvious toxicity or off-target effects in this work, using IM E-Sel/AAV2 VRGT. Identification of an optimal dosage and toxicology investigations are further needed under GLP conditions. For these required follow-up IND-enabling studies, the lowest dose required is defined herein as 2 × 1011 VG.

TABLE 1 Summary of Assay Study Results

	E-Sel/AAV2 VRGT	
Assay Study	2 × 109 VG	2 × 1010 VG	2 × 1011 VG	
LDI	—	+/-	+	
Exhaustion test	—	—	+	
Faber score	+/-	—	++	
DiI perfusion	—	—	+	
Therapeutic response was consistently obtained with E-Sel/AAV2 VRGT at a concentration of 2×1011 VG.

The precise mechanism underlying the biologic and physiological effects of E-Sel/AAV VRGT is just beginning to unfold. Future studies are needed to unravel how IM E-Sel/AAV2 VRGT orchestrates these processes, enhancing limb perfusion and function, arresting or reversing tissue loss, and avoiding thrombosis, inflammation, or edema. Much remains to be studied and understood in this nascent field of gene-based vascular regenerative medicine that uses a membrane-bound adhesion molecule as the targeted payload.

The E-Sel/AAV2 manufacturing cost, production yield, and the need for sequential batches represent considerable limiting factors. In addition, viral vector conservation raises difficulties, as each thawing cycle can potentially reduce the yield by up to 10-fold.45 However, our new purification method improves stability, and future testing will explore virus stability before and after each thawing cycle. This knowledge could expedite future clinical studies by reducing manufacturing costs. While the cost of VRGT may seem elevated compared to nonbiologic treatments, the potential to salvage limbs and minimize amputations, which remain prevalent, could result in substantial health care cost savings in the United States and significantly improve patient quality of life.

We demonstrated that E-Sel/ AAV2 VRGT improves perfusion in mice gangrene model, with the effective dose identified as 2 × 1011 VG, a relatively low dose for scale-up to human limb IM application. These preclinical findings lay the groundwork for further studies under Good Manufacturing Practice (GMP) and subsequent IND-enabling testing of the E-Sel/AAV2 VRGT construct, currently being formulated, leading in near-future to the initiation of first-in-person clinical study.

Supplementary Material

ACKNOWLEDGMENTS

The authors thank the University of Miami Diabetes Research Institute Analytical Imaging Core Facility for assistance with confocal microscopy.

DISCUSSANT

Dr. Steven Stain (Burlington, MA)

The discussion will be initiated by Dr. Dardik from Yale.

Dr. Alan Dardik (New Haven, CT)

That was a really beautifully presented basic science paper.

Response from Francesca Voza

Thank you, Dr. Dardik.

Dr. Alan Dardik (New Haven, CT)

The authors of this study assess a novel strategy to treat patients with critical limb-threatening ischemia. They use AAV to express CO E-selectin, an adhesion molecule that promotes leukocyte and monocyte adhesion to the vascular endothelium as part of the injury response. This strategy builds upon the Velazquez laboratory’s long experience with E-selectin as a strategy to enhance therapeutic angiogenesis and recovery from ischemia to try to take E-selectin therapy from bench to bedside.

Now codon optimization is a very interesting strategy that can help translational efficiency and thereby enable human clinical trials. Humans have 64 different codons to generate only 20 amino acids and 3 stop codons, so multiple codons produce an amino acid. Codon optimization seeks to improve gene expression by changing synonymous codons to others that increase translational efficiency and thus protein efficiency without altering the protein sequence.

This frequently is performed across species, for example, to increase the expression of human proteins in E. coli or yeast. Although codon optimization can increase protein production, synonymous changes to a gene sequence can have unexpected effects. For example, codon optimization can alter protein folding, conformation, or stability. It could change sites of post-translational modification or alter protein function, thus also altering the primary gene sequence can also alter initiation of translation or mRNA stability. Therefore, the experiments here that you presented are absolutely critical to determine the ability of this potential translational strategy to be functional in mammals.

I have 3 questions. First, you show that codon optimization of E-selectin reduces tissue loss and improves hindlimb revascularization and angiogenesis. The experiments are performed very well with appropriate controls. It appears, however, that you used only a single CO product. How was this agent designed? Did you have several versions that you tested and then chose from among them? Are there better agents that would be more appropriate for human clinical trials?

Two, you spent considerable effort performing this dose–response study. How did these doses translate into potential human doses, and are you worried about the potential off-target effects and toxicity with high-dose therapy, and are there sex differences? I’m worried that your high dose in mice may not be relevant to my elderly, obese patient with renal failure.

And lastly, since routes to administer gene therapy to humans are not standardized with intra-arterial, intravenous, and both proximal and direct IM delivery routes, all described in patients, how do you plan to deliver this therapy to humans, and does the route of delivery affect its dosing and its side effects?

Thank you very much for this important and very intriguing study.

Response from Francesca Voza

Thank you so much, Dr. Dardik, for your kind words and insightful questions.

Regarding your first question, using single-codon optimization, we have indeed tried only one CO-designed construct utilizing the patented GenSmart Codon Optimization tool developed by Genscript, which has undergone extensive testing across various regions and countries. This uses a newly designed algorithm to which multiple factors involved in gene expression are integrated, including GC content, codon usage frequency, splicing sites of RNase, and RNA stabilizing acting elements. All of these factors are considered to create a gene sequence designed to potentiate the chances of obtaining functional and active proteins. This was a recommendation from one of our collaborators on this project, Dr. Barry Byrne from the University of Florida Powell Gene Therapy Center, renowned for his contributions to AAV-related patents and clinical trials in Duchenne Muscular dystrophy. Most importantly, our data showed that our newly designed CO E-selectin construct achieves not only a higher level of protein expression both in vitro and in vivo but also results in improved biological response in our mouse limb ischemia model, indicating that our CO E-selectin gene encodes a functional protein. Therefore, we believe that this CO construct would be an ideal therapeutic tool for CLTI.

Dr. Alan Dardik (New Haven, CT)

Fantastic.

Dr. Steven Stain (Burlington, MA)

Thank you. Dr. Chaikof?

Response from Francesca Voza

Oh, there were 3 questions. I’ll try to address the other ones later.

Dr. Steven Stain (Burlington, MA)

You can go ahead. We have time.

Response from Francesca Voza

Okay. Thank you, Dr. Stain.

Dr. Alan Dardik (New Haven, CT)

Sorry, the second one was about the dose, how is the dosage relevant to humans? Your high dose, is it relevant?

Response from Francesca Voza

In our mouse model, this was an educated guess drawn from the effective dosages identified in previously published studies and clinical trials utilizing AAV vectors for gene therapy. While traditional nonbiologic pharmaceuticals rely on allometric scaling, our approach is guided by precedent studies. In our prior publication by Ribieras and colleagues, we demonstrated that approximately 1 to 5 × 1011 viral genome is an effective dose in our mouse model when using the nonoptimized native sequence of E-Selectin. Considering that the CO E-selectin construct expresses approximately 60% higher levels of E-selectin protein, we conducted dosing ranging from 2 × 109 to 2 × 1011 VG to determine the optimal dosage in this study.

Regarding the extrapolation from mouse to human, one way to scale up based on evaluation of the skin surface area or volume of the hindlimb muscle and translate to humans. Another way is based on the effective dose tested in the similar clinical trials, notably the use of AAV gene therapy in Duchenne Muscular Dystrophy (DMD) clinical trial. Given what is published in the literature and what we have found, we have room to scale up to about 1013 VG/kg in future first-in-human clinical trials.

Dr. Alan Dardik (New Haven, CT)

And how do you plan to give that, the route of delivery?

Response from Francesca Voza

Thank you for this question Dr. Dardik as this is an important feature of our therapy. We plan to continue using IM injections and there are different reasons for that. First of all, we demonstrated that the E-selectin priming not only acts on the endotelial vasculature but also on different tissue and cells in the wound milieu such as fibroblasts, other stromal cells, and the immune system. Getting this local action to improve the ischemic tissue microenvironment is crucial for this gene therapy.

The other fact is that after short-term and long-term monitoring in our previous study using the nonoptimized vector, we did not observe any inflammation, edema, or sequestering of our gene therapy in different organs in these mice that were injected. No off-target effects were observed using the IM route, which could be more possibly observed with systemic IV administration. This question will be answered by future toxicology and biodistribution studies under Good Lab Practice conditions.

Another important factor to take into account is the cost of gene therapy. Administration by IM is actually more cost-effective than a systemic administration as a lower dose is required in IM compared with IV.

Thank you.

Dr. Steven Stain (Burlington, MA)

Thank you. Dr. Chaikof?

Dr. Elliot L. Chaikof (Boston, MA)

Congratulations to you and Dr. Velazquez for a really superb study, embracing a very challenging problem, and generating clinical-grade vectors. I would like to follow up on the issue of off-target effects that you mentioned a few moments ago. There have been a number of pharmaceutical companies that have been generating pan-selectin and, in particular, E-selectin inhibitors for the prevention of a variety of inflammatory disorders, whether COPD or allergic asthma or as an agent to prevent thrombosis. Have you assessed whether or not there is a prothombotic tendency among the mice that have received this particular vector?

Response from Francesca Voza

Thank you so much for your question, Dr. Chaikof. This complexity underscores the multifaceted roles of the E-selectin molecule that stands at the forefront of different mechanisms. E-Selectin can indeed potentially induce thrombosis and contribute to fibrosis as reported in cancer patients. However, our previous studies revealed a downregulation of E-selectin in severely ischemic wound milieu in the mouse model. Through this gene therapy, we specifically promote the angiogenic effect of E-selectin and not the prothrombotic effects. Long-term monitoring and subsequent cytological analysis showed no observed toxic effects. The monitored mice did not exhibit any signs of weight loss or behavioral changes. Harvest of different organs after 6 months, including liver, kidneys, heart, brain, and spleen, demonstrated intact structures with no signs of inflammation or sequestering.

Dr. Elliot L. Chaikof (Boston, MA)

Thank you. Congratulations again.

Response from Francesca Voza

Thank you so much.

Dr. Steven Stain (Burlington, MA)

Dr. Gahtan?

Dr. Vivian Gahtan (Maywood, IL)

Congratulations on really an outstanding presentation. It’s been wonderful to see the progression of this work over the years, and I can just comment that Dr. Velazquez unfortunately couldn’t be here today, but I know she’d be extremely proud of your presentation.

My question for you is really about the real-life scenario. When I see a patient in the office, they already have advanced tissue loss, and they’re elderly. With elderly physiology, there is impaired angiogenesis. In your study you’re administering your AAV before your arterial injury, before the ischemia. First, have you looked at or will you look at administering AAV after inducing ischemia and the development of tissue loss? In our real-life scenario, treatment is in the face of the inflammatory response that has been triggered and not in the prevention of the response.

And my second question was have you looked at the response in elderly mice?

Response from FRANCESCA VOZA

Thank you for your inquiry Dr. Gahtan.

I had similar questions when I began this project, and both Dr. Velazquez and Dr. Liu, who were present in the audience, discussed the limitations of the preclinical model with me. Replicating the chronic nature of atherosclerosis developing over decades in humans is challenging in animal models, including the mouse model we employed. Obtaining tissues from patients with critical limb ischemia poses significant risks to their health, so we rely on an acute model. However, the histopathological alterations in the muscle and microvasculature described in some of our previous studies were shown to closely resemble those observed in human ischemic tissue, even in mice. Whereas microvascular changes we see in humans develop over decades, they are recapitulated, in a much shorter span in our induction model during our experimental testing. With the additional fact that rodents possess a repair system that differs from ours, we are left with a short three-week time window to observe a pharmacological effect from our drug. For all these reasons, we have scheduled the injection of our construct before ischemia induction to account for both the lag time in protein production, which is approximately four days, and the short time course to observe the pharmacological effect of the drug. For now, this leads us to mainly focus on evaluating the efficacy of the treatment and exploring the underlying molecular mechanisms.

Currently, we are focused on evaluating the efficacy of the treatment and exploring the underlying molecular mechanisms.

Dr. Vivian Gahtan (Maywood, IL)

Thank you.

Response from Francesca Voza

Thank you so much.

Dr. Steven Stain (Burlington, MA)

Dr. Kent?

Dr. K. Craig Kent (Charlottesville, VA)

Congratulations again, excellent study. I’ll serve to be the historian, so we’ve been trying to tackle this problem for about 30 years now developing angiogenesis to solve lower extremity ischemia, and I would say there are more than several dozen studies showing in mice or rats or different animals that something works that we can restore circulation in these animals, and I don’t see one example in humans that we’ve been able to translate, so I guess the question is what’s different? What makes you optimistic? Is it the high-dose delivery with your vector? Is it E-selectin? What’s going to make the difference between your success versus the failures of all those who have tried before you?

Response from Francesca Voza

We are optimistic about our approach for several reasons. Unlike previous methods that utilized soluble factors such as vascular endothelial growth factor and fibroblast growth factor, which showed limited success in translating preclinical results to positive clinical outcomes in humans, the E-Selectin molecule that we are using is a membrane-bound protein. This protein is therefore less susceptible to degradation and can be administered locally, potentially enhancing its effectiveness.

Furthermore, the use of AAV represents a new era in gene therapy compared to adenovirus and naked plasmids. AAV is associated with fewer systemic effects, reduced immunogenicity, and lower risks of cancer and inflammation. AAV2 was very recently approved for vision loss gene therapy.

Lastly, we have employed next-generation techniques such as codon optimization, resulting in enhanced results compared to wild-type constructs. These factors collectively contribute to our optimism regarding the efficacy of this novel therapy.

Dr. K. Craig Kent (Charlottesville, VA)

Great answer, and fingers crossed.

Response from Francesca Voza

Thank you so much, Dr. Kent.

Dr. Steven Stain (Burlington, MA)

Dr. Fong?

Dr. Yuman Fong (Duarte, CA)

Wonderful work and it is an exciting time in American medicine because gene surgery is here. As you know, AAV-based gene surgery for sickle cell disease just got approved by the FDA. We will have treatments for many more diseases coming forth. These AAVs are really the gene scalpels that we’re about to use for gene surgery, and my question for you is based on that. Why AAV-2? There are capsids that are much more muscle-tropic, and there are ones that are much less off-target.

And then my other question for you is, have you tried cardiotropic AAVs to try to revascularize hearts, especially in diabetics, using the same kind of technology? Revascularization and microrevascularization is what you’re about to do. I’m just asking you about your gene scalpels and whether you have chosen the best one for the job.

Response from Francesca Voza

Thank you for your question, Dr. Fong. In our laboratory, we have experimented with various AAVs, including AAV-9, in addition to AAV-2. My previous colleagues were the one who dedicated considerable effort to testing these different vectors.

Among these, AAV-2 demonstrated the most potent efficacy. Moreover, AAV-2 is currently FDA-approved and offers broad tropism, with the potential to affect multiple tissues. This versatility contributes to its widespread use in gene therapy applications.

Our therapy is directed toward PADs, and we have therefore not explored cardiotropic AAVs. Expanding our therapy beyond critical limb-threatening ischemia (CLTI) could certainly yield valuable insights and broaden the scope of our research.

Dr. Steven Stain (Burlington, MA)

Thank you very much.

Response from Francesca Voza

Thank you so much.

The animal study was reviewed and approved by the University of Miami Institutional Animal Care and Use Committee under protocol #20-096.

Supported by grants from the National Institutes of Health— NIH/NHLBI Catalyze R61 HL156152and NIH/NHLBI Catalyze R33 HL156141; Philanthropy: Eloise & David Kimmelman Foundation. The animal study was reviewed and approved by the University of Miami Institutional Animal Care and Use Committee under protocol #20-096.

F.A.V, Z.J.L., and O.C.V.: study conception and design; all authors except B.J.B.: acquisition of data; all authors except B.J.B.: analysis and interpretation of data; B.J.B.: AAV Vector Manufacturing.

Z.J.L. and O.C.V. declare the following potential conflicts of interest with respect to the research, authorship, and/or presentation and/or publication of some aspects of this work: the E-Selectin gene modification technologies were developed in our research laboratory and patented/licensed by the University of Miami. O.C.V. and Z.J.L. are co-inventors of this technology. This technology is fully owned by University of Miami and is Licensed with exclusivity to Ambulero Inc. This technology is currently under preclinical development by Ambulero Inc., a new incubator company spin out from the University of Miami that focuses on developing new vascular treatments for ischemic tissue conditions, wound healing, and limb salvage. Co-authors, Z.J.L. and O.C.V., serve as consultants and chief scientific and medical advisory officers to Ambulero Inc.; are co-inventors of the technologies; and are minority shareholders in Ambulero Inc. Co-authors, Z.J.L. and O.C.V. are also funded for this work by the NIH/NHLBI and Philanthropy (Eloise & David Kimmelman Foundation) in ongoing preclinical investigations of these technologies. The remaining authors report no conflicts of interest.

Supplemental Digital Content is available for this article. Direct URL citations are provided in the HTML and PDF versions of this article on the journal’s website, www.annalsofsurgery.com.
==== Refs
REFERENCES

1 Shah AJ Pavlatos N Kalra DK . Preventive therapies in peripheral arterial disease. Biomedicines. 2023;11 :3157.38137379
2 Nehler MR Duval S Diao L . Epidemiology of peripheral arterial disease and critical limb ischemia in an insured national population. J Vasc Surg. 2014;60 :686–95.e2.24820900
3 Fowkes FGR Rudan D Rudan I . Comparison of global estimates of prevalence and risk factors for peripheral artery disease in 2000 and 2010: a systematic review and analysis. Lancet. 2013;382 :1329–1340.23915883
4 Webster KA . Translational relevance of advanced age and atherosclerosis in preclinical trials of biotherapies for peripheral artery disease. Genes. 2024;15 :135.38275616
5 Powell RJ . Update on clinical trials evaluating the effect of biologic therapy in patients with critical limb ischemia. J Vasc Surg. 2012;56 :264–266.22633422
6 Eelen G de Zeeuw P Treps L . Endothelial cell metabolism. Physiol Rev. 2018;98 :3–58.29167330
7 Kusumanto YH van Weel V Mulder NH . Treatment with intramuscular vascular endothelial growth factor gene compared with placebo for patients with diabetes mellitus and critical limb ischemia: a double-blind randomized trial. Hum Gene Ther. 2006;17 :683–691.16776576
8 Comerota AJ Throm RC Miller KA . Naked plasmid DNA encoding fibroblast growth factor type 1 for the treatment of end-stage unreconstructible lower extremity ischemia: preliminary results of a phase I trial. J Vasc Surg. 2002;35 :930–936.12021709
9 Belch J Hiatt WR Baumgartner I . Effect of fibroblast growth factor NV1FGF on amputation and death: a randomised placebo-controlled trial of gene therapy in critical limb ischaemia. Lancet. 2011;377 :1929–1937.21621834
10 Powell RJ Simons M Mendelsohn FO . Results of a double-blind, placebo-controlled study to assess the safety of intramuscular injection of hepatocyte growth factor plasmid to improve limb perfusion in patients with critical limb ischemia. Circulation. 2008;118 :58–65.18559703
11 Aitken ML Moss RB Waltz DA . A phase I study of aerosolized administration of tgAAVCF to cystic fibrosis subjects with mild lung disease. Hum Gene Ther. 2001;12 :1907–1916.11589832
12 Muramatsu S-I Fujimoto K-I Kato S . A phase I study of aromatic L-amino acid decarboxylase gene therapy for Parkinson’s disease. Mol Ther. 2010;18 :1731–1735.20606642
13 Koilkonda RD Yu H Chou T-H . Safety and effects of the vector for the Leber hereditary optic neuropathy gene therapy clinical trial. JAMA Ophthalmol. 2014;132 :409–420.24457989
14 Issa SS Shaimardanova AA Solovyeva VV . Various AAV serotypes and their applications in gene therapy: an overview. Cells. 2023;12 :785.36899921
15 Office of the Commissioner. FDA approves novel gene therapy to treat patients with a rare form of inherited vision loss. In: Fischer A, ed. US Food and Drug Administration.. FDA; 2020.
16 Ales E Sackstein R . The biology of E-selectin ligands in leukemogenesis. Adv Cancer Res. 2023;157 :229–250.36725110
17 Liu Z-J Tian R Li Y . SDF-1α-induced dual pairs of E-selectin/ligand mediate endothelial progenitor cell homing to critical ischemia. Sci Rep. 2016;6 :34416.27713493
18 Kavurma MM Bursill C Stanley CP . Endothelial cell dysfunction: implications for the pathogenesis of peripheral artery disease. Front Cardiovasc Med. 2022;9 :1054576.36465438
19 Liu Z-J Tian R An W . Identification of E-selectin as a novel target for the regulation of postnatal neovascularization: implications for diabetic wound healing. Ann Surg. 2010;252 :625–634.20881769
20 Parikh PP Lassance-Soares RM Shao H . Intramuscular E-selectin/adeno-associated virus gene therapy promotes wound healing in an ischemic mouse model. J Surg Res. 2018;228 :68–76.29907232
21 Quiroz HJ Parikh PP Lassance-Soares RM . Gangrene, revascularization, and limb function improved with E-selectin/adeno-associated virus gene therapy. JVS Vasc Sci. 2021;2 :20–32.34617055
22 Huerta CT Voza FA Ortiz YY . Mesenchymal stem cell-based therapy for non-healing wounds due to chronic limb-threatening ischemia: a review of preclinical and clinical studies. Front Cardiovasc Med. 2023;10 :1113982.36818343
23 Liu Z-J Daftarian P Kovalski L . Directing and potentiating stem cell-mediated angiogenesis and tissue repair by cell surface E-selectin coating. PLoS One. 2016;11 :e0154053.27104647
24 Ribieras AJ Ortiz YY Li Y . E-Selectin/AAV2/2 gene therapy alters angiogenesis and inflammatory gene profiles in mMouse gangrene model. Front Cardiovasc Med. 2022;9 :929466.35783833
25 Parikh PP Castilla D Lassance-Soares RM . A reliable mouse model of hindlimb gangrene. Ann Vasc Surg. 2018;48 :222–232.29197603
26 Grieger JC Soltys SM Samulski RJ . Production of recombinant adeno-associated virus vectors using suspension HEK293 cells and continuous harvest of vector from the culture media for GMP FIX and FLT1 clinical vector. Mol Ther. 2016;24 :287–297.26437810
27 Wright JF . Manufacturing and characterizing AAV-based vectors for use in clinical studies. Gene Ther. 2008;15 :840–848.18418418
28 Aref Z de Vries MR Quax PHA . Variations in surgical procedures for inducing hindlimb ischemia in mice and the iImpact of these variations on neovascularization assessment. Int J Mol Sci. 2019;20 :3704.31362356
29 Ribieras AJ Ortiz YY Li Y . E-Selectin/AAV gene therapy promotes myogenesis and skeletal muscle recovery in a mouse hindlimb ischemia model. Cardiovasc Ther. 2023;2023 :6679390.37251271
30 Hochberg Y Benjamini Y . More powerful procedures for multiple significance testing. Stat Med. 1990;9 :811–818.2218183
31 Ribieras AJ Ortiz YY Shrestha S . High-resolution three-dimensional imaging of the footpad vasculature in a murine hindlimb gangrene model. J Vis Exp. 2022. doi:10.3791/63284.
32 Yu J Dardik A . A murine model of hind limb ischemia to study angiogenesis and arteriogenesis. Methods Mol Biol. 2018;1717 :135–143.29468589
33 Li Y Song Y Zhao L . Direct labeling and visualization of blood vessels with lipophilic carbocyanine dye DiI. Nat Protoc. 2008;3 :1703–1708.18846097
34 Chalothorn D Clayton JA Zhang H . Collateral density, remodeling, and VEGF-A expression differ widely between mouse strains. Physiol Genomics. 2007;30 :179–191.17426116
35 Huerta CT Ortiz YY Li Y . Novel gene-modified mesenchymal stem cell therapy reverses impaired wound healing in ischemic limbs. Ann Surg. 2023;278 :383–395.37334717
36 Lapteva L Purohit-Sheth T Serabian M . Clinical development of gene therapies: the first three decades and counting. Mol Ther Methods Clin Dev. 2020;19 :387–397.33209964
37 Buhr F Jha S Thommen M . Synonymous codons direct cotranslational folding toward different protein conformations. Mol Cell. 2016;61 :341–351.26849192
38 Alexaki A Hettiarachchi GK Athey JC . Effects of codon optimization on coagulation factor IX translation and structure: implications for protein and gene therapies. Sci Rep. 2019;9 :1–15.30626917
39 Starikova AV Skopenkova VV Polikarpova AV . Therapeutic potential of highly functional codon-optimized microutrophin for muscle-specific expression. Sci Rep. 2022;12 :848.35039573
40 Dreismann AK McClements ME Barnard AR . Functional expression of complement factor I following AAV-mediated gene delivery in the retina of mice and human cells. Gene Ther. 2021;28 :265–276.33750925
41 Paremskaia AI Kogan AA Murashkina A . Codon-optimization in gene therapy: promises, prospects and challenges. Front Bioeng Biotechnol. 2024;12 :1371596.38605988
42 Koblan LW Doman JL Wilson C . Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction. Nat Biotechnol. 2018;36 :843–846.29813047
43 U.S. Department of Health and Human Services Food and Drug Administration, Center for Biologics Evaluation and Research June 2015. Considerations for the Design of Early-Phase Clinical Trials of Cellular and Gene Therapy Products. Guidance for Industry. Accessed March 2, 2024. https://www.fda.gov/media/106369/download
44 Tang F Wong H Ng CM . Rational clinical dose selection of adeno-associated virus-mediated gene therapy based on allometric principles. Clin Pharmacol Ther. 2021;110 :803–807.33884615
45 Howard DB Harvey BK . Assaying the stability and inactivation of AAV serotype 1 vectors. Hum Gene Ther Methods. 2017;28 :39–48.28192678
