
==== Front
BMC Res Notes
BMC Res Notes
BMC Research Notes
1756-0500
BioMed Central London

39237963
6907
10.1186/s13104-024-06907-4
Research Note
Prebiotic effects of commercial apple juice in high-fat diet fed rat
Kon Risako 1
Ikarashi Nobutomo ikarashi@hoshi.ac.jp

1
Ohkuma Mayumi 1
Toyonaga Misato 1
Tomimoto Rei 1
Sakai Hiroyasu 1
Hosoe Tomoo 1
Kamei Junzo 2
1 https://ror.org/01mrvbd33 grid.412239.f 0000 0004 1770 141X Department of Biomolecular Pharmacology, Hoshi University, 2-4-41 Ebara, Shinagawa-ku, Tokyo, 142-8501 Japan
2 https://ror.org/01692sz90 grid.258269.2 0000 0004 1762 2738 Juntendo Advanced Research institute for Health Science, Juntendo University, Bunkyo City, Japan
5 9 2024
5 9 2024
2024
17 2491 3 2024
21 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Objectives

Apples are one of the most frequently consumed fruits and are effective in preventing lifestyle-related and other diseases. However, few studies have been conducted to evaluate health benefits of processed apple products such as juice. In this study, we analyzed the health benefits of consuming apple juice, focusing on changes in the gut microbiota, which plays an important role in maintaining human health.

Results

Rats were fed apple juice ad libitum, and the relative abundances of various gut microbiota in fecal samples were analyzed. In addition, rats treated apple juice were fed with a high-fat diet, and body weight, plasma triglyceride, glucose, and cholesterol levels were measured. The relative abundance of Clostridium cluster XIV did not change with the treatment of apple juice, but the relative abundance of Clostridium cluster IV was significantly decreased. In contrast, the relative abundances of Lactobacillus and Bifidobacterium, which provide benefits to the human body, were significantly increased by 3-fold and 10-fold, respectively, with apple juice consumption. When apple juice-treated rats were fed a high-fat diet, the increase in body weight, liver fat, and blood lipid parameters were all suppressed compared to high-fat alone group.

Conculusion

This study suggests that the consumption of apple juice changes the gut microbiota, exerts a prebiotic effect, and is effective in improving lifestyle-related diseases.

Keywords

Apple juice
Gut microbiota
Lactobacillus
Bifidobacterium
Prebiotic effect
Obesity
Lotte Shigemitsu Prizeissue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

In recent years, with the westernization of diet and changes in the social environment, the number of patients with lifestyle-related diseases has steadily increased. Since lifestyle-related diseases can lead to death if left untreated, their prevention and treatment have become important issues.

At present, food is gaining attention as a means of maintaining good health. In particular, the consumption of fruit is presumed to have health benefits. Apples (Malus domestica Borkh.) are consumed in large quantities. In recent years, the health effects of apples have been scientifically verified, and it has become clear that they are effective in preventing lifestyle-related diseases. For example, polyphenols and dietary fiber in apples have been reported to have antihyperlipidemic effects [1–3], antidiabetic effects [4–6], and intestinal function regulation [7, 8]. It has also been suggested that apple polyphenols may be able to alter gut microbiota, which could be used to prevent and treat diseases [9].

On the other hand, apples have many processed products, such as juice. Since these processed products contain the components of fresh apples, they can be expected to have the same health benefits as apples, but there is little scientific evidence for this. In this study, we conducted basic research on the effect of consuming commercially available apple juice. We focused on the gut microbiota, which plays an important role in maintaining human health, and assessed changes in the gut microbiota associated with apple juice consumption. We also examined the effects of apple juice on rats fed a high-fat diet.

Materials and methods

Apple juice

In this study, we used two commercial apple juice products made from different cultivars, namely, “Malus domestica Borkh. cv Tsugaru” or “Malus domestica Borkh. cv Fuji” (Shiny Apple®; Aomoriken Ringo Juice Co. Ltd., Aomori, Japan). These are 100% apple juices that have not been heat treated or filtered during the manufacturing process. These are referred to as apple juice T (AJ-T) and apple juice F (AJ-F), respectively.

Animals

Wistar rats were purchased from Japan SLC Co., Ltd. (Shizuoka, Japan). The rats were subjected to experiments following 1 week of acclimatization. Animals were kept at 24 ± 1 °C and 55 ± 15% humidity on a 12 h light/dark cycle (lights on at 8:00 A.M.). This experiment was conducted with approval from Hoshi University (approval number: 29–103 and 29–154).

Treatments

Experiment 1; The rats (seven weeks old, male) were divided into 3 groups and given purified water, AJ-T, or AJ-F freely for 2 weeks. The animals were sacrificed under deep anesthesia with overdose isoflurane inhalation, and the white adipose tissues were removed and weighed. The feces were collected from the large intestine and frozen at -80 °C. Blood was collected using a heparinized syringe, and plasma was separated (1,000×g, 15 min, 4 °C).

Experiment 2; Three weeks old rats were divided into four groups: a control group, a high-fat diet group (HF group), AJ-T/HF, or AJ-F/HF group. The control group was given a control diet (D12450J, 10 kcal% fat, Research Diets, New Brunswick, NJ, USA) and purified water ad libitum during the experimental period. The HF group was given a control diet and purified water ad libitum for 3 weeks from the age of 3 weeks, and then given a high-fat diet (D12492, 60 kcal% fat, Research Diets) for 16 weeks. The AJ-T/HF or AJ-F/HF group was given a control diet and AJ-T or AJ-F ad libitum for 3 weeks from the age of 3 weeks, and then a high-fat diet for 16 weeks. The animals were sacrificed under deep anesthesia with overdose isoflurane inhalation, and the white adipose tissues and liver were removed and weighed. Blood was collected using a heparinized syringe, and plasma was separated.

Measurement of plasma glucose, triglyceride, and cholesterol levels

Plasma glucose, triglyceride, and cholesterol levels were measured using the Glucose C-II-Test Wako, Triglyceride E-Test Wako, and Cholesterol E-Test Wako, respectively (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Each plasma concentrations were calculated based on the standard samples provided with the kit.

Glucose; A 2 µL of plasma was placed in a 96-well plate, and 200 µL of reaction reagent (included in the kit) was added. After shaking, the plate was incubated at 37 °C for 15 min, and the absorbance was measured using a microplate reader.

Triglyceride; A 2 µL of plasma was placed in a 96-well plate, and 200 µL of reaction reagent (included in the kit) was added. After shaking, the plate was incubated at 37 °C for 5 min, and the absorbance was measured using a microplate reader.

Cholesterol; A 2 µL of plasma was placed in a 96-well plate, and 200 µL of reaction reagent (included in the kit) was added. After shaking, the plate was incubated at 37 °C for 5 min, and the absorbance was measured using a microplate reader.

Analysis of the gut microbiota

Extraction of bacterial DNA from fecal samples was performed using the QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany). The quality of extracted DNA was analyzed by the absorbance ratio of 260 nm to 280 nm using NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). A 260/280 ratio of all samples was within the range of 1.8 to 2.1. The primers shown in Table 1 were prepared, and real-time PCR was performed to detect bacteria. Briefly, SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories Inc., Hercules, CA, USA), forward primer, reverse primer, and DNA solution were added to each well of the PCR plate and mixed. Fluorescence intensity during the amplification process was monitored with a CFX Connect Real-Time PCR System (Bio-Rad Laboratories Inc.). The temperature conditions were as follows: 95 °C for 30 s as the denaturation temperature, 58 °C for 30 s as the annealing temperature, and 72 °C for 60 s as the elongation temperature. Bacterial 16S rRNA gene copies were determined by real-time PCR using universal bacterial primer sequences and normalized to total DNA.

Table 1 PCR primers for the detection of bacteria

Target	Forward Primer (5’ to 3’)	Reverse Primer (5’ to 3’)	
Firmicutes[35]	TGAAACTYAAAGGAATTGACG	ACCATGCACCACCTGTC	
Bacteroidetes[36]	GGGGTTCTGAGAGGAAGGT	CCGTCATCCTTCACGCTACT	
Proteobacteria[37]	CATGACGTTACCCGCAGAAGAAG	CTCTACGAGACTCAAGCTTGC	
Actinobacteria[38]	TGTAGCGGTGGAATGCGC	AATTAAGCCACATGCTCCGCT	
Clostridium cluster IV [39]	GCACAAGCAGTGGAGT	CTTCCTCCGTTTTGTCAA	
Clostridium cluster XIV [40]	GAWGAAGTATYTCGGTATGT	CTACGCWCCCTTTACAC	
Bifidobacterium[41]	GCGTGCTTAACACATGCAAGTC	CACCCGTTTCCAGGAGCTATT	
Lactobacillus[42]	TGGAAACAGRTGCTAATACCG	GTCCATTGTGGAAGATTCCC	
L. reuteri[43]	CAGACAATCTTTGATTGTTTAG	GCTTGTTGGTTTGGGCTCTTC	
L. acidophilus[44]	AGAGGTAGTAACTGGCCTTTA	GCGGAAACCTCCCAACA	
L. johnsonii[45]	CACTAGACGCATGTCTAGAG	AGTCTCTCAACTCGGCTATG	
16S rRNA [46]	TCCTACGGGAGGCAGCAGT	GGACTACCAGGGTATCTAATCCTGTT	

Measurement of liver triglyceride content

A portion (100 mg) of liver tissue was homogenized in phosphate buffer saline. The homogenate was extracted with isopropyl alcohol, and the extract was analyzed using a Triglyceride E-Test Wako to determine liver triglyceride content.

Statistical analysis

Experimental values are expressed as the mean ± standard deviation (S.D.). The statistical significance of differences was evaluated by one-way analysis of variance followed by Dunnett’s test or Tukey’s test. All analyses were performed using BellCurve for Excel (Social Survey Research Information Co., Ltd., Tokyo, Japan). A p value of less than 0.05 was considered statistically significant.

Results

Effects of apple juice consumption on body weight and white adipose tissue weight

Body weight and white adipose tissue weight were measured after drinking AJ-T or AJ-F for 2 weeks (Table 2).

Table 2 Body weight and white adipose tissue weight

	Normal	AJ-T	AJ-F	
Body weight (g)	232.3 ± 6.3	233.0 ± 4.3	238.6 ± 12.3	
White adipose tissue	8.5 ± 0.7	8.5 ± 1.1	8.4 ± 0.9	
 Epididymal WAT (g)	3.8 ± 0.5	3.5 ± 0.5	3.5 ± 0.4	
 Retroperitoneal WAT (g)	1.9 ± 0.3	2.2 ± 0.4	2.2 ± 0.3	
 Perirenal WAT (g)	2.9 ± 0.3	2.8 ± 0.3	2.7 ± 0.4	
Rats were given purified water, AJ-T, or AJ-F ad libitum for 2 weeks. The body weight and weight of epididymal, retroperitoneal, and perirenal white adipose tissue (WAT) were measured (mean ± S.D., n = 6)

The body weights of both the AJ-T-treated and AJ-F-treated groups were almost the same as those of the normal group. The epididymal white adipose tissue weight of the AJ-T-treated group was almost the same as that of the normal group. In addition, no difference was observed between the AJ-T-treated group and the normal group in the weight of retroperitoneal and perirenal white adipose tissue. Furthermore, in the AJ-F-treated group as well as in the AJ-T-treated group, there was no change in white adipose tissue weight.

These results showed that the intake of apple juice for 2 weeks had no effect on body weight or white adipose tissue weight.

Plasma glucose levels, triglyceride levels, and cholesterol levels

Plasma glucose levels, triglyceride levels, and cholesterol levels after administration of apple juice were measured (Table 3).

Table 3 Plasma glucose levels, triglyceride levels, and cholesterol levels

	Normal	AJ-T	AJ-F	
Glucose level (mg/dL)	149.0 ± 9.9	139.7 ± 7.5	137.9 ± 20.1	
Triglyceride level (mg/dL)	208.6 ± 20.7	213.9 ± 29.7	191.8 ± 27.9	
Cholesterol level (mg/dL)	80.2 ± 14.1	81.0 ± 10.4	84.9 ± 11.3	
Rats were given purified water, AJ-T, or AJ-F ad libitum for 2 weeks. After treatment, blood was collected, and plasma glucose, triglyceride, and cholesterol levels were measured (mean ± S.D., n = 6)

The plasma glucose concentration of the AJ-T-treated group was almost the same as that of the normal group. In addition, no difference was observed between the AJ-T-treated group and the normal group in plasma triglyceride or cholesterol concentrations. Furthermore, in the AJ-F-treated group, as in the AJ-T-treated group, there was no change in the plasma glucose, triglyceride, or cholesterol concentrations.

These results showed that the intake of apple juice for 2 weeks did not affect plasma glucose, triglyceride, or cholesterol levels.

Analysis of the gut microbiota at the phylum level

The gut microbiota is classified by phylum, class, order, family, genus, and species. 99% of the gut microbiota in humans belongs to four phyla: Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria [10]. Therefore, we analyzed how the gut microbiota of rats changed in response to apple juice consumption at the phylum level (Fig. 1).

Fig. 1 Analysis of the gut microbiota at the phylum level. Rats were given purified water, AJ-T, or AJ-F ad libitum for 2 weeks. After treatment, DNA was extracted from fecal samples, and the phyla Bacteroidetes, Proteobacteria, Actinobacteria, and Firmicutes were analyzed by real-time PCR. The relative abundance of the gut microbiota was normalized to 16S rRNA, and the average value of the normal group was shown as 100% (mean ± S.D., n = 6, *; p < 0.05 vs. normal group)

There was no difference between the normal group and the apple juice-treated groups in the phyla Bacteroidetes and Proteobacteria. The treatment of AJ-T or AJ-F increased the relative abundance of the phylum Actinobacteria. On the other hand, it was found that the relative abundance of the phylum Firmicutes was significantly decreased by the consumption of AJ-T and AJ-F compared to the normal group.

Analysis of Clostridium cluster IV and XIV

Apple juice treatment decreased the relative abundance of the phylum Firmicutes (Fig. 1). It is known that the genus Clostridium in the phylum Firmicutes is involved in the development of lifestyle-related diseases [11, 12]. Therefore, we investigated how the intake of apple juice changes the relative abundance of the bacterium Clostridium (Fig. 2).

Fig. 2 Analysis of Clostridium cluster IV and XIV, Lactobacillus, and Bifidobacterium. Rats were given purified water, AJ-T, or AJ-F ad libitum for 2 weeks. After treatment, DNA was extracted from fecal samples, and Clostridium cluster IV, Clostridium cluster XIV, Lactobacillus genus, Bifidobacterium genus, L. reuteri, L. acidophilus, and L. johnsonii were analyzed by real-time PCR. The relative abundance of the gut microbiota was normalized to 16S rRNA, and the average value of the normal group was shown as 100% (mean ± S.D., n = 6, *; p < 0.05, **; p < 0.01 vs. normal group)

The treatment of AJ-T and AJ-F to rats for 2 weeks significantly decreased the relative abundance of Clostridium cluster IV compared to the normal group (Fig. 2). On the other hand, Clostridium cluster XIV showed no change in either apple juice treatment.

Analysis of Lactobacillus and Bifidobacterium

Gut microbiota are known to provide benefits to the host. Some of these bacterial strains are used as probiotics, and representative examples include the genera Lactobacillus and Bifidobacterium [13–15]. Therefore, we investigated how the relative abundances of Lactobacillus and Bifidobacterium change with apple juice intake (Fig. 2).

The relative abundance of Lactobacillus genus in the AJ-T-treated group was significantly higher than that in the normal group by approximately 3 times. L. reuteri, a representative useful bacterium, was not changed by AJ-T treatment. However, the relative abundances of L. acidophilus and L. johnsonii were significantly increased by treatment of AJ-T compared to the normal group. In addition, the relative abundance of Bifidobacterium genus in the AJ-T-treated group was significantly increased by approximately 10 times compared to that in the normal group. These changes were also observed in the AJ-F-treated group.

Effects of apple juice on body weight gain in high-fat fed rats

From these results, it was clarified that the gut microbiota involved in lifestyle-related diseases were altered due to consumption apple juice. Therefore, we investigated the effects of apple juice on body weight in high-fat diet fed rats (Fig. 3).

Fig. 3 Body weight and white adipose tissue weight. Rats were given HF diet and purified water, AJ-T, or AJ-F (A). Body weight (B) and the whole white adipose tissue (C) were measured (mean ± S.D., n = 5–6, ***; p < 0.001 vs. control group, #; p < 0.05, ###; p < 0.001 vs. HF group)

The body weight of the rats fed with a high-fat diet for 16 weeks increased compared to the control group, and the body weight on the final day was about 1.2 times that of the control group. The white adipose tissue weight in the HF group also showed significantly higher than those in the control group. In contrast, the body weight and white adipose tissue weight in the AJ-T/HF group, which was given AJ-T before HF treatment, were all significantly lower than those in the HF group. Furthermore, the same tendency as the AJ-F/HF group was observed in the AJ-F/HF group as well.

These results indicate that pre-consumption of apple juice suppresses weight gain induced by a high-fat diet.

Effects of apple juice on liver fat accumulation and lipid metabolism in high-fat fed rats

We investigated the preventive effects of apple juice on liver fat accumulation, blood glucose, triglyceride, and cholesterol levels in rats fed a high-fat diet (Fig. 4).

Fig. 4 Liver weight, triglyceride contents, plasma glucose, triglyceride, and cholesterol levels. Rats were given HF diet and purified water, AJ-T, or AJ-F. The liver weight (A) and triglyceride contents (B) were measured. Blood was collected, and plasma glucose (C), triglyceride (D), and cholesterol levels (E) were measured (mean ± S.D., n = 5–6, *; p < 0.05 vs. normal group, **; p < 0.01 vs. control group, #; p < 0.05 vs. HF group)

The liver weight and liver triglyceride content in HF group showed significantly higher than those in the control group. Moreover, blood glucose levels in the HF group were higher than those in the control group. In addition, although there was no difference in blood cholesterol concentration between the HF group and the control group, the blood triglyceride concentration was significantly higher. In contrast, the liver weight, liver triglyceride content, the blood glucose, and triglyceride concentrations in the AJ-T/HF or AJ-F/HF groups were significantly lower than those in the HF group.

These results indicated that pre-consumption of apple juice suppressed fatty liver and abnormalities in lipid metabolism induced by a high-fat diet.

Discussion

In this study, to investigate the health benefits of consuming commercially available apple juice, we analyzed changes in the gut microbiota. Normal rats were given two different types of apple juice for two weeks. These are 100% apple juices that have not been heat treated or filtered during the manufacturing process.

The human gut is home to an abundant and diverse community of bacteria; each person carries approximately 100 trillion bacterial cells, representing more than 1,000 different species [10]. The abundance of gut microbiota changes depending on diet [16–18] and drug intake [19–21]. In recent years, gut microbiota have been reported to change dynamically during the onset of ulcerative colitis [22], obesity [23, 24], and diabetes [25], and the importance of gut microbiota as a factor in the onset and exacerbation of these diseases has been highlighted. In addition, the involvement of gut microbiota in the development of skin diseases such as atopic dermatitis has been reported, and the role of the gut microbiota in the maintenance of skin function is attracting attention [26, 27]. Thus, the gut microbiota plays a very important role in maintaining human health. We focused on the genus Clostridium, which has been reported to be involved in metabolic diseases [11, 12], and the genera Lactobacillus and Bifidobacterium, which are useful gut microbiota that are used as probiotics [13–15], and analyzed the health effects of apple juice based on changes in the abundance of these genera. When apple juice was treated to normal rats, the relative abundance of gut microbiota at the phylum level changed greatly (Fig. 1). In addition, Clostridium cluster IV was significantly decreased by the apple juice treatment. In contrast, intake of apple juice markedly increased Lactobacillus genus by approximately 3-fold and the relative abundance of Bifidobacterium genus by approximately 10-fold (Fig. 2). However, no effect was observed on body weight, white adipose tissue weight, plasma glucose, triglyceride, or cholesterol concentration in the apple juice-treated groups (Tables 2 and 3).

We speculated that the reasons why apple juice intake did not affect body weight and blood lipid levels were that the administration period was short and that the study was conducted in normal rats. Based on the result of experiment 1, we next investigated the effect of apple juice on rats fed a high-fat diet [28, 29]. The body weight, white adipose tissue weight, liver triglyceride content, blood glucose concentration, and blood triglyceride concentration in the HF group were all significantly increased compared to the control group, and obesity, fatty liver, and dyslipidemia were induced. It was shown that both were significantly decreased in rats pretreated with apple juice (Figs. 3 and 4). There was little difference in food and water intakes between the HF group and apple juice treatment groups (data not shown). From the above results, it was clarified that although apple juice does not affect normal body weight or blood lipid levels, it has the effect of improving body weight gain and abnormal blood lipid levels due to HF intake. In addition, it was considered possible that this effect was due to a prebiotic effect.

Among Lactobacillus genus, the relative abundances of L. acidophilus and L. johnsonii were significantly increased by apple juice treatment (Fig. 2). These gut microbiota are reported to have various beneficial effects, including regulating the intestinal function and improving allergic diseases [30–32]. Also, anti-obesity effect has been reported as a probiotic effect of Lactobacillus strain or Bifidobacterium strain [33, 34]. In the future, we plan to demonstrate the health effects of apple juice using animal models.

In summary, treatment of apple juice to normal rats significantly changed the gut microbiota. In addition, prophylactic administration of apple juice may improve liver fat accumulation and lipid metabolism through prebiotic effects. Since apple juice is a readily available food, its prebiotic effects are of great interest. In the future, we believe that the value of human consumption of apple juice will be confirmed and its active ingredient discovered.

Acknowledgements

We thank Ms. Manami Ozaki for their technical assistance.

Author contributions

Data collection and analysis were performed by Risako Kon, Mayumi Ohkuma, Misato Toyonaga, and Rei Tomimoto. The first draft of the manuscript was written by Risako Kon and Nobutomo Ikarashi. The review and editing were performed by Hiroyasu Sakai, Tomoo Hosoe, and Junzo Kamei. All authors reviewed the manuscript.

Funding

This study was funded by the Lotte Shigemitsu Prize.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The research reported in this study involved rats. This animal experiment was conducted with approval and in accordance with the Hoshi University Guiding Principles for the Care and Use of Laboratory Animals (approval number: 29–103 and 29–154). This study is reported in accordance with ARRIVE guidelines.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Esmael OA Sonbul SN Kumosani TA Moselhy SS Hypolipidemic effect of fruit fibers in rats fed with high dietary fat Toxicol Ind Health 2015 31 3 281 8 10.1177/0748233712472526 23315090
Esmael OA, Sonbul SN, Kumosani TA, Moselhy SS. Hypolipidemic effect of fruit fibers in rats fed with high dietary fat. Toxicol Ind Health. 2015;31(3):281–8.23315090 10.1177/0748233712472526
2. Nagasako-Akazome Y Kanda T Ohtake Y Shimasaki H Kobayashi T Apple polyphenols influence cholesterol metabolism in healthy subjects with relatively high body mass index J Oleo Sci 2007 56 8 417 28 10.5650/jos.56.417 17898508
Nagasako-Akazome Y, Kanda T, Ohtake Y, Shimasaki H, Kobayashi T. Apple polyphenols influence cholesterol metabolism in healthy subjects with relatively high body mass index. J Oleo Sci. 2007;56(8):417–28.17898508 10.5650/jos.56.417
3. Osada K Suzuki T Kawakami Y Senda M Kasai A Sami M Dose-dependent hypocholesterolemic actions of dietary apple polyphenol in rats fed cholesterol Lipids 2006 41 2 133 9 10.1007/s11745-006-5081-y 17707979
Osada K, Suzuki T, Kawakami Y, Senda M, Kasai A, Sami M, et al. Dose-dependent hypocholesterolemic actions of dietary apple polyphenol in rats fed cholesterol. Lipids. 2006;41(2):133–9.17707979 10.1007/s11745-006-5081-y
4. Shoji T Yamada M Miura T Nagashima K Ogura K Inagaki N Chronic administration of apple polyphenols ameliorates hyperglycaemia in high-normal and borderline subjects: a randomised, placebo-controlled trial Diabetes Res Clin Pract 2017 129 43 51 10.1016/j.diabres.2017.03.028 28505543
Shoji T, Yamada M, Miura T, Nagashima K, Ogura K, Inagaki N, et al. Chronic administration of apple polyphenols ameliorates hyperglycaemia in high-normal and borderline subjects: a randomised, placebo-controlled trial. Diabetes Res Clin Pract. 2017;129:43–51.28505543 10.1016/j.diabres.2017.03.028
5. Ogura K Ogura M Shoji T Sato Y Tahara Y Yamano G Oral administration of Apple Procyanidins ameliorates insulin resistance via suppression of pro-inflammatory cytokine expression in Liver of Diabetic ob/ob mice J Agric Food Chem 2016 64 46 8857 65 10.1021/acs.jafc.6b03424 27792335
Ogura K, Ogura M, Shoji T, Sato Y, Tahara Y, Yamano G, et al. Oral administration of Apple Procyanidins ameliorates insulin resistance via suppression of pro-inflammatory cytokine expression in Liver of Diabetic ob/ob mice. J Agric Food Chem. 2016;64(46):8857–65.27792335 10.1021/acs.jafc.6b03424
6. Gorjanovic S, Micic D, Pastor F, Tosti T, Kalusevic A, Ristic S et al. Evaluation of Apple Pomace Flour obtained industrially by dehydration as a source of biomolecules with antioxidant, antidiabetic and Antiobesity effects. Antioxid (Basel). 2020;9(5).
7. Saito T Miyake M Toba M Okamatsu H Shimizu S Noda M Inhibition by apple polyphenols of ADP-ribosyltransferase activity of cholera toxin and toxin-induced fluid accumulation in mice Microbiol Immunol 2002 46 4 249 55 10.1111/j.1348-0421.2002.tb02693.x 12061627
Saito T, Miyake M, Toba M, Okamatsu H, Shimizu S, Noda M. Inhibition by apple polyphenols of ADP-ribosyltransferase activity of cholera toxin and toxin-induced fluid accumulation in mice. Microbiol Immunol. 2002;46(4):249–55.12061627 10.1111/j.1348-0421.2002.tb02693.x
8. Niwa T Nakao M Hoshi S Yamada K Inagaki K Nishida M Effect of dietary fiber on morphine-induced constipation in rats Biosci Biotechnol Biochem 2002 66 6 1233 40 10.1271/bbb.66.1233 12162543
Niwa T, Nakao M, Hoshi S, Yamada K, Inagaki K, Nishida M, et al. Effect of dietary fiber on morphine-induced constipation in rats. Biosci Biotechnol Biochem. 2002;66(6):1233–40.12162543 10.1271/bbb.66.1233
9. Wang X Liu F Cui Y Yin Y Li S Li X Apple Polyphenols extracts ameliorate high Carbohydrate Diet-Induced Body Weight Gain by regulating the gut microbiota and appetite J Agric Food Chem 2022 70 1 196 210 10.1021/acs.jafc.1c07258 34935369
Wang X, Liu F, Cui Y, Yin Y, Li S, Li X. Apple Polyphenols extracts ameliorate high Carbohydrate Diet-Induced Body Weight Gain by regulating the gut microbiota and appetite. J Agric Food Chem. 2022;70(1):196–210.34935369 10.1021/acs.jafc.1c07258
10. Sartor RB Microbial influences in inflammatory bowel diseases Gastroenterology 2008 134 2 577 94 10.1053/j.gastro.2007.11.059 18242222
Sartor RB. Microbial influences in inflammatory bowel diseases. Gastroenterology. 2008;134(2):577–94.18242222 10.1053/j.gastro.2007.11.059
11. Yamaguchi Y Adachi K Sugiyama T Shimozato A Ebi M Ogasawara N Association of Intestinal Microbiota with metabolic markers and Dietary habits in patients with type 2 diabetes Digestion 2016 94 2 66 72 10.1159/000447690 27504897
Yamaguchi Y, Adachi K, Sugiyama T, Shimozato A, Ebi M, Ogasawara N, et al. Association of Intestinal Microbiota with metabolic markers and Dietary habits in patients with type 2 diabetes. Digestion. 2016;94(2):66–72.27504897 10.1159/000447690
12. Respondek F Gerard P Bossis M Boschat L Bruneau A Rabot S Short-chain fructo-oligosaccharides modulate intestinal microbiota and metabolic parameters of humanized gnotobiotic diet induced obesity mice PLoS ONE 2013 8 8 e71026 10.1371/journal.pone.0071026 23951074
Respondek F, Gerard P, Bossis M, Boschat L, Bruneau A, Rabot S, et al. Short-chain fructo-oligosaccharides modulate intestinal microbiota and metabolic parameters of humanized gnotobiotic diet induced obesity mice. PLoS ONE. 2013;8(8):e71026.23951074 10.1371/journal.pone.0071026
13. Steenbergen L Sellaro R van Hemert S Bosch JA Colzato LS A randomized controlled trial to test the effect of multispecies probiotics on cognitive reactivity to sad mood Brain Behav Immun 2015 48 258 64 10.1016/j.bbi.2015.04.003 25862297
Steenbergen L, Sellaro R, van Hemert S, Bosch JA, Colzato LS. A randomized controlled trial to test the effect of multispecies probiotics on cognitive reactivity to sad mood. Brain Behav Immun. 2015;48:258–64.25862297 10.1016/j.bbi.2015.04.003
14. Papizadeh M Rohani M Nahrevanian H Javadi A Pourshafie MR Probiotic characters of Bifidobacterium and Lactobacillus are a result of the ongoing gene acquisition and genome minimization evolutionary trends Microb Pathog 2017 111 118 31 10.1016/j.micpath.2017.08.021 28826768
Papizadeh M, Rohani M, Nahrevanian H, Javadi A, Pourshafie MR. Probiotic characters of Bifidobacterium and Lactobacillus are a result of the ongoing gene acquisition and genome minimization evolutionary trends. Microb Pathog. 2017;111:118–31.28826768 10.1016/j.micpath.2017.08.021
15. Invernici MM Salvador SL Silva PHF Soares MSM Casarin R Palioto DB Effects of Bifidobacterium probiotic on the treatment of chronic periodontitis: a randomized clinical trial J Clin Periodontol 2018 45 10 1198 210 10.1111/jcpe.12995 30076613
Invernici MM, Salvador SL, Silva PHF, Soares MSM, Casarin R, Palioto DB, et al. Effects of Bifidobacterium probiotic on the treatment of chronic periodontitis: a randomized clinical trial. J Clin Periodontol. 2018;45(10):1198–210.30076613 10.1111/jcpe.12995
16. Tajima M Ikarashi N Igeta S Toda T Ishii M Tanaka Y Different diets cause alterations in the enteric environment and trigger changes in the expression of hepatic cytochrome P450 3A, a drug-metabolizing enzyme Biol Pharm Bull 2013 36 4 624 34 10.1248/bpb.b12-01005 23370405
Tajima M, Ikarashi N, Igeta S, Toda T, Ishii M, Tanaka Y, et al. Different diets cause alterations in the enteric environment and trigger changes in the expression of hepatic cytochrome P450 3A, a drug-metabolizing enzyme. Biol Pharm Bull. 2013;36(4):624–34.23370405 10.1248/bpb.b12-01005
17. Ikarashi N Ogawa S Hirobe R Kon R Kusunoki Y Yamashita M Epigallocatechin gallate induces a hepatospecific decrease in the CYP3A expression level by altering intestinal flora Eur J Pharm Sci 2017 100 211 8 10.1016/j.ejps.2017.01.022 28115221
Ikarashi N, Ogawa S, Hirobe R, Kon R, Kusunoki Y, Yamashita M, et al. Epigallocatechin gallate induces a hepatospecific decrease in the CYP3A expression level by altering intestinal flora. Eur J Pharm Sci. 2017;100:211–8.28115221 10.1016/j.ejps.2017.01.022
18. O’Keefe SJ Li JV Lahti L Ou J Carbonero F Mohammed K Fat, fibre and cancer risk in African americans and rural africans Nat Commun 2015 6 6342 10.1038/ncomms7342 25919227
O’Keefe SJ, Li JV, Lahti L, Ou J, Carbonero F, Mohammed K, et al. Fat, fibre and cancer risk in African americans and rural africans. Nat Commun. 2015;6:6342.25919227 10.1038/ncomms7342
19. Toda T Ohi K Kudo T Yoshida T Ikarashi N Ito K [Antibiotics suppress Cyp3a in the mouse liver by reducing lithocholic acid-producing intestinal flora] Yakugaku Zasshi 2009 129 5 601 8 10.1248/yakushi.129.601 19420891
Toda T, Ohi K, Kudo T, Yoshida T, Ikarashi N, Ito K, et al. [Antibiotics suppress Cyp3a in the mouse liver by reducing lithocholic acid-producing intestinal flora]. Yakugaku Zasshi. 2009;129(5):601–8.19420891 10.1248/yakushi.129.601
20. Maier L Pruteanu M Kuhn M Zeller G Telzerow A Anderson EE Extensive impact of non-antibiotic drugs on human gut bacteria Nature 2018 555 7698 623 8 10.1038/nature25979 29555994
Maier L, Pruteanu M, Kuhn M, Zeller G, Telzerow A, Anderson EE, et al. Extensive impact of non-antibiotic drugs on human gut bacteria. Nature. 2018;555(7698):623–8.29555994 10.1038/nature25979
21. Imhann F Bonder MJ Vich Vila A Fu J Mujagic Z Vork L Proton pump inhibitors affect the gut microbiome Gut 2016 65 5 740 8 10.1136/gutjnl-2015-310376 26657899
Imhann F, Bonder MJ, Vich Vila A, Fu J, Mujagic Z, Vork L, et al. Proton pump inhibitors affect the gut microbiome. Gut. 2016;65(5):740–8.26657899 10.1136/gutjnl-2015-310376
22. Nishida A Inoue R Inatomi O Bamba S Naito Y Andoh A Gut microbiota in the pathogenesis of inflammatory bowel disease Clin J Gastroenterol 2018 11 1 1 10 10.1007/s12328-017-0813-5 29285689
Nishida A, Inoue R, Inatomi O, Bamba S, Naito Y, Andoh A. Gut microbiota in the pathogenesis of inflammatory bowel disease. Clin J Gastroenterol. 2018;11(1):1–10.29285689 10.1007/s12328-017-0813-5
23. Trikha SRJ Lee DM Ecton KE Wrigley SD Vazquez AR Litwin NS Transplantation of an obesity-associated human gut microbiota to mice induces vascular dysfunction and glucose intolerance Gut Microbes 2021 13 1 1940791 10.1080/19490976.2021.1940791 34313540
Trikha SRJ, Lee DM, Ecton KE, Wrigley SD, Vazquez AR, Litwin NS, et al. Transplantation of an obesity-associated human gut microbiota to mice induces vascular dysfunction and glucose intolerance. Gut Microbes. 2021;13(1):1940791.34313540 10.1080/19490976.2021.1940791
24. Aron-Wisnewsky J Warmbrunn MV Nieuwdorp M Clement K Metabolism and metabolic disorders and the Microbiome: the intestinal microbiota Associated with obesity, lipid metabolism, and Metabolic Health-Pathophysiology and therapeutic strategies Gastroenterology 2021 160 2 573 99 10.1053/j.gastro.2020.10.057 33253685
Aron-Wisnewsky J, Warmbrunn MV, Nieuwdorp M, Clement K. Metabolism and metabolic disorders and the Microbiome: the intestinal microbiota Associated with obesity, lipid metabolism, and Metabolic Health-Pathophysiology and therapeutic strategies. Gastroenterology. 2021;160(2):573–99.33253685 10.1053/j.gastro.2020.10.057
25. Qin J Li Y Cai Z Li S Zhu J Zhang F A metagenome-wide association study of gut microbiota in type 2 diabetes Nature 2012 490 7418 55 60 10.1038/nature11450 23023125
Qin J, Li Y, Cai Z, Li S, Zhu J, Zhang F, et al. A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature. 2012;490(7418):55–60.23023125 10.1038/nature11450
26. Reddel S Del Chierico F Quagliariello A Giancristoforo S Vernocchi P Russo A Gut microbiota profile in children affected by atopic dermatitis and evaluation of intestinal persistence of a probiotic mixture Sci Rep 2019 9 1 4996 10.1038/s41598-019-41149-6 30899033
Reddel S, Del Chierico F, Quagliariello A, Giancristoforo S, Vernocchi P, Russo A, et al. Gut microbiota profile in children affected by atopic dermatitis and evaluation of intestinal persistence of a probiotic mixture. Sci Rep. 2019;9(1):4996.30899033 10.1038/s41598-019-41149-6
27. Ikarashi N, Fujitate N, Togashi T, Takayama N, Fukuda N, Kon R et al. Acacia Polyphenol ameliorates atopic dermatitis in Trimellitic Anhydride-Induced Model mice via changes in the gut microbiota. Foods. 2020;9(6).
28. Molina-Tijeras JA Diez-Echave P Vezza T Hidalgo-Garcia L Ruiz-Malagon AJ Rodriguez-Sojo MJ Lactobacillus fermentum CECT5716 ameliorates high fat diet-induced obesity in mice through modulation of gut microbiota dysbiosis Pharmacol Res 2021 167 105471 10.1016/j.phrs.2021.105471 33529749
Molina-Tijeras JA, Diez-Echave P, Vezza T, Hidalgo-Garcia L, Ruiz-Malagon AJ, Rodriguez-Sojo MJ, et al. Lactobacillus fermentum CECT5716 ameliorates high fat diet-induced obesity in mice through modulation of gut microbiota dysbiosis. Pharmacol Res. 2021;167:105471.33529749 10.1016/j.phrs.2021.105471
29. Mukai K Horike SI Meguro-Horike M Nakajima Y Iswara A Nakatani T Topical estrogen application promotes cutaneous wound healing in db/db female mice with type 2 diabetes PLoS ONE 2022 17 3 e0264572 10.1371/journal.pone.0264572 35271602
Mukai K, Horike SI, Meguro-Horike M, Nakajima Y, Iswara A, Nakatani T. Topical estrogen application promotes cutaneous wound healing in db/db female mice with type 2 diabetes. PLoS ONE. 2022;17(3):e0264572.35271602 10.1371/journal.pone.0264572
30. Nakata J Hirota T Umemura H Nakagawa T Kando N Futamura M Additive effect of Lactobacillus acidophilus L-92 on children with atopic dermatitis concomitant with food allergy Asia Pac Allergy 2019 9 2 e18 10.5415/apallergy.2019.9.e18 31089460
Nakata J, Hirota T, Umemura H, Nakagawa T, Kando N, Futamura M, et al. Additive effect of Lactobacillus acidophilus L-92 on children with atopic dermatitis concomitant with food allergy. Asia Pac Allergy. 2019;9(2):e18.31089460 10.5415/apallergy.2019.9.e18
31. Inoue R Nishio A Fukushima Y Ushida K Oral treatment with probiotic Lactobacillus johnsonii NCC533 (La1) for a specific part of the weaning period prevents the development of atopic dermatitis induced after maturation in model mice, NC/Nga Br J Dermatol 2007 156 3 499 509 10.1111/j.1365-2133.2006.07695.x 17300240
Inoue R, Nishio A, Fukushima Y, Ushida K. Oral treatment with probiotic Lactobacillus johnsonii NCC533 (La1) for a specific part of the weaning period prevents the development of atopic dermatitis induced after maturation in model mice, NC/Nga. Br J Dermatol. 2007;156(3):499–509.17300240 10.1111/j.1365-2133.2006.07695.x
32. Hrdy J Couturier-Maillard A Boutillier D Lapadatescu C Blanc P Prochazka J Oral supplementation with selected Lactobacillus acidophilus triggers IL-17-dependent innate defense response, activation of innate lymphoid cells type 3 and improves colitis Sci Rep 2022 12 1 17591 10.1038/s41598-022-21643-0 36266398
Hrdy J, Couturier-Maillard A, Boutillier D, Lapadatescu C, Blanc P, Prochazka J, et al. Oral supplementation with selected Lactobacillus acidophilus triggers IL-17-dependent innate defense response, activation of innate lymphoid cells type 3 and improves colitis. Sci Rep. 2022;12(1):17591.36266398 10.1038/s41598-022-21643-0
33. Wu T Sun M Liu R Sui W Zhang J Yin J Bifidobacterium longum subsp. Longum Remodeled Roseburia and phosphatidylserine levels and ameliorated intestinal disorders and liver metabolic abnormalities Induced by High-Fat Diet J Agric Food Chem 2020 68 16 4632 40 10.1021/acs.jafc.0c00717 32237746
Wu T, Sun M, Liu R, Sui W, Zhang J, Yin J, et al. Bifidobacterium longum subsp. Longum Remodeled Roseburia and phosphatidylserine levels and ameliorated intestinal disorders and liver metabolic abnormalities Induced by High-Fat Diet. J Agric Food Chem. 2020;68(16):4632–40.32237746 10.1021/acs.jafc.0c00717
34. Song W Song C Li L Wang T Hu J Zhu L Lactobacillus alleviated obesity induced by high-fat diet in mice J Food Sci 2021 86 12 5439 51 10.1111/1750-3841.15971 34859434
Song W, Song C, Li L, Wang T, Hu J, Zhu L, et al. Lactobacillus alleviated obesity induced by high-fat diet in mice. J Food Sci. 2021;86(12):5439–51.34859434 10.1111/1750-3841.15971
35. De Bacchetti T Aldred N Clare AS Burgess JG Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa J Microbiol Methods 2011 86 3 351 6 10.1016/j.mimet.2011.06.010 21704084
De Bacchetti T, Aldred N, Clare AS, Burgess JG. Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa. J Microbiol Methods. 2011;86(3):351–6.21704084 10.1016/j.mimet.2011.06.010
36. Siefring S Varma M Atikovic E Wymer L Haugland RA Improved real-time PCR assays for the detection of fecal indicator bacteria in surface waters with different instrument and reagent systems J Water Health 2008 6 2 225 37 10.2166/wh.2008.022 18209285
Siefring S, Varma M, Atikovic E, Wymer L, Haugland RA. Improved real-time PCR assays for the detection of fecal indicator bacteria in surface waters with different instrument and reagent systems. J Water Health. 2008;6(2):225–37.18209285 10.2166/wh.2008.022
37. Queipo-Ortuno MI Seoane LM Murri M Pardo M Gomez-Zumaquero JM Cardona F Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels PLoS ONE 2013 8 5 e65465 10.1371/journal.pone.0065465 23724144
Queipo-Ortuno MI, Seoane LM, Murri M, Pardo M, Gomez-Zumaquero JM, Cardona F, et al. Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels. PLoS ONE. 2013;8(5):e65465.23724144 10.1371/journal.pone.0065465
38. Matsuki T Watanabe K Fujimoto J Takada T Tanaka R Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces Appl Environ Microbiol 2004 70 12 7220 8 10.1128/AEM.70.12.7220-7228.2004 15574920
Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol. 2004;70(12):7220–8.15574920 10.1128/AEM.70.12.7220-7228.2004
39. Matsuki T Watanabe K Fujimoto J Miyamoto Y Takada T Matsumoto K Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces Appl Environ Microbiol 2002 68 11 5445 51 10.1128/AEM.68.11.5445-5451.2002 12406736
Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 2002;68(11):5445–51.12406736 10.1128/AEM.68.11.5445-5451.2002
40. Song Y Liu C Finegold SM Real-time PCR quantitation of clostridia in feces of autistic children Appl Environ Microbiol 2004 70 11 6459 65 10.1128/AEM.70.11.6459-6465.2004 15528506
Song Y, Liu C, Finegold SM. Real-time PCR quantitation of clostridia in feces of autistic children. Appl Environ Microbiol. 2004;70(11):6459–65.15528506 10.1128/AEM.70.11.6459-6465.2004
41. Penders J Vink C Driessen C London N Thijs C Stobberingh EE Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR FEMS Microbiol Lett 2005 243 1 141 7 10.1016/j.femsle.2004.11.052 15668012
Penders J, Vink C, Driessen C, London N, Thijs C, Stobberingh EE. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol Lett. 2005;243(1):141–7.15668012 10.1016/j.femsle.2004.11.052
42. Byun R Nadkarni MA Chhour KL Martin FE Jacques NA Hunter N Quantitative analysis of diverse Lactobacillus species present in advanced dental caries J Clin Microbiol 2004 42 7 3128 36 10.1128/JCM.42.7.3128-3136.2004 15243071
Byun R, Nadkarni MA, Chhour KL, Martin FE, Jacques NA, Hunter N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J Clin Microbiol. 2004;42(7):3128–36.15243071 10.1128/JCM.42.7.3128-3136.2004
43. Song Y Kato N Liu C Matsumiya Y Kato H Watanabe K Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA FEMS Microbiol Lett 2000 187 2 167 73 10856652
Song Y, Kato N, Liu C, Matsumiya Y, Kato H, Watanabe K. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol Lett. 2000;187(2):167–73.10856652
44. Malinen E Kassinen A Rinttila T Palva A Comparison of real-time PCR with SYBR Green I or 5’-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria Microbiol (Reading) 2003 149 Pt 1 269 77 10.1099/mic.0.25975-0
Malinen E, Kassinen A, Rinttila T, Palva A. Comparison of real-time PCR with SYBR Green I or 5’-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiol (Reading). 2003;149(Pt 1):269–77.10.1099/mic.0.25975-0
45. Furet JP Quenee P Tailliez P Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR Int J Food Microbiol 2004 97 2 197 207 10.1016/j.ijfoodmicro.2004.04.020 15541806
Furet JP, Quenee P, Tailliez P. Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR. Int J Food Microbiol. 2004;97(2):197–207.15541806 10.1016/j.ijfoodmicro.2004.04.020
46. Mohammadi T Pietersz RN Vandenbroucke-Grauls CM Savelkoul PH Reesink HW Detection of bacteria in platelet concentrates: comparison of broad-range real-time 16S rDNA polymerase chain reaction and automated culturing Transfusion 2005 45 5 731 6 10.1111/j.1537-2995.2005.04258.x 15847662
Mohammadi T, Pietersz RN, Vandenbroucke-Grauls CM, Savelkoul PH, Reesink HW. Detection of bacteria in platelet concentrates: comparison of broad-range real-time 16S rDNA polymerase chain reaction and automated culturing. Transfusion. 2005;45(5):731–6.15847662 10.1111/j.1537-2995.2005.04258.x
