
==== Front
J Cancer Res Clin Oncol
J Cancer Res Clin Oncol
Journal of Cancer Research and Clinical Oncology
0171-5216
1432-1335
Springer Berlin Heidelberg Berlin/Heidelberg

39237674
5935
10.1007/s00432-024-05935-8
Research
NR3C2 affects the proliferation and invasiveness of colon cancer cells through the Wnt/β-Catenin signaling pathway
Nie Ke 1
He Zhong-Jiang 2017110643@stu.cqmu.edu.cn

2
Kong Ling-Jun 2
1 Department of Laboratory Medicine, The People’s Hospital of Changshou District of Chongqing City, Chongqing, 401220 China
2 Gastrointestinal Surgery, The People’s Hospital of Yubei District of Chongqing City, Chongqing, 401120 China
5 9 2024
5 9 2024
2024
150 9 41123 7 2024
30 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Purpose

The aim of this study was to explore the potential correlation between the nuclear receptor subfamily 3 group C member 2 (NR3C2) and outcomes of colon cancer, along with the mechanisms underlying this association.

Method

mRNA (messenger RNA) data and clinical records pertaining to colon cancer were retrieved from The Cancer Genome Atlas (TCGA) database. The analysis of NR3C2 expression discrepancies between normal colon and tumor tissues was conducted using R software. In addition, we also studied the relationship between NR3C2 expression and prognosis, pathological parameters. The relative role of NR3C2 were further predicted through bioinformatics methods and receiver operating characteristic (ROC) curve was used to evaluate the diagnostic value of NR3C2 in colon cancer. Single-cell data from colon cancer samples in the GEO (Gene Expression Omnibus) database further investigated the mechanism of the lower survival associated with NR3C2 dysregulation. NR3C2 expression in three fresh colon cancer samples and their respective paracancer samples was determined. Furthermore, colon cancer cell models overexpressing NR3C2 and with knockdown NR3C2 were constructed by lentiviral vector transfection. Cell Counting Kit-8 assay, transplantation of tumors in nude mice and transwell assays were used to examine the proliferation, migration and invasion of colon cancer cells. The effect on the Wnt/β-catenin pathway, activities of cellular autophagy and cell apoptosis were examined by assessing the expression levels of several key proteins, including Bcl-2, Bax, and LC3.

Results

We found that NR3C2 was found a significantly lower level in colon cancer tissues than in adjacent tissues, which was associated with distant and lymphatic metastases, clinical stage, and poor clinical outcome, and it was an independent prognostic factor and potential marker of colon cancer. Single-cell transcriptome data identified the subset of circulating T and B cells with high expression of NR3C2, which is involved in TNF signaling pathway. Functional experiments show that downregulation of NR3C2 resultsed in the activation of the Wnt/β-catenin signaling pathway, and promotesd the proliferation and invasion of colon cancer cells while suppressing cell autophagy and apoptosis.

Conclusion

NR3C2 may regulate Wnt/β-catenin to affect the proliferation, invasion apoptosis and autophagy of colon cancer, and this axis is a potential target for the treatment of colon cancer.

Keywords

NR3C2
Colon cancer
Wnt/β-catenin
Proliferation
Invasion
the Chongqing Yubei District Science and Technology Planning ProjectNo. 2022 (Agricultural Cooperative) 16 He Zhong-Jiang issue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2024
==== Body
pmcIntroduction

Colon cancer is the third-most common disease-causing mortality due to oncology worldwide. A report suggested that global colon cancer cases may increase by 1.27 million from 2020 to 2024 (Sung et al. 2020). Early diagnosis of colon cancer and timely radical surgery can reduce the mortality of patients with colon cancer, and regular postoperative adjuvant systemic therapy can reduce the risk of recurrence and extend overall survival (Lin et al. 2021). Colon cancer poses a considerable challenge in early detection due to the absence of clear initial symptoms and concerns regarding the discomfort associated with colonoscopy, which ultimately leads to a dismal prognosis (Wu et al. 2020; Zhang et al. 2019).

The nuclear receptor subfamily 3, group C, member 2 (NR3C2), a component of Group C within the nuclear receptor subfamily (Kloet et al. 2000). This receptor modulates gene expression in response to corticosteroid hormones. High expression of NR3C2 is linked to inhibiting pancreatic cancer cell proliferation (Zhang et al. 2017). In pancreatic cancer, the expression of NR3C2 is downregulated by macrophage migration inhibitor-induced microRNA (miR)-301b, consequently activating the PI3K/AKT pathway and promoting cancer progression (Yang et al. 2016). Additionally, in liver cancer, NR3C2 expression is inhibited by miR-766, which contributes to liver cancer advancement (Yang et al. 2019). NR3C2 exhibits tumor growth inhibition properties in colon cancer by downregulating vascular endothelial growth factor A protein expression (Tiberio et al. 2013). Notably, two prior study suggested that NR3C2 plays a pivotal role in restraining colorectal cancer growth through its influence on glucose metabolism and AMPK phosphorylation (Liu et al. 2023) and that NR3C2 could reduce colon cancer cell proliferation, metastasis, migration and angiogenesis via downregulating the AKT/ERK pathway (Li and Xu 2022). However, the association of NR3C2 with Wnt/β-catenin signaling, a key pathway in colon cancer, and the role of NR3C2 in the colon tumor microenvironment have not been studied. The Wnt pathway activation is strongly associated with tumor development, particularly in colon cancer. Mutations in APC are often the primary triggers for colon cancer initiation, leading to the formation of precancerous adenomas that can progress to malignant tumors if left untreated (Parsons et al. 2021; Zhan et al. 2017). Notably, APC gene mutation activates the Wnt pathway in intestinal epithelial cells, contributing significantly to colon cancer cell proliferation. The potential connection between the Wnt pathway and NR3C2 in colon cancer remains to be elucidated (Fearon and Vogelstein 1990; Cancer Genome Atlas Network 2012). This study delves into NR3C2 in colon cancer and highlights its role in the Wnt signaling pathway, proposing its potential application in targeted colon cancer therapy.

Materials and methods

Microarray data acquisition

The Cancer Genome Atlas (TCGA) database (Weinstein et al. 2013) was employed to analyze the 385 patients with colonic carcinoma, including follow-up time, age, sex, T stage, lymphatic invasion, distant metastasis and clinical stage. A total of 359 patients who were followed up for ≥ 30 days were included in the analysis. TCGA colon cancer database, containing 480 colon tumor tissue samples and 41 samples from normal colon tissues, was used for the study. The tumor sequences of other 32 in TCGA database were also added to the repository. Differential gene analysis. The “Limma” package was used to analyze NR3C2 differential expression in colon tumor tissue versus normal tissue, and in para-cancerous and cancerous tissues from the same patient. The results were visualized using the “ggpubr” package. Differentially expressed genes were also obtained using this package. This screening identified genes that showed significant alterations in expression levels, highlighting their potential relevance under the specified experimental conditions.

Single-cell expression analysis

The data (GSM7844844) were pre-processed and analyzed to identify different cell populations and their expression profiles. Data processing involved quality control, normalization, and dimensionality reduction using the Seurat package (v3.1.5). The quality control steps included filtering cells with low gene counts and high mitochondrial gene content. Normalized data were used for clustering analysis to identify distinct cell populations. Visualization of the data was achieved using t-SNE and UMAP plots, and cell type annotation was performed based on known marker genes from literature and databases such as CellMarker and PanglaoDB.

Cell communication analysis

Cell communication analysis was performed using the CellChat package (v1.0.0). The normalized expression data from the scRNA-seq dataset (GEO accession number: GSM7844844) were used to construct cell communication networks. The ligand-receptor interactions were identified using the built-in database in CellChat. We calculated the communication probability and strength between different cell types. Major signaling pathways and communication patterns were analyzed and visualized using heatmaps and network plots. This analysis revealed the complex interactions within the tumor microenvironment, providing insights into the cellular crosstalk.

Cell lines and culture conditions

For the purpose of colon cancer investigation, RKO (human colon adenocarcinoma cell line) tumor cell were used. Cultivated in a high-glucose DMEM medium from Thermo Fisher Scientific, the cells were nourished with a 10% fetal bovine serum (FBS) mixture along with a cocktail of antibiotics. Both procured from the Beyotime Institute of Biotechnology, along with 2.5 ng/ml amphotericin B from Sangon Biotech Co., Ltd.

Oligonucleotide transfection

RKO cells were transfected with the Lipofectamine™3000 (Invitrogen). Sequences of NR3C2 shRNA were as follows: CCGG‐CCAGCTAAGATTTATCAGAAT‐CTCGAG‐ATTCTGATAAATCTTAGCTGG‐TTTTTT. Following the protocol provided by the manufacturer. The cells were spread at a concentration of 100,000 cells per well in 6-well plates in a 37 °C incubator with a 5% CO2 environment. The transfection process was conducted for 48 h at 37 °C. Western blot techniques were employed to assess the effectiveness of the shRNA in silencing NR3C2. For NR3C2 overexpression, NR3C2 pLV (Exp)-EGFP: T2A: Hgyro-EF1A was used (Cyagen Biosciences, Inc.). Cells with stable expression of NR3C2 were generated by transfecting them with the NR3C2-containing retroviruses. Puromycin or hygromycin (Sangon Biotech Co., Ltd.) was added to the cell cultures for selecting stable cells at 4 μg/ml, while 1 μg/ml puromycin or hygromycin was employed to maintain a stable cell culture. Cells transfected with viruses containing empty vectors served as controls.

Tissue collection

The tissue collection follows the patient’s informed consent. The ethical approval number associated with this protocol is 2021-SA06. Tissue samples were obtained via surgery, including both tumor tissues and para-cancer tissues (5.0 cm away from the tumor margin). Metastasis of cancer cells to distant areas, combined with other malignant tumors, accompanied by other serious systemic diseases, accompanied by Crohn’s disease and other chronic gastrointestinal diseases were excluded.

Cell proliferation assay

Enzymatic activity as an indicator of cell proliferation was measured using the Cell Counting Kit-8 (CCK-8) reagent provided by Dojindo Molecular Technologies, Inc., according to the instructions of the manufacturer.

Matrigel invasion assay

Cell invasion was evaluated in vitro using Transwell inserts from Corning, Inc., which feature an 8-µm pore size. The inserts were pre-coated with 30 μl of a 1:9 dilution of Matrigel. A suspension of 3 × 104 cells in 200 μl of culture medium was placed into the upper chamber. The cells were allowed to invade the Matrigel and move towards the lower chamber, which from Sigma-Aldrich and Merck KGaA. Following a 24-h incubation period, the cells that had migrated were fixed. The number of invasive cells was quantified under a Nikon Corporation light microscope by examining three randomly selected high-magnification fields.

Xenograft experiments

This study’s xenograft experiments were granted approval by The People’s Hospital of Yubei District, Chongqing, with the ethical approval number 2021-SA06. Operate in the animal room of the hospital, all operations comply with animal welfare principles. For the study, six-week-old nude mice, sourced from Shanghai, China, were selected. The experiment involved 20 mice, evenly divided between males and females, with an average weight of 18–20 g. They were kept under standard environmental with food and water provided as needed.In the xenograft procedure, RKO cells suspended in a 0.2 ml in the right flank, ensuring cell viability for tumor development. The injection protocol was uniform across all mice to maintain experimental consistency. Tumor size was measured tri-weekly with calipers for the duration of the study.

Western blotting

Protein was lysed using RIPA and subjected to water bath denaturation. During electrophoresis, 50ug of protein solution was added to each lane for electrophoresis. After electrophoresis, the membrane was transferred and blocked with BSA. Then, the primary antibody was incubated as follows. For immunoblotting, a panel of specific primary antibodies was used, purchased from Abcam and Novus Biologicals (NB) and Cell Signaling Technology (CST), including anti-NR3C2 (1:1000, Abcam, cat.no.ab2774), anti-β-catenin (1:2000, CST, cat.no.8480), anti-c-Myc (1:2000, CST, cat.no.5605), anti-cyclin D1 (1:1000, Abcam, cat.no.ab16663), anti-cleaved-caspase 3 (1:1000, CST, cat.no.9664), anti-Bcl-2 (1:2000, CST, cat.no.15071), anti-Bax (1:1000, CST, cat.no.5023), anti-LC3 (1:1000, NB, cat.no.NB100-2220), and anti-β-actin (1:2000, CST, cat.no.3700), as a loading control. Incubate with the secondary antibody for exposure.

Statistical analysis

Genetic analysis data were statistically analyzed using the Wilcoxon test in R4.3.2 software. To further explore the correlation between NR3C2 gene expression, the Wilcoxon test or Kruskal–Wallis test was utilized.Cox proportional hazards regression models, both simple and multiple variable, were applied to investigate the interplay between NR3C2 expression levels and a range of clinicopathological factors, focusing on different clinical endpoints. P < 0.05 was considered to indicate a statistically significant difference.

Results

A notable correlation exists between diminished NR3C2 expression and a poor prognosis in cases of colon cancer

Figure 1A illustrates the pancancer analysis of NR3C2 expression, revealing its downregulation in tumor tissues across 18 different types of cancer. The examination of data from the TCGA database, depicted in Fig. 1B, C confirms lower NR3C2 in colon cancer tissues was compared to that in normal colon tissues and adjacent non-cancerous colon tissues. Moreover, survival analysis, as shown in Fig. 1D, E, indicates that colon cancer patients with reduced NR3C2 expression exhibit diminished overall and progression-free survival rates, reinforcing the notion of NR3C2 as a putative tumor suppressor in colon cancer. The relationship between NR3C2 expression and clinical parameters in colon cancer is delineated in Fig. 2A–C. Wilcoxon tests identified significant associations between NR3C2 expression levels and the presence of distant (M) and lymph node (N) metastases, as well as the pathological stage of the disease (all with P < 0.05). Patients exhibiting lower NR3C2 expression levels were found to have a higher propensity for metastatic spread and advanced disease stage. To evaluate the collective influence of NR3C2 expression and clinical parameters on patient outcomes. The univariate analysis pointed to age, T stage as significant predictors of survival (P < 0.05). These factors, along with NR3C2, were subjected to a multivariate Cox regression model. The study identified NR3C2 [HR = 0.942, 95% CI (0.896–0.991), P = 0.022], age [HR = 1.034, 95% CI (1.011–1.059), P = 0.004], and T stage [HR = 1.919, 95% CI (1.035–3.555), P = 0.038], as detailed in Table 1. Significantly, the study highlights NR3C2’s potential as a diagnostic marker for colon cancer, with an area under the receiver operating characteristic curve of 0.984 (Fig. 2D). These findings underscore the clinical relevance of NR3C2 for the prognostic evaluation and diagnostic stratification of colon cancer.Fig. 1 Poor prognosis is associated with downregulation of NR3C2 in colon cancer. A Based on the data from TCGA database, panel A shows the expression of NR3C2 in various cancer tissues. B, C Changes in NR3C2 expression levels in colon cancer tissues relative to normal colon and adjacent colon tissues. D, E Association between the NR3C2 gene and overall and progression-free survival in TCGA database. NR3C2 nuclear receptor subfamily 3 group C member 2, TCGA The Cancer Genome Atlas

Fig. 2 Correlation of NR3C2 with clinicopathological parameters. A–C The expression of NR3C2 was correlated with distant metastasis, lymph node metastasis and stage of colon cancer and the numbers represent P values. D Analysis of receiver operating characteristic curve for NR3C2. NR3C2, nuclear receptor subfamily 3 group C member 2

Table 1 Univariate and multivariate Cox analysis regression of OS in colon cancer patients

Parameter	Univariate analysis	Multivariate analysis	
HR	95%CI	P	HR	95%CI	P	
Age	1.023	1.000–1.046	0.049	1.034	1.011–1.059	0.004	
Gender	1.046	0.630–1.736	0.862	0.872	0.519–1.465	0.605	
Stage	2.829	2.085–3.840	 < 0.001	2.084	0.829–5.239	0.119	
T	3.794	2.261–6.367	 < 0.001	1.919	1.035–3.555	0.038	
M	6.057	3.595–10.207	 < 0.001	1.268	0.365–4.411	0.709	
N	2.322	1.722–3.133	 < 0.001	1.122	0.664–1.895	0.667	
NR3C2	0.918	0.870–0.969	0.002	0.942	0.896–0.991	0.022	
P < 0.05, and the results were statistically significant

Single-cell analysis of NR3C2-related Genes

Considering that dysregulation of NR3C2 expression is highly associated with malignant proliferation of colon tumors and thus increased tumor purity, we hypothesized that NR3C2 might alter the proportion of cells in the tumor microenvironment. Based on this conjecture, we analyzed single-cell transcriptome data of coalesced cancer samples from the GEO database. In single-cell expression analysis, the t-SNE plot (Fig. 3A) shows the clustering of different cell types, mainly including the Macro_c2_FCN1 and CD4_Tm_like1 cell groups. The dot plot (Fig. 3B) outlines the expression profiles of various genes between different cell types. UMAP visualization (Fig. 3C) elucidates the expression distribution of target genes at the single-cell level. Figure 4 comprehensively displays the gene expression characteristics of different cell clusters and their functional enrichment analysis. Firstly, through the bar graph in 4A, we observed that the CD4_Tn_like1 cells occupy the highest proportion in the samples. The heatmap in 4B shows the unique patterns of differentially expressed genes in each cluster, such as the genes PECAM1, HSPG2, and CXCL14 exhibiting significant expression features in specific cell clusters. Through the heatmap analysis of GO terms in 4C, the differential expression of pathways related to immune response and cell adhesion in different cell types is depicted. The violin plot of VIM expression in B_c2_CXCR4 cluster in 4D shows higher levels of expression. The volcano plot in 4E displays the log2-fold changes and statistical significance of genes in this cluster, revealing significant upregulation of genes such as GJA4 and SLIT3. Lastly, the bubble plot in 4F reveals the importance of pathways such as small GTPase-mediated signaling and cell–matrix adhesion through gene enrichment analysis. In single-cell communication analysis, the signaling network plot (Fig. 5A) illustrates the dynamic intercellular signaling between different cell types. The heatmaps Fig. 5B, C) describe the signaling reception patterns of different cell types and the relative strength of various signaling pathways within each cell group. The TNF signaling pathway network plot (Fig. 5D) provides a detailed depiction of the strength of TNF signal transduction between different cell types.Fig. 3 Single-cell expression analysis. A t-SNE plot showing the clustering of different cell populations. Each color represents a cell type, including Macro_c2_FCN1, CD4_Tm_like1, Plasma_c1_IGHA2, Mast_cell, Neutrophil, Cycling_T, and B_c2_CXCR4. B Dot plot displaying gene expression patterns across different cell types. The x-axis represents genes, the y-axis represents cell types, dot size indicates the percentage of cells expressing the gene, and color indicates the average expression level. C UMAP plots showing the distribution of gene expression in single cells. Each small plot represents a gene, with colors ranging from gray to red indicating low to high gene expression levels

Fig. 4 Comprehensively shows the gene expression characteristics and functional enrichment analysis of different cell clusters. A Distribution of cell types. B Heatmap of differentially expressed genes in cell types. C heatmap analysis of GO in cell types. D Violin plot of VIM expression. E Volcano plot of differentially expressed genes in B_c2_CXCR4. F bubble plot of GO enrichment analysis of differentially expressed genes in B_c2_CXCR4

Fig. 5 Single-cell communication analysis. A Intercellular signaling network diagram. Nodes represent cell types, and the thickness of connections indicates the strength of signal transduction. B Heatmap showing signal reception patterns across different cell types. The x-axis represents signaling pathways, the y-axis represents cell types, and colors indicate signal intensity. C Heatmap displaying the relative strength of different signaling pathways in various cell types. The x-axis represents signaling pathways, the y-axis represents cell types, and colors indicate signal intensity. D TNF signaling pathway network diagram. Nodes represent cell types, and the thickness of connections indicates the strength of TNF signal transduction

Functional enrichment analysis

As shown in Fig. 6, a differential gene heat map was obtained for the expression values of NR3C2, and GO and KEGG were employed for enrichment analysis of the differential genes. As shown in Fig. 7A, GO enrichment suggested that NR3C2 was related to material transport. As shown in Fig. 7B, KEGG analysis showed that NR3C2 was enriched in 11 signaling pathways associated with tumorigenesis, substance metabolism and transport. In patients with colon cancer and low NR3C2 expression, GSEA analysis showed that downregulated NR3C2 was mainly enriched in the Wnt pathway and played a promoting role (Fig. 7C, D), which may be associated with the development of colon tumors.Fig. 6 Differential gene heat map

Fig. 7 Functional enrichment analysis of NR3C2 in colon cancer. A Gene Ontology enrichment analysis of NR3C2 expression data and mRNA co-expressed with NR3C2. B Kyoto Encyclopedia of Genes and Genomes was used to analyze signaling pathways associated with NR3C2. C Pathway analysis was performed using Gene Set Enrichment Analysis, and mRNA co-expressed with NR3C2 was further screened. D Association between the Wnt signaling pathway and NR3C2 and its co-expressed mRNA. NR3C2 nuclear receptor subfamily 3 group C member 2

NR3C2 affects the proliferation and invasion of colon cancer cell

To study the correlations between NR3C2 and colon cancer, cell models (Fig. 8A) of NR3C2 overexpression and NR3C2 KD (knockdown NR3C2) were constructed. By protein analysis of fresh tissue, NR3C2 protein expression levels were reduced in colon cancer tissues compared with normal colon tissues (Fig. 8B). In addition, the present study found that colon cancer cells with NR3C2 KD were more proliferative, whereas colon cancer cells with overexpression of NR3C2 were less proliferative (Fig. 8C). The invasion and migration ability of colon cancer cells with NR3C2 KD was significantly enhanced (Fig. 8E, upper panel), while NR3C2 overexpression reduced cancer cell invasion (Fig. 8E, lower panel). Combined with the results of gene function enrichment, it is speculated that NR3C2 may regulate Wnt/β-catenin to affect the proliferation and invasion of colon cancer.Fig. 8 NR3C2 modulates tumorigenicity in colon cancer. A Cell models of NR3C2 overexpression and NR3C2 KD were constructed. B Representative western blot analysis of NR3C2 expression in normal colon and corresponding colon cancer tissue. C Cell Counting Kit-8 assay demonstrated a higher proliferation rate in KD RKO cell lines than in shNC and cell proliferation assay showed decreased proliferation in RKO cell lines overexpressing NR3C2 than in LVNC cells. D KD1 and shNC RKO cells were used for tumor xenograft studies. The weights and volumes of the tumors were calculated for each group (n = 6). E The invasion and migration abilities of shNC and NR3C2 KD RKO cells, as well as LVNC and NR3C2-overexpressing cells were evaluated using a Transwell assay. Note: Statistical comparisons were performed at the indicated time points after cancer cell injection. All data are shown as the mean ± standard error of the mean (n ≥ 3). *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. NR3C2 nuclear receptor subfamily 3 group C member 2, KD knockdown; sh small hairpin, NC negative control, LV lentivirus

NR3C2 promotes Wnt/β-catenin pathway-related proteins and inhibits apoptosis in colon cancer

To determine the involvement of autophagy and apoptosis-associated proteins in colon cancer cell behavior, their expression levels were measured (Fig. 9). The knockdown of NR3C2 resulted in elevated levels of β-catenin, c-Myc, cyclin D1, and Bcl-2 (B-cell lymphoma 2) proteins, while reducing the levels of Bax (BCL2-Associated X) and LC3 (microtubule-associated proteins light chain 3) proteins. Conversely, the overexpression of NR3C2 induced the opposite effects. c-Myc and cyclin D1 are the downstream target proteins of Wnt/β-catenin pathway, which are closely related to colon cancer. Bcl-2 plays an anti-apoptotic role. As illustrated in Fig. 8A, B, these outcomes propose that NR3C2 potentially regulates autophagy and apoptosis in colon cancer cells by affecting proteins involved in the Wnt/β-catenin signaling pathway.Fig. 9 Nuclear receptor subfamily 3 group C member 2 promotes Wnt/β-catenin pathway protein-related expression and inhibits apoptosis in colon cancer. A, B Detection of the levels of proteins associated with the Wnt/β-catenin signaling pathway and apoptosis. Quantitative data represent the mean ± standard error of the mean of ≥ 3 replicates. The results revealed a significant correlation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P ≤ 0.0001

NR3C2 modulates tumorigenicity in colon cancer

Moreover, the effect on tumor proliferation was explored by injecting mice with NR3C2 KD and control cells. As shown in Fig. 8D, tumor weight and volume increased significantly in NR3C2 KD mice versus control mice. These results demonstrated that NR3C2 regulated tumorigenic properties such as the proliferation and invasion of colon cancer cell.

Discussion

Due to the delayed diagnosis of cancer, colon cancer has become the leading cause of cancer-related death worldwide, which is a major public health problem threatening human life. Pan-cancer analysis showed that NR3C2 was significantly differentially expressed in 19 tumors, indicating that this gene is closely related to tumors. Recent research has suggested that NR3C2 is associated with a range of conditions, including depression (Keller et al. 2017) and pseudoaldosteronism (Riepe 2013), and several cancer types such as oral squamous cell carcinoma (Guo et al. 2020), and pancreatic (Zhang et al. 2017; Yang et al. 2016), liver (Yang et al. 2019), renal (Zhao et al. 2018) and colorectal (Tiberio et al. 2013) cancer. NR3C2 shows a tumor suppressor gene function during pancreatic cancer. It retards the growth of pancreatic cancer cells, as well as EMT transformation and enhanced chemosensitivity to certain therapeutic agents (Zhang et al. 2017; Yang et al. 2016, 2019) In renal clear cell carcinoma, overexpression of NR3C2 slows down cell proliferation and migration (Zhao et al. 2018). In addition, miR-454 downregulates NR3C2 expression, facilitating growth, invasion and migration in oral squamous cell carcinoma (Guo et al. 2020). NR3C2 acts as a suppressor across various carcinomas, impeding disease progression through specific mechanisms. Despite its wide-ranging association with tumors, the role of NR3C2 in colon cancer remains underexplored, with unclear pathogenesis.

In this study, data from TCGA database and bioinformatics analysis were conducted, which revealed that NR3C2 expression was lower in colon cancer tissues than in normal colon tissues. Patients with poorer NR3C2 expression showed shorter survival for the first 5 years and more advanced stages and, the majority of them had more lymphatic and extra-lymphatic spread. Cox multivariate analysis corroborated that NR3C2 was identified as an independent prognostic index for colon cancer; for that reason, the low level of NR3C2 that is found in colon tumors may be used to predict the risk of cancer and may serve as a potential biomarker for early diagnosis. Subsequent protein analysis using fresh cancer and normal tissues confirmed that the expression level of NR3C2 was also significantly decreased in colon cancer tissue compared to normal tissue. In agreement with the present results, reduced NR3C2 levels in bladder, breast, colon, head, neck, liver and prostate cancer has been reported by several studies (Long and Campbell 2015; Li and Xu 2022; Zhao et al. 2022; Petherick et al. 2013; Yuan et al. 2020; Behrouj et al. 2021; Zhang et al. 2022). Patients with colorectal cancer whose NR3C2 expression is downregulated have poorer 5-year overall survival, more advanced disease stage, and higher rates of lymphatic and distant metastases (Li and Xu 2022). A previous study on 71 patients with colorectal cancer confirmed that NR3C2 was downregulated in colorectal cancer tissues, particularly in stage II and III colorectal tissues, and that reduced NR3C2 expression was significantly associated with advanced and distant metastases in patients with colorectal cancer (Liu et al. 2023).

A few studies have demonstrated that NR3C2 acts as a tumor suppressor gene (Keller et al. 2017; Riepe 2013; Guo et al. 2020; Zhao et al. 2018; Long and Campbell 2015; Li and Xu 2022). The MR protein, which exhibits antagonistic activity to that encoded by NR3C2, shows antagonistic angiogenesis and thus prevents tumor progression in colorectal cancer (Tiberio et al. 2013).

Single-cell transcriptome profiling of colon cancer can reveal disease heterogeneity, characterize the tumor microenvironment, and improve cancer diagnosis and therapeutics. Through single-cell analysis, we found that colon cells are divided into seven subsets, including Macro_c2_FCN1, CD4_Tm_like1, Plasma_c1_IGHA2, Mast cells, Neutrophils, Cycling T cells, and B_c2_CXCR4 cell (plasma cell) populations. Moreover, NR3C2 was highly expressed in circulating T cells and B_c2_CXCR4 cell, and closely communicates with TNF signaling. TNF-α plays a key role in tumor signaling pathways and immune cell manipulation within the tumor microenvironment (TME) through its role in apoptosis, angiogenesis, immune cell recruitment and regulation, and its function in assisting in extracellular matrix construction. This suggests that NR3C2 may affect colon cancer progression by regulating TME.

To further reveal the role of NR3C2 in colon cancer, functional experiments were performed underscored the role of NR3C2 in regulating cell proliferation and invasion in colon cancer. Through CCK-8 assays and nude mouse tumor formation experiments, colon cancer cells with reduced NR3C2 expression showed enhanced proliferation, whereas those with higher expression exhibited inhibited proliferation and invasion. Additionally, transwell invasion assays revealed that downregulation of NR3C2 elevated the invasive potential of colon cancer cells, whereas overexpression attenuated this ability with statistical significance. Although additional data are needed to elucidate the impact of NR3C2 expression on the development of colon cancer, the current study suggests that NR3C2 also has anticancer effects in colon cancer, inhibiting its occurrence and progression.

Although two previous present study indicated that NR3C2 could reduce colon cancer cell proliferation, metastasis, migration and angiogenesis via downregulating the AKT/ERK pathway (Li and Xu 2022) and that NR3C2 influences glucose metabolism and AMPK phosphorylation to decelerate colorectal cancer cell proliferation (Liu et al. 2023). However, in this study, GSEA enrichment analysis showed that NR3C2 may also be related to Wnt signaling pathway. The Wnt signaling pathway, encompassing the Wnt/β-catenin pathway, planar cell polarity vector pathway and Wnt-Ca2+ components, plays a crucial role in cell behavior and tumorigenesis by influencing apoptosis evasion, chemotherapy resistance and autophagy inhibition (Zhao et al. 2022; Petherick et al. 2013; Yuan et al. 2020). Specifically, the Wnt/β-catenin pathway is a significant driver in colon cancer, affecting cell proliferation, differentiation and autophagy, and is frequently dysregulated in colorectal cancer, contributing to EMT, fibroblast activation and angiogenesis, thus promoting aggressiveness (Zhao et al. 2022; Behrouj et al. 2021; Zhang et al. 2022; Kim et al. 2019; Yang et al. 2020). Targeting components of the Wnt pathway has been explored as a strategy for cancer treatment (Miete et al. 2022; Parichha et al. 2022). The present study investigated the involvement of NR3C2 in colon cancer carcinogenesis by examining its influence on the Wnt/β-catenin pathway and apoptosis-related proteins. It was found that knocking down NR3C2 decreased the pro-apoptotic markers Bax and LC3 while increasing β-catenin, c-Myc, cyclin D1 and Bcl-2 expression in RKO cells, whereas overexpression of NR3C2 had the opposite effect. c-Myc and cyclin D1 are the downstream target proteins of WNT/β-catenin pathway, and Bcl-2 plays an anti-apoptotic role. These findings suggest that NR3C2 may regulate the proliferation and aggressiveness of colon cancer, as well as apoptosis and autophagy through the Wnt/β-catenin signaling pathway.

Conclusions

In conclusion, the present study showed that low expression of NR3C2 was associated with poor outcome in patients with colon cancer and was a potential biomarker for colon cancer. NR3C2 may affect the progression of colon cancer by regulating the Wnt/ β-catenin signaling pathway, and this axis is expected to be a potential therapeutic target.

Abbreviations

ACC Adrenocortical carcinoma

BLCA Bladder urothelial carcinoma

BRCA Breast invasive carcinoma

CESC Cervical squamous cell carcinoma and endocervical adenocarcinoma

CHOL Cholangiocarcinoma

COAD Colon adenocarcinoma

DLBC Lymphoid neoplasm diffuse large B-cell lymphoma

ESCA Esophageal carcinoma

GBM Glioblastoma multiforme

HNSC Head and Neck squamous cell carcinoma

KICH Kidney chromophobe

KIRC Kidney renal clear cell carcinoma

KIRP Kidney renal papillary cell carcinoma

LAML Acute myeloid leukemia

LGG Brain lower grade glioma

LIHC Liver hepatocellular carcinoma

LUAD Lung adenocarcinoma

LUSC Lung squamous cell carcinoma

MESO Mesothelioma

OV Ovarian serous cystadenocarcinoma

PAAD Pancreatic adenocarcinoma

PCPG Pheochromocytoma and paraganglioma

PRAD Prostate adenocarcinoma

READ Rectum adenocarcinoma

SARC Sarcoma

SKCM Skin cutaneous melanoma

STAD Stomach adenocarcinoma

TGCT Testicular germ cell tumors

THCA Thyroid carcinoma

THYM Thymoma

UCEC Uterine corpus endometrial carcinoma

UCS Uterine carcinosarcoma

UVM Uveal melanoma

Author contributions

Ke Nie and Zhong-Jiang He conceptualised the study and wrote the main text of the manuscript, and should be listed as co-first authors. Ling-Jun Kong analysed the data and prepared the figures. All authors reviewed and approved the manuscript.

Funding

The present study was supported by the Chongqing Yubei District Science and Technology Planning Project [grant no. 2022 (Agricultural Cooperative) 16].

Data availability

No datasets were generated or analysed during the current study.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

This study was approved by the Ethics Committee of The People’s Hospital of Yubei District of Chongqing. The ethical approval number associated with this protocol is 2021-SA06.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ke Nie and Zhong-Jiang He are co-first author.
==== Refs
References

Behrouj H Seghatoleslam A Mokarram P Ghavami S Effect of casein kinase 1α inhibition on autophagy flux and the akt/phospho-β-catenin (s552) axis in hct116, a ras-mutated colorectal cancer cell line Can J Physiol Pharmacol 2021 99 284 293 10.1139/cjpp-2020-0449 33635146
Behrouj H, Seghatoleslam A, Mokarram P, Ghavami S (2021) Effect of casein kinase 1α inhibition on autophagy flux and the akt/phospho-β-catenin (s552) axis in hct116, a ras-mutated colorectal cancer cell line. Can J Physiol Pharmacol 99:284–293. 10.1139/cjpp-2020-044933635146 10.1139/cjpp-2020-0449
Cancer Genome Atlas Network Comprehensive molecular characterization of human colon and rectal cancer Nature 2012 487 330 7 10.1038/nature11252 22810696
Cancer Genome Atlas Network (2012) Comprehensive molecular characterization of human colon and rectal cancer. Nature 487:330–7. 10.1038/nature1125222810696 10.1038/nature11252
de Kloet ER Van Acker SA Sibug RM Oitzl MS Meijer OC Rahmouni K Brain mineralocorticoid receptors and centrally regulated functions Kidney Int 2000 57 1329 1336 10.1046/j.1523-1755.2000.00971.x 10760063
de Kloet ER, Van Acker SA, Sibug RM, Oitzl MS, Meijer OC, Rahmouni K et al (2000) Brain mineralocorticoid receptors and centrally regulated functions. Kidney Int 57:1329–1336. 10.1046/j.1523-1755.2000.00971.x10760063 10.1046/j.1523-1755.2000.00971.x
Fearon ER Vogelstein B A genetic model for colorectal tumorigenesis Cell 1990 61 759 767 10.1016/0092-8674(90)90186-i 2188735
Fearon ER, Vogelstein B (1990) A genetic model for colorectal tumorigenesis. Cell 61:759–767. 10.1016/0092-8674(90)90186-i2188735 10.1016/0092-8674(90)90186-i
Guo JY Wang YK Lv B Jin H Mir-454 performs tumor-promoting effects in oral squamous cell carcinoma via reducing nr3c2 J Oral Pathol Med 2020 49 286 293 10.1111/jop.13015 32170966
Guo JY, Wang YK, Lv B, Jin H (2020) Mir-454 performs tumor-promoting effects in oral squamous cell carcinoma via reducing nr3c2. J Oral Pathol Med 49:286–293. 10.1111/jop.1301532170966 10.1111/jop.13015
Keller J Gomez R Williams G Lembke A Lazzeroni L Murphy GM Jr Hpa axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition Mol Psychiatry 2017 22 527 536 10.1038/mp.2016.120 27528460
Keller J, Gomez R, Williams G, Lembke A, Lazzeroni L, Murphy GM Jr et al (2017) Hpa axis in major depression: cortisol, clinical symptomatology and genetic variation predict cognition. Mol Psychiatry 22:527–536. 10.1038/mp.2016.12027528460 10.1038/mp.2016.120
Kim WK Kwon Y Jang M Park M Kim J Cho S Β-catenin activation down-regulates cell-cell junction-related genes and induces epithelial-to-mesenchymal transition in colorectal cancers Sci Rep 2019 9 18440 10.1038/s41598-019-54890-9 31804558
Kim WK, Kwon Y, Jang M, Park M, Kim J, Cho S et al (2019) Β-catenin activation down-regulates cell-cell junction-related genes and induces epithelial-to-mesenchymal transition in colorectal cancers. Sci Rep 9:18440. 10.1038/s41598-019-54890-931804558 10.1038/s41598-019-54890-9
Li J Xu Z Nr3c2 suppresses the proliferation, migration, invasion and angiogenesis of colon cancer cells by inhibiting the akt/erk signaling pathway Mol Med Rep 2022 10.3892/mmr.2022.12649 36579660
Li J, Xu Z (2022) Nr3c2 suppresses the proliferation, migration, invasion and angiogenesis of colon cancer cells by inhibiting the akt/erk signaling pathway. Mol Med Rep. 10.3892/mmr.2022.1264936579660 10.3892/mmr.2022.12649
Lin JS Perdue LA Henrikson NB Bean SI Blasi PR Screening for colorectal cancer: updated evidence report and systematic review for the us preventive services task force JAMA 2021 325 1978 1998 10.1001/jama.2021.4417 34003220
Lin JS, Perdue LA, Henrikson NB, Bean SI, Blasi PR (2021) Screening for colorectal cancer: updated evidence report and systematic review for the us preventive services task force. JAMA 325:1978–1998. 10.1001/jama.2021.441734003220 10.1001/jama.2021.4417
Liu H Lei W Li Z Wang X Zhou L Nr3c2 inhibits the proliferation of colorectal cancer via regulating glucose metabolism and phosphorylating ampk J Cell Mol Med 2023 27 1069 1082 10.1111/jcmm.17706 36950803
Liu H, Lei W, Li Z, Wang X, Zhou L (2023) Nr3c2 inhibits the proliferation of colorectal cancer via regulating glucose metabolism and phosphorylating ampk. J Cell Mol Med 27:1069–1082. 10.1111/jcmm.1770636950803 10.1111/jcmm.17706
Long MD Campbell MJ Pan-cancer analyses of the nuclear receptor superfamily Nucl Recep Res 2015 10.11131/2015/101182
Long MD, Campbell MJ (2015) Pan-cancer analyses of the nuclear receptor superfamily. Nucl Recep Res. 10.11131/2015/10118210.11131/2015/101182
Miete C Solis GP Koval A Brückner M Katanaev VL Behrens J Gαi2-induced conductin/axin2 condensates inhibit wnt/β-catenin signaling and suppress cancer growth Nat Commun 2022 13 674 10.1038/s41467-022-28286-9 35115535
Miete C, Solis GP, Koval A, Brückner M, Katanaev VL, Behrens J et al (2022) Gαi2-induced conductin/axin2 condensates inhibit wnt/β-catenin signaling and suppress cancer growth. Nat Commun 13:674. 10.1038/s41467-022-28286-935115535 10.1038/s41467-022-28286-9
Parichha A Suresh V Chatterjee M Kshirsagar A Ben-Reuven L Olender T Constitutive activation of canonical wnt signaling disrupts choroid plexus epithelial fate Nat Commun 2022 13 633 10.1038/s41467-021-27602-z 35110543
Parichha A, Suresh V, Chatterjee M, Kshirsagar A, Ben-Reuven L, Olender T et al (2022) Constitutive activation of canonical wnt signaling disrupts choroid plexus epithelial fate. Nat Commun 13:633. 10.1038/s41467-021-27602-z35110543 10.1038/s41467-021-27602-z
Parsons MJ Tammela T Dow LE Wnt as a driver and dependency in cancer Cancer Discov 2021 11 2413 2429 10.1158/2159-8290.Cd-21-0190 34518209
Parsons MJ, Tammela T, Dow LE (2021) Wnt as a driver and dependency in cancer. Cancer Discov 11:2413–2429. 10.1158/2159-8290.Cd-21-019034518209 10.1158/2159-8290.Cd-21-0190
Petherick KJ Williams AC Lane JD Ordóñez-Morán P Huelsken J Collard TJ Autolysosomal β-catenin degradation regulates wnt-autophagy-p62 crosstalk EMBO J 2013 32 1903 1916 10.1038/emboj.2013.123 23736261
Petherick KJ, Williams AC, Lane JD, Ordóñez-Morán P, Huelsken J, Collard TJ et al (2013) Autolysosomal β-catenin degradation regulates wnt-autophagy-p62 crosstalk. EMBO J 32:1903–1916. 10.1038/emboj.2013.12323736261 10.1038/emboj.2013.123
Riepe FG Pseudohypoaldosteronism Endocrine Dev 2013 24 86 95 10.1159/000342508
Riepe FG (2013) Pseudohypoaldosteronism. Endocrine Dev 24:86–95. 10.1159/00034250810.1159/000342508
Sung H Ferlay J Siegel RL Laversanne M Soerjomataram I Jemal A Global cancer statistics 2020: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J Clin 2021 71 209 49 10.3322/caac.21660 33538338
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global cancer statistics 2020: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 71:209–49. 10.3322/caac.2166033538338 10.3322/caac.21660
Tiberio L Nascimbeni R Villanacci V Casella C Fra A Vezzoli V The decrease of mineralcorticoid receptor drives angiogenic pathways in colorectal cancer PLoS ONE 2013 8 e59410 10.1371/journal.pone.0059410 23555666
Tiberio L, Nascimbeni R, Villanacci V, Casella C, Fra A, Vezzoli V et al (2013) The decrease of mineralcorticoid receptor drives angiogenic pathways in colorectal cancer. PLoS ONE 8:e59410. 10.1371/journal.pone.005941023555666 10.1371/journal.pone.0059410
Weinstein JN Collisson EA Mills GB Shaw KR Ozenberger BA Ellrott K The cancer genome atlas pan-cancer analysis project Nat Genet 2013 45 1113 1120 10.1038/ng.2764 24071849
Weinstein JN, Collisson EA, Mills GB, Shaw KR, Ozenberger BA, Ellrott K et al (2013) The cancer genome atlas pan-cancer analysis project. Nat Genet 45:1113–1120. 10.1038/ng.276424071849 10.1038/ng.2764
Wu H Qin W Lu S Wang X Zhang J Sun T Long noncoding rna zfas1 promoting small nucleolar rna-mediated 2′-o-methylation via nop58 recruitment in colorectal cancer Mol Cancer 2020 19 95 10.1186/s12943-020-01201-w 32443980
Wu H, Qin W, Lu S, Wang X, Zhang J, Sun T et al (2020) Long noncoding rna zfas1 promoting small nucleolar rna-mediated 2′-o-methylation via nop58 recruitment in colorectal cancer. Mol Cancer 19:95. 10.1186/s12943-020-01201-w32443980 10.1186/s12943-020-01201-w
Yang S He P Wang J Schetter A Tang W Funamizu N A novel mif signaling pathway drives the malignant character of pancreatic cancer by targeting nr3c2 Can Res 2016 76 3838 3850 10.1158/0008-5472.Can-15-2841
Yang S, He P, Wang J, Schetter A, Tang W, Funamizu N et al (2016) A novel mif signaling pathway drives the malignant character of pancreatic cancer by targeting nr3c2. Can Res 76:3838–3850. 10.1158/0008-5472.Can-15-284110.1158/0008-5472.Can-15-2841
Yang C Ma X Guan G Liu H Yang Y Niu Q Microrna-766 promotes cancer progression by targeting nr3c2 in hepatocellular carcinoma FASEB J 2019 33 1456 1467 10.1096/fj.201801151R 30130435
Yang C, Ma X, Guan G, Liu H, Yang Y, Niu Q et al (2019) Microrna-766 promotes cancer progression by targeting nr3c2 in hepatocellular carcinoma. FASEB J 33:1456–1467. 10.1096/fj.201801151R30130435 10.1096/fj.201801151R
Yang D Li Q Shang R Yao L Wu L Zhang M Wnt4 secreted by tumor tissues promotes tumor progression in colorectal cancer by activation of the wnt/β-catenin signalling pathway J Exp Clin Cancer Res 2020 39 251 10.1186/s13046-020-01774-w 33222684
Yang D, Li Q, Shang R, Yao L, Wu L, Zhang M et al (2020) Wnt4 secreted by tumor tissues promotes tumor progression in colorectal cancer by activation of the wnt/β-catenin signalling pathway. J Exp Clin Cancer Res 39:251. 10.1186/s13046-020-01774-w33222684 10.1186/s13046-020-01774-w
Yuan S Tao F Zhang X Zhang Y Sun X Wu D Role of wnt/β-catenin signaling in the chemoresistance modulation of colorectal cancer Biomed Res Int 2020 2020 9390878 10.1155/2020/9390878 32258160
Yuan S, Tao F, Zhang X, Zhang Y, Sun X, Wu D (2020) Role of wnt/β-catenin signaling in the chemoresistance modulation of colorectal cancer. Biomed Res Int 2020:9390878. 10.1155/2020/939087832258160 10.1155/2020/9390878
Zhan T Rindtorff N Boutros M Wnt signaling in cancer Oncogene 2017 36 1461 1473 10.1038/onc.2016.304 27617575
Zhan T, Rindtorff N, Boutros M (2017) Wnt signaling in cancer. Oncogene 36:1461–1473. 10.1038/onc.2016.30427617575 10.1038/onc.2016.304
Zhang Z Che X Yang N Bai Z Wu Y Zhao L Mir-135b-5p promotes migration, invasion and emt of pancreatic cancer cells by targeting nr3c2 Biomed Pharmacother 2017 96 1341 1348 10.1016/j.biopha.2017.11.074 29196101
Zhang Z, Che X, Yang N, Bai Z, Wu Y, Zhao L et al (2017) Mir-135b-5p promotes migration, invasion and emt of pancreatic cancer cells by targeting nr3c2. Biomed Pharmacother 96:1341–1348. 10.1016/j.biopha.2017.11.07429196101 10.1016/j.biopha.2017.11.074
Zhang X Zhang H Shen B Sun XF Chromogranin-a expression as a novel biomarker for early diagnosis of colon cancer patients Int J Mol Sci 2019 10.3390/ijms20122919 31906256
Zhang X, Zhang H, Shen B, Sun XF (2019) Chromogranin-a expression as a novel biomarker for early diagnosis of colon cancer patients. Int J Mol Sci. 10.3390/ijms2012291931906256 10.3390/ijms20122919
Zhang J Li Q Sun Q Wang B Cui Y Lou C Epigenetic modifications inhibit the expression of marveld1 and in turn tumorigenesis by regulating the wnt/β-catenin pathway in pan-cancer J Cancer 2022 13 225 242 10.7150/jca.63608 34976185
Zhang J, Li Q, Sun Q, Wang B, Cui Y, Lou C et al (2022) Epigenetic modifications inhibit the expression of marveld1 and in turn tumorigenesis by regulating the wnt/β-catenin pathway in pan-cancer. J Cancer 13:225–242. 10.7150/jca.6360834976185 10.7150/jca.63608
Zhao Z Zhang M Duan X Deng T Qiu H Zeng G Low nr3c2 levels correlate with aggressive features and poor prognosis in non-distant metastatic clear-cell renal cell carcinoma J Cell Physiol 2018 233 6825 6838 10.1002/jcp.26550 29693713
Zhao Z, Zhang M, Duan X, Deng T, Qiu H, Zeng G (2018) Low nr3c2 levels correlate with aggressive features and poor prognosis in non-distant metastatic clear-cell renal cell carcinoma. J Cell Physiol 233:6825–6838. 10.1002/jcp.2655029693713 10.1002/jcp.26550
Zhao H Ming T Tang S Ren S Yang H Liu M Wnt signaling in colorectal cancer: pathogenic role and therapeutic target Mol Cancer 2022 21 144 10.1186/s12943-022-01616-7 35836256
Zhao H, Ming T, Tang S, Ren S, Yang H, Liu M et al (2022) Wnt signaling in colorectal cancer: pathogenic role and therapeutic target. Mol Cancer 21:144. 10.1186/s12943-022-01616-735836256 10.1186/s12943-022-01616-7
