
==== Front
Cancer Diagn Progn
Cancer Diagn Progn
Cancer Diagnosis & Prognosis
2732-7787
International Institute of Anticancer Research

39238632
10.21873/cdp.10365
Research Article
Putative Dual Roles of Bone Morphogenetic Protein 8B (BMP8B) in Disease Progression of Gastric Cancer
SUN ZHIWEI 12
CAI SHUO 13
LIU XIANGYI 1
JIANG WEN G. 1
YE LIN 1
1 Cardiff China Medical Research Collaborative, Division of Cancer and Genetics, Cardiff University School of Medicine, Cardiff, U.K.
2 Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education/Beijing), The VIP-II Gastrointestinal Cancer Division of Medical Department, Peking University Cancer Hospital & Institute, Beijing, P.R. China
3 Department of Endoscopy Centre, Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Peking University Cancer Hospital and Institute, Beijing, P.R. China
Dr. Lin Ye, Cardiff China Medical Research Collaborative, Division of Cancer and Genetics, Cardiff University School of Medicine, Cardiff, CF14 4XN, U.K. E-mail: YeL@Cardiff.ac.uk
1 9 2024
Sep-Oct 2024
4 5 567578
26 4 2024
29 5 2024
30 5 2024
©2024 The Author(s). Published by the International Institute of Anticancer Research.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license
Background/Aim

Increased expression of bone morphogenetic protein 8B (BMP8B) in bone marrow and primary tumors of patients with gastric cancer (GC) is associated with disease progression and poor prognosis. However, a reduced expression has also been seen in GCs due to histone acetylation. This study aimed to evaluate BMP8B transcript levels in a large GC cohort and its impact on cellular functions.

Materials and Methods

BMP8B transcripts were determined in 319 gastric tumors and compared with 182 adjacent normal tissues using real time PCR, with a further analysis conducted in the TCGA database. Kaplan-Meier plotter analysis was performed to evaluate the correlation between BMP8B and prognosis of the disease. BMP8B knockdown model was employed to determine the effect of BMP8B on the function of GC cells (HGC27).

Results

BMP8B mRNA levels were significantly up-regulated in the GC tissues compared with adjacent normal tissues in both TCGA database and our own database from Beijing Cancer Hospital, and high BMP8B expression was associated with poor prognosis. BMP8B is most likely to be involved in the differentiation of GC. Poorly differentiated GC samples presented a significantly reduced BMP8B expression in relation to well-differentiated and moderately differentiated GC. BMP8B knockdown inhibited proliferation of GC cells, while promoted invasion and migration of cancer cells.

Conclusion

BMP8B was reduced in GCs, whereas higher BMP8B expression was associated with poor prognosis. BMP8B knockdown inhibited proliferation of GC cells, and promoted invasion and migration. Our results suggest that BMP8B plays dual roles in GC.

BMP8B
gastric cancer
survival
proliferation
migration
invasion
==== Body
pmcDuring the past few decades, the incidence and mortality of gastric cancer (GC) have shown a significant decline, but it remains the fourth leading cause of cancer-related death worldwide because of its poor prognosis (1). Only less than 20% of the newly diagnosed cases are stage I or II for whom surgery is the main treatment. For unresectable locally advanced or metastatic gastric cancer, chemotherapy is the backbone of palliative treatment. Although chemotherapy in GC has progressed in recent years (2,3), patients with GC have poor prognosis (4). An improved understanding of the molecular mechanisms of GC and the exploration of new therapeutic targets may improve the outcome for patients.

Bone morphogenetic proteins (BMPs) are signalling molecules that belong to the transforming growth factor β (TGF-β) superfamily. They directly activate at least two signal transduction pathways: one is the SMADs pathway (5,6) and the other is the MAPKs pathway (7-9). BMPs were originally identified as molecules that can induce ectopic bone and cartilage formation, and then several studies revealed that they are involved in several biological processes, including organogenesis, cell proliferation, differentiation, migration, immune response, angiogenesis, and apoptosis (10). BMPs are detected in many types of tumors, such as bone, odontogenic, colorectal cancer and maxillofacial tumors (11-14), and correlated with the development and metastasis (15-21). However, most of the studies were carried out on breast and prostate cancer. For instance, by up-regulating the expressions of MMP-1 and CXCR4, BMP4 may involve in the progression of invasion and migration of breast cancer cells (16). BMP-10 can suppress the growth of prostate cancer cells by inducing apoptosis via a Smad independent pathway in which XIAP and ERK1/2 are involved, and it can also prevent prostate cancer cell migration and invasiveness (17).

In the field of GC, research has shown that BMPs play an important role in regulating the homeostasis of the gastric epithelium and tumorigenesis through their ability to control the biological functions of the parietal cells (22-25). Inhibition of BMP signaling in the gastric mucosa leads to severe abnormalities in the proliferation, maturation, and differentiation of several lineages of gastric epithelial cells, and further formation of metaplasia, atypical hyperplasia, and tumors (22,26). Moreover, some studies suggested that BMPs could regulate the growth and metastasis of GC. BMP-2 inhibits the growth of GC cells (27,28). BMP-4 expression rate was inversely related to the prevalence of lymph node metastasis and tumor invasiveness (29).

Recently, two studies suggested that BMP8B may also be involved in the progression of GC. Mima et al. (30) reported that high BMP8B mRNA expression in the primary tumor was significantly associated with a shorter cancer-specific survival following a curative resection (p=0.007). And the multivariate analysis revealed that the prognostic power of BMP8B mRNA expression in the tumor was independent of other standard prognostic markers [hazard ratio (HR)=2.066; 95% confidence interval (CI)=1.132-3.772; p=0.018]. Wisnieski (31) demonstrated that BMP8B expression was reduced in GC compared to nontumor samples (p<0.01), and reduced BMP8B expression was associated with poorly differentiated GC (p=0.02). However, there is no research on the effect of BMP8B on the function of GC cells and its molecular mechanism.

In the present study, we aimed to examine the expression of BMP8B in GC compared to normal tissues, and its relationship with clinicopathological factors of patients. Moreover, we established a BMP8B knockdown model to determine its effect of on the function of GC cell lines.

Materials and Methods

Tumor samples from patients with gastric cancer. Primary tumor samples (n=319) together with paired adjacent normal tissues (n=182) were taken from patients with GC immediately after the surgery in Beijing Cancer Hospital. The tissues were kept at –80˚C until RNA extraction. All the patients had signed a written informed consent at the Beijing Cancer Hospital. The protocols and procedures of the tissue collection were approved by Peking University Cancer Hospital Research Ethics Committee. The pathological diagnoses and clinicopathological factors of patients were collected.

Analysis of BMP8B expression in human gastric cancer tissues using gene expression array data. We analysed the expression of BMP8B in GC tissues (n=274) compared to normal gastric tissues (n=33) in the TCGA database and its relationship with the clinicopathological parameters. In addition, TCGA database was analyzed to evaluate the correlation between BMP8B and key genes relevant to the hallmarks of cancer including proliferation, cell cycle, matrix metalloproteinases, and stemness. Heatmaps and scatter plots were used for presenting the results. Kaplan-Meier (KM) plotter analysis was also performed to evaluate the prognostic value of BMP8B in GC. The best cut-off was automatically selected and the most efficient and specific probe set for BMP8B, as recommended by KMplot, was employed.

Cell lines. HGC27 cell lines were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). The cell line was routinely cultured in Dulbecco’s modified Eagle medium (DMEM; Sigma-Aldrich, Poole, Dorset, UK) supplemented with 10% foetal bovine serum (FBS; HyClone™, Cytiva, Marlborough, MA, USA) at 37˚C under a 5% CO2 and 95% air.

RNA extraction and Reverse transcription-PCR (RT-PCR). Total RNA was isolated from tissues and cell lines using TRI Reagent kit (Sigma-Aldrich, Inc., Poole, Dorset, UK), according to the manufacturer’s instructions. The RNA concentration and quality were measured using an Implen Nanophotometer (Implen GmbH, München, Germany). Reverse transcription was performed using the GoScriptTM Reverse Transcription System (Promega, Southampton, UK), followed by PCR or quantitative real-time PCR (q-PCR). Cycling conditions for PCR were 95˚C for 5 min, followed by 30 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 30 s. GAPDH was used as a control.

Real-time quantitative PCR (q-PCR). Q-PCR for BMP8B and GAPDH were performed using the Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) with the following conditions: 94˚C for 2 min and then 40 cycles of 94˚C for 15 s and 55˚C for 1 min. The primers were as follows: BMP8B forward: CTGGTTGCTGAAGCGTCACAAG, reverse: AGT GACCACGAAAGGCTGTTGG; GAPDH forward: TGCACCACC AACTGCTTAGC, reverse: GGCATGGACTGTGGTCATGAG.

Western blot. The DC protein assay kit (Bio-Rad Laboratories, Hemel-Hempstead, UK) was used for determining the protein concentration. Proteins were then loaded and separated in SDS-PAGE and transferred onto PVDF membranes. Then, proteins were probed with either an antibody against BMP8B (ab230553, Abcam, Cambridge, UK) or GAPDH (sc-47724, Santa Cruz Biotechnology, Dallas, TX, USA) and corresponding secondary antibody. Protein bands were visualized using the Supersignal™ West Dura system (Pierce Biotechnology, Inc., Rockford, IL, USA), and photographed using an UVITech imager (UVITech, Inc., Cambridge, UK).

BMP8B knockdown. Lentiviral vectors carrying either BMP8B shRNA (GACCCTCACAACCACGTACAT) or scramble shRNA (CCTAAGGTTAAGTCGCCCTCG) were purchased from Cyagen Biosciences (Santa Clara, CA, USA). After a packaging of lentiviral particles with pMD2G and pSPAX2 plasmid vectors, HGC27 cells were transduced to establish BMP8B knockdown cells. G418 (500 μg/ml) was used for the selection. Q-PCR and western blot were employed to verify the expression of BMP8B in the transduced cells.

Cell proliferation assay. Cells were plated into 96-well plates (3,000 cells/well) and incubated at 37˚C with 5% CO2. Cells were then fixed in 4% formaldehyde at days 1, 3, and 5 after plating, and then stained with 0.1% crystal violet. Following washing, staining was extracted with 10% (v/v) acetic acid and the absorbance was read at a wavelength of 540 nm using a spectrophotometer (BIO-TEK, ELx800, Wolf Laboratories, York, UK).

Cell adhesion assay. 30,000 cells were seeded into each well of 96-well plates previously coated with Matrigel (BD Biosciences, Oxford, UK). Non-adherent cells were washed off with PBS buffer after 40 min of incubation, and adhered cells were then fixed with 4% formalin and stained with 0.5% crystal violet. Absorbance was measured at 540 nm after the staining was dissolved with acetic acid (10%).

Cell invasion assay. Transwell inserts with an 8.0 μm pore size membranes (Greiner Bio-One Ltd., Stonehouse, UK) were coated with 50 μg Matrigel airdried. After rehydration, 30,000 cells were added to each well of 24-well plates and incubated for 72 h at 37˚C. Cells that had invaded through the matrix to the other side of the insert were fixed with formalin (4%) and stained with crystal violet (0.5%).

Wound healing assays. Cells were seeded in six-well plates (2×106 per well) and allowed to adhere overnight. The layer of cells was then scraped with a 200 μl pipette tip to create a wound. After washing with 1×PBS, cell cultures were re-fed with fresh medium. The cells were allowed to move to close the wound for 5 h. Photographs of the wound were taken at 0 and 5 h at the same position.

Statistical analysis. Following a normality check, t-test was employed for normally distributed data whilst non-normally distributed data was analysed using Mann-Whitney test. All experiments were repeated three times, and the results are expressed as the mean±SD, p<0.05 was considered as statistically significant.

Results

BMP8B expression was up-regulated in the gastric cancer tissues. In the TCGA database, the expression of BMP8B at the mRNA level was significantly up-regulated in the GC tissues (n=274) compared with adjacent normal tissues (n=33) (Figure 1A). As shown in Figure 1B, the up-regulation of BMP8B in GC tissues is more pronounced in our own database from Beijing Cancer Hospital.

Figure 1 BMP8B expression in gastric cancer (GC) and its clinical relevance. (A) Expression of BMP8B transcripts in GCs (n=274) and normal tissues (n=33) in the TCGA GC cohort. (B) Expression of BMP8B transcripts in GCs (n=319) and normal tissues (n=182) in the Beijing Cancer Hospital cohort. Correlation between BMP8B mRNA expression and T stage (n=265) (C), N stage (n=262) (D), M stage (n=261) (E), TNM stage (n=245) (F) of GC in the TCGA cohort. (G) Correlation between BMP8B mRNA expression and differentiation (n=269). *p<0.05, **p<0.01; ***p<0.001.

To clarify the role of BMP8B in the progression of gastric cancer, we analysed the correlation between the expression of BMP8B and clinical pathological parameters in patients with GC in the TCGA database and found that poorly differentiated GC samples presented a significantly reduced BMP8B expression in relation to well differentiated and moderately differentiated GC (p=0.007) (Figure 1G). In GC tissues from the Beijing Cancer Hospital, although the difference of BMP8B expression between poorly differentiated adenocarcinoma and moderately differentiated adenocarcinoma did not reach statistical significance, a decreasing trend was also observed (0.00071±0.00035 vs. 0.00237±0.00107) (Table I). In addition, we found that the expression of BMP8B in signet ring cell carcinoma was significantly lower than that in adenocarcinoma (Table I). These results suggest that BMP8B is most likely to be involved in the differentiation of gastric cancer. However, BMP8B expression was not significantly correlated with T stage, N stage, and M stage of GC, in both TCGA database (Figure 1C-F) and our own cohort from Beijing Cancer Hospital (Table I).

Table I The expression of BMP8B transcripts in gastric cancer.

Numbers in each subgroup represent the number of samples that have both gene levels and clinical information.

KM plotter analysis (http://kmplot.com/) showed that patients with higher expression of BMP8B had shorter OS than those with low expression (n=876) (Figure 2A). In addition, higher expression of BMP8B was also related to poorer progression free survival (PFS) (n=641) (Figure 2B).

Figure 2 Higher BMP8B expression correlates with poorer overall survival of patients with gastric cancer (GC). (A) Kaplan-Meier survival analyses show correlations between BMP8B expression and overall survival of patients with GC using the online platform. The cut off value used in the analysis was 47. (B) Correlation between BMP8B expression and progression-free survival (PFS) of GC was analysed, and the cut off value used in the analysis was 47. (C) Evaluation of BMP8B expression in GC cell lines using PCR. BMP8B knockdown in HGC27 was confirmed using Q-PCR (D) and western blot (E), respectively. ***p<0.001. HR: Hazard ratio.

Evaluation of BMP8B expression in gastric cancer cell lines using PCR. We examined the expression of BMP8B in five GC cell lines (HGC27, MKN7, NUGC4, MKN45 and AGS) using PCR. Four cell lines had different degrees of expression (except AGS) and among them the HGC27 cell line had the strongest expression (Figure 2C).

BMP8B knockdown inhibits proliferation of GC cells in vitro. Knockdown of BMP8B was employed in HGC27 cells using shRNA, and the knockdown was confirmed using Q-PCR and western blot (Figure 2D and E). Then, we examined the effect of BMP8B on cell functions, including cell proliferation, adhesion, invasion, and migration. As shown in Figure 3A, a growth assay showed that BMP8B knockdown inhibited proliferation of HGC27 cells. The difference in proliferation between BMP8B knockdown HGC27 cell line and scramble control cells was observed on the third day and became more apparent on the fifth day.

Figure 3 BMP8B and tumor growth in gastric cancer (GC). (A) Cell proliferation assay was performed using HGC27BMP8B sh cells. Correlation between BMP8B mRNA expression and Ki67/PCNA was analysed using Spearman tests; results are shown as a heatmap (D) and scatter plots (B-C). Correlations between BMP8B mRNA expression and cell cycle regulators are shown as heatmap (D) and scatter plots (E). Three independent experiments were performed.

To explore the molecular mechanism of BMP8B in the progression of GC, the correlation between BMP8B and cell proliferation indices MKI67 and PCNA was determined. We found a significant positive correlation between BMP8B and Ki67 (Figure 3B-D). More importantly, we found that BMP8B was also significantly positively related to most of the cell cycle-promoting molecules, especially CCNE1, CDK2, CCNB2, CDK1, CCNB3, CCNA2, CCNB1 and CCNC (Figure 3D and E). The correlation between BMP8B and cell cycle inhibitor molecules P21 and P27 did not reach statistical significance, but there was a trend of negative correlation (Figure 3D and E). These results suggest that the BMP8B’s effect on GC cell proliferation is likely to be accomplished by regulating the cell cycle.

BMP8B knockdown promotes invasion and migration of GC cells in vitro. The adhesion assay showed that there was no significant difference in adhesion between the BMP8B knockdown HGC27 cell line and scramble control cells (Figure 4A). Invasion assay showed that BMP8B knockdown promotes invasion of GC cells (Figure 4B). In addition, wound healing assays showed that BMP8B knockdown cells had increased migratory capacity (Figure 4C). These results show that BMP8B knockdown promotes cell invasion and migration, which is different from its effect on cell proliferation.

Figure 4 BMP8B regulates the adhesion, invasion, and migration of gastric cancer (GC) cells. Cell adhesion assay (A) and transwell invasion assay (B) were performed to evaluate the impact of BMP8B on the adhesion and invasiveness of GC cell lines. Wound healing assays were performed using HGC27SC and HGC27BMP8B sh and semi-quantification of migration area was performed using Image J (C). Aberrant expression of BMP8B correlates with the EMT, MMPs and stemness in GC. Correlations between BMP8B mRNA expression and EMT markers, MMPs and stem cell markers are shown as heatmap (D) and scatter plots (E). (F) Correlation between BMP8B and EGFR in TCGA database. Three independent experiments were performed. **p<0.01.

We analyzed the correlation between the expression of BMP8B and some important molecules including EMT-related molecules (SNAI1, SNAI2, and TWIST1), matrix metalloproteinases (MMP2, MMP7, MMP9 and MMP14) and stemness markers (CD34, CD44 and CD133) in the TCGA database and GSE84433 database and found that BMP8B was significantly negatively correlated with MMP7, CD34 and CD44 in both databases (Figure 4D and E).

In addition, we found that the expression of BMP8B and EGFR were significantly positively correlated in the TCGA database (Figure 4F), indicating that EGFR may also be involved in the effect of BMP8B on gastric cancer.

Correlation between BMP8B and other BMPs and BMP receptors (BMPRs). We analysed the correlation between BMP8B and other BMPs and BMPRs in TCGA database, GSE84433 database, and GSE36139 database, and the results were consistent (Figure 5B). As shown in the Figure 5A, BMP8B has a significant positive correlation with BMP7, ACVR2B, ACVR2A, ALK7 and ALK6, while BMP8B has a significant negative correlation with ALK2, BMP6 and TGFBR2.

Figure 5 Correlations between BMP8B and other bone morphogenetic proteins (BMPs) and bone morphogenetic protein receptors (BMPRs). (A) The overlapping BMPs/BMPRs that are more closely associated with BMP8B in TCGA, GSE84433, and GSE36139 database are shown. (C) Correlations between BMP8B mRNA expression and other BMPs/BMPRs. Red represents positive correlation, and green represents negative correlation.

Discussion

Previous studies have shown that BMPs can regulate the homeostasis of the gastric epithelium (22,23,32), and also play an important role in the progression of GC through regulating the proliferation or invasion, migration of cancer cells (28,29,33-35). They may function as tumor-suppressors or tumor-promoters, depending on the different BMP ligands (29,30,36,37). For example, BMP-2 and BMP-4 suppress the proliferation of GC cells via the induction of p21 (36). BMP-4 expression rate was inversely related to the prevalence of lymph node metastasis and tumor invasiveness (29). BMP-7 promoted metastasis of GC and correlated with poor prognosis (37).

However, the role of BMP8B in GC remains uncertain because there have been only two relevant studies. Mima et al. (30) reported that higher BMP8B in the GC was significantly associated with poorer survival, and Wisnieski (31) demonstrated that BMP8B expression was reduced in GC compared to nontumor samples, and it was associated with differentiation of tumor. This study systematically analyzed the expression of BMP8B in GC compared to normal tissues, and its correlation with clinicopathological factors. In addition, the study is the first to explore the effect of BMP8B on the function of GC cell lines by establishing a BMP8B knockdown model. Our results contribute to understanding the mechanism of BMP8B involved in the disease progression of GC.

As mentioned above, only one research has compared the difference of BMP8B expression between GC and normal tissues. Wisnieski (31) detected the expression of BMP8B in 42 matched pairs of GCs and corresponding adjacent nontumor tissues, showing that BMP8B mRNA expression was significantly reduced in GC tissues (p<0.01). However, in this study, we found that the expression of BMP8B at the mRNA level was significantly up-regulated in the GC tissues compared with adjacent normal tissues in both TCGA database and our own database from Beijing Cancer Hospital. The difference may be related to ethnic differences, and different experimental conditions such as mRNA quantification methods may also have some impact on the results.

We found that the expression of BMP8B in GC is related to the prognosis of patients in the KM-plotter analysis. Higher expression of BMP8B correlated with both shorter OS and shorter PFS. This result is consistent with a previous report by Mima et al. (30), showing that high BMP8B mRNA expression was associated with a shorter survival of patients with GC following a curative resection. Furthermore, the multivariate analysis revealed that the prognostic power of BMP8B mRNA expression in the tumor was independent of other standard prognostic markers (HR=2.066; 95%CI=1.132-3.772; p=0.018) such as tumor size and the presence of the histological diffuse-type GC. However, we found that BMP8B expression was not significantly correlated with T stage, N stage and M stage of GC, in both TCGA database and our own cohort from Beijing Cancer Hospital, which was also consistent with a previous report by Mima et al. (30).

Pathologic grade classifies tumors into well, moderately, or poorly differentiated/anaplastic (38,39). Previous studies have shown that the degree of differentiation of tumor cells correlates with the aggressiveness of the tumor (40-43). Poorly differentiated tumors are more invasive than well and moderately differentiated tumors. And some studies reported (44) that histology types (differentiated or undifferentiated) are strong indicators of poor prognosis in node negative patients with GC. In the present study, we found that poorly differentiated GC samples presented a significantly reduced BMP8B expression compared to well-differentiated and moderately differentiated GC, and the expression of BMP8B in signet ring cell carcinoma was also significantly lower than that in adenocarcinoma. In addition, we can find the same result in Wisnieski’s research (31). Furthermore, a study has revealed that a BMP can modulate the differentiation of gastric cells by increasing pepsinogen II, a differentiation marker of the stomach (27). These results suggest that BMP8B is most likely to be involved in the differentiation of GC.

To explore the mechanism of BMP8B acting on GC cells, we established BMP8B knockdown model and performed the experiment in vitro, showing that BMP8B knockdown significantly inhibited proliferation of HGC27 cells. Cheng (45) has studied the effects of BMP8B on the proliferation of pancreatic cancer cell lines, and found that the over-expression of BMP8B inhibited cell growth and promoted activation of caspase-3 and -9, decreased the mitochondrial membrane potential, and inhibited PANC-1 cell apoptosis, while silencing the BMP8B gene expression with BMP8B shRNA exerted anti-apoptotic effects and boosted the growth of pancreatic cancer cells. It seemed that the effect of BMP8B on the proliferation of GC cell lines and pancreatic cancer cell lines may be reversed. In our research, we also found that BMP8B is significantly positively correlated with Ki67 and most cell cycle-promoting molecules. It is speculated that BMP8B’s promotion of GC cell proliferation is likely to be achieved by regulating the cell cycle. However, the specific mechanism needs further confirmation in further research.

To the best of our knowledge, there are no studies on the effect of BMP8B on cancer cell invasion and migration. We are the first to report that BMP8B knockdown promotes invasion and migration of GC cells. Furthermore, we found that BMP8B was significantly negatively correlated with MMP7 and stem cell markers CD34 and CD44. MMPs play an important role in local invasion and distant metastasis of tumors, and our previous studies have also confirmed that many BMP receptors, including ACVRL1, ACVR1, TGFBR1, BMPR1B and TGFBR2 were also related to the expression of various MMP2, MMP7 and MMP14 (46). Tumor stem cells are a group of tumor cells with self-renewal ability and multi-directional differentiation potential. Some studies showed that cancer stem cells might form the basis of cancer invasion and metastasis (47-49). Taken together, it was shown that BMP8B was significant negatively associated with MMP7 and stem cell markers CD34 and CD44, which may contribute to the regulation of GC invasion by BMP8B. In addition, we found that the expression of BMP8B and EGFR were significantly positively correlated in the TCGA database, indicating that EGFR may also be involved in the effect of BMP8B on GC.

In our previous research, we systematically analysed the expression and clinical significance of BMPs (BMP2-BMP7) and BMP receptors (BMPR) in TCGA GC database and Gene Expression Omnibus (GEO) database and explored the possible mechanism of action (46). We found that most of the BMPs and BMPRs may inhibit proliferation of GC cells, and also, promote disease progression through a promotion of invasion, EMT and stemness. Among the BMPs and BMPRs, ALK1, ALK5, ALK6, TGFBR2, TGFBR3 and BMPR2 had the most statistically significant effect. The results are contrary to the effect of BMP8B on GC cells in this study, which showed that BMP8B knockdown inhibited proliferation of GC cells, while promoted invasion and migration of GC cancer cells. Thus, we hypothesize that BMP8B is a different from other BMPs and BMPRs. Then we analysed the correlation between BMP8B and other BMPs and BMPRs in TCGA database, GSE84433 database, and GSE36139 database, and found that BMP8B has a significant positive correlation with BMP7, ACVR2B, ACVR2A, ALK7 and ALK6, while BMP8B has a significant negative correlation with ALK2, BMP6 and TGFBR2 in these three databases. In addition, BMP8B was found to be mostly negatively correlated with the majority molecules that may play a crucial role in GC, such as TGFBR2, TGFBR3, BMPR2 and ALK5. It can be hypothesized that the mechanism of BMP8B in GC is likely to be different from other BMPs and BMPRs, but the specific molecular mechanism needs to be further studied.

In conclusion, BMP8B expression was significantly up-regulated in GC tissues compared with adjacent normal tissues, and high BMP8B expression was associated with poor prognosis. BMP8B is most likely to be involved in the differentiation of gastric cancer. Poorly differentiated GC samples presented a significantly reduced BMP8B expression in relation to well-differentiated and moderately differentiated GC. BMP8B knockdown inhibited proliferation of GC cells, while promoted invasion and migration of cancer cells. These findings provide possible mechanisms of GC progression influenced by BMP8B, a potential therapeutic target for the treatment.

Funding

This study was funded by the National Natural Science Foundation of China. Grant/Award Number: 82103509.

Conflicts of Interest

The Authors have no conflicts of interest to disclose in relation to this study.

Authors’ Contributions

LY and WGJ designed the study. ZS, SC, XL, WGJ and LY did the experiments. ZS, SC, WGJ and LY contributed to data analyses. ZS, CS, WGJ and LY prepared the manuscript. ZS, SC, XL, WGJ and LY revised and proofread the article.

Acknowledgements

Dr Zhiwei Sun is a recipient of the Chinese Scholarship from Cardiff University. The authors thank the support for this collaborative research of GC from both Peking University and Cardiff University.
==== Refs
1 Yoon J Kim TY Oh DY Recent progress in immunotherapy for gastric cancer J Gastric Cancer 2023 23(1) 207 223 10.5230/jgc.2023.23.e10 36751000
2 Bang YJ Van Cutsem E Feyereislova A Chung HC Shen L Sawaki A Lordick F Ohtsu A Omuro Y Satoh T Aprile G Kulikov E Hill J Lehle M Rüschoff J Kang YK ToGA Trial Investigators Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomised controlled trial Lancet 2010 376(9742) 687 697 10.1016/S0140-6736(10)61121-X 20728210
3 Ma ES Wang ZX Zhu MQ Zhao J Immune evasion mechanisms and therapeutic strategies in gastric cancer World J Gastrointest Oncol 2022 14(1) 216 229 10.4251/wjgo.v14.i1.216 35116112
4 Zhuang Y Li L Wu H Fang T CircRNA ACVR2A sponges miR-1290 to modulate cell progression in gastric cancer J Oncol 2022 2022 9461054 10.1155/2022/9461054 35186081
5 Maeda S Hayashi M Komiya S Imamura T Miyazono K Endogenous TGF-beta signaling suppresses maturation of osteoblastic mesenchymal cells EMBO J 2004 23(3) 552 563 10.1038/sj.emboj.7600067 14749725
6 Moustakas A Heldin CH From mono- to oligo-Smads: The heart of the matter in TGF-β signal transduction: Figure 1 Genes Dev 2002 16(15) 1867 1871 10.1101/gad.1016802 12154118
7 Canalis E Economides AN Gazzerro E Bone morphogenetic proteins, their antagonists, and the skeleton Endocr Rev 2003 24(2) 218 235 10.1210/er.2002-0023 12700180
8 Nohe A Hassel S Ehrlich M Neubauer F Sebald W Henis YI Knaus P The mode of bone morphogenetic protein (BMP) receptor oligomerization determines different BMP-2 signaling pathways J Biol Chem 2002 277(7) 5330 5338 10.1074/jbc.M102750200 11714695
9 Nohe A Keating E Knaus P Petersen NO Signal transduction of bone morphogenetic protein receptors Cell Signal 2004 16(3) 291 299 10.1016/j.cellsig.2003.08.011 14687659
10 Khin SS Kitazawa R Win N Aye TT Mori K Kondo T Kitazawa S BAMBI gene is epigenetically silenced in subset of high-grade bladder cancer Int J Cancer 2009 125(2) 328 338 10.1002/ijc.24318 19326429
11 Fan Y Guo L Zheng H Ji C Wang W Sun H BMP-9 is a novel marker for colorectal tumorigenesis undergoing the normal mucosa-adenoma-adenocarcinoma sequence and is associated with colorectal cancer prognosis Oncol Lett 2020 19(1) 271 282 10.3892/ol.2019.11125 31897139
12 Cuellar A Inui A James MA Borys D Reddi AH Immunohistochemical localization of bone morphogenetic proteins (BMPs) and their receptors in solitary and multiple human osteochondromas J Histochem Cytochem 2014 62(7) 488 498 10.1369/0022155414535781 24789804
13 Ehata S Miyazono K Bone morphogenetic protein signaling in cancer; some topics in the recent 10 years Front Cell Dev Biol 2022 10 883523 10.3389/fcell.2022.883523 35693928
14 Kusafuka K Luyten FP De Bondt R Hiraki Y Shukunami C Kayano T Takemura T Immunohistochemical evaluation of cartilage-derived morphogenic protein-1 and -2 in normal human salivary glands and pleomorphic adenomas Virchows Arch 2003 442(5) 482 490 10.1007/s00428-003-0761-y 12707774
15 Tamada H Kitazawa R Gohji K Kitazawa S Epigenetic regulation of human bone morphogenetic protein 6 gene expression in prostate cancer J Bone Miner Res 2001 16(3) 487 496 10.1359/jbmr.2001.16.3.487 11277266
16 Guo D Huang J Gong J Bone morphogenetic protein 4 (BMP4) is required for migration and invasion of breast cancer Mol Cell Biochem 2012 363(1-2) 179 190 10.1007/s11010-011-1170-1 22167620
17 Ye L Kynaston H Jiang WG Bone morphogenetic protein-10 suppresses the growth and aggressiveness of prostate cancer cells through a Smad independent pathway J Urol 2009 181(6) 2749 2759 10.1016/j.juro.2009.01.098 19375725
18 Cao Y Slaney CY Bidwell BN Parker BS Johnstone CN Rautela J Eckhardt BL Anderson RL BMP4 inhibits breast cancer metastasis by blocking myeloid-derived suppressor cell activity Cancer Res 2014 74(18) 5091 5102 10.1158/0008-5472.CAN-13-3171 25224959
19 Clement JH Raida M Sanger J Bicknell R Liu J Naumann A Geyer A Waldau A Hortschansky P Schmidt A Hoffken K Wolft S Harris AL Bone morphogenetic protein 2 (BMP-2) induces in vitro invasion and in vivo hormone independent growth of breast carcinoma cells Int J Oncol 2005 27(2) 401 407 16010421
20 Katsuno Y Hanyu A Kanda H Ishikawa Y Akiyama F Iwase T Ogata E Ehata S Miyazono K Imamura T Bone morphogenetic protein signaling enhances invasion and bone metastasis of breast cancer cells through Smad pathway Oncogene 2008 27(49) 6322 6333 10.1038/onc.2008.232 18663362
21 Gautschi O Tepper CG Purnell PR Izumiya Y Evans CP Green TP Desprez PY Lara PN Gandara DR Mack PC Kung HJ Regulation of Id1 expression by Src: Implications for targeting of the bone morphogenetic protein pathway in cancer Cancer Res 2008 68(7) 2250 2258 10.1158/0008-5472.CAN-07-6403 18381431
22 Todisco A Regulation of gastric metaplasia, dysplasia, and neoplasia by bone morphogenetic protein signaling Cell Mol Gastroenterol Hepatol 2017 3(3) 339 347 10.1016/j.jcmgh.2017.01.014 28462376
23 Willet SG Mills JC Stomach organ and cell lineage differentiation: from embryogenesis to adult homeostasis Cell Mol Gastroenterol Hepatol 2016 2(5) 546 559 10.1016/j.jcmgh.2016.05.006 27642625
24 Nitsche H Ramamoorthy S Sareban M Pausawasdi N Todisco A Functional role of bone morphogenetic protein-4 in isolated canine parietal cells Am J Physiol Gastrointest Liver Physiol 2007 293(3) G607 G614 10.1152/ajpgi.00194.2006 17600042
25 Lopez-Diaz L Hinkle KL Jain RN Zavros Y Brunkan CS Keeley T Eaton KA Merchant JL Chew CS Samuelson LC Parietal cell hyperstimulation and autoimmune gastritis in cholera toxin transgenic mice Am J Physiol Gastrointest Liver Physiol 2006 290(5) G970 G979 10.1152/ajpgi.00461.2005 16399875
26 Maloum F Allaire JM Gagné-Sansfaçon J Roy E Belleville K Sarret P Morisset J Carrier JC Mishina Y Kaestner KH Perreault N Epithelial BMP signaling is required for proper specification of epithelial cell lineages and gastric endocrine cells Am J Physiol Gastrointest Liver Physiol 2011 300(6) G1065 G1079 10.1152/ajpgi.00176.2010 21415412
27 Wen XZ Miyake S Akiyama Y Yuasa Y BMP-2 modulates the proliferation and differentiation of normal and cancerous gastric cells Biochem Biophys Res Commun 2004 316(1) 100 106 10.1016/j.bbrc.2004.02.016 15003517
28 Wen XZ Akiyama Y Baylin SB Yuasa Y Frequent epigenetic silencing of the bone morphogenetic protein 2 gene through methylation in gastric carcinomas Oncogene 2006 25(18) 2666 2673 10.1038/sj.onc.1209297 16314833
29 Kim SG Park HR Min SK Choi JY Koh SH Kim JW Lee HW Expression of bone morphogenic protein-4 is inversely related to prevalence of lymph node metastasis in gastric adenocarcinoma Surg Today 2011 41(5) 688 692 10.1007/s00595-010-4320-2 21533942
30 Mima K Fukagawa T Kurashige J Takano Y Uchi R Ueo H Matsumura T Ishibashi M Sawada G Takahashi Y Akiyoshi S Eguchi H Sudo T Sugimachi K Watanabe M Ishii H Mori M Baba H Sasako M Mimori K Gene expression of bone morphogenic protein 8B in the primary site, peripheral blood and bone marrow of patients with gastric cancer Oncol Lett 2013 6(2) 387 392 10.3892/ol.2013.1392 24137334
31 Wisnieski F Leal MF Calcagno DQ Santos LC Gigek CO Chen ES Artigiani R Demachki S Assumpção PP Lourenço LG Burbano RR Smith MC BMP8B is a tumor suppressor gene regulated by histone acetylation in gastric cancer J Cell Biochem 2017 118(4) 869 877 10.1002/jcb.25766 27748538
32 Tong QY Pang MJ Hu XH Huang XZ Sun JX Wang XY Burclaff J Mills JC Wang ZN Miao ZF Gastric intestinal metaplasia: progress and remaining challenges J Gastroenterol 2024 59(4) 285 301 10.1007/s00535-023-02073-9 38242996
33 Kang MH Oh SC Lee HJ Kang HN Kim JL Kim JS Yoo YA Metastatic function of BMP-2 in gastric cancer cells: The role of PI3K/AKT, MAPK, the NF-κB pathway, and MMP-9 expression Exp Cell Res 2011 317(12) 1746 1762 10.1016/j.yexcr.2011.04.006 21570392
34 Chen Z Yuan L Li X Yu J Xu Z BMP2 inhibits cell proliferation by downregulating EZH2 in gastric cancer Cell Cycle 2022 21(21) 2298 2308 10.1080/15384101.2022.2092819 35856444
35 Huang JY Peng SF Chueh FS Chen PY Huang YP Huang WW Chung JG Melittin suppresses epithelial–mesenchymal transition and metastasis in human gastric cancer AGS cells via regulating Wnt/BMP associated pathway Biosci Biotech Bioch 2021 85(11) 2250 2262 10.1093/bbb/zbab153
36 Shirai YT Ehata S Yashiro M Yanagihara K Hirakawa K Miyazono K Bone morphogenetic protein-2 and -4 play tumor suppressive roles in human diffuse-type gastric carcinoma Am J Pathol 2011 179(6) 2920 2930 10.1016/j.ajpath.2011.08.022 21996676
37 Aoki M Ishigami S Uenosono Y Arigami T Uchikado Y Kita Y Kurahara H Matsumoto M Ueno S Natsugoe S Expression of BMP-7 in human gastric cancer and its clinical significance Br J Cancer 2011 104(4) 714 718 10.1038/sj.bjc.6606075 21224856
38 Li X Chen Z Lin J Wang S Song C Predicting overall survival in patients with nonmetastatic gastric signet ring cell carcinoma: a machine learning approach Comput Math Methods Med 2022 2022 4862376 10.1155/2022/4862376 36148015
39 Mo Q Wang Y Shan J Wang X Effect of postoperative radiotherapy in women with localized pure mucinous breast cancer after lumpectomy: a population-based study Radiat Oncol 2022 17(1) 119 10.1186/s13014-022-02082-7 35799256
40 Zhang Y Shi X Zhang J Chen X Zhang P Liu A Zhu T A comprehensive analysis of somatic alterations in Chinese ovarian cancer patients Sci Rep 2021 11(1) 387 10.1038/s41598-020-79694-0 33432021
41 Xiong Y Cao P Lei X Tang W Ding C Qi S Chen G Accurate prediction of microvascular invasion occurrence and effective prognostic estimation for patients with hepatocellular carcinoma after radical surgical treatment World J Surg Oncol 2022 20(1) 328 10.1186/s12957-022-02792-y 36180867
42 Pan Q Yang W Zhang Z Shao Z Rare bone metastasis of neuroendocrine tumors of unknown origin: a case report and literature review Orthop Surg 2022 14(10) 2766 2775 10.1111/os.13384 35856167
43 Sadula A Li G Xiu D Ye C Ren S Guo X Yuan C Clinicopathological characteristics of nonfunctional pancreatic neuroendocrine neoplasms and the effect of surgical treatment on the prognosis of patients with liver metastases: a study based on the SEER database Comput Math Methods Med 2022 2022 3689895 10.1155/2022/3689895 35720036
44 Saito H Kuroda H Matsunaga T Fukuda K Tatebe S Tsujitani S Ikeguchi M Prognostic indicators in node-negative advanced gastric cancer patients J Surg Oncol 2010 101(7) 622 625 10.1002/jso.21562 20461771
45 Cheng Z Cui W Ding Y Liu T Liu W Qin Y Xia W Xu J Zhang Y Zou X BMP8B mediates the survival of pancreatic cancer cells and regulates the progression of pancreatic cancer Oncol Rep 2014 32(5) 1861 1866 10.3892/or.2014.3413 25176058
46 Sun Z Liu C Jiang WG Ye L Deregulated bone morphogenetic proteins and their receptors are associated with disease progression of gastric cancer Comput Struct Biotechnol J 2020 18 177 188 10.1016/j.csbj.2019.12.014 31988704
47 Tang X Hao N Zhou Y Liu Y Ultrasound targeted microbubble destruction-mediated SOCS3 attenuates biological characteristics and epithelial-mesenchymal transition (EMT) of breast cancer stem cells Bioengineered 2022 13(2) 3896 3910 10.1080/21655979.2022.2031384 35109743
48 Dai Z Liu P High copy number variations, particular transcription factors, and low immunity contribute to the stemness of prostate cancer cells J Transl Med 2021 19(1) 206 10.1186/s12967-021-02870-x 33985534
49 Xuan SH Hua ML Xiang Z He XL Huang L Jiang C Dong P Wu J Roles of cancer stem cells in gastrointestinal cancers World J Stem Cells 2023 15(4) 209 220 10.4252/wjsc.v15.i4.209 37181004
