
==== Front
Microb Biotechnol
Microb Biotechnol
10.1111/(ISSN)1751-7915
MBT2
Microbial Biotechnology
1751-7915
John Wiley and Sons Inc. Hoboken

39235571
10.1111/1751-7915.70007
MBT270007
MICROBIO-2024-320-RAR.R2
Research Article
Research Article
Genomic characterization and identification of candidate genes for putative podophyllotoxin biosynthesis pathway in Penicillium herquei HGN12.1C
Podophyllotoxin production in Penicillium herquei
Nguyen et al.
Nguyen Duong Huy https://orcid.org/0000-0001-8313-3455
1
Tran Quang Ho 1 2
Le Lam Tung 1
Nguyen Ha Hong Thi 1
Tran Hoa Thi 1 2
Do Thuy Phuong 1
Ho Anh Ngoc 1 2
Tran Quang Hong 3
Thu Hien Thi Nguyen 1
Bui Van Ngoc 1 2
Chu Hoang Ha 1 2
Pham Ngoc Bich https://orcid.org/0000-0001-8148-901X
1 2 pbngoc@ibt.ac.vn

1 Institute of Biotechnology (IBT) Vietnam Academy of Science and Technology (VAST) Hanoi Vietnam
2 Graduate University of Science and Technology (GUST), VAST Hanoi Vietnam
3 Institute of Marine Biochemistry (IMBC), VAST Hanoi Vietnam
* Correspondence
Ngoc Bich Pham, Institute of Biotechnology (IBT), Vietnam Academy of Science and Technology (VAST), Hanoi, Vietnam.
Email: pbngoc@ibt.ac.vn

05 9 2024
9 2024
17 9 10.1111/mbt2.v17.9 e7000729 5 2024
15 8 2024
© 2024 The Author(s). Microbial Biotechnology published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.

Abstract

Previous studies have reported the functional role, biochemical features and synthesis pathway of podophyllotoxin (PTOX) in plants. In this study, we employed combined morphological and molecular techniques to identify an endophytic fungus and extract PTOX derivatives. Based on the analysis of ITS sequences and the phylogenetic tree, the isolate was classified as Penicillium herquei HGN12.1C, with a sequence identity of 98.58%. Morphologically, the HGN12.1C strain exhibits white colonies, short‐branched mycelia and densely packed hyphae. Using PacBio sequencing at an average read depth of 195×, we obtained a high‐quality genome for the HGN12.1C strain, which is 34.9 Mb in size, containing eight chromosomes, one mitochondrial genome and a GC content of 46.5%. Genome analysis revealed 10 genes potentially involved in PTOX biosynthesis. These genes include VdtD, Pinoresinollariciresinol reductase (PLR), Secoisolariciresinol dehydrogenase (SDH), CYP719A23, CYP71BE54, O‐methyltransferase 1 (OMT1), O‐methyltransferase 3 (OMT3), 2‐ODD, CYP71CU and CYP82D61. Notably, the VdtD gene in fungi shares functional similarities with the DIR gene found in plants. Additionally, we identified peltatin, a PTOX derivative, in the HGN12.1C extract. Docking analysis suggests a potential role for the 2‐ODD enzyme in converting yatein to deoxypodophyllotoxin. These findings offer invaluable insights into the synthesis mechanism of PTOX in fungi, shedding light on the relationship between host plants and endophytes.

Morphological features of Penicillium herquei HGN12.1C, an endophytic fungus capable of synthesizing podophyllotoxin (PTOX) derivatives. Colony morphology of HGN12.1C strain on PDA medium after 5 days of culture: (A) Top; (B) Reverse; (C) The fungal mycelium of HGN12.1C at 40× objective; (D) The fungal spore of HGN12.1C at 40× objective.

Vietnam Academy of Science and Technology 10.13039/100012046 TĐCNSH.01/20‐22 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:05.09.2024
Nguyen, D.H. , Tran, Q.H. , Le, L.T. , Nguyen, H.H.T. , Tran, H.T. , Do, T.P. et al. (2024) Genomic characterization and identification of candidate genes for putative podophyllotoxin biosynthesis pathway in Penicillium herquei HGN12.1C Microbial Biotechnology, 17 , e70007. Available from: 10.1111/1751-7915.70007 39235571

Duong Huy Nguyen and Quang Ho Tran have the equal contributions to this paper.
==== Body
pmcINTRODUCTION

Podophyllotoxin (PTOX) is an important natural product that has found extensive use in medicine and demonstrated effectiveness as an antimicrobial, antifungal and anticancer agent. PTOX can be obtained from various plant sources, such as Podophyllum (Berberidaceae), Anthriscus (Apiaceae), Callitris (Cupressaceae), Cassia (Fabaceae), Catharanthus (Apocynaceae), Commiphora (Burseraceae), Hernandia (Hernandiaceae), Hyptis (Verbenaceae), Juniperus (Cupressaceae), Linum (Linaceae), Polygala (Polygalaceae), Teucrium (Lamiaceae) and Dysosma (Berberidaceae) (Ardalani et al., 2017; Yu et al., 2017). Among these, the genus Podophyllum is considered the most common source for PTOX extraction (Motyka et al., 2023). In the Podophyllum species, PTOX has been found in different parts of the plant, including seeds, roots, fruits and leaves (Kumar et al., 2013; Liang et al., 2016; Yu et al., 2017). In roots, PTOX is produced by endophytic fungi, such as Trametes hirsuta (Puri et al., 2006), Fusarium solani (Nadeem et al., 2012) and Alternaria tenuissima (Liang et al., 2016).

As well as plant species, endophytic fungi could serve as potential sources of PTOX and novel bioactive compounds. Endophytic fungi are microbes that inhabit the inner tissues of healthy plants without causing harm to their hosts (Biswas et al., 2020; Gakuubi et al., 2021). Some studies have shown that endophytic fungi are capable of producing active substances similar to or identical to those synthesized by their host plants. These metabolites include alkaloids, coumarins, flavonoids, peptides, phenolic acids, quinones, saponins, terpenoids, xanthones and lignans (Gakuubi et al., 2021; Hashem et al., 2023; Singh et al., 2021). Endophytes can not only enhance the growth and development of plants but also play a crucial role in protecting their hosts against pathogens (Azar et al., 2023; Badawy et al., 2021; Ogbe et al., 2020; Zotchev, 2024). This indicates that endophyte communities and their hosts have physiological, nutritional and genetic interactions, suggesting the co‐evolution of plants and their endophytes (Pathak et al., 2022). In this way, they can exchange their genetic materials through horizontal gene transfer and share synthesis pathways for secondary metabolites (Alam et al., 2021).

In natural ecosystems, endophytes and their hosts coexist in complex genetic and ecological relationships. Previous studies have described the biosynthetic pathways of PTOX and identified genes and proteins involved in this process in plants (Arneaud & Porter, 2015; Chen et al., 2020; Kumari et al., 2017; Shah et al., 2021). Other studies reported that, in Podophyllum hexandrum, at least eight genes (DIR, PLR, SDH, CYP719A13, OMT3, CYP71CU1, OMT1 and 2‐ODD) are thought to play important roles in converting coniferyl alcohol to deoxypodophyllotoxin and its etoposide (Lau & Sattely, 2015; Li et al., 2021). However, the biochemical and molecular mechanisms governing the production of PTOX by fungi remain largely unexplored, especially with respect to endophytic isolates like Penicillium herquei. Recently, various tools and methods were used to identify, annotate and compare microbial genomes, such as internal transcribed spacer (ITS) sequence analysis, genome sequencing, comparative genomics, microarrays, next‐generation sequencing, metagenomics and metatranscriptomics (Kaul et al., 2016; Shankar & Sharma, 2022). These tools allow for the detection of the fungal genome as well as the comprehension of the close association between endophytes and their plant hosts.

Penicillium herquei, an endophytic fungus isolating in the healthy rhizome of Dysosma difformis (syn. Podophylum difforme) plants collected from Ha Giang Province, Vietnam, has been proven capable of producing PTOX (Tran et al., 2022). In this study, we identified and characterized the species Penicillium herquei using a combination of morphological characteristics and molecular identification. The genome sequence of Penicillium herquei was assembled, annotated and analysed using several bioinformatic tools. By identifying genomic features and examining PTOX derivatives, the study aimed to suggest candidate genes involved in the putative synthesis pathway of PTOX in Penicillium herquei.

EXPERIMENTAL PROCEDURES

Fungal strain and culture

Penicillium herquei HGN12.1C strains (VCCM44283) isolated from D. difformis are currently kept at −20°C at the Vietnam Academy of Science and Technology (VAST)—Culture Collection of Microorganisms (VCCM), Institute of Biotechnology, for this study.

Molecular and morphological identification of endophytic fungus

The internal transcribed spacer region (ITS) was utilized for the molecular classification and genus level identification of the endophytic fungus, following the method described by Tran et al. (2022). Briefly, the genome of the HGN12.1C strain was extracted using the G‐spinTM Total DNA Extraction Kit (INtRON, Korea), following the manufacturer's instructions. The ITS1‐18S‐ITS4 segment of fungal rDNA was amplified using the specific primers (ITS1: 5′‐TCCGTAGGTGAACCTGCGG‐3′ and ITS4: 5′‐TCCTCCGCTTATTGATATGC‐3′) and sequenced with the AEI PRISM @ 3700 Genetic Analyzer. Subsequently, the obtained nucleotide sequences were processed with PCGENE 3.1 software, and their regions were compared to the GenBank database (Genbank‐NCBI) via the BLAST SEARCH tool. Sequence identities greater than 99%, between 95% and 99% and ≤95% correspond to species, genus and family level classification, respectively (Landeweert et al., 2003).

For molecular identification, the ITS sequences of 16 different fungal isolates, including the Penicillium herquei HGN12.1C strain and 15 other sourced from Genbank‐NCBI (last accession date: 21 July 2023), were used to construct a phylogenetic tree. The additional strains included: Penicillium herquei (NR_103659.1), Penicillium herquei (MZ470422.1), Aspergillus tubingensis (XR_004775241.1), Aspergillus keveii (MF004311.1), Ascosphaera atra strain 693A (GQ867794.1), Penicillium salamii (NR_156542.1), Penicillium brevicompactum (MH047201.1), Penicillium roqueforti (NR_103621.1), Penicillium expansum (NR_077154.1), Penicillium solitum strain 20‐01 (JN642222.1), Penicillium brasilianum (NR_111499), Penicillium oxalicum strain 114‐2 (KF152942.1), Penicillium rolfsii (NR_111669.1), Penicillium herquei (MF537646.1) and Penicillium subrubescens (NR_111863.1). A phylogenetic tree was constructed for these fungi using MEGA‐X program with the maximum likelihood method and a bootstrap value of 1000 repetitions.

For species‐level identification, various microscopic characteristics, including colony morphological features, pigment production, hyphae, mycelium and septa, were examined using the AXIO A2 Imager Upright Microscope (Zeiss, Göttingen, Germany). The morphological classification was performed in accordance with the taxonomy keys provided by authors Nguyen (1982) and Klich (2002).

Preparation of fungal extract and compound isolation

Fungal extract was prepared according to the method described previously by Tran et al. (2022). Briefly, the strain HGN12.1C was shaken in 5000 mL of PDB medium (potato glucose broth): 2% D‐glucose (Germany); 20% (w/v) potatoes; pH 7 at 150 rpm, 25 ± 2°C for 5 days. Biomass and culture filtrate were collected separately through filter papers. Fresh biomass was dried at 45–60°C for up to 8 h (Medcenter Einrichtungen GmbH MC000724). Dried biomass was soaked in 500 mL of methanol organic solvent for 24 h, sonicated for 1 h at room temperature (33 MHz, Roop Telesonic, India), and repeated three times for collecting the biomass extract. After filtration, the fermented filtrate was evaporated to dryness in an evaporator system (Buchi evaporator system R‐300 Rotavapor, V‐300 vacuum pumper, B‐300 heating bath) to collect the culture filtrate extract. The mixture of biomass and culture filtrate extract was used for column chromatography.

Column chromatography

The dried methanolic extract from VN12C (45 g) was evenly distributed in water (500 mL) and partitioned successively with n‐hexane, methylene chloride and ethyl acetate (3 × 500 mL for each solvent) to obtain the corresponding extracts (195 mg, 2.577 g and 1.143 g, respectively), and the water layer remained.

The methylene chloride fraction (2.577 g) was subjected to a reverse‐phase silica‐gel column (ODS‐A, YMC), eluting with a gradient of MeOH‐H2O (1/2, v/v) up to 100% MeOH to afford eight fractions (D1 → D8). Fractions D5 and D6 show similar smears on TLC plates and were combined and further purified by preparative HPLC (Agilent 1260 Infinity II). Isocratic elution of acetonitrile‐H2O (66/34, v/v) yielded compound 1 (VN12C.03, 5 mg). Fractions D7 and D8 were combined based on TLC results and deployed on preparative HPLC with isocratic conditions of acetonitrile‐H2O 65/35, v/v, to obtain the D7C fraction. The fraction D7C was continuously isolated by Prep‐HPLC (isocratic of acetonitrile‐H2O 57/43, v/v) to yield compound 2 (VN12C.06, 6 mg).

Nuclear magnetic resonance (NMR)

Compounds were measured on an AVANCE NEO 600 FT‐NMR spectrometer (Bruker, Germany), Institute of Chemistry, Vietnam Academy of Science and Technology.

Genomic DNA extraction, library preparation, and genome sequencing

Fungal genomic DNA was extracted using the E.Z.N.A.® Fungal DNA Mini Kit (OMEGA, USA) following the manufacturer's instructions. The quantity and quality of the DNA product were assessed using Qubit™ dsDNA HS Assay Kits (QUBIT 3.0 Fluorometer) and by running 8% agarose gel electrophoresis, respectively. The fungal genomic DNA was diluted to 4 ng μL−1 with EB buffer, then sheared into small fragments of approximately 10 kb using The g‐TUBE™ (Covaris), and checked by the Bioanalyzer Agilent 2100 with Agilent DNA 12000 Kit (5067‐1508‐Agilent).

The library preparation was conducted using the SMRTbell Express Template Prep Kit 2.0 (100‐938‐900‐PacBio), followed by polymerase attachment and purification via the Sequel Binding and Internal Ctrl Kit 3.0 (101626‐600‐PacBio). Prior to loading onto the Sample Plate (000‐448‐888‐PacBio), the genomic DNA concentration was determined (9 pM) and set up using the Sample Setup software in the SMRTLink portal, version 9.0. Finally, the 12C genome was sequenced using PacBio SEQUEL with the Sequel SMRT Cell 1M v3 Tray chip (101‐531‐001—PacBio) and Sequel Sequencing Kit 3.0 (101‐597‐900—PacBio).

De novo assembly, quality assessment and annotation of functional genes

Raw reads from the fungal genome were de novo assembled using the Hierarchical Genome‐Assembly Process (HGAP) version 4 (Chin et al., 2013). Repeat sequences in the HGN12.1C genome were masked using the RepeatMasker tool on the Galaxy online platform (https://usegalaxy.eu/) to facilitate subsequent analysis (The Galaxy Community, 2022). Prediction of tRNA and rRNA genes was performed using tRNAscan‐SE (version 2.0, http://lowelab.ucsc.edu/tRNAscan‐SE/, accessed on 22 July 2023) and the barrnap tool on the Galaxy Australia server (https://usegalaxy.org.au/, accessed on 6 September 2023).

Ab initio gene identification for the HGN12.1C genome sequence was conducted using AUGUSTUS (version 3.4.0) within OmicsBox version 3.0 (https://www.biobam.com/omicsbox/), with Aspergillus fumigatus serving as the closely related reference species. The completeness of the HGN12.1C genome assembly was then evaluated using the BUSCO (version 5) program implemented on the gVolante web server (https://gvolante.riken.jp/analysis.html, accessed on 7 September 2023) against the fungi database (Nishimura et al., 2017).

The gene functional annotations were carried out with OmicsBox (version 3.0) using Blast2GO against NCBI's nonredundant (Nr), Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, with an E‐value threshold of e−05 InterProScan5 in OmicsBox was used to identify sequences that shared significant similarities with known protein sequences (the E‐value was set at e−10). Subsequently, the hierarchical classification of Gene Ontology (GO) terms, encompassing cellular component (CC), molecular function (MF) and biological process (BP), was then analysed and visualized using the OmicsBox tool.

Identification of genes associated with the biosynthesis of the PTOX in Penicillium herquei

To identify homologous genes in endophytic fungi, we used 10 genes involved in the PTOX production pathway in Podophyllum hexandrum. Their protein sequences were retrieved from the UniProtKB database (https://www.uniprot.org) using the following accession numbers: DIR (Q1ZZU9), PLR (B0LL23), SDH (A3F5F0), 2‐ODD (A0A0N9HQ36), OMT1 (A0A0N9HTA1), OMT3 (A0A0N9HMN6), CYP719A23 (L7T8H2), CYP71BE54 (A0A0N9HT29), CYP71CU1 (A0A0N9HTU1) and CYP82D61 (A0A0N7F297). For the VdtD gene, which is one of the genes involved in the biosynthesis of viriditoxin in fungi (Urquhart et al., 2019), its protein was downloaded from https://www.uniprot.org with accession number A0A443HK52. These proteins were then used to BLAST against the fully annotated Penicillium herquei protein sequences using the BLASTP tool (align two or more sequences) on NCBI with an E‐value threshold of e−05 (Altschul et al., 1990). Finally, proteins exhibiting an E‐value less than e−10 were selected for further characterization using the UniProtKB database (https://www.uniprot.org) and Pfam (http://pfam‐legacy.xfam.org/).

Molecular docking analysis and amino acid sequence alignment

To predict and investigate the binding interaction between the substrate and proteins, yatein was docked inside the active sites of selected proteins. In this study, four putative 2‐ODD proteins from the HGN12.1C genome were used for molecular docking evaluation: g9213.t1, g10191.t1, g10175.t1 and g4336.t1. The yatein structure was obtained from the PubChem database (CID 442835). The putative 3D models of the fungal 2‐ODD proteins were predicted using the UniProt AlphaFold protein structure database (https://alphafold.ebi.ac.uk/, accessed on 02/2024), while the 3D crystal structure of the plant 2‐ODD protein with PDB ID: 7E37 (Tang et al., 2022) was collected from the RCSB‐PDB (https://doi.org/10.2210/pdb7E37/pdb). Next, the Swiss PDB Viewer (https://spdbv.unil.ch/) was used for energy minimization of the 2‐ODD proteins. To prepare for molecular docking, water molecules and heteroatoms were removed, polar hydrogen atoms were added and charges were assigned. The prepared proteins were saved as PDBQT files and subjected to the docking process. Using AutoDock Vina ver 1.2.0 (Eberhardt et al., 2021), a grid size of 44.95 × 40.394 × 52.907 Å was selected, with grid centre coordinates set at −10.044, 22.617, and −5.9495 along the x‐, y‐ and z‐axes, respectively. Blind docking was performed with the grid box covering the whole protein and the default settings of nine output binding modes, an exhaustiveness of eight, and a 2 kcal/mol maximum energy difference. Finally, the results were visualized and analysed using UCSF ChimeraX 1.7.1 (https://www.cgl.ucsf.edu/chimerax/) and BIOVIA Discovery Studio Visualizer (https://www.3ds.com/products/biovia/discovery‐studio/visualisation).

Multiple alignment analysis of the amino acid sequences of the 2‐ODD proteins was performed using BioEdit version 7.7 (https://bioedit.software.informer.com/). The conserved binding domain was noted and highlighted in red in the docking structures of all docked 2‐ODD proteins.

RESULTS

Molecular identification and phylogenetic analysis of endophytic fungus

The endophytic fungal isolate was identified through sequencing the ITS1‐18S‐ITS4 nucleotide sequence as well as by describing its morphological and physiological features. Molecular identification relied on the highest similarity matches obtained from BLAST results. The top 20 blast hits of fungal ITS, along with their percent identity, are described in Table S1. The BLAST results showed that the endophytic fungus belonged to the Penicillium genus, with a minimum identity of 98.58%. Furthermore, a phylogenetic tree for 16 fungal species was constructed by the MEGA‐X program, confirming that the fungal isolate (HGN12C.1) belongs to Penicillium herquei (MZ470422.1) with a bootstrap value of 99% (Figure 1). It is clear that Penicillium herquei HGN12.1C was grouped into one cluster, which only consists of Penicillium herquei species (highlighted in yellow).

FIGURE 1 Bootstrap maximum‐likelihood phylogenetic trees of Penicillium herquei HGN12.C based on ITS region sequences in rRNA genes. Sequence alignment was performed using Clustal W in MEGA X. Bootstrap values obtained from 1000 replications of the dataset are displayed at the nodes.

Morphological and physiological features

The fungal isolate was cultured on PDB medium for 5 days at 25°C. We then examined its morphological characteristics under a microscope (Figure 2). After 5 days of incubation on PDB medium, the HGN12.1C colonies displayed the following features: moss‐green and cottony, with a white border and a slightly convex centre. The pigments diffused into the agar plate (Figure 2A), and the stem was dark yellow with a diameter of 2–3 cm (Figure 2B). The mycelium morphology of the HGN12.1C strain was short with branched, densely packed hyphae (Figure 2C). In their early stage, the phialides of the HGN12.1C strain produced globose and tear‐drop‐shaped spores, which became long chains upon maturity (Figure 2).

FIGURE 2 Colony morphology of HGN12.1C strain on PDA medium after 5 days of culture: (A) Top; (B) Reverse; (C) The fungal mycelium of HGN12.1C at 40× objective; (D) The fungal spore of HGN12.1C at 40× objective).

The HGN12.1C strain was tested for various physiological and biochemical characteristics, such as catalase production, motility, fermentation ability and growth conditions (temperature, oxygen and pH). The results revealed that the HGN12.1C strain possesses motility, can undergo aerobic fermentation, and has the ability to produce catalase enzymes. Optimal growth conditions for the HGN12.1C strain were observed at 25°C and a pH range of 5–7 (Table S2).

Based on its identifying characteristics, the HGN12.1C fungal strain was identified as Penicillium herquei HGN12.1C and deposited in the Vietnam Academy of Science and Technology Culture Collection of Microorganisms (VCCM) under accession number VCCM 44283.

Isolation of compounds from Penicillium herquei

By 1‐D (1H, 13C NMR) and 2‐D (HMBC) NMR elucidation, we have determined that the two purified compounds, namely compounds 1 (VN12C.03) and 2 (VN12C.06), are analogous to PTOX. In comparison with published NMR data, compounds VN12C.03 and VN12C.06 were analysed for NMR signals, proving that their structures are α‐peltatin and β‐peltatin, respectively, as follows (Figure S1A).

Compound VN12C.03 (α‐Peltatin): White powder

On the 1H NMR spectrum, there is a singlet signal of three aromatic protons at d 6.13 (1H, s, H‐8) and 6.36 (2H, s, H‐2′ and H‐6′), along with the signal of two methoxy groups at d 3.74 (6H, s, 3′,5′‐OCH3). Analysis of 13C NMR (Figure S1B) and HSQC 2D spectroscopy (Figure S1C) showed the presence of signals of 21 carbon atoms, including signals of a 5‐position benzene ring [d 119.8 (C‐4a), 138.7 (C‐5), 134.1 (C‐6), 148.2 (C‐7), 103.1 (C‐8), 132.5 (C‐8a)], a benzene ring substituted at positions 1,3,4,5 [d 132.8 (C‐1′), 108.9 (C‐2′ and C‐6′), 148.0 (C‐3′ and C‐5′) and 135.0 (C‐4′)], a carbonyl group at d 177.6 (C‐2a), 3 oxymethylene groups at d 73.6 (C‐3a), 27.0 (C‐4), and 101.9 (OCH2O), along with three methine groups at d 44.6 (C‐1), 48.2 (C‐2) and 33.4 (C‐3). These 1H and 13C NMR spectral signals suggest that compound VN12C.03 has a lignan framework, a fairly common phenolic form in plants.

To further confirm the attribution of positions and structures of compound VN12C.03, analysis of interactions on the HMBC spectrum was performed (Figure S1D). On the HMBC spectrum, the interaction between d 5.89 with C‐6 and C‐7 helps confirm the position of the OCHO group at position C‐6/C‐7. The positions of the 5‐site aromatic ring are confirmed through HMBC interactions from H‐8 to C‐4a, C‐5, C‐6, C‐7 and C‐8a. The position of the 1, 3, 4, 5 substituent benzene ring is also determined at C‐1 by HMBC interactions from H‐1 to C‐1′, from H‐2′ and H‐6′ to C‐1. In addition, HMBC interactions from H‐3a to C‐2, C‐2a, C‐3 and C‐4 confirm the coupling of the gamma‐lactone ring with the cyclohexane ring of the lignan framework at the C‐2/C‐3 position. The positions of two methoxy groups at C‐3′ and 5′ are confirmed by HMBC interactions from d 3.74 to C3′ and C‐5′.

Thus, VN12C.03 has been identified as α‐Peltatin, with the molecular formula C21H20O8 and a molecular weight of 400 g/mol.

Compound VN12C.06 (β‐Peltatin): White powder

On the 1H NMR spectrum, there is a singlet signal of three aromatic protons at d 6.12 (1H, s, H‐8) and 6.42 (2H, s, H‐2′ and H‐6′), along with the signal of three methoxy groups at d 3.73 (9H, s, 3′,4′,5′‐OCH3). Analysis of the 13C NMR (Figure S2A) and HSQC (Figure S2B) spectrum showed the presence of signals of 22 carbon atoms, including signals of a 5‐position benzene ring [d 120.5 (C‐4a), 139.4 (C‐5), 134.6 (C‐6), 148.7 (C‐7), 103.2 (C‐8), 132.8 (C‐8a)], a benzene ring substituted at positions 1,3,4,5 [d 138.7 (C‐1′), 109.5 (C‐2′ and C‐6′), 153.7 (C‐3′ and C‐5′) and 138.9 (C‐4′)], a carbonyl group at d 177.9 (C‐2a), 3 oxymethylene groups at d 74.0 (C‐3a), 27.8 (C‐4) and 102.4 (OCH2O), along with three methine groups at d 45.2 (C‐1), 48.3 (C‐2) and 34.0 (C‐3). These 1H and 13C NMR spectral signals suggest that compound 2 VN12C.06 has a lignan framework, similar to compound VN12C.03.

To further confirm the attribution of positions and structures of compound VN12C.06, analysis of interactions on the HMBC spectrum was performed (Figure S2C). Similar to compound 1 VN12C.03, on the HMBC spectrum, the interaction between d 5.90 and 5.89 with C‐6 and C‐7 helps confirm the position of the OCHO group at position C‐6/C‐7. The positions of the 5‐site aromatic ring are confirmed through HMBC interactions from H‐8 to C‐4a, C‐5, C‐6, C‐7 and C‐8a. The position of the 1,3,4,5 substituent benzene ring is also determined at C‐1 by HMBC interactions from H‐1 to C‐1′, from H‐2′ and H‐6′ to C‐1. In addition, HMBC interactions from H‐3a to C‐2, C‐2a, C‐3 and C‐4 confirm the coupling of the gamma‐lactone ring with the cyclohexane ring of the lignan framework at the C‐2/C‐3 position. The positions of the three methoxy groups at C‐3′, C‐4′ and C‐5′ are confirmed by HMBC interactions from d 3.73 to C3, C‐4′ and C‐5′.

Thus, we identified VN12C.06 as β‐Peltatin, with the molecular formula C22H22O8 and a molecular weight of 414 g/mol.

Main features of the Penicillium herquei genome

In this study, we sequenced the HGN12.1C strain's genome using a whole‐genome shotgun strategy with the PacBio long‐read single‐molecule real‐time (SMRT) sequencing platform at a coverage depth of 195.0×. Following de novo assembly of the sequencing data, we identified the entire genome of the HGN12.1C strain. It has an approximate size of 34.9 Mb, including 8 chromosomes, 1 mitochondrial genome, and a GC content of 46.5%. The largest chromosome measured 8.4 Mb, with an N50 value of 6.2 Mb. The de novo genome draft assembly of Penicillium herquei HGN12.1C is given in Table 1.

TABLE 1 Genomic features and assembly statistics of HGN12.1C strain.

Genome assembly	Values	
Total assembly size (~Mb)	34.9 Mb	
Total assembly size (≥1000bp)	34,960,691	
Total assembly size (≥50,000bp)	34,903,660	
Number of chromosomes (≥1000bp)	8	
Number of chromosomes (≥5000bp)	7	
Number of organelles	1	
Largest chromosome (~Mb)	8.4	
GC‐content (%)	46.5	
N50 (~Mb)	6.2	
L50	3	
Total predicted genes	12,871	
Genome coverage	195.0×	
Completeness evaluation (%)	
Completeness	98.3	
Complete and single‐copy BUSCOs	97.9	
Complete and duplicated BUSCOs	0.4	
Fragmented BUSCOs	1.1	
Missing BUSCOs	0.6	
Repeat annotation	
Unclassified (%)	0	
Simple repeat (%)	0.59	
Low complexity (%)	0.14	
Total repeat length (bp)	254,455	
RNA gene annotation	
mRNA	12,593	
tRNA	263	
rRNA	15	

To estimate the quality of the HGN12.1C genome assembly, we performed an evaluation using BUSCO (ver 5, fungi dataset), which revealed a high completeness of 98.3% (745 of 758 core genes). Our gene prediction analysis identified a total of 12,593 protein‐coding genes, with an average length of 1569.8 bp. Of these, 10,337 (82.09%) had more than five hits against the non‐redundant (NR) database. The HGN12.1C genome also contains 263 tRNA genes and 15 rRNA genes. Repeated sequences in the genome accounted for 254,455 bp, equivalent to 0.73% of the entire genome.

For gene annotation, we utilized OmicsBox with four databases (non‐redundant, InterProScan, Gene Ontology and Pfam). This annotation identified 10,629 genes (InterProScan), 10,568 genes (non‐redundant), 7673 genes (Gene Ontology) and 6784 genes (Pfam). Notably, Gene Ontology categorized 7673 genes (60.93% of the total annotated genes) into three main groups: cellular component (CC), molecular function (MF) and biological process (BP) (Figure 3).

FIGURE 3 Distribution of the top 15 gene ontology (GO) identified from the HGN12.1C strain genome according to Biological process (BP), Cellular component (CC), and Molecular function (MF).

Candidate genes coding enzymes in the PTOX biosynthesis of Penicillium herquei

To identify the key genes associated with the PTOX synthetic pathway in the HGN12.1C, we screened and explored candidate genes in the HGN12.1C genome using the BLASTP search (with an E‐value cut‐off of e−05) and 10 genes in plants and fungi (including the VdtD gene) as references. Accordingly, a total of 778 homologous unigenes were detected from the HGN12.1C genome, including 119 CYP71BE54, 118 SDH, 111 CYP82D61, 109 CYP719A23, 101 CYP71CU1, 49 VdtD, 27 OMT3, 23 OMT1, 7 2‐ODD and 5 PLR (Tables S3–S12, respectively). Next, we selected the BLAST hits with an E‐value <e−10 to characterize their function and verified them using the Pfam database. As a result, we obtained 517 unigenes encoding 10 enzymes similar to those found in plants (Table 2). Among them, VdtD, a gene found in fungi, has a similar function to the dirigent (DIR) gene in plants.

TABLE 2 Summary and characteristics of candidate genes identified in the HGN12.1C genome.

No.	Genes in plants and fungi	Unigenes in the HGN12.1C genome	
ID	Description	The number of genes	% identity (min, max)	Pfam code	Pfam description	
1.	SDH	Secoisolariciresinol dehydrogenase	91	21.7–35.9	adh_short_C2	Enoyl‐(Acyl carrier protein) reductases	
2.	CYP71BE54	Desmethyl‐deoxy‐podophyllotoxin synthase	79	21.0–31.9	P450	Cytochrome P450 family 71 subfamily BE polypeptide 54	
3.	CYP82D61	Demethylepipodophyllotoxin synthase	73	21.4–35.9	P450	Cytochrome P450 family 82 subfamily D polypeptide 61	
4.	CYP719A23	Pluviatolide synthase	70	20.7–33.9	P450	Cytochrome P450 family 719 subfamily A polypeptide 23	
5.	CYP71CU1	Desmethylyatein synthase	54	20.7–31.9	P450	Cytochrome P450 family 71 subfamily CU polypeptide 1	
6.	VdtD a	Inactive carboxylesterase‐like protein VdtD	48	21.6–39.1	COesterase	Carboxylesterase family	
7.	OMT3	Pluviatolide O‐methyltransferase	19	23.5–33.7	Methyltransf_2	O‐methyltransferase domain	
8.	OMT1	Desmethyl‐yatein O‐methyltransferase	12	24.1–32.5	Methyltransf_2	O‐methyltransferase domain	
9.	2‐ODD	Deoxypodophyllotoxin synthase	4	24.3–26.8	DIOX_N, 2OG‐FeII_Oxy	2OG‐Fe(II) oxygenase superfamily	
10.	PLR	Bifunctional pinoresinol‐lariciresinol reductase	1	26.7	NmrA	NmrA‐like family	
a Gene encodes a CoA‐esterase enzyme in fungi, which performs a function similar to that of a dirigent protein in plants (Hu et al., 2019).

As shown in Table 2, the gene group encoding the Cytochrome P450 enzyme family had the largest number of genes (276 out of 451 genes), followed by SDH (91 genes) and 2‐ODD (4 genes). Meanwhile, the PLR figure was the lowest, with a single gene. Additionally, we detected high similarity in unigene composition across the members of the Cytochrome P450 family, with a total of 34 shared unigenes (Figure S3).

In plants, there are several reaction steps involved in the production of the PTOX and its derivatives from coniferyl alcohol. Among these steps, the conversion of yatein to deoxypodophyllotoxin via the 2‐ODD enzyme is one of the crucial final reactions in this process. Thus, to explore how the 2‐ODD enzyme interacts with its substrates, we perform molecular docking between the 2‐ODD protein and the yatein substrate. In fungi, the four putative 2‐ODD proteins were chosen for analysis, including g9213.t1, g10191.t1, g10175.t1 and g4336.t1 (Table 3).

TABLE 3 Binding affinity of yatein substrate to 2‐ODD proteins.

	2‐ODD protein in plant (ID: 7e37)	Putative 2‐ODD proteins in the HGN12.1C genome (BLAST hits with E‐value < e−10)	Pose	
g9213.t1	g10191.t1	g10175.t1	g4336.t1	
Binding affinity score (kcal/mol)	−8.7	−6.5	−6.9	−6.4	−7.0	1	
−8.6	−6.3	−6.9	−6.2	−6.9	2	
−8.6	−6.2	−6.9	−6.2	−6.8	3	
−8.4	−6.1	−6.8	−6.1	−6.7	4	
−8.4	−6.1	−6.8	−6.1	−6.7	5	
−8.2	−6.1	−6.8	−6.1	−6.6	6	
−8.1	−6.0	−6.7	−6.1	−6.1	7	
−8.1	−6.0	−6.7	−6.0	−5.9	8	
−8.1	−6.0	−6.6	−6.0	−5.9	9	

Accordingly, yatein was docked inside the active sites of four putative 2‐ODD proteins from the HGN12.1C genome, including g9213.t1, g10191.t1, g10175.t1 and g4336.t1 (Table 3).

Molecular docking analysis revealed that the yatein substrate interacts with the g4336.t1 protein's active site (the 8th pose) in its 3D structure, with a binding affinity score of −5.9 kcal/mol (Table 3).

As shown in Figure 4, the most common types of interactions between the substrate and protein are hydrogen bonds and van der Waals attractions. Additionally, residues MET 252 and ARG 253 are involved in hydrophobic (alkyl) interactions, while ASP 249 exhibits two types of interactions: Pi‐Anion and van der Waals attractions. Notably, histidine (HIS 206) in the form of the 206HTDX55H264 motif triad (Figure S4) interacts with yatein via a carbon hydrogen bond (Figure 4).

FIGURE 4 Molecular docking of the g4336.t1 protein and substrate. (A) The model 3D structure of proteins shows the binding sites with active sites (red) and yatein (green). (B) The 2D interaction map of yatein with surrounding amino acids of the g4336.t1 protein. Ligand–protein interactions are marked by dashed lines.

DISCUSSION

Identification of the PTOX and its derivatives in the HGN12.1C Strain

Numerous studies have reported the extraction and structural detection of lignans from various plant sources using several methods, such as HPLC‐UV methods, HPLC‐ESI‐MS and NMR. In general, the dominant lignans found in plants include deoxypodophyllotoxin, yatein, PTOX, nemerosin, guayadequiol, matairesinol, peltatin and podophyllotoxone (Donoso‐Fierro et al., 2015; Fonseca et al., 1980; Orčić et al., 2021, 2022; Renouard et al., 2011; Zheljazkov et al., 2009). Our study aimed to provide information on the extraction and structural characterisation of lignan compounds from endophytic fungi through NMR elucidation. As a result, two compounds were found in the culture filtrate extract of the HGN12.1C strain, namely VN12C.03 and VN12C.06 (Figure S1A). Based on 1H and 13C NMR spectral signals, these compounds were identified as α‐peltatin and β‐peltatin with molecular formulas of C21H20O8 (400 g/mol) and C22H22O8 (414 g/mol), respectively. These structural data are consistent with previous studies in plants (Rashid et al., 2000; Shah et al., 2021; Yang et al., 2013).

In another study, Kusari et al. (2009) extracted and quantified deoxypodophyllotoxin from cultured Aspergillus fumigatus using LC–MS methods. They proposed the hypothesis that horizontal gene transfer (from the host plant to its fungal endophytes) could be involved in deoxypodophyllotoxin production (Kusari et al., 2009). According to Arroo et al. (2002), deoxypodophyllotoxin is considered a precursor in the biosynthesis of β‐peltatin and PTOX (Arroo et al., 2002). It has recently been proven that the PTOX is present in some genera, such as Penicillium, Trametes, Purpureocillium, Aspergillus, Ganoderma (Tran et al., 2022), and strain Fusarium proliferatum TQN5T (Nguyen et al., 2023). In this study, we only found peltatin without finding the PTOX or its other analogues, a result that might be due to technical issues during the fungal extract processing. Importantly, both alpha‐peltatin and beta‐peltatin are PTOX derivatives generated by modification of the B‐ring in the PTOX compound structure. They exhibit significant antiviral and antitumor activities (Motyka et al., 2023; Shah et al., 2021). Therefore, our finding provides important support for the hypothesis of a PTOX synthesis pathway in endophytic fungi.

Fungal genome and candidate genes potentially involved in the PTOX synthesis pathway in Penicillium herquei HGN12.1C

Recently, Penicillium herquei, a member of the genus Penicillium, has been known for the production of various secondary metabolites such as phenalenone derivatives (Yang et al., 2021; Yu et al., 2022), long‐chain polyenes (Long et al., 2023), acetaminophen derivatives (Zhou et al., 2019) and triene derivatives (Luo et al., 2021). However, there has been very little research focusing on genome sequencing, mining and searching for genes related to the biosynthesis of bioactive compounds in Penicillium herquei HGN12.1C. Our study is one of the few that has sequenced and annotated the whole genome of Penicillium herquei HGN12.1C with high quality. We found the genome size of Penicillium herquei (34.96 Mb) with a GC content of 46.38% was larger than that of other reported strains, such as Penicillium chrysogenum KF‐25 (29.92 Mb) (Peng et al., 2014), Penicillium chrysogenum HKF‐25 (31.48 Mb) (Gujar et al., 2018), Penicillium chrysogenum NCPC10086 (32.2 Mb) (Wang et al., 2014) and P. oxalicum strain I1R1 (30.8 Mb) (Pham et al., 2022). To the best of our knowledge, only one genome of the species Penicillium herquei (40.24 Mb) (Guo et al., 2023) has been assembled and annotated, and it is larger than our genome. This may be due to the differences in sequencing technology that greatly affect the genome size and number of generated contigs after assembly (Miyamoto et al., 2014). With the whole‐genome sequencing, we expect to discover the PTOX synthesis‐associated genes present in the genome of Penicillium herquei HGN12.1C.

Until now, the overall picture of the biosynthetic pathway of PTOX in plants has not been comprehensively elucidated. However, some important steps have been identified, in which most authors focus on exploring the genes and enzymes responsible for converting phenylalanine to deoxypodophyllotoxin and its derivative (Chen et al., 2020; Esmaeilzadeh Bahabadi et al., 2012; Javadian et al., 2017; Lau & Sattely, 2015). In this research, we recognized 10 potential genes in the HGN12.1C genome, involved in the production of the PTOX from coniferyl alcohol by annotation and sequencing of the fungal genome (Table 2).

In the initial stage of PTOX biosynthesis, dirigent proteins (DIR) play a pivotal role in directing the regio‐ and stereo‐selective formation of pinoresinol from two archiral molecules of coniferyl alcohol (Davin et al., 1997; Halls & Lewis, 2002). In our study, the DIR plant protein was not found in the HGN12.1C genome. Instead, we discovered a different protein, VdtD, which appears to have a similar function to DIR in plants. Hu et al. (2019) reported that VdtD acts like a dirigent protein to promote coupling stereoselectivity. This process was catalysed by the VdtB protein, a member of the multiple‐copper oxidase (MCO) superfamily with a role similar to that of plant laccases (Urquhart et al., 2019). The detection of VdtD protein from the HGN12.1C genome may offer new insights into the PTOX synthesis pathway in fungi, suggesting significant differences from plant pathways.

In the subsequent steps, pinoresinol undergoes a two‐step transformation to matairesinol. First, pinoresinol is converted to lariciresinol and secoisolariciresinol by PLR. Then, SDH oxidizes secoisolariciresinol to form matairesinol. This process has been observed in various plant species, including Forsythia intermedia, Podophyllum peltatum, Linum corymbulosum, Sinopodophyllum hexandrum and Isatis indigotica (Bayindir et al., 2008; Lau & Sattely, 2015; Xia et al., 2001; Xiao et al., 2015). Transcriptome analysis has revealed the presence of PLR and SDH homologues in the genomes of some plant species. For instance, Schisandra chinensis displays 4 PLR and 11 SDH homologous unigenes, while Anthriscus sylvestris shows 14 PLR and 8 SDH homologous unigenes. Notably, the HGN12.1C fungal strain shows a significantly distinct distribution of PLR and SDH homologous genes. SDH genes are predominant, with 91 genes identified, while PLR genes are comparatively fewer, with only one unigene at E‐value <e−10 and 5 unigenes at E‐value <e−05 (Table 2, Tables S4 and S12). The observed difference in the number of homologous unigenes between PLR and SDH in the HGN12.1C strain could be attributed to variations in PTOX biosynthesis between plants and fungi. There might also be unidentified intermediary metabolic steps in the fungal biosynthesis pathway that remain to be elucidated.

CYP719A23, CYP719A24, CYP71CU1, CYP71BE54 and CYP82D61 are members of the Cytochrome P450 protein family found widely in plants and fungi (Chen et al., 2014). In plants, both CYP719A23 and CYP719A24 are responsible for methylenedioxy bridge formation, a crucial step in generating pluviatolide from matairesinol (Marques et al., 2013). Through a series of steps, the enzymes OMT3, CYP71CU1, CYP71BE54 and CYP82D61 OMT1 and 2‐ODD facilitate the conversion of pluviatolide to desmethyl‐epipodophyllotoxin, an essential precursor for etoposide synthesis (Lau & Sattely, 2015). In this study, four enzymes (CYP719A23, CYP71CU1, CYP71BE54 and CYP82D61) belonging to the Cytochrome P450 (CYP) protein family were identified with the highest abundance (276 of 451 genes). Upset diagram analysis revealed that they shared over 43% of unigenes (34/79 genes) (Figure S3), making it challenging to pinpoint the specific CYP enzyme involved in each step of PTOX biosynthesis in fungi. Similarly, there is a substantial overlap between OMT1 and OMT3 unigenes discovered in the HGN12.1C genome (Table 2, Figure S5).

Docking analysis revealed an interaction between yatein and a histidine residue (located at site 206 within the 206HTDX55H264 motif) in the structure of the g4336.t1 protein. This motif, known as the HX (D/E) Xn H triad motif, plays a role in flavonoid and PTOX biosynthesis in plants (Cheng et al., 2014; Lazzarotto et al., 2019; Li et al., 2019). The interaction of the 206HTDX55H264 motif with yatein in the g4336.t1 protein suggests its potential role in facilitating the conversion of yatein to deoxypodophyllotoxin. This finding supports the hypothesis that the putative 2‐ODD protein (g4336.t1) may be involved in deoxypodophyllotoxin production in the HGN12.1C strain.

Deoxypodophyllotoxin serves as a precursor for the production of β‐peltatin and PTOX by the enzymes deoxypodophyllotoxin 6‐hydroxylase (DOP6H) and deoxypodophyllotoxin 7‐hydroxylase (DOP7H), respectively (Federolf et al., 2007; Kumari et al., 2014). Our NMR analysis confirmed the presence of α‐peltatin and β‐peltatin in the extract of the HGN12.1C fungus. This is one of the few studies to experimentally confirm the chemical structures of α‐peltatin and β‐peltatin in fungi using NMR analysis. These compounds exhibit structural similarities to α‐peltatin and β‐peltatin found in plants.

CONCLUSION

We have successfully sequenced and identified the endophytic fungal strain isolated from the Dysosma difformis plant as Penicillium herquei HGN12.1C. Based on the analysis and annotation of the HGN12.1C genome, we identified 10 genes potentially involved in PTOX and its derivatives. Importantly, we have elucidated the chemical structure of peltatin, an important derivative of PTOX, present in the extract of the HGN12.1C fungus. Additionally, docking analysis suggests an interaction between yatein and the putative 2‐ODD protein (g4336.t1), proposing the role of the 2‐ODD enzyme in the conversion of yatein to deoxypodophyllotoxin. This is one of the few studies to date that has not only identified the chemical structure of a PTOX derivative in fungi, but has also identified several genes with potential involvement in PTOX production. However, the significant differences in the number of PLR and ODD enzymes, and especially the discovery of a gene encoding a putative VdtD enzyme in the HGN12.1C genome, further highlight the potential differences in the PTOX biosynthesis pathway between fungi and plants. This requires further verification studies using experimental methods such as HPLC, LC–MS, gene coexpression analysis, and additional comparative studies with the other fungal genomes.

AUTHOR CONTRIBUTIONS

Duong Huy Nguyen: Conceptualization; methodology; data curation; software; visualization; writing – original draft; formal analysis. Quang Ho Tran: Methodology; resources; conceptualization; funding acquisition; methodology; data curation; writing – original draft. Lam Tung Le: Methodology; data curation; writing – original draft. Ha Hong Thi Nguyen: Methodology; investigation; formal analysis. Hoa Thi Tran: Conceptualization; methodology; writing – original draft. Thuy Phuong Do: Methodology; writing – original draft. Anh Ngoc Ho: Methodology; data curation; writing – original draft. Quang Hong Tran: Methodology; data curation; writing – original draft. Hien Thi Nguyen Thu: Data curation; writing – original draft; methodology. Van Ngoc Bui: Methodology; writing – review and editing. Hoang Ha Chu: Supervision; writing – review and editing; funding acquisition; project administration. Ngoc Bich Pham: Supervision; resources; funding acquisition; validation; writing – review and editing; project administration.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this article.

Supporting information

Tables S1–S12.

ACKNOWLEDGEMENTS

The authors are grateful to Mr. Ngo Hong Duong for the HGN12.1C genome submission and Dr. Hoang Dang Hieu for his contribution to the editing of the manuscript. This research is funded by Vietnam Academy of Science and Technology through Grant TĐCNSH.01/20‐22.

DATA AVAILABILITY STATEMENT

The whole genome sequence of Penicillium herquei HGN12.1C has  been deposited in the GenBank data with the accession number: GCA_039634405.1.
==== Refs
REFERENCES

Alam, B. , Lǐ, J. , Gě, Q. , Khan, M.A. , Gōng, J. , Mehmood, S. et al. (2021) Endophytic fungi: from symbiosis to secondary metabolite communications or vice versa? Frontiers in Plant Science, 12 , 791033.34975976
Altschul, S.F. , Gish, W. , Miller, W. , Myers, E.W. & Lipman, D.J. (1990) Basic local alignment search tool. Journal of Molecular Biology, 215 , 403–410.2231712
Ardalani, H. , Avan, A. & Ghayour‐Mobarhan, M. (2017) Podophyllotoxin: a novel potential natural anticancer agent. Avicenna Journal of Phytomedicine, 7 , 285–294.28884079
Arneaud, S.L.B. & Porter, J.R. (2015) Investigation and expression of the secoisolariciresinol dehydrogenase gene involved in podophyllotoxin biosynthesis. Molecular Biotechnology, 57 , 961–973.26289300
Arroo, R.R.J. , Alfermann, A.W. , Medarde, M. , Petersen, M. , Pras, N. & Woolley, J.G. (2002) Plant cell factories as a source for anti‐cancer lignans. Phytochemistry Reviews, 1 , 27–35.
Azar, N. , Liarzi, O. , Zavitan, M. , Samara, M. , Nasser, A. & Ezra, D. (2023) Endophytic Penicillium species secretes mycophenolic acid that inhibits the growth of phytopathogenic fungi. Microbial Biotechnology, 16 , 1629–1638.36700385
Badawy, A.A. , Alotaibi, M.O. , Abdelaziz, A.M. , Osman, M.S. , Khalil, A.M.A. , Saleh, A.M. et al. (2021) Enhancement of seawater stress tolerance in barley by the endophytic fungus Aspergillus ochraceus . Metabolites, 11 , 428.34209783
Bayindir, Ü. , Alfermann, A.W. & Fuss, E. (2008) Hinokinin biosynthesis in Linum corymbulosum Reichenb. The Plant Journal, 55 , 810–820.18489708
Biswas, D. , Biswas, P. , Nandy, S. , Mukherjee, A. , Pandey, D.K. & Dey, A. (2020) Endophytes producing podophyllotoxin from Podophyllum sp. and other plants: a review on isolation, extraction and bottlenecks. South African Journal of Botany, 134 , 303–313.
Chen, C.‐Y. , Liu, S.‐Y. , Yan, Y. , Yin, L. , Di, P. , Liu, H.‐M. et al. (2020) Candidate genes involved in the biosynthesis of lignan in Schisandra chinensis fruit based on transcriptome and metabolomes analysis. Chinese Journal of Natural Medicines, 18 , 684–695.32928512
Chen, W. , Lee, M.‐K. , Jefcoate, C. , Kim, S.‐C. , Chen, F. & Yu, J.‐H. (2014) Fungal cytochrome P450 monooxygenases: their distribution, structure, functions, family expansion, and evolutionary origin. Genome Biology and Evolution, 6 , 1620–1634.24966179
Cheng, A.‐X. , Han, X.‐J. , Wu, Y.‐F. & Lou, H.‐X. (2014) The function and catalysis of 2‐oxoglutarate‐dependent oxygenases involved in plant flavonoid biosynthesis. International Journal of Molecular Sciences, 15 , 1080–1095.24434621
Chin, C.‐S. , Alexander, D.H. , Marks, P. , Klammer, A.A. , Drake, J. , Heiner, C. et al. (2013) Nonhybrid, finished microbial genome assemblies from long‐read SMRT sequencing data. Nature Methods, 10 , 563–569.23644548
Davin, L.B. , Wang, H.‐B. , Crowell, A.L. , Bedgar, D.L. , Martin, D.M. , Sarkanen, S. et al. (1997) Stereoselective bimolecular phenoxy radical coupling by an auxiliary (Dirigent) protein without an active center. Science, 275 , 362–367.8994027
Donoso‐Fierro, C. , Tiezzi, A. , Ovidi, E. , Ceccarelli, D. , Triggiani, D. , Mastrogiovanni, F. et al. (2015) Antiproliferative activity of yatein isolated from Austrocedrus chilensis against murine myeloma cells: cytological studies and chemical investigations. Pharmaceutical Biology, 53 , 378–385.25420758
Eberhardt, J. , Santos‐Martins, D. , Tillack, A.F. & Forli, S. (2021) AutoDock Vina 1.2.0: new docking methods, expanded force field, and python bindings. Journal of Chemical Information and Modeling, 61 , 3891–3898.34278794
Esmaeilzadeh Bahabadi, S. , Sharifi, M. , Behmanesh, M. , Safaie, N. , Murata, J. , Araki, R. et al. (2012) Time‐course changes in fungal elicitor‐induced lignan synthesis and expression of the relevant genes in cell cultures of Linum album . Journal of Plant Physiology, 169 , 487–491.22218086
Federolf, K. , Alfermann, A.W. & Fuss, E. (2007) Aryltetralin‐lignan formation in two different cell suspension cultures of Linum album: deoxypodophyllotoxin 6‐hydroxylase, a key enzyme for the formation of 6‐methoxypodophyllotoxin. Phytochemistry, 68 (10 ), 1397–1406.17449073
Fonseca, S.F. , Rúveda, E.A. & McChesney, J.D. (1980) 13C NMR analysis of podophyllotoxin and some of its derivatives. Phytochemistry, 19 , 1527–1530.
Gakuubi, M.M. , Munusamy, M. , Liang, Z.‐X. & Ng, S.B. (2021) Fungal endophytes: a promising frontier for discovery of novel bioactive compounds. Journal of Fungi, 7 , 786.34682208
Gujar, V.V. , Fuke, P. , Khardenavis, A.A. & Purohit, H.J. (2018) Draft genome sequence of Penicillium chrysogenum strain HKF2, a fungus with potential for production of prebiotic synthesizing enzymes. 3 Biotech, 8 , 106.
Guo, W. , Wang, W. , Tang, J. , Li, T. & Li, X. (2023) Genome analysis and genomic comparison of a fungal cultivar of the nonsocial weevil Euops chinensis reveals its plant decomposition and protective roles in fungus‐farming mutualism. Frontiers in Microbiology, 14 , 1048910.36876094
Halls, S.C. & Lewis, N.G. (2002) Secondary and quaternary structures of the (+)‐Pinoresinol‐forming Dirigent protein. Biochemistry, 41 , 9455–9461.12135368
Hashem, A.H. , Attia, M.S. , Kandil, E.K. , Fawzi, M.M. , Abdelrahman, A.S. , Khader, M.S. et al. (2023) Bioactive compounds and biomedical applications of endophytic fungi: a recent review. Microbial Cell Factories, 22 , 107.37280587
Hu, J. , Li, H. & Chooi, Y.‐H. (2019) Fungal Dirigent protein controls the stereoselectivity of multicopper oxidase‐catalyzed phenol coupling in viriditoxin biosynthesis. Journal of the American Chemical Society, 141 , 8068–8072.31045362
Javadian, N. , Karimzadeh, G. , Sharifi, M. , Moieni, A. & Behmanesh, M. (2017) In vitro polyploidy induction: changes in morphology, podophyllotoxin biosynthesis, and expression of the related genes in Linum album (Linaceae). Planta, 245 , 1165–1178.28293732
Kaul, S. , Sharma, T. & Dhar, M.K. (2016) “Omics” tools for better understanding the plant–endophyte interactions. Frontiers in Plant Science, 7 , 955.27446181
Klich, M.A. (2002) Identification of common Aspergillus species. Utrecht, The Netherlands: American Society for Microbiology.
Kumar, A. , Patil, D. , Rajamohanan, P.R. & Ahmad, A. (2013) Isolation, purification and characterization of vinblastine and vincristine from endophytic fungus Fusarium oxysporum isolated from Catharanthus roseus . PLoS One, 8 , e71805.24066024
Kumari, A. , Singh, H.R. , Jha, A. et al. (2014) Transcriptome sequencing of rhizome tissue of Sinopodophyllum hexandrum at two temperatures. BMC Genomics, 15 , 871.25287271
Kumari, A. , Singh, D. & Kumar, S. (2017) Biotechnological interventions for harnessing podophyllotoxin from plant and fungal species: current status, challenges, and opportunities for its commercialization. Critical Reviews in Biotechnology, 37 , 739–753.27644897
Kusari, S. , Lamshöft, M. & Spiteller, M. (2009) Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro‐drug deoxypodophyllotoxin. Journal of Applied Microbiology, 107 , 1019–1030.19486398
Landeweert, R. , Leeflang, P. , Kuyper, T.W. , Hoffland, E. , Rosling, A. , Wernars, K. et al. (2003) Molecular identification of ectomycorrhizal mycelium in soil horizons. Applied and Environmental Microbiology, 69 , 327–333.12514012
Lau, W. & Sattely, E.S. (2015) Six enzymes from mayapple that complete the biosynthetic pathway to the etoposide aglycone. Science, 349 , 1224–1228.26359402
Lazzarotto, M. , Hammerer, L. , Hetmann, M. , Borg, A. , Schmermund, L. , Steiner, L. et al. (2019) Chemoenzymatic total synthesis of deoxy‐, epi‐, and podophyllotoxin and a biocatalytic kinetic resolution of dibenzylbutyrolactones. Angewandte Chemie, International Edition, 58 , 8226–8230.30920120
Li, C.‐Q. , Lei, H.‐M. , Hu, Q.‐Y. , Li, G.‐H. & Zhao, P.‐J. (2021) Recent advances in the synthetic biology of natural drugs. Frontiers in Bioengineering and Biotechnology, 9 , 691152.34395399
Li, J. , Zhang, X. & Renata, H. (2019) Asymmetric chemoenzymatic synthesis of (−)‐podophyllotoxin and related aryltetralin lignans. Angewandte Chemie, International Edition, 58 , 11657–11660.31241812
Liang, Z. , Zhang, J. , Zhang, X. , Li, J. , Zhang, X. & Zhao, C. (2016) Endophytic fungus from Sinopodophyllum emodi (wall.) Ying that produces podophyllotoxin. Journal of Chromatographic Science, 54 , 175–178.26306574
Long, K.Y. , Dai, D.C. , Zheng, C.J. , Wang, Y.T. , Song, X.M. , Chen, X. et al. (2023) Three new long‐chain polyenes from the mangrove‐derived fungus Penicillium herquei JX4. Journal of Asian Natural Products Research, 25 , 422–428.35930272
Luo, Z.‐W. , Tang, M.‐M. , Zhou, X.‐M. , Song, X.‐M. , Yi, J.‐L. , Zhang, B. et al. (2021) Five new triene derivatives from the fungus Penicillium herquei JX4. Chemistry & Biodiversity, 18 , e2100027.33738965
Marques, J.V. , Kim, K.‐W. , Lee, C. , Costa, M.A. , May, G.D. , Crow, J.A. et al. (2013) Next generation sequencing in predicting gene function in podophyllotoxin biosynthesis. The Journal of Biological Chemistry, 288 , 466–479.23161544
Miyamoto, M. , Motooka, D. , Gotoh, K. , Imai, T. , Yoshitake, K. , Goto, N. et al. (2014) Performance comparison of second‐ and third‐generation sequencers using a bacterial genome with two chromosomes. BMC Genomics, 15 , 699.25142801
Motyka, S. , Jafernik, K. , Ekiert, H. , Sharifi‐Rad, J. , Calina, D. , Al‐Omari, B. et al. (2023) Podophyllotoxin and its derivatives: potential anticancer agents of natural origin in cancer chemotherapy. Biomedicine & Pharmacotherapy, 158 , 114145.36586242
Nadeem, M. , Ram, M. , Alam, P. , Ahmad, M.M. , Mohammad, A. , Al‐Qurainy, F. et al. (2012) Fusarium solani, P1, a new endophytic podophyllotoxin‐producing fungus from roots of Podophyllum hexandrum . African Journal of Microbiology Research, 6 , 2493–2499.
Nguyen, L.D. (1982) Fungi. Hanoi, Vietnam: Science and Engineering, pp. 1–266.
Nguyen, G.T. , Nguyen, H.T.H. , Tran, H.T. , Tran, H.T. , Ho, A.N. , Tran, Q.H. et al. (2023) Enhanced podophyllotoxin production of endophyte Fusarium proliferatum TQN5T by host extract and phenylalanine. Applied Microbiology and Biotechnology, 107 , 5367–5378.37436482
Nishimura, O. , Hara, Y. & Kuraku, S. (2017) gVolante for standardizing completeness assessment of genome and transcriptome assemblies. Bioinformatics, 33 , 3635–3637.29036533
Ogbe, A.A. , Finnie, J.F. & Van Staden, J. (2020) The role of endophytes in secondary metabolites accumulation in medicinal plants under abiotic stress. South African Journal of Botany, 134 , 126–134.
Orčić, D. , Berežni, S. & Mimica‐Dukić, N. (2022) Quantitative HPLC–UV study of lignans in Anthriscus sylvestris . Molecules, 27 , 6072.36144804
Orčić, D. , Berežni, S. , Škorić, D. & Mimica‐Dukić, N. (2021) Comprehensive study of Anthriscus sylvestris lignans. Phytochemistry, 192 , 112958.34560578
Pathak, P. , Rai, V.K. , Can, H. , Singh, S.K. , Kumar, D. , Bhardwaj, N. et al. (2022) Plant‐endophyte interaction during biotic stress management. Plants, 11 , 2203.36079585
Peng, Q. , Yuan, Y. , Gao, M. , Chen, X. , Liu, B. , Liu, P. et al. (2014) Genomic characteristics and comparative genomics analysis of Penicillium chrysogenum KF‐25. BMC Genomics, 15 , 144.24555742
Pham, H.M. , Le, D.T. , Le, L.T. , Chu, P.T.M. , Tran, L.H. , Pham, T.T. et al. (2022) A highly quality genome sequence of Penicillium oxalicum species isolated from the root of Ixora chinensis in Vietnam. G3 (Bethesda, Md.), 13 , jkac300.
Puri, S.C. , Nazir, A. , Chawla, R. , Arora, R. , Riyaz‐ul‐Hasan, S. , Amna, T. et al. (2006) The endophytic fungus Trametes hirsuta as a novel alternative source of podophyllotoxin and related aryl tetralin lignans. Journal of Biotechnology, 122 , 494–510.16375985
Rashid, M.A. , Gustafson, K.R. , Cardellina, J.H., II & Boyd, M.R. (2000) A new podophyllotoxin derivative from Bridelia ferruginea . Natural Product Letters, 14 , 285–292.
Renouard, S. , Lopez, T. , Hendrawati, O. , Dupre, P. , Doussot, J. , Falguieres, A. et al. (2011) Podophyllotoxin and deoxypodophyllotoxin in Juniperus bermudiana and 12 other Juniperus species: optimization of extraction, method validation, and quantification. Journal of Agricultural and Food Chemistry, 59 , 8101–8107.21702435
Shah, Z. , Gohar, U.F. , Jamshed, I. , Mushtaq, A. , Mukhtar, H. , Zia‐UI‐Haq, M. et al. (2021) Podophyllotoxin: history, recent advances and future prospects. Biomolecules, 11 , 603.33921719
Shankar, A. & Sharma, K.K. (2022) Fungal secondary metabolites in food and pharmaceuticals in the era of multi‐omics. Applied Microbiology and Biotechnology, 106 , 3465–3488.35546367
Singh, A. , Singh, D.K. , Kharwar, R.N. , White, J.F. & Gond, S.K. (2021) Fungal endophytes as efficient sources of plant‐derived bioactive compounds and their prospective applications in natural product drug discovery: insights, avenues, and challenges. Microorganisms, 9 , 197.33477910
Tang, H. , Wu, M.‐H. , Lin, H.‐Y. , Han, M.‐R. , Tu, Y.‐H. , Yang, Z.‐J. et al. (2022) Mechanistic analysis of carbon–carbon bond formation by deoxypodophyllotoxin synthase. Proceedings of the National Academy of Sciences, 119 , e2113770119.
The Galaxy Community . (2022) The galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Research, 50 , W345–W351.35446428
Tran, T.H. , Nguyen, G.T. , Nguyen, H.T.H. , Tran, T.H. , Tran, H.Q. , Tran, H.Q. et al. (2022) Isolation and cytotoxic potency of endophytic fungi associated with Dysosma difformis, a study for the novel resources of podophyllotoxin. Mycobiology, 50 , 389–398.36404896
Urquhart, A.S. , Hu, J. , Chooi, Y.‐H. & Idnurm, A. (2019) The fungal gene cluster for biosynthesis of the antibacterial agent viriditoxin. Fungal Biology and Biotechnology, 6 , 9.
Wang, F.‐Q. , Zhong, J. , Zhao, Y. , Xiao, J. , Liu, J. , Dai, M. et al. (2014) Genome sequencing of high‐penicillin producing industrial strain of Penicillium chrysogenum . BMC Genomics, 15 , S11.
Xia, Z.‐Q. , Costa, M.A. , Pélissier, H.C. , Davin, L.B. & Lewis, N.G. (2001) Secoisolariciresinol dehydrogenase purification, cloning, and functional expression: implications for human health protection. The Journal of Biological Chemistry, 276 , 12614–12623.11278426
Xiao, Y. , Ji, Q. , Gao, S. , Tan, H. , Chen, R. , Li, Q. et al. (2015) Combined transcriptome and metabolite profiling reveals that IiPLR1 plays an important role in lariciresinol accumulation in Isatis indigotica . Journal of Experimental Botany, 66 , 6259–6271.26163698
Yang, S.‐Q. , Mándi, A. , Li, X.‐M. , Liu, H. , Li, X. , Balázs Király, S. et al. (2021) Separation and configurational assignment of stereoisomeric phenalenones from the marine mangrove‐derived fungus Penicillium herquei MA‐370. Bioorganic Chemistry, 106 , 104477.33279250
Yang, Z. , Liu, X. , Wang, K. , Cao, X. & Wu, S. (2013) Novel linear and step‐gradient counter‐current chromatography for bio‐guided isolation and purification of cytotoxic podophyllotoxins from Dysosma versipellis (hance). Journal of Separation Science, 36 , 1022–1028.23418155
Yu, J.S. , Jeong, S.Y. , Li, C. , Oh, T. , Kwon, M. , Ahn, J.S. et al. (2022) New phenalenone derivatives from the Hawaiian volcanic soil‐associated fungus Penicillium herquei FT729 and their inhibitory effects on indoleamine 2,3‐dioxygenase 1 (IDO1). Archives of Pharmacal Research, 45 , 105–113.35201589
Yu, X. , Che, Z. & Xu, H. (2017) Recent advances in the chemistry and biology of podophyllotoxins. Chemistry – A European Journal, 23 , 4467–4526.27726183
Zheljazkov, V.D. , Jones, A.M. , Avula, B. , Maddox, V. & Rowe, D.E. (2009) Lignan and nutrient concentrations in American mayapple (Podophyllum peltatum L.) in the eastern United States. HortScience, 44 , 349–353.
Zhou, X.‐M. , Zheng, C.‐J. , Song, X.‐M. , Tang, M.‐M. , Yang, J.‐Y. , Yang, X. et al. (2019) Bioactive acetaminophen derivatives from Penicillum herquei JX4. Fitoterapia, 139 , 104400.31669962
Zotchev, S.B. (2024) Unlocking the potential of bacterial endophytes from medicinal plants for drug discovery. Microbial Biotechnology, 17 , e14382.38345183
