
==== Front
Biomed Rep
Biomed Rep
BR
Biomedical Reports
2049-9434
2049-9442
D.A. Spandidos

BR-21-5-01838
10.3892/br.2024.1838
Articles
Single‑nucleotide polymorphisms in the promoter of the gene encoding for C‑reactive protein associated with acute coronary syndrome
Lopez-Roblero Alexander 1
Serrano-Guzmán Eleazar 12
Guerrero-Báez Rocío Stephania 1
Delgado-Enciso Iván 34
Gómez-Manzo Saúl 5
Aguilar-Fuentes Javier 6
Ovando-Garay Vivían 7
Hernández-Ochoa Beatriz 8
Quezada-Cruz Iliana Concepción 9
Lopez-Lopez Noe 1
Canseco-Ávila Luis Miguel 1
1 Diagnostic and Molecular Biomedicine Laboratory, Faculty of Chemistry Sciences, Campus IV, Autonomous University of Chiapas, Tapachula, Chiapas 30700, México
2 Regional High Specialty Hospital, Tapachula, Chiapas 30700, México
3 Cancerology State Institute, Colima State Health Services, Colima 28085, México
4 School of Medicine, University of Colima, Colima 28040, México
5 Genetic Biochemistry Laboratory, National Institute of Pediatrics, Ministry of Health, México City 04530, México
6 Faculty of Agricultural Sciences, Autonomous University of Chiapas, Huehuetán, Chiapas 30660, México
7 Faculty of Medicine, Campus IV, Autonomous University of Chiapas, Tapachula, Chiapas 30700, México
8 Immunochemistry Laboratory, Children's Hospital of México Federico Gómez, Ministry of Health, México City 06720, México
9 Faculty of Chemistry Sciences, Campus IV, Autonomous University of Chiapas, Tapachula, Chiapas 30700, México
Correspondence to: Dr Luis Miguel Canseco-Ávila, Diagnostic and Molecular Biomedicine Laboratory, Faculty of Chemistry Sciences, Campus IV, Autonomous University of Chiapas, St. Puerto Madero, S/N, Km 1.5, Tapachula, Chiapas 30700, México cansecoavila@gmail.com
11 2024
20 8 2024
20 8 2024
21 5 15024 10 2023
26 7 2024
Copyright: © 2024 Lopez-Roblero et al.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
Acute coronary syndrome (ACS) is a leading cause of mortality worldwide. Several studies have shown that certain single nucleotide polymorphisms (SNPs) are linked to the development of ACS. In particular, C-reactive protein (CRP) has emerged as an important predictive biomarker for cardiovascular disease. The current study aimed to investigate four polymorphisms of the CRP gene as possible biomarkers for ACS in a sample of 252 individuals (114 patients with ACS and 138 healthy controls) from Southeastern Mexico. Multivariate analysis adjusted for clinical variables showed that the polymorphism 3872CT for the genotype CC/CT [adjusted Odds Ratio (AdOR)=3.78; 95% Confidence Interval (CI): 1.11-12.92; P=0.034] and the genotype GG/GC of the polymorphisms 2667CG (AdOR=4.82; 95% CI: 1.69-13.72; P=0.02) were associated with ACS. However, the polymorphisms 3006AC genotype AA/AC and 5237GA genotype GG/GC were not found to be associated in the multivariate analysis with ACS (P>0.05). These results suggested that 3872CC/CT and 2667CC/CG polymorphism of the CRP gene plays a significant role in the development of ACS.

acute coronary syndrome
C-reactive protein
risk
polymorphisms
quantitative PCR
Funding: No funding was received.
==== Body
pmcIntroduction

Acute coronary syndrome (ACS) is a cardiovascular disease with a multifactorial etiology, which often involves acute myocardial infarction and unstable angina (1,2). Several factors have been linked to the development of ACS, including hypertension, diabetes, dyslipidemia, obesity, smoking, age, sex and genetic background (3). This disease imposes a heavy burden, particularly on developing countries, and is a leading cause of mortality in Mexico (4). According to the Instituto Nacional de Estadística y Geografia, in 2022 heart disease was the second cause of mortality in Mexico. In Southeastern Mexico the mortality rate is 15.9%, slightly below the national rate of 17.7% (5).

The diagnostic process of ACS is often complicated by its varied clinical features. Hence, some biomarkers, including troponins, creatine kinase MB (CK-MB), B-type natriuretic peptides, copeptin, C-reactive protein (CRP), IL-6, D-dimers and fibrinogen, have evolved as crucial instruments for the diagnosis ACS (6). CRP is an acute-phase protein that plays a key role in chronic and acute inflammation. It is used as a general biomarker of systemic inflammation and participates in the pathogenesis of cardiovascular diseases, such as endothelial dysfunction and atherosclerosis (7,8). CRP has been associated with the presence of coronary artery disease (CAD) (9) and a higher risk of future cardiovascular events in apparently healthy individual (10). Genetic polymorphisms in the interleukin genes as well as in the CRP gene have been associated with minor elevations in CRP (11). The single nucleotide polymorphisms (SNPs) in the promoter region, exon 2 and the 3' untranslated region (UTR) of the CRP gene have been reported to influence CRP serum levels (12-14); similarly, other SNPs have been shown to induce changes in transcription factor binding and gene promoter activity (15,16). The association of SNPs in the CRP gene with plasma CRP levels and cardiovascular disease has been reported in previous studies (17-19). A genome-wide association study found no association of variants in the CRP locus and cardiovascular hearth disease, but five genetic loci were strongly associated with CRP levels (20).

Another study in an American population found no association in 1059G/C polymorphism in the human CRP gene however, it suggested that genetic and environmental determinants each importantly contribute to the vascular risk associated with inflammation (21).

In the literature, the polymorphisms of the CRP gene 2667GG/GC (rs1800947), 3872CC/CT (rs1205), 5237GG/GA (rs2808630) and 3006AA/AC (rs3093066) are known to be associated with changes of the CRP production in vivo and cardiovascular diseases (22,23). However, it remains to be elucidated whether polymorphisms in the CRP gene are associated with susceptibility to ACS in patients of Mexico. For this reason, the current study analyzed the relationship between four SNPs of the CRP gene, namely 2667 GG/GC, 3872CC/CT, 5237GG/GA and 3006AA/AC, and ACS in a group of individuals from Southeastern Mexico.

Materials and methods

Subjects

The present retrospective and descriptive study included patients who attended the cardiology department at the Hospital Regional de Alta Especialidad-Ciudad Salud (HRAE-CS; Chiapas, Mexico) between March 2010 and December 2012. It included a cohort of 252 patients, 159 male (63.1%) and 93 female (36.9%), with an age range of 22-81 years and a median age of 53.5. In total, 114 patients were diagnosed with primary ACS according to the American College of Cardiology (ACA) criteria (24) and were included in the ACS group under the following criteria: i) Persistent chest pain for >20 min; ii) typical electrocardiographic changes including new pathologic Q waves; iii) ST-segment elevation of >1 mm; and iv) increased plasma levels of CK-MB >2-fold higher than the upper reference limit and/or troponin-T >0.1 µg/ml.

In parallel, 138 healthy individuals were included in the control group according to the ACA criteria (24): i) Individuals without a history of cardiovascular disease; and ii) individuals without evidence of other systemic diseases.

Based on their medical history, no subjects in the control group suffered from ACS or any related pathology. The age and sex of the control and the ACS groups were matched. The selection of patients is shown in the STROBE flow (Fig. 1). The current study was conducted in accordance with The Declaration of Helsinki. All participants provided written informed consent before taking their blood samples. The study was approved by the HRAE-CS Ethics Committee (approval no. 02/2010).

DNA extraction and genotyping

For each patient, 5 ml of blood was drawn into a purple top EDTA tube and stored at 4˚C for a maximum of 1 week to prevent degradation of nucleic acids. DNA was extracted from EDTA-treated venous blood samples using the QIAamp DNA Blood Mini kit (Qiagen GmbH) and stored at -20˚C until use. DNA was quantified in an Eppendorf 6131 Biophotometer (Eppendorf SE) and sample concentrations were adjusted to 50 ng/µl. Genotyping was performed in a StepOne Real-Time PCR System with the TaqMan Genotyping Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). Specific assays for the SNPs 3872C>T [rs1205; genotyping primer: ACTTCCAGTTTGGCTTCTGTCCTCA(C/T)AGTCTCTCTCCATGTGGCAAACAAG], 5237G>A [rs2808630; genotyping primer: AGGCCAGAGGCTGTCTACCAGACTA(G/A)GTATAGTAAGATGCAAGCAACTGAA], 2667C>G [rs1800947; genotyping primer: AGATGGTGTTAATCTCATCTGGTGA(C/G)AGCACAAAGTCCCACATGTTCACAT] and 3006A>C [rs3093066; genotyping primer: ATGTCACTGGCCTCATGCTTTGCAC(A/C)TTACAAAGTGAGTAATGTGTGCTGA] previously associated with cardiovascular disease (CVD) in the CRP gene (25) were purchased from Thermo Fisher Scientific, Inc. with ID C_7479334_10, C_12035003_10, C_11663840_10 and C_27452296_10, respectively. PCR protocol included initial denaturation 1 cycle at 95˚C for 10 min, followed by 40 cycles of denaturation at 95˚C for 15 seg and annealing/extension at 60˚C for 1 min. The genotyping was performed following the manufacturer's protocol. Genotype calls were made upon visualization of the allelic discrimination charts in which the clusters were identified.

Statistical analysis

Data are presented as mean ± standard deviation (age) or percentages. For inferential statistics, the normal distribution of the data was first determined using the Kolmogorov-Smirnov test and the equality of variances was confirmed using the Levene test. The age of the groups was compared using the Student's unpaired t-test. Fisher's exact test was used to compare categorical values. The association between various cardiovascular risk variables (age, male, diabetes, smoking, alcoholism, arterial hypertension, dyslipidemia, sedentary lifestyle and obesity), or CRP genotypes, with the presence of ACS was determined using odds ratios (OR) and 95% confidence intervals (95% CI) using univariate binary logistic regression analyses. Subsequently, significant predictors were added to the multivariate model and with forward stepwise logistic regression the most parsimonious model was identified. The probability used for the stepwise regression was set at 0.15 for variable input and 0.25 for removal. Analysis involving a two-way interaction (A x B, where A and B are the genotypes 2667CC/CG and 3872CC/CT) was made in a separate multivariate model that did not include genotypes of other polymorphisms. The multivariate analysis was considered pertinent because various metabolic and vascular disorders have been previously reported to be associated with both the exposure variable of interest (CRP genotypes) and the outcome variable (ACS) (26-29). Multivariate logistic regression allowed for the necessary statistical adjustments for probable confounding variables, resulting in an adjusted OR (AdOR). Data were analyzed using SPSS V.21 (IBM Corp.) apart from linkage disequilibrium (LD) and haplotype analyses, which were performed using SNPStats software (30). P<0.05 was considered to indicate a statistically significant difference.

Results

Main clinical characteristics in ACS

Demographic and clinical parameters of the patients with ACS and control group are presented in Table I. In total, 252 participants were included in the present study. Male individuals were the majority in both groups, with 55.8% in the control and 71.9% in the ACS group. Significant differences were found between the group control and ACS in age, sex, T2DM, smoking, alcohol, HBP, dyslipidemia and sedentary lifestyle (P<0.05). On the other hand, the obesity incidence was not found significantly different (P=0.876). Except for T2DM, the aforementioned variables are considered risk factors for ACS.

Genotype of the C-reactive protein in ACS

Allele and genotype frequencies of the four polymorphisms in the patients with ACS and controls were in Hardy-Weinberg equilibrium (P>0.05; data not shown). The frequency of the genotypes 2667CC/CG, 3872CC/CT, and 3006AA/AC were significantly higher in the group of patients with ACS, compared with the control group (26.1 vs. 57.0%, P<0.001; 66.7 vs. 80.7%, P=0.015; and 8.0 vs. 16.7%, P=0.049; respectively). The genotype 5237GG/GA did not show a statistical significance between groups (P=0.467; Table II). Furthermore, the analysis involved a two-way interaction between the 2667*3872 polymorphisms, showing that the combination of genotypes 2667CC/CG*3872CC/CT was significantly higher in the group with ASC (43.0%) compared with the control group (18.1%) (P<0.001; Table II).

Association of C-reactive protein polymorphisms with acute coronary syndrome

The univariate logistic regression analysis showed that age, maleness, T2DM, smoking, alcohol, HBP, dyslipidemia and sedentary lifestyle were factors associated with ACS (Table III). The multivariate analysis reveals that only age, T2DM, alcohol, HBP and sedentary lifestyle had an association with ACS (Table III). The univariate model reveals that genotypes 2667CC/CG, 3872CC/CT and 3006AA/AC were ACS-associated (OR=3.75, 95% CI: 2.21-6.39; OR=2.09, 95% CI: 1.16-3.75; and OR=2.3, 95% CI: 1.04-5.08, respectively; Table III). The multivariate model showed that genotypes 2667CC/CG (AdOR=4.82, 95% CI: 1.69-13.72) and 3872CCGG/CTGA (AdOR=3.78, 95% CI: 1.1-12.92) remain associated to ACS independently of other clinical variables or genotypes analyzed; while the 3006AA/AC genotype lost relevance and was not included in the multivariate model. The interaction of the 2667CC/CG and 3872CC/CT genotypes increased the risk for ACS in the univariate and multivariate model (OR=3.40, 95% CI: 1.92-6.02; and AdOR=4.14, 95% CI: 1.49-11.52, respectively). However, the probability of developing ACS generated by this combination of genotypes was not higher than that generated by the 2667CC/CG genotype alone (Table III).

Haplotype analysis and LD

The most frequent haplotype in the population was H1 T/A/G/C, with 29.15% of occurrence, followed by H2 C/A/G/C with 28.46%, H3 C/A/C/C with 11.92% and H4 T/A/C/C with 10.68%; together, they represent 80.21% of the total haplotypes. Due to the frequency of the remaining haplotypes in the population, only four were analyzed. Haplotypes numbers H2, H3, and H4 showed an association with risk of ACS (OR=14.86, 95% CI: 2.62-84.15, P=0.0026; OR=29.98, 95% CI: 4.38-205.34, P=7x10-4 and OR=100.56, 95% CI: 4.64-2177.88, P=0.0037 respectively) after adjusting for age, sex and other clinical variables (T2DM, smoking, alcohol, hypertension, dyslipidemia, sedentary lifestyle and obesity), as shown in Table IV. The polymorphism 3006 exhibited a strong LD with 3872 and 2667 (with D 0.0143, D'=0.4556, P=0.006; and D=0.0184, D'=0.4402, P<0.001, respectively), as shown in Fig. 2. The genotype 3006AA/AC rs3093066 was associated with ACS in the univariate model. This polymorphism was previously associated with CRP levels in Caucasian American and African American young adults (25). However, this polymorphism does not seem to be an independent risk factor for the genesis of ACS in the population in the present study, since other clinical or genetic factors studied here make it lose relevance in a multivariate analysis. A probable explanation for this fact is that polymorphism 3006 exhibited a strong LD with 3872 and 2667 (with D=0.0143, D'=0.4556, P<0.05; and D=0.0184, D'=0.4402, P<0.05, respectively). This means that the alleles of the 3006 polymorphisms are nonrandomly associated with the alleles at nearby polymorphic sites 3872 and 2667. Therefore, it is likely that the 3006AA/AC genotype is not an independent risk factor, but rather a ‘linked or predicted’ factor by the genotypes 2667CC/CG and 3872CC/CT, an aspect that was detected in the multivariate model.

Discussion

Clinical parameters

ACS is a spectrum of myocardial ischemic disorders, including myocardial infarction with ST-segment elevation, myocardial infarction with non-ST segment elevation and unstable angina, with a multifactorial origin. In addition, previous works have linked genetic polymorphisms with the development of ACS (13,14,31). The present study analyzed the association between four polymorphisms in the promoter region of the CRP gene and ACS in a group of individuals from Southern Mexico. In the present study variables such as age, maleness, T2DM, alcohol consumption, smoking, HBP, dyslipidemia and sedentary lifestyle showed significant differences between the groups (Table I), a result which is consistent with previous reports (16,32-34). Hypertension, dyslipidemia and smoking are the three modifiable risk factors most strongly and independently associated with coronary heart disease (CHD) (35). Recently, a study showed that factors such as age 70 years old, femaleness sex, HBP, T2DM and hypertension are more frequent in patients with combined endpoint (cardiovascular mortality, mortality from stroke, myocardial infarction and stroke/transient ischemic attack in 10-year follow-up) in comparison with the control group in German patients (P<0.05) (36). DM is linked with comorbidities such as CAD (37) and represents 25-30% of the patients with ACS. Patients with ACS and DM, present poorer outcomes regarding CV morbidity and mortality, compared with individuals with ACS but not with DM. In addition, T2DM prolongs hospitalization time in patients with ACS and disruption of the normal glucose homeostasis has been found in ~70-75% of patients with CAD (38).

CRP polymorphisms and ACS

Few studies have been conducted in the Hispanic population to establish an association between gene polymorphisms and ACS. In the present study, the genotype 3872CC/CT (rs1205) was found to be a risk factor for ACS (AdOR=3.78; 95% CI: 1.11-12.92, P=0.034). The only study conducted in Mexico with this SNP did not show any association with ACS in individuals from Western Mexico; however, the allele T is associated with lower CRP concentration (38). 3872CT has been associated with low levels of CRP (33,39-42) myocardial infarction (33) and CHD (12), but other studies have not shown an association with CHD (40) or aortic stenosis (30). The current results reported that the 5237GG/AA genotype did not show an association with ACS (OR=1.04; 95% CI: 1.60-1.79, P=0.884); which agrees with a previous report (12).

The 2667CC/CG genotypes (rs1800947) were found to be a risk factor for ACS in the present study population (AdOR=4.82, 95%CI: 1.69-13.72, P=0.003). These polymorphisms have been associated with CHD (43), coronary artery disease (44), myocardial infarction (45), cerebrovascular ischemia-related disease (46), cardiovascular disease mortality (23) and other diseases such as diabetes (47), prostatic (48) and colorectal cancer (49) and microangiopathic stroke (50). In addition, other investigations have not found an association (33,15,51,52). Allele G from rs1800947 has been associated with low CRP levels in coronary artery disease (44), myocardial infarction (53) and adverse cardiovascular (54).

The genotype 3006AA/AC rs3093066 was associated with ACS in the univariate model. This polymorphism was previously associated with CRP levels in European American and African American young adults (25). However, this polymorphism does not seem to be an independent risk factor for the genesis of ACS in the present population, since other clinical or genetic factors studied here make it lose relevance in a multivariate analysis. A probable explanation for this is that polymorphism 3006 exhibited a strong LD with 3872 and 2667 (with D=0.0143, D'=0.4556, P<0.05; and D=0.0184, D'=0.4402, P<0.05, respectively). This meant that the alleles of the 3006 polymorphism were non-randomly associated with the alleles at nearby polymorphic sites 3872 and 2667. Therefore, it is likely that the 3006AA/AC genotype is not an independent risk factor, but rather a ‘linked or predicted’ factor by the genotypes 2667CC/CG and 3872CC/CT, an aspect that was detected in the multivariate model. The LD between polymorphism 3006 with polymorphisms 3872 and 2667 may reflect the natural selection history, gene conversion and mutation history of the analyzed population (from Chiapas, southeast of Mexico) (55), which although it can be classified as mestizo (individuals of mixed ancestry with a European and an indigenous background), has a strong Mayan ethnological and linguistic affiliations (56). Future analyses will be necessary in this respect. On the other hand, the present results showed that haplotype numbers H2 (C/A/G/C), H3 (C/A/C/C) and H4 (T/A/C/C) showed an association with risk ACS. Similar results have been shown in the US population (12).

Polymorphisms in the CRP promoter region would increase the risk of ACS by favoring an elevation of this protein, which is a clear sign of systemic inflammation (57,58). The expression of the CRP gene is modulated by several SNPs in the promoter region and these SNPs affects changes in gene promoter activity, RNA structure or turnover, transcription factor binding and transcriptional activity (25,59). The mechanisms by which SNP 2667 affects the expression of CRP are unclear, so it remains possible that 2667 is in strong LD with a polymorphism in a distal regulatory element not within the region scanned for polymorphisms (25). However, a study showed that the minor alleles of the 2667 and 3872 polymorphisms linked with CRP haplotypes are associated with decreased promoter activity (23). As aforementioned, several SNPs have been associated with CHD and with CRP levels. CRP is an inflammatory marker associated with cardiovascular disease, T2DM and other pathology. It is probable that CRP genotypes affect CRP synthesis and influence the onset of clinical CVD or ACS (23).

Due to the aforementioned factors, it is hypothesized that the number of subjects included in the present study may be a limitation. However, the results shown can be considered reliable, considering that it has previously been postulated that it is necessary to have ≤10 individuals with the event of interest for each predictor variable included in logistic regression models (60) to improve the performance of the model and reduce the risk of false positive results. In the multivariate logistic regression model performed in the present study (Table III), eight predictor variables were included in the multivariate model, analyzing 114 individuals with ACS and 138 subjects in the control group. Therefore, the present study complied with the rule of having ≤10 events per variable. However, some reports have suggested that this rule is controversial (61,62). Another limitation was that the serum levels of CRP were not determined in the participants, so it would be relevant for future research to quantify this protein to evaluate whether the risk conferred by certain genotypes is directly related to the elevation of CRP.

In conclusion, four polymorphisms in the promoter region of the CRP gene in association with ACS were analyzed in the present study. Variables such as age, T2DM, alcohol, HBP and sedentary lifestyle were associated with ACS. To the best of the authors' knowledge, this work provided the first evidence of the association of CRP genotypes 2667CC/CG and 3872CC/CT with ACS in Mexico. These genotypes were evidenced as risk factors independent of other clinical risk factors in the multivariate analysis. It is possible that a set of polymorphisms, along with environmental factors, contribute to the development of chronic degenerative diseases, modulating the increased risk for heart disease. However, further studies are required to ascertain whether these polymorphisms participate in the development of ACS.

Acknowledgements

Not applicable.

Availability of data and materials

The data presented in this study are available on request from the corresponding author.

Authors' contributions

ALR and LMCA were responsible for conceptualization. IDE, ESG, ALR, BHO and ICQC were responsible for methodology. JAF, ALR, IDE and VOG were responsible for software. ALR, LMCA, IDE and ESG were responsible for formal analysis. ALR, RSGB, SGM and NLL were responsible for investigation. JAF, IDE and VOG were responsible for data curation. ALR, RSGB and NLL were responsible for writing and preparation of the original draft. ALR, LMCA, IDE, ICQC, SGM and NLL were responsible for writing, reviewing and editing. LMCA, IDE and BHO were responsible for supervision. LMCA was responsible for project administration. ALR and LMCA confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was conducted according to the guidelines of the Declaration of Helsinki and was approved by the HRAE-CS Ethics Committee, with a permit number 02/2010. Informed consent was obtained from all subjects involved in the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Use of artificial intelligence tools

Not applicable.

Figure 1 Strobe flow diagram. Flowchart of eligible participants for the current study.

Figure 2 Linkage disequilibrium analysis of polymorphisms.

Table I Main clinical characteristics of the participating subjects according to the presence or absence of acute coronary syndrome.

 	Acute coronary syndrome	 	
Variable	Total	No	Yes	P-value	
Age (years)	51.8±13.5	45.8±11.9	59.2±11.6	<0.001a	
Sex	 	 	 	0.009b	
     Malec	63.1%	55.8%	71.9%	 	
     Female	36.9%	44.2%	28.1%	 	
T2DM	 	 	 	<0.001b	
     Yes	30.6%	13.0%	51.8%	 	
     No	69.4%	87.0%	48.2%	 	
Smoking	 	 	 	0.008b	
     Yesc	35.7%	28.3%	44.7%	 	
     No	64.3%	71.7%	55.3%	 	
Alcohol	 	 	 	<0.001b	
     Yesc	52.0%	38.4%	74.7%	 	
     No	48.0%	61.6%	25.3%	 	
HBP	 	 	 	<0.001b	
     Yesc	42.1%	17.4%	71.9%	 	
     No	57.9%	82.6%	28.1%	 	
Dyslip	 	 	 	<0.001b	
     Yesc	27.4%	10.1%	48.2%	 	
     No	72.6%	89.9%	51.8%	 	
Sedentarism	 	 	 	<0.001b	
     Yesc	38.7%	23.9%	63.1%	 	
     No	61.3%	76.1%	36.9%	 	
Obesity	 	 	 	0.876b	
     Yesc	26.4%	26.8%	25.6%	 	
     No	73.6%	73.2%	74.4%	 	
aStudent's t test;

bFisher's exact test;

cStratum generally considered a risk factor. HBP, high blood pressure; T2DM, type 2 diabetes mellitus; Alcohol, alcoholism; Dyslip, dyslipidemia.

Table II Distribution of the analyzed genotypes of CRP according to the presence or absence of acute coronary syndrome.

 	Acute coronary syndrome	 	
CRP genotypes	Total (%)	No (%)	Yes (%)	P-valuea	
2667	 	 	 	 	
     2667CC/CG	40.1	26.1	57.0	<0.001	
2667GG	59.9	73.9	43.0	 	
3872	 	 	 	 	
     3872CC/CT	73.0	66.7	80.7	0.015	
     3872TT	27.0	33.3	19.3	 	
5237	 	 	 	 	
     5237GG/GA	29.4	29.0	29.8	0.467	
     5237AA	70.6	71.0	70.2	 	
3006	 	 	 	 	
     3006AA/AC	11.9	8.0	16.7	0.049	
     3006CC	88.1	92.0	83.3	 	
2667*3872b	 	 	 	 	
     CC/CG*CC/CT*	29.4	18.1	43.0	<0.001	
     CC/CG*TT	10.7	8.0	14.0	 	
     GG*CC/CT	43.7	48.6	37.7	 	
     GG*TT	16.3	25.4	5.3	 	
aFisher's exact test;

banalysis involved a two-way interaction (2,667x3,872 genotypes). P<0.05 was considered to indicate a statistically significant difference. CRP, C-reactive protein.

Table III Univariate and multivariate logistic regression analyses of factors associated with ACS.

 	Univariate model	Multivariable model	
 	cOR	95% CI	P-value	aOR	95% CI	P-value	
Age	1.09	1.06	1.12	<0.001	1.15	1.08	1.21	<0.001	
Male	2.03	1.19	3.44	0.009	 	 	 	 	
T2DM	7.15	3.86	13.25	<0.001	4.76	1.56	14.49	0.006	
Smoking	2.05	1.21	3.46	0.007	 	 	 	 	
Alcohola	4.74	2.59	8.64	<0.001	9.15	3.14	26.63	<0.001	
HBP	12.17	6.67	22.1	<0.001	5.40	1.89	15.30	0.002	
Dyslip	8.25	4.25	16.0	<0.001	2.87	0.96	8.99	0.060	
Sedentarism	5.44	3.01	9.82	<0.001	16.36	4.74	56.42	<0.001	
Obesity	0.94	0.50	1.75	0.845	 	 	 	 	
CRP genotypes	
     2667CC/CG	3.75	2.21	6.39	<0.001	4.82	1.69	13.72	0.003	
     3872CC/CT	2.09	1.16	3.75	0.013	3.78	1.11	12.92	0.034	
     5237GG/GA	1.04	1.60	1.79	0.884	 	 	 	 	
     3006AA/AC	2.30	1.04	5.08	0.038	 	 	 	 	
     2667*3872b	3.40	1.92	6.02	<0.001	4.14	1.49	11.52	0.006	
Important variables in the univariate model were subsequently added to the multivariate model and a forward stepwise logistic regression identified the most parsimonious model. The probability used for the stepwise regression was set at 0.15 for entry of variables and 0.25 for removal.

aStratum generally considered a risk factor.

bAnalysis involved a two-way interaction (2667CC/CG*3872CC/CT), which was performed in a separate multivariate model that did not include genotypes of other polymorphisms. P<0.05 was considered to indicate a statistically significant difference. ACS, acute coronary syndrome; cOR, crude odds ratio; CI, lower and upper bounds of the 95% confidence interval; aOR, adjusted odds ratio; T2DM, type 2 diabetes mellitus; Alcohol, alcoholism; Dyslip, dyslipidemia; HBP, high blood pressure; CRP, C-reactive protein.

Table IV Haplotype association with ACS (n=252, adjusted by sex, age, T2DM, smoking, alcohol, hypertension, dyslipidemia, sedentarism and obesity).

Haplotype	CRP3872	CRP5237	CRP2667	CRP3006	Freq	OR (95% CI)	P-value	
H1	T	A	G	C	0.2915	1.00	-	
H2	C	A	G	C	0.2846	14.86 (2.62-84.15)	0.0026	
H3	C	A	C	C	0.1192	29.98 (4.38-205.34)	7x10-4	
H4	T	A	C	C	0.1068	100.56 (4.64-2177.88)	0.0037	
Global haplotype association. P<0.05 was considered to indicate a statistically significant difference. ACS, acute coronary syndrome; T2DM, type 2 diabetes mellitus; OR, adjusted odds ratio; CI, Lower and upper bounds of the 95% confidence interval; freq, genotype frequency.
==== Refs
References

1 Birnbaum Y Wilson JM Fiol M de Luna AB A Eskola M Nikus K ECG diagnosis and classification of acute coronary syndromes Ann Noninvasive Electrocardiol 19 4 14 2014 10.1111/anec.12130 24382164
2 Crea F Liuzzo G Pathogenesis of acute coronary syndromes J Am Coll Cardiol 61 1 11 2013 10.1016/j.jacc.2012.07.064 23158526
3 Hamm CW Bassand JP Agewall S Bax J Boersma E Bueno H Caso P Dudek D Gielen S Huber K Israrci ST-segment yükselmesi belirtileri göstermeyen hastalarda akut koronersendromlarin (AKS) tedavi kilavuzlari Turk Kardiyol Dern Ars 39 73 128 2011
4 Sanchis-Gomar F Perez-Quilis C Leischik R Lucia A Epidemiology of coronary heart disease and acute coronary syndrome Ann Transl Med 4 256 2016 10.21037/atm.2016.06.33 27500157
5 INEGI: Techninal note on statistics of registered deaths. 2021. Mexico, 2022. Available at: https://www.inegi.org.mx/contenidos/programas/mortalidad/doc/defunciones_registradas_2021_nota_tecnica.pdf.
6 Katsioupa M Kourampi I Oikonomou E Tsigkou V Theofilis P Charalambous G Marinos G Gialamas I Zisimos K Anastasiou A Novel biomarkers and their role in the diagnosis and prognosis of acute coronary syndrome Life (Basel) 13 1992 2023 10.3390/life13101992 37895374
7 Momiyama Y Ohmori R Fayad ZA Kihara T Tanaka N Kato R Taniguchi H Nagata M Nakamura H Ohsuzu F Associations between plasma C-reactive protein levels and the severities of coronary and aortic atherosclerosis J Atheroscler Thromb 17 460 467 2010 10.5551/jat.2931 20134100
8 Szmitko PE Wang CH Weisel RD de Almeida JR Anderson TJ Verma S New markers of inflammation and endothelial cell activation: Part I Circulation 108 1917 1923 2003 10.1161/01.CIR.0000089190.95415.9F 14568885
9 Gupta S Gupta VK Gupta R Arora S Gupta V Relationship of high-sensitive C-reactive protein with cardiovascular risk factors, clinical presentation and angiographic profile in patients with acute coronary syndrome: An Indian perspective Indian Heart J 65 359 365 2013 10.1016/j.ihj.2013.04.035 23809399
10 Casas JP Shah T Hingorani AD Danesh J Pepys MB C-reactive protein and coronary heart disease: A critical review J Intern Med 264 295 314 2008 10.1111/j.1365-2796.2008.02015.x 18823504
11 Eklund CM Proinflammatory cytokines in CRP baseline regulation Adv Clin Chem 48 111 136 2009 10.1016/s0065-2423(09)48005-3 19803417
12 Pai JK Mukamal KJ Rexrode KM Rimm EB C-reactive protein (CRP) gene polymorphisms, CRP levels, and risk of incident coronary heart disease in two nested case-control studies PLoS One 3 e1395 2008 10.1371/journal.pone.0001395 18167554
13 Rios DL Cerqueira CC Bonfim-Silva R Araújo LJ Pereira JF Gadelha SR Barbosa AA Interleukin-1 beta and interleukin-6 gene polymorphism associations with angiographically assessed coronary artery disease in Brazilians Cytokine 50 292 296 2010 10.1016/j.cyto.2010.02.012 20206549
14 Tonet AC Karnikowski M Moraes CF Gomez L Karnikowski MGO Córdova C Nóbrega OT Association between the-174 G/C promoter polymorphism of the interleukin-6 gene and cardiovascular disease risk factors in Brazilian older women Braz J Med Biol Res 41 47 53 2008 10.1590/s0100-879x2006005000190 17994165
15 Brull DJ Serrano N Zito F Jones L Montgomery HE Rumley A Sharma P Lowe GD World MJ Humphries SE Hingorani AD Human CRP gene polymorphism influences CRP levels: Implications for the prediction and pathogenesis of coronary heart disease Arterioscler Thromb Vasc Biol 23 2063 2069 2003 10.1161/01.ATV.0000084640.21712.9C 12842840
16 Kovacs A Green F Hansson LO Lundman P Samnegård A Boquist S Ericsson CG Watkins H Hamsten A Tornvall P A novel common single nucleotide polymorphism in the promoter region of the C-reactive protein gene associated with the plasma concentration of C-reactive protein Atherosclerosis 178 193 198 2005 10.1016/j.atherosclerosis.2004.08.018 15585218
17 Volanakis JE Human C-reactive protein: Expression, structure, and function Mol Immunol 38 189 197 2001 10.1016/s0161-5890(01)00042-6 11532280
18 NACB LMPG Committee Members Myers GL Christenson RH Cushman M Ballantyne CM Cooper GR Pfeiffer CM Grundy SM Labarthe DR Levy D National academy of clinical biochemistry laboratory medicine practice guidelines: Emerging biomarkers for primary prevention of cardiovascular disease Clin Chem 55 378 384 2009 10.1373/clinchem.2008.115899 19106185
19 Wang XH Liu SQ Wang YL Jin Y Correlation of serum high-sensitivity C-reactive protein and interleukin-6 in patients with acute coronary syndrome Genet Mol Res 13 4260 4266 2014 10.4238/2014.June.9.11 25036169
20 Elliott P Chambers JC Zhang W Clarke R Hopewell JC Peden JF Erdmann J Braund P Engert JC Bennett D Genetic Loci associated with C-reactive protein levels and risk of coronary heart disease JAMA 302 37 48 2009 10.1001/jama.2009.954 19567438
21 Zee RYL Ridker PM Polymorphism in the human C-reactive protein (CRP) gene, plasma concentrations of CRP, and the risk of future arterial thrombosis Atherosclerosis 162 217 219 2002 10.1016/s0021-9150(01)00703-1 11947917
22 Liu C Jin P Luo Y Xu J Kong C Chen J Xie H Zhou G Association of single-nucleotide polymorphisms of C-reactive protein gene with susceptibility to infantile sepsis in Southern China Med Sci Monit 24 590 595 2018 10.12659/msm.908602 29379005
23 Lange LA Carlson CS Hindorff LA Lange EM Walston J Durda JP Cushman M Bis JC Zeng D Lin D Association of polymorphisms in the CRP gene with circulating C-reactive protein levels and cardiovascular events JAMA 296 2703 2711 2006 10.1001/jama.296.22.2703 17164456
24 Cannon CP Brindis RG Chaitman BR Cohen DJ Cross JT Jr Drozda JP Jr Fesmire FM Fintel DJ Fonarow GC Fox KA 2013 ACCF/AHA key data elements and definitions for measuring the clinical management and outcomes of patients with acute coronary syndromes and coronary artery disease: A report of the American college of cardiology foundation/American heart association task force on clinical data standards (writing committee to develop acute coronary syndromes and coronary artery disease clinical data standards) Circulation 127 1052 1089 2013 10.1161/CIR.0b013e3182831a11 23357718
25 Carlson CS Aldred SF Lee PK Tracy RP Schwartz SM Rieder M Liu K Williams OD Iribarren C Lewis EC Polymorphisms within the C-reactive protein (CRP) promoter region are associated with plasma CRP levels Am J Hum Genet 77 64 77 2005 10.1086/431366 15897982
26 Zhao Y Wang H Liu S Zhao X Chen Y Yang Y Wang W Wu Y Chen A Tang J Association study of CRP gene polymorphism and hypertension in Han Chinese population Gene 512 41 46 2013 10.1016/j.gene.2012.09.107 23046580
27 Jebur HB Masroor M Ahmad H Khan NA Akther J Bharali D Singh VK Verma A Khan S Khan V CRP gene polymorphism and their risk association with type 2 diabetes mellitus Open Access Maced J Med Sci 7 33 37 2018 10.3889/oamjms.2019.014 30740156
28 Wei W Yang S Qiu Y Wang H Zhao X Zhao Y Li Y Wu M Chen Y Wang W CRP gene polymorphism contributes genetic susceptibility to dyslipidemia in Han Chinese population Mol Biol Rep 41 2335 2343 2014 10.1007/s11033-014-3087-8 24474658
29 Todendi PF Klinger EI Ferreira MB Reuter CP Burgos MS Possuelo LG Valim AR Association of IL-6 and CRP gene polymorphisms with obesity and metabolic disorders in children and adolescents An Acad Bras Cienc 87 915 924 2015 10.1590/0001-3765201520140364 25993353
30 Solé X Guinó E Valls J Iniesta R Moreno V SNPStats: A web tool for the analysis of association studies Bioinformatics 22 1928 1929 2006 10.1093/bioinformatics/btl268 16720584
31 Libby P Mechanisms of acute coronary syndromes and their implications for therapy N Engl J Med 368 2004 2013 2013 10.1056/NEJMra1216063 23697515
32 Hackam DG Anand SS Emerging risk factors for atherosclerotic vascular disease: A critical review of the evidence JAMA 290 932 940 2003 10.1001/jama.290.7.932 12928471
33 Miller DT Zee RY Suk Danik J Kozlowski P Chasman DI Lazarus R Cook NR Ridker PM Kwiatkowski DJ Association of common CRP gene variants with CRP levels and cardiovascular events Ann Hum Genet 69 623 638 2005 10.1111/j.1529-8817.2005.00210.x 16266402
34 Danesh J Wheeler JG Hirschfield GM Eda S Eiriksdottir G Rumley A Lowe GDO Pepys MB Gudnason V C-reactive protein and other circulating markers of inflammation in the prediction of coronary heart disease N Engl J Med 350 1387 1397 2004 10.1056/NEJMoa032804 15070788
35 Greenland P Knoll MD Stamler J Neaton JD Dyer AR Garside DB Wilson PW Major risk factors as antecedents of fatal and nonfatal coronary heart disease events JAMA 290 891 897 2003 10.1001/jama.290.7.891 12928465
36 Schulz S Rehm S Schlitt A Lierath M Lüdike H Hofmann B Bitter K Reichert S C-reactive protein level and the genetic variant rs1130864 in the CRP gene as prognostic factors for 10-year cardiovascular outcome Cells 12 1775 2023 10.3390/cells12131775 37443809
37 Task Force on diabetes, pre-diabetes and cardiovascular diseases of the European Society of Cardiology (ESC); European Association for the Study of Diabetes (EASD) Rydén L Grant PJ Anker SD Berne C Cosentino F Danchin N Deaton C Escaned J ESC guidelines on diabetes, pre-diabetes, and cardiovascular diseases developed in collaboration with the EASD-summary Diabetes Vasc Dis Res 11 133 173 2014 10.1177/1479164114525548 24800783
38 Babes EE Bustea C Behl T Abdel-Daim MM Nechifor AC Stoicescu M Brisc CM Moisi M Gitea D Iovanovici DC Acute coronary syndromes in diabetic patients, outcome, revascularization, and antithrombotic therapy Biomed Pharmacother 148 112772 2022 10.1016/j.biopha.2022.112772 35245735
39 Reynoso-Villalpando GL Padilla-Gutiérrez JR Valdez-Haro A Casillas-Muñoz F Muñoz-Valle JF Castellanos-Nuñez E Chávez-Herrera JC Valle Y Relationship between C-reactive protein serum concentration and the 1846 C>T (rs1205) polymorphism in patients with acute coronary syndrome from Western Mexico Genet Test Mol Biomarkers 21 334 340 2017 10.1089/gtmb.2016.0312 28277782
40 Suk Danik J Chasman DI Cannon CP Miller DT Zee RY Kozlowski P Kwiatkowski DJ Ridker PM Influence of genetic variation in the C-reactive protein gene on the inflammatory response during and after acute coronary ischemia Ann Hum Genet 70 705 716 2006 10.1111/j.1469-1809.2006.00272.x 17044845
41 Kardys I de Maat MP Uitterlinden AG Hofman A Witteman JC C-reactive protein gene haplotypes and risk of coronary heart disease: The rotterdam study Eur Heart J 27 1331 1337 2006 10.1093/eurheartj/ehl018 16682383
42 Ridker PM Cannon CP Morrow D Rifai N Rose LM McCabe CH Pfeffer MA Braunwald E Pravastatin or Atorvastatin Evaluation and Infection Therapy-Thrombolysis in Myocardial Infarction 22 (PROVE IT-TIMI 22) Investigators. C-reactive protein levels and outcomes after statin therapy N Engl J Med 352 20 28 2005 15635109
43 Russell AI Cunninghame Graham DS Shepherd C Roberton CA Whittaker J Meeks J Powell RJ Isenberg DA Walport MJ Vyse TJ Polymorphism at the C-reactive protein locus influences gene expression and predisposes to systemic lupus erythematosus Hum Mol Genet 13 137 147 2004 10.1093/hmg/ddh021 14645206
44 Hernández-Díaz Y Tovilla-Zárate CA Juárez-Rojop I Baños-González MA Torres-Hernández ME López-Narváez ML Yañez-Rivera TG González-Castro TB The role of gene variants of the inflammatory markers CRP and TNF-α in cardiovascular heart disease: Systematic review and meta-analysis Int J Clin Exp Med 15 11958 11984 2015 26550110
45 Grammer TB März W Renner W Böhm BO Hoffmann MM C-reactive protein genotypes associated with circulating C-reactive protein but not with angiographic coronary artery disease: the LURIC study Eur Heart J 30 170 182 2009 10.1093/eurheartj/ehn191 18499652
46 Schulz S Lüdike H Lierath M Schlitt A Werdan K Hofmann B Gläser C Schaller HG Reichert S C-reactive protein levels and genetic variants of CRP as prognostic markers for combined cardiovascular endpoint (cardiovascular death, death from stroke, myocardial infarction, and stroke/TIA) Cytokine 88 71 76 2016 10.1016/j.cyto.2016.08.021 27580453
47 Chen Z Yu D Xu ZW Li SS Li XF Li J Yang X C-reactive protein gene polymorphisms and gene-environment interactions in ischaemic stroke Neurol Res 37 979 984 2015 10.1179/1743132815Y.0000000053 26004291
48 Lee CC You NC Song Y Hsu YH Manson J Nathan L Tinker L Liu S Relation of genetic variation in the gene coding for C-reactive protein with its plasma protein concentrations: Findings from the women's health initiative observational cohort Clin Chem 55 351 360 2009 10.1373/clinchem.2008.117176 19095725
49 Markt SC Rider JR Penney KL Schumacher FR Epstein MM Fall K Sesso HD Stampfer MJ Mucci LA Genetic variation across C-reactive protein and risk of prostate cancer Prostate 74 1034 1042 2014 10.1002/pros.22820 24844401
50 Chen XL Liao YQ Liu JR Genotype CC of rs1800947 in the C-reactive protein gene may increase susceptibility to colorectal cancer: a meta-analysis Asian Pac J Cancer Prev 15 2663 2667 2014 10.7314/apjcp.2014.15.6.2663 24761881
51 Kuhlenbaeumer G Huge A Berger K Kessler C Voelzke H Funke H Stoegbauer F Stoll M Ringelstein EB Genetic variants in the C-reactive protein gene are associated with microangiopathic ischemic stroke Cerebrovasc Dis 30 476 482 2010 10.1159/000319021 20733302
52 Dai DF Chiang FT Lin JL Huang LY Chen CL Chang CJ Lai LP Hsu KL Tseng CD Tseng YZ Hwang JJ Human C-reactive protein (CRP) gene 1059G>C polymorphism is associated with plasma CRP concentration in patients receiving coronary angiography J Formos Med Assoc 106 347 354 2007 10.1016/S0929-6646(09)60319-3 17561469
53 Kolz M Koenig W Müller M Andreani M Greven S Illig T Khuseyinova N Panagiotakos D Pershagen G Salomaa V DNA variants, plasma levels and variability of C-reactive protein in myocardial infarction survivors: Results from the AIRGENE study Eur Heart J 29 1250 1258 2008 10.1093/eurheartj/ehm442 17956875
54 Rizzello V Liuzzo G Giannuario GD Trabetti E Brugaletta S Santamaria M Piro M Pignatti PF Maseri A Biasucci LM Crea F 1059G/C polymorphism within the exon 2 of the C-reactive protein gene: Relationship to C-reactive protein levels and prognosis in unstable angina Coron Artery Dis 18 533 538 2007 10.1097/MCA.0b013e3282f08eb9 17925606
55 Slatkin M Linkage disequilibrium-understanding the evolutionary past and mapping the medical future Nat Rev Genet 9 477 485 2008 10.1038/nrg2361 18427557
56 Martínez-Cortés G Salazar-Flores J Fernández-Rodríguez LG Rubi-Castellanos R Rodríguez-Loya C Velarde-Félix JS Muñoz-Valle JF Parra-Rojas I Rangel-Villalobos H Admixture and population structure in Mexican-Mestizos based on paternal lineages J Hum Genet 57 568 574 2012 10.1038/jhg.2012.67 22832385
57 Obisesan TO Leeuwenburgh C Phillips T Ferrell RE Phares DA Prior SJ Hagberg JM C-reactive protein genotypes affect baseline, but not exercise training-induced changes, in C-reactive protein levels Arterioscler Thromb Vasc Biol 24 1874 1879 2004 10.1161/01.ATV.0000140060.13203.22 15271790
58 Wang Q Hunt SC Xu Q Chen YE Province MA Eckfeldt JH Pankow JS Song Q Association study of CRP gene polymorphisms with serum CRP level and cardiovascular risk in the NHLBI family heart study Am J Physiol Heart Circ Physiol 291 H2752 H2757 2006 10.1152/ajpheart.01164.2005 16731635
59 Szalai AJ Wu J Lange EM McCrory MA Langefeld CD Williams A Zakharkin SO George V Allison DB Cooper GS Single-nucleotide polymorphisms in the C-reactive protein (CRP) gene promoter that affect transcription factor binding, alter transcriptional activity, and associate with differences in baseline serum CRP level J Mol Med (Berl) 83 440 447 2005 10.1007/s00109-005-0658-0 15778807
60 Shipe ME Deppen SA Farjah F Grogan EL Developing prediction models for clinical use using logistic regression: An overview J Thorac Dis 11 (Suppl 4) S574 S584 2019 10.21037/jtd.2019.01.25 31032076
61 Van Smeden M de Groot JAH Moons KG Collins GS Altman DG Eijkemans MJ Reitsma JB No rationale for 1 variable per 10 events criterion for binary logistic regression analysis BMC Med Res Methodol 16 163 2016 10.1186/s12874-016-0267-3 27881078
62 Van Smeden M Moons KG de Groot JA Collins GS Altman DG Eijkemans MJ Reitsma JB Sample size for binary logistic prediction models: Beyond events per variable criteria Stat Methods Med Res 28 2455 2474 2019 10.1177/0962280218784726 29966490
