
==== Front
Ann Med Surg (Lond)
Ann Med Surg (Lond)
MS9
Annals of Medicine and Surgery
2049-0801
Lippincott Williams & Wilkins Hagerstown, MD

AMSU-D-24-00932
10.1097/MS9.0000000000002349
00046
3
Original Research
The beneficial influences of vitamin D intake on inflammation and oxidative stress in infertile women with polycystic ovary syndrome
Asemi Reza MD aAsemi.rezaraa@gmail.com

Ahmadi Asouri Sahar MSc Sahar.Ahmadi.Asouri11@gmail.com
b*
Aghadavod Esmat PhD b*Esmat.Aghadavod225@gmail.com

Jamilian Mehri MD c*Jamilian.mehri@gmail.com

a Department of Internal Medicine, School of Medicine, Cancer Prevention Research Center, Seyyed Al-Shohada Hospital, Department of Internal Medicine, Isfahan University of Medical Sciences, Isfahan
b Research Center for Biochemistry and Nutrition in Metabolic Diseases, Department of Biochemistry, Kashan University of Medical Sciences, Kashan
c Traditional and Complementary Medicine Research Center, Department of Gynecology, Arak University of Medical Sciences, Arak, Iran
* Corresponding authors. Address: Arak University of Medical Sciences, Arak 3848176341, Iran Tel.: +86 322 338 23. E-mail: jamilian.mehri@gmail.com (M. Jamilian); E-mail: ahmadiisahar98@gmail.com (S. Ahmadi Asouri); Tel.: +31 555 894 80. E-mail: aghadavod_m@yahoo.com (E. Aghadavod).
9 2024
5 7 2024
86 9 52185223
9 5 2024
26 6 2024
Copyright © 2024 The Author(s). Published by Wolters Kluwer Health, Inc.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0/

Objective:

Oxidative stress and inflammation play a vital function in the pathophysiology of polycystic ovary syndrome (PCOS) and infertility. The aim of this work was to control the impacts of vitamin D intake on metabolic profiles in infertile subjects with PCOS.

Trial design and methods:

This randomized, double-blinded, placebo-controlled clinical trial was carried out among 40 infertile women with PCOS. Subjects were randomly divided into two intervention groups to take either 50 000 IU vitamin D (n=20) or placebo (n=20) weekly for 8 weeks. Metabolic profiles and few inflammatory cytokines expression evaluated on peripheral blood mononuclear cells (PBMCs) of participants, using real-time polymerase chain reaction (RT-PCR) method.

Results:

Vitamin D intake decreased high-sensitivity C-reactive protein (hs-CRP) (−0.9±1.1 vs. 0.3±0.9 mg/l, P=0.002) and elevated total antioxidant capacity (TAC) levels (49.2±60.2 vs. −50.6±161.8 mmol/l, P=0.02) compared with placebo; but no significant effects on other metabolic parameters were observed. Moreover, a significant downregulation of tumor necrosis factor alpha (TNF-α) expression (P=0.03) was observed after taking vitamin D compared with the placebo.

Conclusions:

Overall, vitamin D intake for eight weeks had beneficial impacts on hs-CRP, TAC, and TNF-α among infertile women with PCOS.

Keywords:

inflammation
oxidative stress
polycystic ovary syndrome
vitamin D intake
OPEN-ACCESSTRUE
==== Body
pmcIntroduction

Highlights

This randomized double-blind, placebo-controlled trial was conducted on 40 infertile polycystic ovary syndrome (PCOS) women candidates for in-vitro fertilization (IVF).

Eight-week vitamin D supplementation decreased tumor necrosis factor alpha (TNF-α) expression in infertile PCOS women candidates for IVF.

Vitamin D supplementation reduced inflammation and oxidative damage.

Background

Polycystic ovary syndrome (PCOS) is an endocrine disorder in woman with a prevalence of 5–20%1. Its main characteristics are hyperandrogenemia (HA), insulin resistance (IR), obesity, oligo/anovulation, and/or polycystic ovarian morphology2. The possibilities of conception is decreased in PCOS women and the risk of complications during pregnancy is increased3. The pathogenesis of PCOS may be due to hyperandrogenemia, oxidative damage and inflammation together, play a main role in its pathophysiology4,5. Inflammation is a risk feature of the pathogenesis and expansion of this syndrome4, which has an important role in female infertility6. In addition, several studies confirmed the existence of oxidative stress in PCOS women because aberrant circulating oxidative stress markers has been detected in these patients7. Furthermore, reactive oxygen species (ROS) has been established to play an indispensable part in the pathophysiology of subfertility in females8. Controlled and adequate ROS levels exert physiologic functions which is an important mediator of conception in females8.

The occurrence of vitamin D insufficiency in PCOS patients was reported about 67–85%3. It was reported that hypocalcemia and vitamin D deficiency have an effect on female reproductive function9. Vitamin D is a vital antioxidant for humans because it has the ability of controlling oxidative stress, systemic inflammation, and mitochondrial respiratory function10. Evans et al. 11 shown that 25OHD3 and 1,25(OH)2D3 decrease synthesis of pro-inflammatory cytokines like interleukin-1 (IL-1), tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), and IL-6 in isolated uterine natural killer cells. Another in-vitro study reported that vitamin D repressed human monocytes production of IL-6 and TNF-α12. Vitamin D may have antioxidant properties by modulating some antioxidant defense enzymes13. Nitric oxide (NO), malondialdehyde (MDA), xanthine oxidase and advanced glycosylated end products (AGEs) increase in women with PCOS14. A meta-analysis reported a significant improvement in MDA, high-sensitivity C-reactive protein (hs-CRP) and total antioxidant capacity (TAC) levels in PCOS patients by receiving vitamin D supplement, while no notable effects were reported for glutathione (GSH) and NO levels15. Further, vitamin D plus calcium intake reduced oxidative stress and hs-CRP16. Moreover, Zhao et al. 17 reported that vitamin D intake could regulate TAC, hs-CRP, and MDA values in PCOS women without change in NO and GSH levels. But another study reported no significant change in hs-CRP by receiving vitamin D18. Vitamin D supplementation in PCOS patients candidate for in-vitro fertilization (IVF) improved clinical pregnancy19.

Objectives

Although the issue of whether vitamin D supplementation has a healing impact on hormones, oxidative stress and inflammation has attracted a lot of attention, but the results have remained debatable17. So, this work was aimed to control the impacts of vitamin D intake on biomarkers of oxidative stress and inflammation in infertile women with PCOS.

Methods

Trial design

The research design for this work was a clinical trial using the gold standard of randomization and blinding.

Participants

Subjects included 40 infertile women between the ages of 18 and 40 who had been identified with PCOS consistent with the Rotterdam criteria20 and who were considering IVF as a treatment option. Between December 2018 and March 2019, people were scouted (recruitment date: December 2018–January 2019 and intervention date: January 2019 to March 2019). People who used anti-diabetic drugs like metformin, as well as hormone and anti-obesity medications, were not allowed to participate. Those with cardiovascular disease, neoplastic disorders, or malabsorptive disorders were also excluded. Before any procedures were performed, all subjects signed an informed consent form.

Interventions

Vitamin D (n=20) or a placebo (n=20) was given to participants on a weekly basis for 8 weeks. All participants were stratified randomization according to BMI (<25 and ≥25 kg/m2) and age (<30 and ≥30 years). Vitamin D and placebos (sunflower oil) were both manufactured by different firms, but they were indistinguishable from one another in every respect (shape, size, color and packaging). Dosage of medication (Gonal-F therapy) administered based on international protocol, and there was no significant change between two groups.

Outcomes

The principal measure was total testosterone, while secondary measurements were defined as changes in other metabolic markers.

Biochemical assessment

At the start and finish of the experiment, 15 ml of fasting blood were taken. An ELISA kit (IDS, Boldon, UK) was used to measure 25-hydroxyvitamin D concentrations, with coefficient variations (CVs) of less than 7% between individual assays. Inter- and intra-assay CVs for the measurement of serum sex hormone-binding globulin (SHBG) and total testosterone were both less than 5%, thanks to the use of Elisa kits (DiaMetra, Milano, Italy). Inter- and intra-assay CVs for measuring Hs-CRP levels were both less than 7%, thanks to the use of an ELISA kit (LDN). Inter- and intra-assay CVs of less than 5% were achieved when measuring plasma NO with the Griess method21, GSH using the method of Beutler et al. 22, method, TAC with the ferric reducing antioxidant power developed by Benzie and Strain23, and MDA values with spectrophotometric test24 were determined with inter- and intra-assay CVs lower than 5%.

RNA extraction and real-time polymerase chain reaction (RT-PCR)

Quantitative RT-PCR was performed on PBMCs to quantity IL-1, TNF-α and IL-8 expression using Light Cycler technology (Roche Diagnostics) and SYBR green detection with an Amplicon Kit (Table 1). Lymphocytes were isolated from blood samples using 50% percoll (Sigma-Aldrich). Extractions of RNA and DNA were made, and trypan blue was used to count and viably test cells25. Blood samples were processed using an RNX-plus kit for RNA extraction. In order to extract cDNA, the RNA solution was kept at −20 °C. Each sample’s total RNA was measured using UV spectrophotometer. There was no evidence of protein or DNA contamination because the OD 260/280 ratios for all of the samples ranged from 1.7 to 2.125. Using moloney murine leukemia virus reverse transcriptase, the obtained RNA was transformed into a cDNA library (RT). Primers targeting the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were utilized. Primers were created with the use of Beacon designer and Primer Express software (Applied Biosystems).

Table 1 Specific primers used for real-time quantitative PCR.

Gene	Primer	Product size (bp)	Annealing temperature (C)	
GAPDH	F: AAGCTCATTTCCTGGTATGACAACG	126	61.3	
	R: TCTTCCTCTTGTGCTCTTGCTGG			
IL-1	F: GCTTCTCTCTGGTCCTTGG	174	56	
	R: AGGGCAGGGTAGAGAAGAG			
IL-8	F: GCAGAGGGTTGTGGAGAAGT	150	56	
	R: ACCCTACAACAGACCCACAC			
TNF-α	F: GTCAACCTCCTCTCTGCCAT
R: CCAAAGTAGACCTGCCCAGA	188	52	
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL-1, interleukin-1; IL-8, interleukin-8; PCR, polymerase chain reaction; TNF-α, tumor necrosis factor α.

Sample size

Considerations for type one error (α) of 0.05, type two error (β) of 0.20, and 80% power were used to determine the required number of participants for this clinical research. Based on this, we needed 16 patients in per group. Assuming a dropout of 4 patients in each group, we calculated to have 20 subjects per group.

Randomization and treatment allocation

Using a random number table, we assigned duties at random. Participants’ 25(OH)D values were measured and supplement containers were collected to calculate the compliance rate. Each patient established a short text message on their phone every day to remind them to intake their supplements, which significantly increased the compliance rate.

Implementation

A trained staff at the clinic, who was not involved in the trial and not aware of assignments, assigned numbered packages of vitamin D and placebos to the subjects.

Blinding

The researchers and the patients had their allocations kept secret by randomization and concealment until the analyses were complete.

Statistical methods

To check if the variables were distributed normally, the Kolmogorov–Smirnov test was carried out. We compared the two intervention groups to assess metabolic profiles, anthropometric parameters, and gene expression of inflammatory markers with an independent samples t-test. P values below 0.05 were viewed as substantial statistical markers.

Results

Participant flow and recruitment

Totally, 40 persons randomly randomized to two groups receiving: (1) vitamin D (n=20) and (2) placebos (n=20). Among patients in the vitamin D group, 3 patients (withdrawn due to personal reasons) and in the placebo group, 3 persons (withdrawn due to personal reasons) were excluded (Fig. 1). Finally, 34 participants [vitamin D (n=17) and placebo (n=17)] completed the trial. In this study, the compliance rate was between 90% and 100% across both groups.

Figure 1 Summary of patient flow diagram.

Baseline data and numbers analyzed

Mean age, weight and BMI at baseline and end-of-trial, and weight and BMI change of study participants were not statistically different between the two groups (Table 2).

Table 2 General characteristics of study participants.

	Placebo group (n=17)	Vitamin D group (n=17)	
Age (year)	30.2±3.3	29.2±3.8	
Height (cm)	159.1±2.2	160.9±3.2	
Weight at study baseline (kg)	71.5±7.4	71.4±10.7	
Weight at end-of-trial (kg)	71.7±7.3	71.6±10.3	
BMI at study baseline (kg/m2)	28.3±2.8	27.6±4.1	
BMI at end-of-trial (kg/m2)	28.3±2.8	27.7±3.9	
Data are means±SDs.

Outcomes and estimation

TAC levels were significantly higher (49.2±60.2 vs. 50.6±161.8 mmol/l, P=0.02) and hs-CRP levels were significantly lower (−0.9±1.1 vs. 0.3±0.9 mg/l, P=0.002) after vitamin D supplementation compared with the placebo (Table 3). Other metabolic indicators showed no discernible change after vitamin D supplementation.

Table 3 Changes in the levels of metabolic profiles in two groups of patients with polycystic ovary syndrome candidate for in-vitro fertilization.

	Placebo group (n=17)	Vitamin D group (n=17)		
	Baseline	End-of-trial	Change	Baseline	End-of-trial	Change	P a	
Vitamin D (ng/ml)	9.3±1.8	9.2±1.9	−0.1±0.7	10.0±1.9	19.3±4.9	9.3±4.7	<0.001	
Total testosterone (ng/ml)	1.2±0.4	1.3±0.6	0.1±0.6	1.0±0.3	0.9±0.4	−0.1±0.4	0.35	
SHBG (nmol/l)	49.1±18.0	51.3±16.9	2.2±13.2	53.3±13.4	56.3±17.4	2.9±13.8	0.86	
hs-CRP (mg/l)	3.4±0.6	3.7±1.0	0.3±0.9	3.6±1.4	2.7±1.2	−0.9±1.1	0.002	
NO (μmol/l)	40.2±3.4	38.4±4.2	−1.8±3.9	39.3±5.3	37.8±6.3	−1.5±2.8	0.78	
TAC (mmol/l)	694.9±57.2	644.4±160.4	−50.6±161.8	679.8±179.1	729.1±203.2	49.2±60.2	0.02	
GSH (µmol/l)	421.4±42.7	434.8±92.8	13.8±85.2	409.9±41.3	408.3±44.3	−1.6±35.5	0.51	
MDA (µmol/l)	2.7±0.4	2.8±0.4	0.1±0.2	2.5±0.2	2.6±0.2	0.03±0.2	0.57	
All values are means±SDs.

GSH, total glutathione; hs-CRP, high-sensitivity C-reactive protein; MDA, malondialdehyde; NO, nitric oxide; SHBG, sex hormone-binding globulin; TAC, total antioxidant capacity.

a P values represent independent t-test.

Also, a significant downregulation of TNF-α gene expression (0.95±0.15 vs. 1.07±0.14-fold change, P=0.03) was observed after taking vitamin D supplements, compared with the placebo, in PBMCs of infertile women with PCOS (Fig. 2). We didn’t observe any significant impact on IL-8 and IL-1 expression following vitamin D intake.

Figure 2 Effect of the 8-week supplementation with vitamin D or placebo on expression ratio of IL-1, IL-8 and TNF-α gene in PBMCs of patients with polycystic ovary syndrome candidate for in-vitro fertilization. IL-1, interleukin-1; IL-8, interleukin-8; TNF-α, tumor necrosis factor alpha.

Harms

Women with PCOS who were unable to conceive naturally were given vitamin D supplements in this study with no reported adverse effects.

Discussion

Generalizability

This work demonstrated that vitamin D intake for eight weeks had beneficial impacts on hs-CRP, TAC, and TNF-α among infertile subjects with PCOS.

Interpretation

Oxidative stress and inflammation have key roles in the pathophysiology of PCOS17. Previously, the beneficial properties of vitamin D intake on metabolic values among subjects with PCOS and other diseases were reported26–29. Consistent with our findings, Sharifi et al. 30 showed that 50 000 IU vitamin D3/2 weeks for 4 months decreased hs-CRP in persons with non-alcoholic fatty liver disease. Further, Karonova et al. 31 reported that vitamin D intake (40 000 IU/week) for 24 weeks ameliorated some inflammatory cytokines in people with type 2 diabetes. Duggan et al. 32 demonstrated that vitamin D supplements (2000 IU/day) for 12 months among postmenopausal women has no beneficial effect on IL-10, IL-1B, IL-8 and TNF-α levels. In another study, no significant changes in some inflammatory markers were seen by taking vitamin D supplements (1000, 2000, or 4000 IU/day for three months) among African Americans population33. Inflammatory cytokines may trigger endothelial cell damage and dysfunction in PCOS34. Vitamin D has a key role in changeable the creation of inflammatory markers and inhibiting the proliferation of pro-inflammatory cells to modulate the immune/inflammation system35. It also plays several other anti-inflammatory effects such as inhibiting prostaglandin action and nuclear factor kappa B (NF-κB) signaling paths36.

Similar to our findings, Zhang et al. 37 exhibited that vitamin D intake (50 000 IU/2 weeks) significantly elevated GSH and TAC levels in women with gestational diabetes mellitus. Also, Cavalcante et al. 38 exhibited that supplementation with 200 000 IU vitamin D3 increased TAC and reduced ultra-sensitive-CRP concentrations in elderly subjects with vitamin D inadequacy after 4 weeks; but no change in MDA levels were detected. Moreover, Heidari et al. 39 shown that vitamin D intake (50 000 IU fortnightly for 4 months) increased TAC levels and decreased some inflammatory cytokines in premenstrual syndrome. Similarly, another study showed that 50 000 IU vitamin D3/weekly for eight weeks significantly increased TAC levels among breast cancer women40. In contrast, Mamede et al. 41 demonstrated that a single-oral megadose of vitamin D3 did not improve oxidative damage and inflammation markers levels in obese or overweight women who had a deficiency or insufficiency of vitamin D. Likewise, vitamin D3 supplementation (50 000 IU/week )significantly reduced MDA concentrations; but the increase in TAC level was nonsignificant in type 2 diabetes42. Oxidative stress can cause a number of reproductive diseases like PCOS. The imbalance between pro-oxidants and antioxidants can be an important factor of pregnancy complications including recurrent pregnancy loss, spontaneous abortion, and preeclampsia43. On the other hand, vitamin D deficiency disturbs mitochondrial function by decreasing oxygen consumption rate. The exact mechanism of regulating oxidative stress via vitamin D is not yet clarified. In total, vitamin D might directly influence the mitochondrial reactive oxygen species creation by regulating mitochondrial dynamics and function44.

Limitations

Limitations of this work were: Due to financial limitations, we could not evaluate gene expression related to biomarkers of oxidative stress. The period of the intervention and sample size were low. Future works with a period and larger sample size are required to approve our findings. In addition, in the current study, the range of hs-CRP in most participants was normal. This should be considered in the interpretation of our finding. We believe that further studies should be conducted in different ranges of hs-CRP among infertile women with PCOS. The main outcome of our study was total testosterone. We suggest that further studies should be conducted according to biomarkers of oxidative stress and inflammatory markers. Also, we did not evaluate serum vitamin D concentrations at the study baseline. Serum vitamin D concentrations were measured at the end-of-trial to assess compliance to vitamin D supplements.

Conclusions

Overall, we established that vitamin D intake for eight weeks had beneficial effects on hs-CRP, TAC, and TNF-α among infertile women with PCOS.

Ethical approval

The research was approved by the ethics committee of AUMS. Ethics committee reference number: IR.ARAKMU.REC.1397.246. Approval date: 2018-12-16. IRCT code: IRCT20170513033941N53. IRCT record: https://www.IRCT20170513033941N53. Link: https://irct.behdasht.gov.ir/trial/38409

Consent

Before any procedures were performed, all subjects signed an informed consent form.

Source of funding

The current study was founded by a grant from the Vice-chancellor for Research, AUMS, and Iran.

Author contribution

S.A.-A., R.A., E.A. and M.J. involved in drafting and data collection. All authors accepted the final version.

Conflicts of interest disclosure

The authors declare no conflict of interest.

Research registration unique identifying number (UIN)

Registry used: IRCT20170513033941N53

Unique Identifying number or registration ID: IRCT20170513033941N53

Hyperlink to your specific registration: https://irct.behdasht.gov.ir/trial/38409

Guarantor

Guarantor is Mehri Jamilian.

Data availability statement

The datasets analyzed and/or used during the present study are obtainable from the corresponding author on rational request.

Provenance and peer review

Not commissioned, externally peer-reviewed.

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.
==== Refs
References

1 Azziz R Carmina E Chen Z . Polycystic ovary syndrome. Nat Rev Dis Primers 2016;2 :1–18.
2 Lim SS Davies M Norman RJ . Overweight, obesity and central obesity in women with polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod Update 2012;18 :618–637.22767467
3 Thomson RL Spedding S Buckley JD . Vitamin D in the aetiology and management of polycystic ovary syndrome. Clin Endocrinol 2012;77 :343–350.
4 Artimani T Karimi J Mehdizadeh M . Evaluation of pro-oxidant-antioxidant balance (PAB) and its association with inflammatory cytokines in polycystic ovary syndrome (PCOS). Gynecol Endocrinol 2018;34 :148–152.28868943
5 Walters KA Gilchrist RB Ledger WL . New perspectives on the pathogenesis of PCOS: neuroendocrine origins. Trends Endocrinol Metabolism 2018;29 :841–852.
6 Weiss G Goldsmith LT Taylor RN . Inflammation in reproductive disorders. Reprod Sci 2009;16 :216–229.19208790
7 Murri M Luque-Ramírez M Insenser M . Circulating markers of oxidative stress and polycystic ovary syndrome (PCOS): a systematic review and meta-analysis. Hum Reprod Update 2013;19 :268–288.23303572
8 Goutami L Jena SR Swain A . Pathological role of reactive oxygen species on female reproduction. Adv Exp Med Biol 2022;1391 :201–220.36472824
9 Safari H Hajian M Nasr-Esfahani MH . Vitamin D and calcium, together and separately, play roles in female reproductive performance. Sci Rep 2022;12 :10470.35729248
10 Wimalawansa SJ . Vitamin D deficiency: effects on oxidative stress, epigenetics, gene regulation, and aging. Biology (Basel) 2019;8 :30.31083546
11 Evans KN Nguyen L Chan J . Effects of 25-hydroxyvitamin D3 and 1,25-dihydroxyvitamin D3 on cytokine production by human decidual cells. Biol Reprod 2006;75 :816–822.16957024
12 Zhang Y Leung DY Richers BN . Vitamin D inhibits monocyte/macrophage proinflammatory cytokine production by targeting MAPK phosphatase-1. J Immunol 2012;188 :2127–2135.22301548
13 Karmakar R Banik S Chatterjee M . Inhibitory effect of vitamin D3 on 3’methyl-4-dimethyl-amino-azobenzene-induced rat hepatocarcinogenesis: a study on antioxidant defense enzymes. J Exp Ther Oncol 2002;2 :193–199.12416023
14 Mohammadi M . Oxidative stress and polycystic ovary syndrome: a brief review. Int J Prev Med 2019;10 :86.31198521
15 Akbari M Ostadmohammadi V Lankarani KB . The effects of vitamin D supplementation on biomarkers of inflammation and oxidative stress among women with polycystic ovary syndrome: a systematic review and meta-analysis of randomized controlled trials. Horm Metab Res 2018;50 :271–279.29475212
16 Foroozanfard F Jamilian M Bahmani F . Calcium plus vitamin D supplementation influences biomarkers of inflammation and oxidative stress in overweight and vitamin D-deficient women with polycystic ovary syndrome: a randomized double-blind placebo-controlled clinical trial. Clin Endocrinol (Oxf) 2015;83 :888–894.26119844
17 Zhao J-F Li B-X Zhang Q . Vitamin D improves levels of hormonal, oxidative stress and inflammatory parameters in polycystic ovary syndrome: a meta-analysis study. Ann Palliat Med 2021;10 :169–183.33545754
18 Javed Z Papageorgiou M Deshmukh H . A randomized, controlled trial of vitamin D supplementation on cardiovascular risk factors, hormones, and liver markers in women with polycystic ovary syndrome. Nutrients 2019;11 :188.30658483
19 Zhao J Liu S Wang Y . Vitamin D improves in-vitro fertilization outcomes in infertile women with polycystic ovary syndrome and insulin resistance. Minerva Med 2019;110 :199–208.30612423
20 Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril 2004;81 :19–25.
21 Tatsch E Bochi GV Pereira Rda S . A simple and inexpensive automated technique for measurement of serum nitrite/nitrate. Clin Biochem 2011;44 :348–350.21185277
22 Beutler E Gelbart T . Plasma glutathione in health and in patients with malignant disease. J Lab Clin Med 1985;105 :581–584.3989350
23 Benzie IF Strain JJ . The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Anal Biochem 1996;239 :70–76.8660627
24 Janero DR . Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic Biol Med 1990;9 :515–540.2079232
25 Dunkley PR Jarvie PE Robinson PJ . A rapid Percoll gradient procedure for preparation of synaptosomes. Nat Protoc 2008;3 :1718–1728.18927557
26 Ostadmohammadi V Jamilian M Bahmani F . Vitamin D and probiotic co-supplementation affects mental health, hormonal, inflammatory and oxidative stress parameters in women with polycystic ovary syndrome. J Ovarian Res 2019;12 :5.30665436
27 Jamilian H Amirani E Milajerdi A . The effects of vitamin D supplementation on mental health, and biomarkers of inflammation and oxidative stress in patients with psychiatric disorders: a systematic review and meta-analysis of randomized controlled trials. Prog Neuropsychopharmacol Biol Psychiatry 2019;94 :109651.31095994
28 Jamilian M Samimi M Mirhosseini N . The influences of vitamin D and omega-3 co-supplementation on clinical, metabolic and genetic parameters in women with polycystic ovary syndrome. J Affect Disord 2018;238 :32–38.29859385
29 Luo J Li T Yuan J . Effectiveness of vitamin D supplementation on lipid profile in polycystic ovary syndrome women: a meta-analysis of randomized controlled trials. Ann Palliat Med 2021;10 :114–129.33545752
30 Sharifi N Amani R Hajiani E . Does vitamin D improve liver enzymes, oxidative stress, and inflammatory biomarkers in adults with non-alcoholic fatty liver disease? A randomized clinical trial. Endocrine 2014;47 :70–80.24968737
31 Karonova T Stepanova A Bystrova A . High-dose vitamin D supplementation improves microcirculation and reduces inflammation in diabetic neuropathy patients. Nutrients 2020;12 :2518.32825324
32 Duggan C de Dieu Tapsoba J Mason C . Effect of vitamin D3 supplementation in combination with weight loss on inflammatory biomarkers in postmenopausal women: a randomized controlled trialvitamin d3 supplementation, weight loss, and inflammation. Cancer Prevent Res 2015;8 :628–635.
33 Chandler PD Scott JB Drake BF . Impact of vitamin D supplementation on inflammatory markers in African Americans: Results of a four-arm, randomized, placebo-controlled trial vitamin D supplementation and inflammation in Blacks. Cancer Prev Res 2014;7 :218–225.
34 Rudnicka E Suchta K Grymowicz M . Chronic low grade inflammation in pathogenesis of PCOS. Int J Mol Sci 2021;22 :3789.33917519
35 Yin K Agrawal DK . Vitamin D and inflammatory diseases. J Inflamm Res 2014;7 :69.24971027
36 Krishnan AV Feldman D . Mechanisms of the anti-cancer and anti-inflammatory actions of vitamin D. Annu Rev Pharmacol Toxicol 2011;51 :311–336.20936945
37 Zhang Q Cheng Y He M . Effect of various doses of vitamin D supplementation on pregnant women with gestational diabetes mellitus: a randomized controlled trial. Exp Ther Med 2016;12 :1889–1895.27588106
38 de Medeiros Cavalcante IG Silva AS Costa MJC . Effect of vitamin D3 supplementation and influence of BsmI polymorphism of the VDR gene of the inflammatory profile and oxidative stress in elderly women with vitamin D insufficiency: Vitamin D3 megadose reduces inflammatory markers. Exp Gerontol 2015;66 :10–16.25827670
39 Heidari H Amani R Feizi A . Vitamin D Supplementation for premenstrual syndrome-related inflammation and antioxidant markers in students with vitamin D deficient: a randomized clinical trial. Sci Rep 2019;9 :1–8.30626917
40 Mohseni H Amani R Hosseini SA . Genetic variations in VDR could modulate the efficacy of vitamin D3 supplementation on inflammatory markers and total antioxidant capacity among breast cancer women: a randomized double blind controlled trial. Asian Pac J Cancer Prev 2019;20 :2065.31350967
41 Mamede LdCGP de Lima RLFC Silva AS . Effects of a single oral megadose of vitamin D3 on inflammation and oxidative stress markers in overweight and obese women: a randomized, double-blind, placebo-controlled clinical trial. Diabetes Metab Synd Ob 2021;14 :525.
42 Imanparast F Mashayekhi FJ Kamankesh F . Improving the endothelial dysfunction in type 2 diabetes with chromium and vitamin D3 byreducing homocysteine and oxidative stress: a randomized placebo-controlled trial. J Trace Elem Med Biol 2020;62 :126639.32971450
43 Agarwal A Aponte-Mellado A Premkumar BJ . The effects of oxidative stress on female reproduction: a review. Reprod Biol Endocrinol 2012;10 :1–31.22233680
44 Dzik KP Kaczor JJ . Mechanisms of vitamin D on skeletal muscle function: oxidative stress, energy metabolism and anabolic state. Eur J Appl Physiol 2019;119 :825–839.30830277
