
==== Front
BMC Cancer
BMC Cancer
BMC Cancer
1471-2407
BioMed Central London

12840
10.1186/s12885-024-12840-3
Research
Eslicarbazepine induces apoptosis and cell cycle arrest in C6 glioma cells in vitro and suppresses tumor growth in an intracranial rat model
Afsordeh Nastaran 1
Pournajaf Safura 1
Bayat Hadi 2
Mohajerani Fatemeh 3
Shojaei Amir 1
Mirnajafi-Zadeh Javad 1
Pourgholami Mohammad Hossein pourgholami.mh@gmail.com

1
1 https://ror.org/03mwgfy56 grid.412266.5 0000 0001 1781 3962 Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, 14115-111 Iran
2 grid.14709.3b 0000 0004 1936 8649 Biochemical Neuroendocrinology, Division of Experimental Medicine, Faculty of Medicine and Health Sciences, Institut de Recherches Cliniques de Montréal (IRCM), McGill University, Montréal, H2W 1R7 Canada
3 https://ror.org/03mwgfy56 grid.412266.5 0000 0001 1781 3962 Department of Molecular Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, 14115-111 Iran
4 9 2024
4 9 2024
2024
24 109912 4 2024
21 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Glioblastoma multiforme (GBM) is the most malignant brain tumor, with a poor prognosis and life expectancy of 14–16 months after diagnosis. The standard treatment for GBM consists of surgery, radiotherapy, and chemotherapy with temozolomide. Most patients become resistant to treatment after some time, and the tumor recurs. Therefore, there is a need for new drugs to manage GBM. Eslicarbazepine (ESL) is a well-known antiepileptic drug belonging to the dibenzazepine group with anticancer potentials. In this study, for the first time, we evaluated the potential effects of ESL on C6 cell growth, both in vitro and in vivo, and examined its molecular effects.

Methods

To determine the effect of ESL on the c6 cell line, cell viability, proliferation, and migration were evaluated by MTT assay, colony formation, and wound healing assay. Also, apoptosis and cell cycle were examined by flow cytometry, qRT-PCR, and western blotting. In addition, an intracranial model in Wistar rats was used to investigate the effect of ESL in vivo, and the tumor size was measured using both Caliper and MRI.

Results

The obtained results are extremely consistent and highly encouraging. C6 cell viability, proliferation, and migration were significantly suppressed in ESL-treated C6 cells (p < 0.001), as determined by cell-based assays. ESL treatment led to significant enhancement of apoptosis (p < 0.01), as determined by flow cytometry, and upregulation of genes involved in cell apoptosis, such as the Bax/Bcl2 ratio at RNA (p < 0.05) and protein levels (5.37-fold). Flow cytometric analysis of ESL-treated cells revealed G2/M phase cell cycle arrest. ESL-treated cells demonstrated 2.49-fold upregulation of p21 alongside, 0.22-fold downregulation of cyclin B1, and 0.34-fold downregulation of cyclin-dependent kinase-1 at the protein level. Administration of ESL (30 mg/kg) to male rats bearing C6 intracranial tumors also suppressed the tumor volume and weight (p < 0.01).

Conclusions

Based on these novel findings, ESL has the potential for further experimental and clinical studies in glioblastoma.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12885-024-12840-3.

Keywords

Glioblastoma
Eslicarbazepine
C6 cell
Apoptosis
G2/M cell cycle arrest
Cytochrome c
Caspase 3
P53
p21
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Gliomas are the most common type of adult brain tumor [1]. The World Health Organization (WHO) divides gliomas into four grades, and glioblastoma multiforme (GBM) fits into grade IV, which is the most malignant [2, 3]. Despite concomitant Surgery, radiotherapy, and temozolomide (TMZ) chemotherapy as the first-line treatment for GBM [4], the prognosis is still poor, and average survival is approximately 14–16 months from the time of diagnosis [5]. Additionally, GBM is associated with various disturbing CNS symptoms [6], and factors depending on tumor location, the affected areas of the brain, and the disease duration may impact those disorders [7, 8]. Defects in cognitive functions are common clinical symptoms of brain tumors (80%), which also occur in the in vivo GBM models in experimental animals [9, 10]. Temporal lobe and entorhinal cortex tumors cause impairment in learning, memory, and attention processes and also induce seizures [11, 12].

Due to the heterogeneous nature of GBM, chemoresistance is highly common among GBM patients, eventually leading to tumor recurrence [13]. Tumor recurrence and poor prognosis coupled with various drug-resistant symptoms make GBM a highly challenging disease that requires extensive investigations to identify new anticancer drugs to inhibit tumor growth and improve the management of patients.

Dibenzazepines are a well-known class of drugs that have been used for controlling epilepsy and mood disorders [14, 15]. Up to now, three generations of this drug class have been introduced, including carbamazepine (CBZ), oxcarbazepine (OXC), and eslicarbazepine (ESL), as the first, second, and third generation, respectively [16]. The fewer side effects, higher safety, and efficacy of ESL led to its approval by the U.S. Food and Drug Administration (FDA) as a promising anticonvulsant treatment for epilepsy in 2013 [17–19]. ESL blocks voltage-gated sodium channels and decreases glutamate release [20, 21]. Additionally, experimental studies have demonstrated the anticancer effectiveness of dibenzazepines in colon adenocarcinoma, HepG2 liver carcinoma cell lines [22, 23], and even in a clinical trial of prostate cancer [24]. More interestingly, OXC has been shown to inhibit the proliferation of human GBM cell lines U87-MG and T98G under in vitro conditions [25].

Herein, we evaluated for the first time the anticancer effects of ESL on the rat GBM C6 cell line. The C6 rat model is considered the most relevant and the gold standard in experimental animal models for glioblastoma. Orthotropic C6 allografts provide considerable insights into the biological mechanisms of GBM progression and invasion as they reproduce in vivo characteristics of human gliomas, including genetic and growth patterns, and highly resemble the brain tissue micro-environment and its immune response. As a syngeneic model, the necessity for the use of immune-competent rats or the use of immunosuppressive drugs is avoided [26]. We conducted a step-by-step progressive series of tests, starting with cell proliferation, apoptosis, and the cell cycle evolution in vitro. The promising results led to an in vivo experiment in male rats bearing C6 intracranial tumors.

Materials and methods

Cell line

C6 cells (ATCC Cat# CCL-107, RRID: CVCL_0194) were cultured in DMEM/F12 (GIBCO; Cat. #12500096) medium supplemented with 10% fetal bovine serum (FBS) (GIBCO; Cat. #A4736401) and 1% penicillin-streptomycin (GIBCO, Cat. #10378016) in a 37˚C and 5% CO2 humidified incubator.

MTT assay

The 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) (Sigma- Aldrich; Cat. #M2003) assay was used to assess the C6 cell’s viability. Cells (5 × 103) were seeded in 96-well microplates, left 24 h for attachment, and then exposed to different concentrations of ESL (0, 10, 25, 50, 75, 100,150, and 200 µM) for 48 and 72 h. Then, the cell media was discarded and replaced with 0.5 mg/ml MTT (Sigma- Aldrich; Cat. #M2003) stock solution. After 4 h, 100 ml dimethyl sulfoxide (Merck; Cat. #D8418) was added to each well and maintained for 15 min to dissolve formazan crystals. Finally, the absorbance of the samples was measured at 570 nm with a microplate reader (Cytation 3, United States).

Soft-agar colony formation assay

To perform a soft agar colony formation assay, DMEM-F12 containing 10% FBS, 1% pen strep/streptomycin, and 0.5% agar (BioBasic; Cat. #FB0010) was added to 6-well plates and rested at room temperature to solidify as the bottom layer. Next, C6 cells were suspended in DMEM F12 supplemented with 10% FBS, 1% pen strep/streptomycin, and 0.35% agar (BioBasic; Cat. #D0012), poured into each well as the top layer and cultivated in a humified incubator with 5% C02. Wells were then treated with varying concentrations of ESL (0, 10, 25, and 50 µM) for 48 h. After 21 days, the cells were stained with a 0.1% filtered crystal violet (w/v). Formed colonies with more than 50 cells were counted using the ImageJ software (RRID: SCR_003070) [27].

Morphology

To observe the impact of ESL treatment on C6 cell morphology, 1 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\:\times\:$$\end{document} 104 cells were seeded in 6-well plates and incubated overnight for attachment, followed by treatment with ESL (0, 10, 25, and 50 µM) for 48 h. Cells were then fixed with 4% paraformaldehyde for 10 min and stained by Giemsa (Sigma-Aldrich; LOT# 0620) for 15 min. The images were captured by an inverted microscope (Olympus, BX51 TRF, USA) at 10× magnification.

Wound healing assay

In vitro cell migration was measured using a wound-healing assay [28]. C6 cells were seeded in 24-well plates (1 × 105 cells/well) and grown to 75% confluence. The plates were scratched using a sterile pipette tip and washed twice with PBS. Afterward, serum-free DMEM or ESL in different concentrations (0, 10, 25, and 50 µM) were added to each well. The wounded areas images were captured at indicated time points (0 and 24 h), and the scratch’s average width after cell migration was calculated using ImageJ.

Dual acridine orange/ethidium bromide (AO/EB) fluorescent staining

Apoptosis in C6 cells was assessed using AO/EB fluorescent staining (Sigma-Aldrich; MO) [22]. C6 cells (1 × 105 cells/well) were seeded in 6-well plates. After 24 h, the cells were treated with different concentrations of ESL (0, 10, 25, and 50 µM) for 48 h. Then, treated cells were washed with PBS, detached with Trypsin-EDTA 0.25%, and resuspended in phosphate-buffered saline 1X (PBS) buffer. Next, AO/EB (1 µl) was added to cell suspension (10 µL) and poured on a slide. The fluorescence intensity was monitored at 488 nm excitation using a fluorescent microscope (Olympus, BX-51 Japan). The percentage of apoptotic cells was determined using the ImageJ software.

Apoptosis and cell cycle analysis

The DNA content and cell cycle of C6 cells treated with ESL (25 µM) were analyzed using flow cytometry. For apoptosis analysis, 1 × 106 cells were stained with FITC-Annexin V and propidium iodide (PI) for 15 min in the dark at 24 and 48-htime points. For cell cycle analysis, 24 h after ESL treatment, 1 × 106 cells were fixed with 70% ethanol for 1 h and then incubated with PI for 30 min in the dark. The FACS Calibur Flow Cytometry System (RRID: SCR_000401) was used to measure cell cycle and apoptosis, and FlowJo v.10 software (RRID: SCR_008520) was used to analyze the results [29].

RNA extraction, cDNA synthesis, and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)

Total RNA extraction from C6 cells treated with 0 and 25 µM ESL for 48 h was performed using the Trizole reagent (DNAbiotech; cat. #DB9683) and DNase I RNase-Free treatment kit (AMINSAN; cat. #EADN01) according to the manufacturer’s instructions. First-strand cDNA was synthesized with 1 µg of total RNA from these cells using the Easy cDNA Synthesis Kit (Pars tous; cat. 751173).

Transcript levels of the candidate genes were measured by real-time PCR on ABI Step One Real-time PCR system (Applied Biosystems, United States, (RRID: SCR_014281)) using SYBR Green Real-Time PCR Master Mix (BioFact; Cat. #DQ385) reagent, with reaction cycling conditions as follows: 95 °C for 10 min (activation), 95 °C for 15s (denaturation), annealing for 30s at optimum temperature and 30s of extension at 72 °C. To quantify the expression of target genes, threshold cycles (Ct) were used by the 2− ΔΔCt method with Beta-actin (Actb) as the internal reference gene. The primer sets used for Real-time qPCR analysis are listed in Table 1.

Table 1 The sequence of the primer sets was used in this study

Gene	Forward Primer (5ˊ-3ˊ)	Reverse Primer (3ˊ-5ˊ)	
Actb	TCTATCCTGGCCTCACTGTC	AACGCAGCTCAGTAACACTCC	
BCL2-associated X protein (Bax)	TGGTTGCCCTCTTCTACTTTGC	AAGTCCAGTGTCCAGCCCATG	
BCL2 Apoptosis Regulator (Bcl2)	TGGTTGCCCTCTTCTACTTTGC	AAGTCCAGTGTCCAGCCC	
Caspase 3 (Casp3)	GGAGCTTGGAACGCGAAGAA	ACACAAGCCCATTTCAGGGT	
Cytochrome C (Cycs)	TGACAGGCAATGCTAAACACC	ACATAAACCACAGTAAATGCCT	
Tumor Protein P53(Tp53)	GTACCGTATGAGCCACCTGAG	AGGACAGGCACAAACACGAAC	
Cyclin Dependent Kinase Inhibitor 1 A (Cdkn1a)	CGGGCAGTCCCTTCTAGTTCC	AATGCTTGAGCACACACGAG	
Cyclin Dependent Kinase 1 (Cdk1)	ACAGAGAGGGTCCGTTGT	CGTACTGGGCACTCCTTCTT	
Cyclin B1 (Ccnb1)	AAAGGCGTAACTCGAATGGA	CCGACCTTTTATTGAAGAGCA	

Western blot analysis

To examine the effect of ESL (25 µM, 48 h treatment) on C6 cellular expression of BCL2, CDK1, BAX, CASP-3, CYCS, P53, CCNB1 and CDKN1A, western blot analysis was performed according to the standard procedure [30]. In Brief, following treatment and protein extraction from the cells, total protein was purified using ice-cold RIPA buffer (Cat. #9806; Cell Signaling Technology). The concentration of purified proteins was determined by Bradford assay. Whole-cell extracts were separated by SDS- polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane (Millipore Corporation, MA, USA). The membranes were then incubated with specific primary and secondary antibodies as below:

The primary antibodies used: anti–ACTB (Santa Cruz Biotechnology; Cat# sc-517582), anti–BCL2 (Santa Cruz Biotechnology; Cat. #sc-7382), anti-BAX (Santa Cruz Biotechnology; Cat. #sc-7480), anti-CYCS (Santa Cruz Biotechnology; Cat. #sc-13156), anti-CCNB1 (Santa Cruz Biotechnology; Cat. #sc-166210), and anti-CDKN1A (Santa Cruz Biotechnology; Cat. #sc-6246), anti-P53 (Santa Cruz Biotechnology; Cat. #ab131442) and anti-CDK1 (Abcam; Cat. #ab131450), anti -CASP-3 (Cell Signaling; Cat. #14220), (1:1,000) (Cell Signaling). Secondary antibodies: anti-mouse (Santa Cruz Biotechnology; Cat# sc-516102) and anti-rabbit (Santa Cruz Biotechnology; Cat. #sc-2357).

Immunoreactivity was visualized by Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific; Cat. #32106) and photographed. Densitometry of the western blot was quantified using ImageJ software. β actin was used for equal protein loading.

Animal surgery and cell implantation

Twelve male Wistar rats weighing 200–250 g were purchased from the Pasteur Institute of Tehran and kept under 12 h of darkness and light in the animal house of Tarbiat Modares University (ethics approval code: IR. MODARES.REC.1400.101). The animals had ad libitum access to food and water. The rats were anesthetized with ketamine (90 mg/kg) and xylazine (10 mg/kg) and placed in a stereotactic apparatus to generate an intracranial C6 GBM model. Then, 106 C6 cells were injected into the right entorhinal cortex coordinated according to the Paxinos and Watson atlas as -8.0 mm posterior and 4.5 mm to the right of bregma and 4.1 mm below dura [26] by infusion pump. Animals were transferred to their home cage for recovery. Subjects were divided into the GBM + vehicle (VEH) group, in which animals received C6 cells and daily doses of the vehicle, and the GBM + ESL group, in which animals received C6 cells plus daily doses of ESL (30 mg/kg). Within 30 min after intracranial C6 injection, VEH or ESL was administered intraperitoneally twice daily for 18 consecutive days. At the end of the study, the tumor volumes were monitored by magnetic resonance imaging (MRI; T2 method, 3 Tesla, Voxel size = 0.2 × 0.2 × 0.8 mm3 and rat brain coil = 38 mm diameter); then measured by ITK software V3.8. Finally, the animals were sacrificed using ketamine/xylazine anesthesia. In compliance with the euthanasia recommendations stated in the “Guide for the Care and Use of Laboratory Animals”, and brain tumors were isolated. The weight and volume of the isolated brain tumors were calculated using a digital scale and caliper, respectively.

Statistical analysis

Data statistical analysis was performed using Graph Pad Prism (RRID: SCR_002798). One-way ANOVA and unpaired t-test followed by Tukey’s post-test were used when applicable to identify the differences between the studied groups. Data is presented as mean ± standard error of the mean (S.E.M.), with the statistical difference (p < 0.05) considered at p < 0.05. Significance levels are denoted as *p < 0.05; ** p < 0.01; *** p < 0.001. All experiments were performed at least in two or three replicates.

Results

ESL reduced cell viability, proliferation, and migration of C6 cells

To evaluate the effects of ESL (10, 25, 50, 75, 100, 150, and 200 µM) on cell viability, MTT assay was performed. Different concentrations of ESL significantly decrease cell viability compared to control cells (0 µM of ESL) at 48 h (p < 0.001 vs. 0 µM: Fig. 1A) and 72 h (p < 0.001 vs. 0 µM: Fig. 1B). The higher concentration of ESL showed enhanced suppression of cell viability. The IC50 value was determined to find the lowest concentration of ESL for killing 50% of treated cells at 48 h (Fig. 1C) and 72 h (Fig. 1D), in which the log IC50 was found to be 1.63 µM and 1.37 µM, respectively. We stained the treated cells (after 48 h under ESL treatment) to find out the effects of ESL (0, 10, 25, and 50 µM) on the morphology of the C6 cells. The obtained results were highly consistent with the MTT data in showing the concentration-dependent efficacy of ESL in profoundly suppressing cell viability and proliferation (Fig. 1E).

Cell proliferation and colony formation are flagships of cancer cells. To evaluate the inhibitory effect of ESL on these two phenotypes, we performed a soft-agar colony formation assay with different concentrations of ESL (0, 10, 25, and 50 µM) over 21 days (Fig. 1F). ESL significantly suppressed cell proliferation and colony formation of the C6 cells in three tested concentrations. The disruption was drug concentration-dependent, with a higher concentration of ESL having a significant positive correlation with decreased colony number (using a one-way ANOVA test) (p < 0.001 vs. 0 µM: Fig. 1G). Moreover, we carried out wound-healing assay to determine the effect of ESL on cell migration as a prominent feature of cancer invasion. According to our findings, ESL significantly suppressed gap closure compared to control cells (0 µM) after 48 h (Fig. 1H). Increased concentration of ESL more significantly (p < 0. 001) suppressed gap closure compared to vehicle (Fig. 1I). Altogether, our results clearly demonstrate that ESL significantly reduced the cell viability, proliferation, colony formation, and migration of the C6 cells.

Fig. 1 ESL suppressed cell viability, proliferation, colony formation, and migration of the C6 cells. MTT assay, using different concentrations of ESL (0-200 µM), was performed at 48 h (A) and 72 h (B). By increasing ESL concentration, the percentage of the viable C6 cells was significantly decreased at both time points (p < 0.001). The IC50 of ESL was 1.63 and 1.37 µM at 48 h (C) and 72 h (D), respectively. E) Giemsa staining showed the morphology of the C6 cells under different concentrations of ESL (0. 25 and 50 µM). F & G) Soft-agar colony formation assay showed an inverse correlation of colony number with ESL concentration. Increased concentration of ESL indicated a more significant reduction in colony formation of the C6 cells (p < 0.001). H & I) wound-healing assay demonstrated that the treated cells had significantly less migration at the higher concentration of ESL (p < 0.001). Scale bar: 200 μm

ESL significantly increased apoptosis rate in C6-treated cells

To evaluate the effects of ESL on cell apoptosis, the C6 cells were treated with various concentrations of ESL (10, 25, and 50 µM) and stained by AO/EB. Compared to control cells (0 µM), ESL treatment led to increased apoptosis at 24 and 48 h (Fig. 2A). One-way ANOVA analysis showed that the percentage of apoptotic cells significantly increased in 25 (p < 0.01) and 50 µM (p < 0.001) treated cells at 24 h and in 25, and 50 µM (p < 0.001) at 48 h (Fig. 2B). To confirm our AO/EB staining, we evaluated the apoptosis rate of the treated C6 cells with 25 µM ESL, using Annexin V -FITC and PI staining and flow cytometry. The apoptosis rate of the treated cells significantly increased at 24 h (p < 0.05) and 48 h (p < 0.01), using a three-way ANOVA test. Moreover, live cell numbers decreased at 24 h and 48 h compared to control cells (p < 0.00: Fig. 2C & D). To confirm the cell-based assays, the expression of candidate genes involved in cell apoptosis, including Bax/Bcl2 ratio, Cycs, Tp53, and Casp3, were measured using qRT-PCR. All evaluated genes showed a significant increase at RNA level in ESL-treated cells treated with 25 µM, compared to control cells (p < 0.05: Fig. 2E). Afterward, the expression of the candidate genes was measured at protein levels. Our results showed an increased level of BAX (4.03-fold) and a decreased level of BCL2 (0.75-fold) in treated cells compared to control cells. Accordingly, the BAX/BCL2 ratio was estimated to be 5.37-fold in treated cells compared to control cells. Our results indicated a 0.23-fold decrease in proprotein (p)-CASP3 expression and an 8.64-fold increase in the expression of cleaved (c)-CASP3 in ESL-treated cells compared to the control cells. Moreover, the expression of P53 and CYCS as key regulators of cell apoptosis also increased 1.52- and 2.25-fold in treated cells, respectively (Fig. 2F). Our results validated that ESL can induce cell apoptosis and decrease C6 GBM cell survival and viability.

Fig. 2 ESL increased the apoptosis rate in the c6 cells. (A & B) C6 cells under various concentrations of ESL (0, 10, 25, and 50 µM) were stained with AO/EB. ESL significantly increased the apoptosis rate at 24 and 48 h (green dots are viable cells and red dots are apoptotic cells). (C & D) The C6 cells treated with ESL (25 µM) were stained by Annexin V-PI and analyzed using flow cytometry. ESL significantly increased the rate of apoptotic cells at 24 h (p < 0.05) and 48 h (p < 0.01) compared to control cells. Moreover, the number of live cells decreased in the C6 cells treated with ESL (24 h, p < 0.001; 48 h, p < 0.001). (E) The expression level of the genes involved in apoptosis was determined at the RNA level in the C6 cells treated with 25 µM of ESL, using qRT-PCR. Bax/Bcl2 ratio, the expression of Cycs, Tp53 (p < 0.05), and Casp3 (p < 0.01) significantly increased in treated cells compared to control cells. (F) The expression of the candidate genes was also measured at the protein level using a Western blot test. The expression of BAX, P53, cleaved CASP3, and CYCS increased while the expression of BCL2 and p-CASP3 decreased in the C6 cells treated with 25 µM of ESL compared to control cells. Scale bar: 200 μm. The original and uncropped blot images are presented in supplementary Figure XA

ESL arrested cell cycle in the G2/M phase

To assess the effect of ESL on the cell cycle status, C6 cells were treated with 25 µM of ESL and analyzed at 24 h and 48 h with flow cytometry. The results showed that ESL caused cell cycle arrest in the G2/M phase of the cell cycle after 24 h. The G2/M phase arrest was also visible at 48 h (Fig. 3A). The expression of cell cycle-involved genes Cdkn1a, Cdk1, and Ccnb1 at the RNA level did not show significant differences between treated and control cells (Fig. 3B). However, the expression of these genes at the protein level increased in the ESL-treated cells compared to control cells (CDKN1A increased 2.49-fold; CCNB1 and CDK1 decreased 0.22- and 0.34-fold, respectively: Fig. 3C). For the first time, our results indicated that ESL arrests the G2/M phase of the cell cycle.

Fig. 3 ESL modulates the expression of the G2/M cell cycle regulatory proteins. (A) PI staining showed that treatment of the C6 cells with 25 µM ESL arrested the cell cycle in the G2/M phase at 24 and 48 h. (B) qRT-PCR from cells treated with ESL (25 µM for 48 h) were analyzed for the expression of Ccnd1, Cdk1, and Cdkn1a. (C) Western blot of lysates prepared from cells treated with ESL (25 µM for 48 h) was analyzed for the expression of CCNB1, CDK1, and CDKN1A proteins. The expression of p21, as a negative regulator, was increased, while the expression of CDK1 and CCNB1, as positive regulators, was decreased in treated cells compared to control cells. The original and uncropped blot images are presented in supplementary Figure XB

ESL suppressed tumor growth in an intracranial rat model of GBM: in vivo study

To confirm the potential inhibitory effects of ESL on tumor growth in vivo, we generated an intracranial C6 rat GBM model by injecting the C6 cells into the entorhinal cortex [26]. After 18 days, the MRI images showed tumor formation and growth in the VEH group (Fig. 4A & B), whereas, administration of 30 mg/kg ESL profoundly suppressed tumor growth (Fig. 4C & D). ESL-treatment suppressed tumor growth compared to the VEH group when calculated with MRI and Caliper (p < 0.001: Fig. 4F & G). In line with this, the tumor weight was substantially lower in the rats treated with 30 mg/kg ESL compared to the VEH treated group (p < 0.01: Fig. 4H). There was no significant change in the body weights resulting from ESL treatment (Fig. 4E).

Fig. 4 ESL significantly suppressed tumor growth in rat C6 glioma model. MRI images of rat C6 glioma model and tumor samples in VEH (A and B) and ESL-treated rats (C and D). Body weight differences between the VEH and ESL groups did not show significant differences (E). Analysis of tumor size data using MRI (F) and caliper (G) indicated that tumor growth was significantly suppressed in the ESL group. (H) The tumor weight in the ESL-treated animals was remarkably lower compared to the VEH-treated counterparts

Discussion

GBM is a malignant brain tumor with a short life expectancy [31]. The current treatment options are scarce and not sufficient to manage the disease. GBM cells ultimately develop resistance to radiation and chemotherapy, leading to tumor recurrence, remarking an urgent need for novel and effective treatment strategies for GBM. Specific chemotherapy for GBM is TMZ, but 50% of patients become resistant to this drug after treatment [13]. Subsequently, there is an extensive need for new drugs to manage post-TMZ resistance. In this study, we investigated for the first time the anticancer effects of ESL on C6 GBM cells both in vitro and in vivo.

Derivatives of dibenzoazepine have shown anticancer effects. CBZ, a first-generation dibenzoazepine, has been shown to reduce the viability of HT-29 human colon adenocarcinoma cells [22]. Besides, the protective effects of CBZ have been observed in breast cancer [32, 33]. Moreover, OXC, a second-generation dibenzoazepine, has also shown anti-proliferative effects in various malignant cells, including HeLa, MCF7, and HepG2 [34]. In a recent in vitro study by Dao Trong et al. (2023), OXC demonstrated antiproliferative effects on human Isocitrate dehydrogenase (IDH) mutant glioma stem-like cells in vitro [35]. Here, we report the anticancer effects of ESL on C6 glioma cells for the first time. Our results showed that ESL significantly suppresses C6 cell viability and proliferation in the MTT and soft agar colony formation assays. Besides, we showed that ESL reduces migration of the C6 cells with enhancing concentrations captured by wound healing assay. Dibenzazepine drugs inhibit the voltage-gated Na + channels, which are involved in cell processes including phagocytosis, endocytosis, secretion, proliferation, and differentiation in unstimulated cells. It has been reported that ESL has inhibitory effects on Nav1.5. By using Nav1.5 and voltage-gated sodium channels, cancer cells enhance their invasion and metastasis [36–38]. Accordingly, inhibition of these channels may directly or indirectly affect tumor cell growth, proliferation and migration.

In the next step, our staining results demonstrate that ESL increases the apoptosis in C6 GBM cells. By disrupting the expression of tumor suppressor genes, cancer cells can inhibit apoptosis and increase cell viability and proliferation. Apoptosis induction is a primary feature of anticancer drugs [39]. Our results showed a significant increase in the BAX/BCL2 ratio at RNA and protein levels. The anti-apoptotic protein BCL2 and pro-apoptotic member BAX are released from the mitochondria and play a crucial role in the process of apoptosis [40]. The BAX/BCL2 ratio is a rheostat determining whether the cells are undergoing apoptosis or not [41]. The release of CYCS from mitochondria is the turning point to start the irreversible process of apoptosis. CYCS converts p-CASP9 to active CASP9, which cleaves p-CASP3 to its activated form. As a consequence, the apoptosis process occurs irreversibly [42]. Our results indicated that the expression of pro-caspase 3 and its cleaved form were downregulated and upregulated, respectively, in the ESL-treated C6 cells. In line with our findings, Sohaib et al. reported CBZ-induced apoptosis of HT-29 cells through ROS and Caspase3 induction [22]. Moreover, the expression of cytochrome C also increased in ESL-treated C6 cells compared to control cells. Our findings correlate with the results reported by Song et al. that OXC can increase the apoptosis rate in brain cells [43]. We showed a significant increase in the Tp53 at the RNA level, confirmed by its enhancement at the protein level in the ESL-treated C6 cells. P53 is a protein with many biological functions that regulate intrinsic and extrinsic apoptotic pathways [44]. For example, P53 binds to the promoter of the Bax and regulates the expression of this gene [45].

Subsequent experiments revealed that ESL arrests C6 cell cycle progression in the G2/M phase. We found that the expression of CDKN1A, a cell cycle inhibitor, increased while the expression of CDK1 and CCNB1, cell cycle inducers, decreased at the protein level, albeit we did not find a significant difference at the RNA level. According to this, ESL probably acts as a translation regulator of the factors involved in the cell cycle. Our results correlate with the ones reported by Lee et al. (2016). They revealed that OXC affects the cell cycle at the G2/M phase in GBM cells, including U-87 MG and T98G [25]. The cell cycle is a vital process in cell proliferation. Cancer cells can dysregulate the cell cycle checkpoints and enhance cell proliferation. Hence, cell cycle regulation is the main focus of some anticancer strategies [46]. Cell damage during apoptosis leads to P53 enhancement, activating CDKN1A, which acts as an inhibitor of CCNB1/CDK1. The latter complex is the inducer of cell cycle arrest in G2/M phase [47]. Cell arrest in this phase will cause cell death via mitotic catastrophe in cells with damaged DNA [48].

This report presents the first finding that ESL suppresses GBM growth in a rat C6 glioma cell model. Our results also showed a high correlation between the three parameters of tumor weight and tumor volume (MRI and caliper measurements) [26]. Orthotropic C6 allografts provide highly similar tumors to human GBM characteristics regarding genetic profile, growth patterns, and invasion. Hence, our findings on the antitumor effects of ESL may pave the way for more research. Here, to fully understand the tumor growth pattern and better observe the drug effect, we recommend serial monitoring of the tumor volume by MRI throughout the experimental period. While it is common to only measure the tumor volume at the end of the study, measurements on days 7, 13 and 18 could be considered as optimal. This was a limitation of our study. On the other hand, repetitive MRI sessions are quite time and money-consuming, alongside the repetitive anesthesia could be hazardous to the rats. However, during the establishment of the tumor model, we did measure tumor volumes by MRI on days 10 and 18 post-cell inoculations to ensure consistent tumor growth in all control animals. After ensuring the establishment of the model, in the continuance of the work, the final measurements were done only on the 18th day. Undoubtedly, additional MRI measurements during the experiment would be highly informative. Our novel findings on the significant antitumor effects of ESL in the C6 rat glioblastoma model may pave the way for further research.

Conclusions

Overall, we present the first report showing ESL inhibits the viability, proliferation, and migration of the C6 cells thorough inducing apoptosis and arrest of the cell cycle in the G2/M phase in vitro. Furthermore, ESL profoundly suppresses tumor growth in vivo. Based on these encouraging findings further research on ESL in the management of glioblastoma is highly recommended.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Author contributions

N. A: Investigation, Formal analysis, Writing – original draft, Writing – review; editing.S.P: Investigation, Formal analysis, Writing – review & editing.H.B: Investigation, Formal analysis, Writing – review & editing.F. M: Investigation, Formal analysis.J. M-Z: Conceptualization, Supervision, Resources.A. Sh: Conceptualization, Supervision, Resources.M. P: Conceptualization, Methodology, Supervision, Resources, Funding acquisition, Writing – review & editing All authors reviewed the manuscript.

Funding

This project was supported by the Iran National Science Foundation (INSF) (grant number 4005050).

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethical/Scientific Committee of Tarbiat Modares University (TMU), Tehran, Iran (IR. MODARES.REC.1400.101). Furthermore, the rat model experiments were conducted according to the national guidelines for animal experiments (The ARRIVE guidelines) and the experimental protocol was approved by the Ethics Committee of Tarbiat Modares University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

AO/EB acridine orange/ethidium bromide

CBZ Carbamazepine

ESL Eslicarbazepine

FBS fetal bovine serum

GBM Glioblastoma multiforme

IDH Human Isocitrate dehydrogenase

MRI magnetic resonance imaging

MTT 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide

OXC Oxcarbazepine

PBS Phosphate-buffered saline

PI propidium iodide

qRT- PCR quantitative reverse transcriptase- Polymerase chain reaction

TMZ temozolomide

WHO World Health Organization

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Salari N Ghasemi H Fatahian R Mansouri K Dokaneheifard S Shiri MH Hemmati M Mohammadi M The global prevalence of primary central nervous system tumors: a systematic review and meta-analysis Eur J Med Res 2023 28 1 39 10.1186/s40001-023-01011-y 36670466
Salari N, Ghasemi H, Fatahian R, Mansouri K, Dokaneheifard S, Shiri MH, Hemmati M, Mohammadi M. The global prevalence of primary central nervous system tumors: a systematic review and meta-analysis. Eur J Med Res. 2023;28(1):39.36670466 10.1186/s40001-023-01011-y
2. Roura AJ Szadkowska P Poleszak K Dabrowski MJ Ellert-Miklaszewska A Wojnicki K Ciechomska IA Stepniak K Kaminska B Wojtas B Regulatory networks driving expression of genes critical for glioblastoma are controlled by the transcription factor c-Jun and the pre-existing epigenetic modifications Clin Epigenetics 2023 15 1 29 10.1186/s13148-023-01446-4 36850002
Roura AJ, Szadkowska P, Poleszak K, Dabrowski MJ, Ellert-Miklaszewska A, Wojnicki K, Ciechomska IA, Stepniak K, Kaminska B, Wojtas B. Regulatory networks driving expression of genes critical for glioblastoma are controlled by the transcription factor c-Jun and the pre-existing epigenetic modifications. Clin Epigenetics. 2023;15(1):29.36850002 10.1186/s13148-023-01446-4
3. Özcan H Emiroğlu BG Sabuncuoğlu H Özdoğan S Soyer A Saygı T A comparative study for glioma classification using deep convolutional neural networks Math Biosci Engineering: MBE 2021 18 2 1550 72 10.3934/mbe.2021080 33757198
Özcan H, Emiroğlu BG, Sabuncuoğlu H, Özdoğan S, Soyer A, Saygı T. A comparative study for glioma classification using deep convolutional neural networks. Math Biosci Engineering: MBE. 2021;18(2):1550–72.33757198 10.3934/mbe.2021080
4. Delgado-López PD Corrales-García EM Survival in glioblastoma: a review on the impact of treatment modalities Clin Translational Oncology: Official Publication Federation Span Oncol Soc Natl Cancer Inst Mexico 2016 18 11 1062 71 10.1007/s12094-016-1497-x
Delgado-López PD, Corrales-García EM. Survival in glioblastoma: a review on the impact of treatment modalities. Clin Translational Oncology: Official Publication Federation Span Oncol Soc Natl Cancer Inst Mexico. 2016;18(11):1062–71.10.1007/s12094-016-1497-x
5. Czapski B Baluszek S Herold-Mende C Kaminska B Clinical and immunological correlates of long term survival in glioblastoma Contemp Oncol (Pozn) 2018 22 1A 81 5 29628799
Czapski B, Baluszek S, Herold-Mende C, Kaminska B. Clinical and immunological correlates of long term survival in glioblastoma. Contemp Oncol (Pozn). 2018;22(1A):81–5.29628799
6. McKinnon C Nandhabalan M Murray SA Plaha P Glioblastoma: clinical presentation, diagnosis, and management BMJ 2021 374 n1560 10.1136/bmj.n1560 34261630
McKinnon C, Nandhabalan M, Murray SA, Plaha P. Glioblastoma: clinical presentation, diagnosis, and management. BMJ. 2021;374:n1560.34261630 10.1136/bmj.n1560
7. Scheibel RS Meyers CA Levin VA Cognitive dysfunction following surgery for intracerebral glioma: influence of histopathology, lesion location, and treatment J Neurooncol 1996 30 1 61 9 10.1007/BF00177444 8865004
Scheibel RS, Meyers CA, Levin VA. Cognitive dysfunction following surgery for intracerebral glioma: influence of histopathology, lesion location, and treatment. J Neurooncol. 1996;30(1):61–9.8865004 10.1007/BF00177444
8. Lee J Chaloner Winton Hall R The impact of Gliomas on Cognition and Capacity J Am Acad Psychiatry Law 2019 47 3 350 9 31186364
Lee J, Chaloner Winton Hall R. The impact of Gliomas on Cognition and Capacity. J Am Acad Psychiatry Law. 2019;47(3):350–9.31186364
9. Mukand JA Blackinton DD Crincoli MG Lee JJ Santos BB Incidence of neurologic deficits and rehabilitation of patients with brain tumors Am J Phys Med Rehabil 2001 80 5 346 50 10.1097/00002060-200105000-00005 11327556
Mukand JA, Blackinton DD, Crincoli MG, Lee JJ, Santos BB. Incidence of neurologic deficits and rehabilitation of patients with brain tumors. Am J Phys Med Rehabil. 2001;80(5):346–50.11327556 10.1097/00002060-200105000-00005
10. Wasilewska-Sampaio AP Santos TG Lopes MH Cammarota M Martins VR The growth of glioblastoma orthotopic xenografts in nude mice is directly correlated with impaired object recognition memory Physiol Behav 2014 123 55 61 10.1016/j.physbeh.2013.09.012 24096193
Wasilewska-Sampaio AP, Santos TG, Lopes MH, Cammarota M, Martins VR. The growth of glioblastoma orthotopic xenografts in nude mice is directly correlated with impaired object recognition memory. Physiol Behav. 2014;123:55–61.24096193 10.1016/j.physbeh.2013.09.012
11. Noll KR Sullaway C Ziu M Weinberg JS Wefel JS Relationships between tumor grade and neurocognitive functioning in patients with glioma of the left temporal lobe prior to surgical resection Neuro Oncol 2015 17 4 580 7 10.1093/neuonc/nou233 25227126
Noll KR, Sullaway C, Ziu M, Weinberg JS, Wefel JS. Relationships between tumor grade and neurocognitive functioning in patients with glioma of the left temporal lobe prior to surgical resection. Neuro Oncol. 2015;17(4):580–7.25227126 10.1093/neuonc/nou233
12. Bouckaert C, Germonpré C, Verhoeven J, Chong SA, Jacquin L, Mairet-Coello G, André VM, Leclercq K, Vanhove C, De Vos F et al. Development of a Rat Model for Glioma-Related Epilepsy. Int J Mol Sci 2020, 21(19).
13. Lee SY Temozolomide resistance in glioblastoma multiforme Genes Dis 2016 3 3 198 210 10.1016/j.gendis.2016.04.007 30258889
Lee SY. Temozolomide resistance in glioblastoma multiforme. Genes Dis. 2016;3(3):198–210.30258889 10.1016/j.gendis.2016.04.007
14. Lawthom C Peltola J McMurray R Dodd E Villanueva V Dibenzazepine agents in Epilepsy: how does Eslicarbazepine acetate Differ? Neurol Therapy 2018 7 2 195 206 10.1007/s40120-018-0111-2
Lawthom C, Peltola J, McMurray R, Dodd E, Villanueva V. Dibenzazepine agents in Epilepsy: how does Eslicarbazepine acetate Differ? Neurol Therapy. 2018;7(2):195–206.10.1007/s40120-018-0111-2
15. Assenza G Mecarelli O Lanzone J Assenza F Tombini M Di Lazzaro V Pulitano P The ROME (Retrospective Observational Multicenter study on Eslicarbazepine) study: efficacy and behavioural effects of eslicarbazepine acetate as adjunctive therapy for adults with partial onset seizures in real life Seizure 2018 58 35 40 10.1016/j.seizure.2018.03.028 29649684
Assenza G, Mecarelli O, Lanzone J, Assenza F, Tombini M, Di Lazzaro V, Pulitano P. The ROME (Retrospective Observational Multicenter study on Eslicarbazepine) study: efficacy and behavioural effects of eslicarbazepine acetate as adjunctive therapy for adults with partial onset seizures in real life. Seizure. 2018;58:35–40.29649684 10.1016/j.seizure.2018.03.028
16. Peltola J Holtkamp M Rocamora R Ryvlin P Sieradzan K Villanueva V Practical guidance and considerations for transitioning patients from oxcarbazepine or carbamazepine to eslicarbazepine acetate–Expert opinion Epilepsy Behav 2015 50 46 9 10.1016/j.yebeh.2015.05.036 26114438
Peltola J, Holtkamp M, Rocamora R, Ryvlin P, Sieradzan K, Villanueva V. Practical guidance and considerations for transitioning patients from oxcarbazepine or carbamazepine to eslicarbazepine acetate–Expert opinion. Epilepsy Behav. 2015;50:46–9.26114438 10.1016/j.yebeh.2015.05.036
17. Rocamora R A review of the efficacy and safety of eslicarbazepine acetate in the management of partial-onset seizures Ther Adv Neurol Disord 2015 8 4 178 86 10.1177/1756285615589711 26136845
Rocamora R. A review of the efficacy and safety of eslicarbazepine acetate in the management of partial-onset seizures. Ther Adv Neurol Disord. 2015;8(4):178–86.26136845 10.1177/1756285615589711
18. Ben-Menachem E Eslicarbazepine acetate: a well-kept secret? Epilepsy Curr 2010 10 1 7 8 10.1111/j.1535-7511.2009.01337.x 20126330
Ben-Menachem E. Eslicarbazepine acetate: a well-kept secret? Epilepsy Curr. 2010;10(1):7–8.20126330 10.1111/j.1535-7511.2009.01337.x
19. Verrotti A Loiacono G Rossi A Zaccara G Eslicarbazepine acetate: an update on efficacy and safety in epilepsy Epilepsy Res 2014 108 1 1 10 10.1016/j.eplepsyres.2013.10.005 24225327
Verrotti A, Loiacono G, Rossi A, Zaccara G. Eslicarbazepine acetate: an update on efficacy and safety in epilepsy. Epilepsy Res. 2014;108(1):1–10.24225327 10.1016/j.eplepsyres.2013.10.005
20. Ambrósio AF Silva AP Malva JO Soares-da-Silva P Carvalho AP Carvalho CM Inhibition of glutamate release by BIA 2–093 and BIA 2–024, two novel derivatives of carbamazepine, due to blockade of sodium but not calcium channels Biochem Pharmacol 2001 61 10 1271 5 10.1016/S0006-2952(01)00584-6 11322931
Ambrósio AF, Silva AP, Malva JO, Soares-da-Silva P, Carvalho AP, Carvalho CM. Inhibition of glutamate release by BIA 2–093 and BIA 2–024, two novel derivatives of carbamazepine, due to blockade of sodium but not calcium channels. Biochem Pharmacol. 2001;61(10):1271–5.11322931 10.1016/S0006-2952(01)00584-6
21. Hebeisen S Pires N Loureiro AI Bonifácio MJ Palma N Whyment A Spanswick D Soares-da-Silva P Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide Neuropharmacology 2015 89 122 35 10.1016/j.neuropharm.2014.09.008 25242737
Hebeisen S, Pires N, Loureiro AI, Bonifácio MJ, Palma N, Whyment A, Spanswick D, Soares-da-Silva P. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide. Neuropharmacology. 2015;89:122–35.25242737 10.1016/j.neuropharm.2014.09.008
22. Sohaib M Ezhilarasan D Carbamazepine, a histone deacetylase inhibitor induces apoptosis in human Colon adenocarcinoma cell line HT-29 J Gastrointest Cancer 2020 51 2 564 70 10.1007/s12029-019-00286-x 31407251
Sohaib M, Ezhilarasan D. Carbamazepine, a histone deacetylase inhibitor induces apoptosis in human Colon adenocarcinoma cell line HT-29. J Gastrointest Cancer. 2020;51(2):564–70.31407251 10.1007/s12029-019-00286-x
23. Beutler AS Li S Nicol R Walsh MJ Carbamazepine is an inhibitor of histone deacetylases Life Sci 2005 76 26 3107 15 10.1016/j.lfs.2005.01.003 15850602
Beutler AS, Li S, Nicol R, Walsh MJ. Carbamazepine is an inhibitor of histone deacetylases. Life Sci. 2005;76(26):3107–15.15850602 10.1016/j.lfs.2005.01.003
24. Stettner M Krämer G Strauss A Kvitkina T Ohle S Kieseier BC Thelen P Long-term antiepileptic treatment with histone deacetylase inhibitors may reduce the risk of prostate cancer Eur J Cancer Prev 2012 21 1 55 64 10.1097/CEJ.0b013e32834a7e6f 21979296
Stettner M, Krämer G, Strauss A, Kvitkina T, Ohle S, Kieseier BC, Thelen P. Long-term antiepileptic treatment with histone deacetylase inhibitors may reduce the risk of prostate cancer. Eur J Cancer Prev. 2012;21(1):55–64.21979296 10.1097/CEJ.0b013e32834a7e6f
25. Lee CY Lai HY Chiu A Chan SH Hsiao LP Lee ST The effects of antiepileptic drugs on the growth of glioblastoma cell lines J Neurooncol 2016 127 3 445 53 10.1007/s11060-016-2056-6 26758059
Lee CY, Lai HY, Chiu A, Chan SH, Hsiao LP, Lee ST. The effects of antiepileptic drugs on the growth of glioblastoma cell lines. J Neurooncol. 2016;127(3):445–53.26758059 10.1007/s11060-016-2056-6
26. Pournajaf S, Afsordeh N, Pourgholami MH. In vivo C6 glioma models: an update and a guide toward a more effective preclinical evaluation of potential anti-glioblastoma drugs. Rev Neurosci 2023.
27. Borowicz S, Van Scoyk M, Avasarala S, Karuppusamy Rathinam MK, Tauler J, Bikkavilli RK, Winn RA. The soft agar colony formation assay. J Vis Exp 2014(92):e51998.
28. Rodriguez LG, Wu X, Guan J-L. Wound-healing assay. Cell Migration: Dev Methods Protocols 2005:23–9.
29. Vermes I Haanen C Steffens-Nakken H Reutellingsperger C A novel assay for apoptosis flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled annexin V J Immunol Methods 1995 184 1 39 51 10.1016/0022-1759(95)00072-I 7622868
Vermes I, Haanen C, Steffens-Nakken H, Reutellingsperger C. A novel assay for apoptosis flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled annexin V. J Immunol Methods. 1995;184(1):39–51.7622868 10.1016/0022-1759(95)00072-I
30. Hirano S. Western blot analysis. Nanotoxicity: Methods Protocols 2012:87–97.
31. Krex D Klink B Hartmann C von Deimling A Pietsch T Simon M Sabel M Steinbach JP Heese O Reifenberger G Long-term survival with glioblastoma multiforme Brain 2007 130 Pt 10 2596 606 10.1093/brain/awm204 17785346
Krex D, Klink B, Hartmann C, von Deimling A, Pietsch T, Simon M, Sabel M, Steinbach JP, Heese O, Reifenberger G, et al. Long-term survival with glioblastoma multiforme. Brain. 2007;130(Pt 10):2596–606.17785346 10.1093/brain/awm204
32. Peralta MF Mendieta SN Scolari IR Gerbaldo MV Oliva MI Gil GA Granero GE Crivello ME Magnetic layered double hydroxides with carbamazepine for breast cancer treatment Heliyon 2023 9 10 e21030 10.1016/j.heliyon.2023.e21030 37916071
Peralta MF, Mendieta SN, Scolari IR, Gerbaldo MV, Oliva MI, Gil GA, Granero GE, Crivello ME. Magnetic layered double hydroxides with carbamazepine for breast cancer treatment. Heliyon. 2023;9(10):e21030.37916071 10.1016/j.heliyon.2023.e21030
33. Meng Q Chen X Sun L Zhao C Sui G Cai L Carbamazepine promotes Her-2 protein degradation in breast cancer cells by modulating HDAC6 activity and acetylation of Hsp90 Mol Cell Biochem 2011 348 1–2 165 71 10.1007/s11010-010-0651-y 21082217
Meng Q, Chen X, Sun L, Zhao C, Sui G, Cai L. Carbamazepine promotes Her-2 protein degradation in breast cancer cells by modulating HDAC6 activity and acetylation of Hsp90. Mol Cell Biochem. 2011;348(1–2):165–71.21082217 10.1007/s11010-010-0651-y
34. El Sharkawi FZ El Shemy HA Khaled HM Possible anticancer activity of rosuvastatine, doxazosin, repaglinide and oxcarbazepin Asian Pac J Cancer Prev 2014 15 1 199 203 10.7314/APJCP.2014.15.1.199 24528027
El Sharkawi FZ, El Shemy HA, Khaled HM. Possible anticancer activity of rosuvastatine, doxazosin, repaglinide and oxcarbazepin. Asian Pac J Cancer Prev. 2014;15(1):199–203.24528027 10.7314/APJCP.2014.15.1.199
35. Dao Trong P, Jungwirth G, Unterberg A, Herold-Mende C, Warta R. The antiepileptic drug Oxcarbazepine inhibits the growth of patient-derived isocitrate dehydrogenase mutant glioma stem-like cells. Cells 2023, 12(8).
36. Leslie TK Brückner L Chawla S Brackenbury WJ Inhibitory effect of Eslicarbazepine acetate and S-Licarbazepine on na(v)1.5 channels Front Pharmacol 2020 11 555047 10.3389/fphar.2020.555047 33123007
Leslie TK, Brückner L, Chawla S, Brackenbury WJ. Inhibitory effect of Eslicarbazepine acetate and S-Licarbazepine on na(v)1.5 channels. Front Pharmacol. 2020;11:555047.33123007 10.3389/fphar.2020.555047
37. Brackenbury WJ Djamgoz MB Activity-dependent regulation of voltage-gated na + channel expression in Mat-LyLu rat prostate cancer cell line J Physiol 2006 573 Pt 2 343 56 10.1113/jphysiol.2006.106906 16543264
Brackenbury WJ, Djamgoz MB. Activity-dependent regulation of voltage-gated na + channel expression in Mat-LyLu rat prostate cancer cell line. J Physiol. 2006;573(Pt 2):343–56.16543264 10.1113/jphysiol.2006.106906
38. Xia J Wang H Li S Wu Q Sun L Huang H Zeng M Ion channels or aquaporins as novel molecular targets in gastric cancer Mol Cancer 2017 16 1 54 10.1186/s12943-017-0622-y 28264681
Xia J, Wang H, Li S, Wu Q, Sun L, Huang H, Zeng M. Ion channels or aquaporins as novel molecular targets in gastric cancer. Mol Cancer. 2017;16(1):54.28264681 10.1186/s12943-017-0622-y
39. Hänggi K Ruffell B Cell death, therapeutics, and the immune response in cancer Trends Cancer 2023 9 5 381 96 10.1016/j.trecan.2023.02.001 36841748
Hänggi K, Ruffell B. Cell death, therapeutics, and the immune response in cancer. Trends Cancer. 2023;9(5):381–96.36841748 10.1016/j.trecan.2023.02.001
40. Hassan M Watari H AbuAlmaaty A Ohba Y Sakuragi N Apoptosis and molecular targeting therapy in cancer Biomed Res Int 2014 2014 150845 10.1155/2014/150845 25013758
Hassan M, Watari H, AbuAlmaaty A, Ohba Y, Sakuragi N. Apoptosis and molecular targeting therapy in cancer. Biomed Res Int. 2014;2014:150845.25013758 10.1155/2014/150845
41. Bayat H Pourgholami MH Rahmani S Pournajaf S Mowla SJ Synthetic miR-21 decoy circularized by tRNA splicing mechanism inhibited tumorigenesis in glioblastoma in vitro and in vivo models Mol Ther Nucleic Acids 2023 32 432 44 10.1016/j.omtn.2023.04.001 37181451
Bayat H, Pourgholami MH, Rahmani S, Pournajaf S, Mowla SJ. Synthetic miR-21 decoy circularized by tRNA splicing mechanism inhibited tumorigenesis in glioblastoma in vitro and in vivo models. Mol Ther Nucleic Acids. 2023;32:432–44.37181451 10.1016/j.omtn.2023.04.001
42. Cai J Yang J Jones DP Mitochondrial control of apoptosis: the role of cytochrome c Biochim Biophys Acta 1998 1366 1–2 139 49 10.1016/S0005-2728(98)00109-1 9714780
Cai J, Yang J, Jones DP. Mitochondrial control of apoptosis: the role of cytochrome c. Biochim Biophys Acta. 1998;1366(1–2):139–49.9714780 10.1016/S0005-2728(98)00109-1
43. Song Y Zhong M Cai FC Oxcarbazepine causes neurocyte apoptosis and developing brain damage by triggering Bax/Bcl-2 signaling pathway mediated caspase 3 activation in neonatal rats Eur Rev Med Pharmacol Sci 2018 22 1 250 61 29364494
Song Y, Zhong M, Cai FC. Oxcarbazepine causes neurocyte apoptosis and developing brain damage by triggering Bax/Bcl-2 signaling pathway mediated caspase 3 activation in neonatal rats. Eur Rev Med Pharmacol Sci. 2018;22(1):250–61.29364494
44. Fridman JS Lowe SW Control of apoptosis by p53 Oncogene 2003 22 56 9030 40 10.1038/sj.onc.1207116 14663481
Fridman JS, Lowe SW. Control of apoptosis by p53. Oncogene. 2003;22(56):9030–40.14663481 10.1038/sj.onc.1207116
45. Wei H Wang H Wang G Qu L Jiang L Dai S Chen X Zhang Y Chen Z Li Y Structures of p53/BCL-2 complex suggest a mechanism for p53 to antagonize BCL-2 activity Nat Commun 2023 14 1 4300 10.1038/s41467-023-40087-2 37463921
Wei H, Wang H, Wang G, Qu L, Jiang L, Dai S, Chen X, Zhang Y, Chen Z, Li Y, et al. Structures of p53/BCL-2 complex suggest a mechanism for p53 to antagonize BCL-2 activity. Nat Commun. 2023;14(1):4300.37463921 10.1038/s41467-023-40087-2
46. Alimbetov D, Askarova S, Umbayev B, Davis T, Kipling D. Pharmacological targeting of cell cycle, apoptotic and cell Adhesion Signaling pathways implicated in Chemoresistance of Cancer cells. Int J Mol Sci 2018, 19(6).
47. Massacci G Perfetto L Sacco F The cyclin-dependent kinase 1: more than a cell cycle regulator Br J Cancer 2023 129 11 1707 16 10.1038/s41416-023-02468-8 37898722
Massacci G, Perfetto L, Sacco F. The cyclin-dependent kinase 1: more than a cell cycle regulator. Br J Cancer. 2023;129(11):1707–16.37898722 10.1038/s41416-023-02468-8
48. Wang Y Ji P Liu J Broaddus RR Xue F Zhang W Centrosome-associated regulators of the G(2)/M checkpoint as targets for cancer therapy Mol Cancer 2009 8 8 10.1186/1476-4598-8-8 19216791
Wang Y, Ji P, Liu J, Broaddus RR, Xue F, Zhang W. Centrosome-associated regulators of the G(2)/M checkpoint as targets for cancer therapy. Mol Cancer. 2009;8:8.19216791 10.1186/1476-4598-8-8
