
==== Front
BMC Infect Dis
BMC Infect Dis
BMC Infectious Diseases
1471-2334
BioMed Central London

9815
10.1186/s12879-024-09815-x
Research
Exploring expression levels of the cGAS-STING pathway genes in peripheral blood mononuclear cells of spinal tuberculosis patients
Peng Xianglin 12
Pu Feifei 12
Zhou Fangzheng 12
Dai Xiyong 3
Xu Feng 3
Wang Junwen 4
Feng Jing fengjingwhdyyy@163.com

12
Xia Ping xiapingfm@163.com

4
1 grid.33199.31 0000 0004 0368 7223 Department of Orthopedics, Tongji Medical College, Traditional Chinese and Western Medicine Hospital of Wuhan, Huazhong University of Science and Technology, Wuhan, 430022 China
2 Department of Orthopedics, Wuhan No.1 Hospital, Wuhan, 430022 China
3 grid.508271.9 0000 0004 9232 3834 Wuhan Pulmonary Hospital, Wuhan Institute for Tuberculosis Control, Wuhan, 430022 China
4 https://ror.org/00qavst65 grid.501233.6 0000 0004 1797 7379 Department of Orthopedics, Wuhan Fourth Hospital, Puai Hospital, Wuhan, 430030 China
4 9 2024
4 9 2024
2024
24 9154 4 2024
27 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

This study aimed to investigate the differential expression levels of the cGAS-STING pathway in peripheral blood mononuclear cells (PBMCs) of spinal tuberculosis (TB) patients with different progression and its feasibility as a diagnostic marker.

Methods

Peripheral blood and medical records of 25 patients with spinal TB and 10 healthy individuals, were prospectively collected and analyzed. PBMCs and serum were extracted from peripheral blood and the expression levels of the cGAS-STING pathway in PBMCs were measured by real-time PCR (RT-PCR) and serum interferon β (IFN-β) expression levels were measured by enzyme-linked immunosorbent assay (ELISA). The expression of Interferon regulatory Factor 3 (IRF3) in PBMCs was measured using western blot. Statistical analysis was performed using the SPSS 26.0 statistical package.

Results

The results showed that the expression level of the TANK-binding kinase 1 (TBK1) and IRF3 was significantly higher in PBMCs (P < 0.05), in patients with active lesions than in patients with stable lesions. The serum concentration of IFN-β was significantly higher in patients with active lesions (P = 0.028). Compared with healthy individuals, the expression level of the cGAS-STING pathway was elevated in PBMCs of TB patients (P < 0.05), and the difference in the expression level of IFN-β was not statistically significant (P > 0.05), and the serum IFN-β concentration was elevated (P < 0.05). The calculated AUC values for TBK1 and IRF3 in PBMCs, IFN-β in serum and erythrocyte sedimentation rate (ESR) to distinguish between patients with active and stable lesions were 0.732, 0.714, 0.839, and 0.714 respectively.

Conclusions

The expression level of TBK1 and IRF3 in PBMCs, and IFN-β in the serum of patients with spinal TB is positively correlated with disease activity. TBK1 has higher specificity and IFN-β in serum has higher sensitivity when used to differentiate between patients with active and stable lesions.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-024-09815-x.

Keywords

Spinal tuberculosis
cGAS-STING
Diagnostic marker
PBMCs
Activity
http://dx.doi.org/10.13039/501100010849 Health and Family Planning Commission of Wuhan Municipality WX21M02 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Tuberculosis (TB), a chronic infectious disease caused by Mycobacterium tuberculosis (MTB), is a major cause of death worldwide, especially in developing countries, and places a heavy medical burden on them [1]. The World Health Organization (WHO) reports that 10.6 million individuals worldwide developed TB in 2021, with an incidence rate of 133 per 100,000 people. This represents a 3.6% increase from 2020 and resulted in 1.3 million deaths from TB-related illnesses [2]. TB is challenging to eliminate due to the complex immune evasion strategies of MTB, allowing it to persist asymptomatically for years [3]. Approximately 25% of the global population has latent TB, the primary source of active TB cases [4]. Spinal TB is the most common form of extrapulmonary TB, mostly in the thoracolumbar spine, and in severe cases can lead to kyphosis, spinal cord, cauda equina dysfunction, and even paraplegia [5, 6].

The main indications for surgical treatment of spinal TB are progressive nerve damage, deformity, spinal instability, recurrent infections, and unbearable pain [7]. However, at the present stage, the judgment of the surgical moment for spinal TB mainly relies on the exacerbation of symptoms, imaging data, and non-specific auxiliary tests such as erythrocyte sedimentation rate (ESR), C-reactive protein(CRP), blood routine, and so on. This results in many patients missing the optimal time for surgical intervention as well as poor surgical outcomes and a high rate of postoperative complications [8]. Early diagnosis and intervention can therefore effectively control the disease and shorten the treatment period [9]. In recent years, next-generation sequencing(NGS) and GeneXpert have shown great potential in the early diagnosis of spinal TB, but are limited by the level of diagnostic technology and the economic conditions that prevent them from widespread implementation in poor areas, and still fail to diagnose active TB [10]. Therefore, there is an urgent need for new diagnostic markers that can assess the progression of spinal TB to determine the appropriate timing of surgical intervention and enhance prognosis.

After the entry of MTB into the body, the innate immune defense response of the body is one of the most important factors affecting the prognosis of the disease [11], however, studies have demonstrated that MTB can evade the innate immune defenses of the host through a complex mechanism, thus avoiding removal by the immune system [12]. Macrophage autophagy is one of the important mechanisms of the innate immune defense response, and some researchers have suggested that autophagy activators are promising treatment options as a complement to standard anti-TB therapy and as an alternative treatment for drug-resistant TB [3]. Our previous studies have also shown that autophagy regulates osteoclastogenesis and bone resorption in spinal TB [13], therefore, autophagy is closely related to the development of spinal TB, and research on autophagy is important for improving the treatment and prognosis of spinal TB. It has been shown that cyclic GMP-AMP Synthase (cGAS) acts as a cytoplasmic DNA receptor to recognize exogenous double-stranded DNA (dsDNA) and catalyze the production of the second messenger 2’,3’-cGAMP, which signals downstream stimulator of interferon genes (STING), induces the entry of transcription factors Interferon regulatory Factor 3 (IRF3) and NF-κB into the nucleus, and expresses and secretes inflammatory factors such as interferon β (IFN-β), which in turn activates innate immune defense responses such as autophagy [14] (Fig. 1). Furthermore, cGAS acts as a dsDNA receptor, and the expression of downstream factors is theoretically positively correlated with TB activity, as intracytoplasmic dsDNA concentrations increase with MTB replication [15]. The cGAS-STING pathway may be feasible as a diagnostic marker to assess the progression of spinal TB.

Fig. 1 The invasion of pathogenic microorganisms and cellular damage result in the formation of abnormal DNA aggregates within the cytoplasm. The cGAS protein is responsible for the recognition of dsDNA within the cytoplasm and catalyse the second messenger 2’,3’-cGAMP to transmit the signal to the downstream factors. Ultimately, this results in the transcription factors IRF3 and NF-κB entering the nucleus, where they express and secrete inflammatory factors, including IFN-β, and thus activate the intrinsic and adaptive immune responses

Therefore, this study collected peripheral blood from patients with spinal TB. and analyzed the differential expression of the cGAS-STING pathway in peripheral blood mononuclear cells (PBMCs) from healthy individuals, patients with active lesions, and patients with stable lesions to investigate the feasibility of detecting the expression level of the cGAS-STING pathway to assess the progression of spinal TB.

Methods

Inclusion criteria and Exclusion criteria.

The inclusion criteria were as follows:

(i) Patients are diagnosed with spinal TB based on typical clinical presentation, imaging, laboratory examination, postoperative histologic examination, and pus culture.

(ii) Patients who voluntarily agreed to participate and signed an informed consent form.

The exclusion criteria for both groups were as follows:

(i) Patients with active pulmonary TB and other nonskeletal TB.

(ii) Patients with nonspecific spinal infections or suspected other specific infections such as Brucellosis spondylitis.

(iii) Patients with other serious acute or chronic uncontrolled bacterial infections.

(iv) Patients with HIV and other severe viral infections.

(v) Patients with immunodeficiency diseases such as rheumatoid arthritis, ankylosing spondylitis, and systemic lupus erythematosus.

(vi) Patients with diabetes or major diseases.

(vii) Patients with tumors or cardiac, pulmonary, hepatic, and renal insufficiency.

Patients

A total of 25 patients (mean age, 52.3 ± 18.6 years; 14 males and 11 females) with spinal TB and 10 healthy individuals (mean age, 53.5 ± 10.8 years; 4 males and 6 females) were admitted to Wuhan No.1 Hospital and Wuhan Pulmonary Hospital from December 2021 to March 2023, and patients who met the inclusion and exclusion criteria were selected. The study was reviewed and approved by the Ethics Committee of Wuhan No.1 Hospital, Tongji Medical College, Huazhong University of Science and Technology (the ethical approval number: 2021-33). All patients provided written informed consent.

Admission procedure and blood collection

Upon admission, the patient underwent laboratory testing and imaging, including routine blood tests, liver and kidney function, ESR and CRP levels, spinal X-ray, computed tomography (CT), and magnetic resonance imaging (MRI). Patients were categorized into high activity group and low activity group based on their Status of anti-TB treatment, clinical presentation, and examination. Patients were categorized into a high activity group and a low activity group based on their clinical presentation and examination (the clinical presentation, laboratory tests and diagnostic methods can be found in the supplementary file). Patients in the high-activity group had fever, night sweats, emaciation, lumbago, back pain, stiffness, neurological dysfunction, sinus tracts, etc. Patients in the low-activity group were already receiving anti-TB treatment and did not develop severe lordosis, nerve compression dysfunction, or spinal instability. All patients with spinal TB were diagnosed by postoperative pathology, TB antibodies, bacterial culture, and GeneXpert. While the enrolled patients had their blood drawn for laboratory examinations, 8 milliliters of fasting peripheral blood was drawn, 3 milliliters of peripheral blood was used to extract serum, and 5 milliliters of peripheral blood was used to extract PBMCs. Serum and PBMCs were stored at -80℃ until further analysis.

Reverse transcription polymerase chain reaction (RT-PCR) assay

PBMCs from all patients were tested by RT-PCR. Add 1 ml of RNA extraction solution to PBMCs, trichloromethane was employed to cleave proteins, isopropanol was used to precipitate RNA, Water Nuclease-Free was used to solubilize RNA, and all RNAs were finally diluted to 200 ng/µl. Preparation of reverse transcription systems: 4 µL of 5 x Reaction Buffer, 0.5 µL of Oligo (dT)18 Primer (100 µM), 0.5 µL of And Random Hexamer primer (100 µM), 1 µL of Enzyme Mix, 10 µL of Total RNA, and add RNase free water to 20 µl. RT-PCR was conducted under the following conditions: 95℃ for 30s, then 40 circles at 95℃ for 15s, and 65℃ for 30s. The 2 − ΔΔCt method was used to calculate relative expression. Gene expression levels in the TB group are indicated relative to the average expression in healthy individuals. All supplies were purchased from Servicebio (Wuhan, Hubei, China), and primer sequences are shown in Table 1.

Table 1 Primers of RT-PCR

Gene	Primers	Sequences(5’-3’)	
ACTIN	H-ACTIN-S	CACCCAGCACAATGAAGATCAAGAT	
	H-ACTIN-A	CCAGTTTTTAAATCCTGAGTCAAGC	
CGAS	H-CGAS(1)-S	ACATGGCGGCTATCCTTCTC	
	H-CGAS(1)-A	TCTTTGCGGTCCCACTGACT	
STING	H-STING-S	TTCTACTACTCCCTCCCAAATGC	
	H-STING-A	ATGTAATATGACCATGCCAGCC	
TBK1	H-TBK1-S	CAAGAACTTATCTACGAAGGGCG	
	H-TBK1-A	CGTGGATGTACTTTAGGGAGGG	
IRF3	H-IRF3-S	CTATGCCCTCTGGTTCTGTGTG	
	H-IRF3-A	TTGAGGTGGTGGGGAACAGG	
IFNB1	H-IFNB1-S	GACCAACAAGTGTCTCCTCCAAA	
	H-IFNB1-A	TAATCTCCTCAGGGATGTCAAAGT	

Enzyme-linked immunosorbent assay (ELISA)

Serum from 10 healthy patients and 15 patients were tested by ELISA, including 8 active lesions and 7 stable lesions. The concentration of IFN-β in serum was measured by ELISA according to the Human IFN-β ELISA Kit (MULTISCIENCES, Hangzhou, Zhejiang, China) instructions. The standard curve was made according to the concentration and OD value of the standards, and then the concentration of IFN-β in each group of serum was calculated according to the equation of the standard curve.

Western blot

Two PBMCs were randomly selected from each group for testing. Collect PBMCs and add approximately 250 µL of radioimmunoprecipitation assay lysate per 106 cells, then lysed on ice for 30 min and centrifuge at 12,000 rpm,4 °C for 10 min, collect the supernatant, which is total protein. The undenatured protein solution was taken and the protein concentration was measured using the BCA protein concentration assay kit. The protein solution was added to 5×SDS-PAGE Loading Buffer in a ratio of 4:1, denatured in a boiling water bath for 15 min, and stored in a -20 °C refrigerator. Use SDS-PAGE electrophoresis until the bromophenol blue is approximately 1 cm from the bottommost part, then transfer to PVDF membrane on ice for 30 min and block with 5% skimmed milk for 30 min. The primary antibody was added according to the instructions, and incubated overnight at 4 °C on a shaker, then the primary antibody was recovered, and the membrane was washed three times with TBST by rapid shaking for 10 min each time, horseradish peroxidase (HRP)-labeled secondary antibody was added dropwise and incubated for 30 min. Finally, the IOD values were analyzed using ECL luminol exposure for color development, using GAPDH as an internal reference. All reagents and antibodies were purchased from Servicebio and primary antibodies were of mouse (GAPDH, GB105002) and rabbit (IRF3, GB11368) origin, and secondary antibodies were goat anti-mouse (GAPDH, GB25301) and goat anti-rabbit (IRF3, GB23303).

Statistical analysis

Statistical analysis was performed using the SPSS 26.0 statistical package. We used ANOVA analysis for multiple comparisons with normal distribution variables and independent samples t-tests for two group comparisons. The Mann-Whitney U test was used for non-normally distributed data, and all results are expressed as mean ± standard deviation (means ± SD), p < 0.05 was considered a statistically significant difference.

Result

Basic information

There were 25 cases in the TB group, including 14 who had not received anti-TB treatment on admission and had symptoms such as fever, night sweats, emaciation, lumbago, back pain, stiffness, neurological dysfunction, sinus tracts, and 11 who had received anti-TB treatment and had stabilized lesions. The median duration and IQR of patients receiving anti-TB therapy was 35 (16,75) days. Basic patient information can be found in Table 2. All imaging studies suggested the destruction of the vertebral body and disc, and paravertebral abscesses, T2WI shows compression and deformation of the vertebral body with heterogeneous high signal and flow-like high signal in the soft tissue space. Frankel’s classification on admission: 1 case in grade B (no muscle motility below the plane of injury and preserved sensory function in the saddle region only), 2 cases in grade C (non-functional exercise capacity below the plane of injury exists only), 6 cases in grade D (functional exercise capacity exists below the plane of injury but is incomplete) and 16 cases in grade E (sensorimotor and sphincter function is normal). Some patients have symptoms of chronic wasting disease, such as anemia. Laboratory examination: routine blood, liver function (aspartate aminotransferase and alanine aminotransferase), and kidney function (urea nitrogen and creatinine) indicators were not significantly abnormal. All patients were diagnosed by bacterial culture (pus), bacterial smear (pus), GeneXpert (sputum), T-SPOT (peripheral blood), and postoperative pathology. Ten healthy individuals were collected from the same period of physical examination as the control group.

Table 2 Clinical characteristics and basic information of patients in different groups

Variables	healthy individual (n = 10)
Mean ± SD or N(%)	active lesions (n = 14)
Mean ± SD or N(%)	stable lesions (n = 11)
Mean ± SD or N(%)	p-value	
Age, yr	53.50 ± 10.78	50.21 ± 19.71	54.91 ± 17.75	0.778	
Gender				0.902	
Male	4(40.00)	8(57.14)	6(54.56)	
Fmale	6(60.00)	6(42.86)	5(45.46)	
Frankel	/			0.067	
B	/	1(7.14)	0(0)	
C	/	2(14.29)	0(0)	
D	/	4(28.57)	2(18.18)	
E	/	7(50.00)	9(81.82)	
Number of lesion segments	/	2.57 ± 1.16	2.00 ± 0.45	0.136	
Disease duration, mo	/	4.46 ± 4.31	3.68 ± 3.91	0.640	
abscess formation	/	11(78.6)	3(27.27)	0.009	

Higher expression of the cGAS-STING pathway in patients with spinal tuberculosis than in healthy individuals

The cGAS-STING pathway and IFN-β expression levels of PBMCs from spinal TB patients and healthy subjects were examined by RT-PCR, and gene expression levels in the TB group are indicated relative to the average expression in healthy individuals. The results showed that all patients with spinal TB showed higher expression of the cGAS-STING pathway than healthy individuals (Fig. 2A-D, P < 0.05). Nevertheless, no significant difference was observed in IFN-β expression in PBMCs of patients with spinal TB compared to healthy individuals (Fig. 2E). Hence, we randomly selected 2 PBMC samples from each group and examined their protein levels of IRF3, as IRF3 can directly stimulate IFN-β expression (Fig. 3). However, when ELISA was performed on serum IFN-β concentrations, significantly higher expression was observed in patients with active lesions than in healthy individuals and stable lesions (Fig. 2F).

Fig. 2 Comparison of cGAS-STING pathway expression levels in healthy group, active lesions and stable lesions groups (A-E: cGAS-STING pathway expression levels in PBMCs; F: IFN-β concentration in serum. All data above represent the means ± SD from at least three independent experiments. Differences were analyzed using the Waller-Duncan method. Different letters represent significant differences and the same letters represent non-significant differences

Fig. 3 Comparison of IRF3 expression levels of PBMCs in healthy group, active lesions and stable lesions groups. All data above represent the means ± SD from at least three independent experiments. Differences were analyzed using the Waller-Duncan method. Different letters represent significant differences and the same letters represent non-significant differences

Higher levels of the cGAS-STING pathway expression in patients with active lesions

A comparative analysis of the expression levels of the cGAS-STING pathway in PBMCs from patients with stable and active lesions revealed that PBMCs from patients with active lesions exhibited elevated expression levels of TANK-binding kinase 1 (TBK1) and IRF3. (Table 3). The average expression fold of cGAS was 8.42 ± 2.06, STING was 11.49 ± 4.52, TBK1 was 6.70 ± 2.18 and IRF3 was 12.69 ± 6.81 in patients with active lesions. The average expression fold of cGAS was 6.92 ± 1.58, STING was 9.88 ± 5.45, TBK1 was 4.41 ± 2.17 and IRF3 was 7.62 ± 2.72 in patients with stable lesions. The difference in IFN-β within PBMCs between the two groups was not statistically significant. We also calculated the sensitivity and specificity of the indicators for distinguishing between patients with active and stable lesions. Using the 95% confidence interval of the active lesions group as a reference. The sensitivities of TBK1, IRF3, and IFN-β (test by ELISA) were 71.4%, 71.4%, and 87.5%, and the specificities were 63.6%, 54.6%, and 57.1% respectively. The sensitivity and specificity of the clinically used ESR were 78.6% and 54.6%, respectively. In addition, we plotted ROC curves for each metric and calculated AUC values (supplementary files). The AUC values of TBK1, IRF3, IFN-β (test by ELISA), and ESR were calculated to be 0.732, 0.714, 0.839, and 0.714 respectively. The cutoff values of TBK1, IRF3, IFN-β (test by ELISA) and ESR were 3.75, 10.58, 64.47 and 88.50 respectively by calculating the maximum youden index. Therefore, it can be concluded that TBK1 has higher specificity and IFN-β (test by ELISA) has higher sensitivity when used to differentiate between patients with active and stable lesions. However, in terms of AUC value, the detection of peripheral blood IFN-β by ELISA has a better diagnostic value, but this data is not normally distributed in this experiment, and a larger sample size is needed in the future to further validate this conclusion.

Table 3 Comparison of cGAS-STING pathway expression levels in spinal tuberculosis patients with active and stable lesions

Item	active lesions (n = 14) Mean ± SD (95% CI) or Median (IQR)	stable lesions (n = 11)
Mean ± SD (95% CI) or Median (IQR)	P value	
cGAS, PBMC	8.42 ± 2.06 (7.24, 9.61)	6.92 ± 1.58 (5.85, 7.98)	0.057	
STING, PBMC	11.49 ± 4.52 (8.88, 14.10)	9.88 ± 5.45 (6.22, 13.54)	0.428	
TBK1, PBMC	6.70 ± 2.18 (5.44, 7.96)	4.41 ± 2.17 (2.96, 5.87)	0.016	
IRF3, PBMC	12.69 ± 6.81 (8.76, 16.62)	7.62 ± 2.72 (5.79, 9.45)	0.021	
IFN-β, PBMC	0.97 ± 0.60 (0.62, 1.31)	1.04 ± 0.71 (0.56, 1.51)	0.793	
IFN-β, Serum (pg/mL)	71.74(58.16, 144.02)	55.09(44.04, 62.28)	0.028	
ESR, mm/h	90.14 ± 31.64 (71.87, 108.41)	58.75 ± 30.13 (38.51, 78.99)	0.019	
CRP, mg/L	44.76(25.30, 62.94)	16.70(11.02, 40.68)	0.006	

Discussion

Spinal TB, the most common type of extrapulmonary TB, which continues to maintain a high morbidity and mortality rates worldwide. One of the primary reasons for the poor prognosis of patients with TB is the difficulty in diagnosis. In particular, in cases of spinal TB, an untimely diagnosis and subsequent treatment often results in the development of spinal scoliosis, spinal cord and cauda equina dysfunction, and even paraplegia [16]. Although IFN-γ release assays and tuberculin skin tests can differentiate latent infection from healthy individuals, they are unable to identify active infection and [17]. As the proportion of multidrug-resistant TB caused by MTB resistant to first-line anti-TB drugs such as isoniazid and rifampicin increases, it presents a growing challenge to patient safety and public health systems [18]. Therefore, early diagnosis and treatment of active TB are essential to control disease progression and shorten the treatment cycle. The progression of TB is closely related to the state of the host immune system [11]. This study took the immune signal within macrophages as the entry point to find potential diagnostic markers for assessing the activity of spinal TB. To achieve this goal, it is important to further elucidate the clinical and basic research on the interaction between the immune system and MTB.

Over the past decade, important advances have been made in a range of studies on cGAS as a key receptor in the cytoplasmic DNA detection system. Early studies focused on revealing the important role of the cGAS-STING pathway in antitumors, and in subsequent years the pathway has gained attention for its key role in infectious diseases [19]. Current studies have clarified the protective role of the cGAS pathway for the host in viral infectious diseases [20]. Recently, studies have gradually revealed the involvement of the cGAS pathway in the development of bacterial infectious diseases as well. Following the detection of bacterial dsDNA by cGAS, STING, and TBK1 were activated by synthesizing second messengers and inducing IFN-β expression [15]. However, the protective or deleterious effects of the cGAS pathway on the host depend on the bacterial species and the mode of infection. For example, in Staphylococcus aureus infections, IFN-β promotes macrophage polarization to an anti-inflammatory phenotype, which in turn promotes bacterial replication and survival [21]. In Streptococcus pneumoniae infection, IFN-β inhibits inflammation-related injury and lethality [22]. The antibacterial role of the cGAS pathway remains controversial in TB research, as IFN-β induces apoptosis and autophagy while promoting IL-10 expression to antagonize the inflammatory response [23, 24]. However, activation of STING can elicit Th1 and Th17 immune responses rather than IFN-dependent ways to protect cells from MTB infection [15, 25]. Despite the controversy, the role of cGAS in recognizing the dsDNA of MTB in the cytoplasm and further activating autophagy is well established; therefore, cGAS intervention has potential value as an antitubercular agent for autophagy activation [26]. Additionally, as the concentration of dsDNA in the cytoplasm increases with bacterial replication, the cGAS-STING pathway represents a viable approach for evaluating the progression of tuberculosis.

The diagnosis of TB has undergone significant advancements in recent years, with the introduction of sequencing technology and molecular detection techniques leading to notable improvements in both the speed and accuracy of diagnosis [10, 27]. However, a number of tests, including IFN-γ release assays and tuberculin skin tests, are ineffective in distinguishing between latent and active TB. Currently, the diagnosis of active spinal TB is based on the presence of progressive clinical symptoms, imaging examination, and poor specificity indicators, such as ESR and CRP [28]. This may result in patients being unable to undergo surgical intervention at the optimal time, which could lead to surgical difficulties, poor surgical outcomes, and postoperative complications [29]. The LIODetect® TB-ST assay has recently been developed by analysing a large number of antigen/antibody combinations, including a wide range of antigen mixtures and cell wall antigens. The test rapidly assesses serum, plasma or whole blood for the presence of IgG, IgA and IgM antibodies to MTB antigens to identify latent and active TB [30]. In particular, LIODetect® TB-ST is the only test that detects active TB and demonstrates good sensitivity. At this stage, the focus of research on TB has shifted from macroscopic and pathological studies to an immunological perspective [31]. As the intricate regulatory processes between MTB and the immune system gradually come to light, an increasing number of immune signalling molecules are emerging as promising diagnostic markers. For example, in latent TB, miR-889 is expressed at elevated levels and maintains the latent state of MTB by inhibiting autophagy. The inhibition of miR-899 expression resulted in the disruption of granulomas and the reactivation of latent TB, indicating a crucial function for miR-899 in the context of latent TB, as well as a diagnostic marker to distinguish latent TB from active TB [32]. Further analysis is required to elucidate the differences in immunological characteristics between latent and active TB in order to develop simple, accurate and rapid diagnostic methods.

In this study, we collected a total of 25 patients with spinal TB, 11 of whom had received medication and had stable lesions before hospital admission. The expression levels of the cGAS-STING pathway in PBMCs from patients with spinal TB were analyzed by ANOVA, independent sample t-test, and Mann-Whitney U test. The cGAS-STING pathway was highly expressed in all patients with spinal TB and was relatively lower in patients with stable lesions (P < 0.05). The significant difference in expression of TBK1 and IRF3 in PBMCs and IFN-β in serum between patients with active and stable lesions (P < 0.05). In comparison to ESR, ELISA for serum IFN-β exhibits superior sensitivity and RT-PCR for TBK1 in PBMCs displays a higher specificity to distinguish patients with active lesions. This study provides additional clinical evidence to the previous basic studies. It also provides a potential marker to diagnose active spinal TB. In the future, the postoperative outcomes of patients with different expression levels of these indicators can be compared to clarify the significance of this indicator in guiding the timing of surgical interventions. This study is important for early diagnosis of active spinal TB and holds promise for future widespread diagnosis or screening due to the ease and inexpensiveness of the test.

However, there are limitations to this study: (1) Because there are no uniform criteria to differentiate between high and low activity spinal TB, this study was judged by whether or not the patients received anti-TB treatment and by the presence or absence of abscess formation, neurological symptoms, ESR and CRP, which may have had some selection bias. (2) Because some patients underwent surgical treatment after admission resulting in changes in exposure factors, comparisons of pathway expression levels before and after treatment were not performed. (3) Furthermore, this study did not examine the protein levels of the cGAS-STING pathway and the phosphorylation levels of TBK1 and IRF3 in PBMCs to ensure multiple validations. (4) The cGAS-STING pathway can also be activated in other infections and tumours; therefore, this indicator cannot be used exclusively as a criterion for determining TB activity or can be used as a diagnostic marker when other diseases are excluded. (5) The sample of this study was small, and future multicenter and large-scale studies are needed.

Conclusion

The expression level of TBK1 and IRF3 in PBMCs, and IFN-β in the serum of patients with spinal TB is positively correlated with disease activity. TBK1 has higher specificity and IFN-β in serum has higher sensitivity when used to differentiate between patients with active and stable lesions.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Acknowledgements

No acknowledgement.

Author contributions

FP and XP retrieved and analyzed patient data and imaging. XDand FX searched literatures and wrote the original draft. FZ and JW reviewed and edited the manuscript. PX and JF made substantial contributions in data retrieval and data interpretation. All the authors read and approved the final manuscript.

Funding

This study was funded by the Medical Research Project of Wuhan Municipal Health Commission (grant number WX21M02).

Data availability

The datasets of the current study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Wuhan Hospital of Traditional Chinese and Western Medicine (Wuhan No.1 Hospital), Tongji Medical College, Huazhong University of Science and Technology and strictly adhered to the tenets of the Declaration of Helsinki (the ethical approval number: 2021-33). Informed consent was obtained from all subjects and their parents/legal guardian(s).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

cGAS cyclic GMP-AMP Synthase

CRP C-reactive protein

CT computed tomography

dsDNA double-stranded DNA

ELISA enzyme-linked immunosorbent assay

ESR erythrocyte sedimentation rate

IFN-β interferonβ

IRF3 interferon regulatory factor 3

mm/h millimetre/hour

MRI magnetic resonance imaging

MTB Mycobacterium tuberculosis

NGS next-generation sequencing

PBMCs peripheral blood mononuclear cells

STING stimulator of interferon genes

TB tuberculosis

TBK1 TANK-binding kinase 1

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xianglin Peng and Feifei Pu Contributed equally to this work.
==== Refs
References

1. Dheda K Perumal T Moultrie H The intersecting pandemics of tuberculosis and COVID-19: population-level and patient-level impact, clinical presentation, and corrective interventions Lancet Respir Med 2022 10 6 603 22 10.1016/S2213-2600(22)00092-3 35338841
Dheda K, Perumal T, Moultrie H, et al. The intersecting pandemics of tuberculosis and COVID-19: population-level and patient-level impact, clinical presentation, and corrective interventions. Lancet Respir Med. 2022;10(6):603–22.35338841 10.1016/S2213-2600(22)00092-3
2. Bagcchi S WHO’s Global Tuberculosis Report 2022 Lancet Microbe 2023 4 1 e20 10.1016/S2666-5247(22)00359-7 36521512
Bagcchi S. WHO’s Global Tuberculosis Report 2022. Lancet Microbe. 2023;4(1):e20.36521512 10.1016/S2666-5247(22)00359-7
3. Zhai W Wu F Zhang Y The Immune escape mechanisms of Mycobacterium Tuberculosis Int J Mol Sci 2019 20 2 340 10.3390/ijms20020340 30650615
Zhai W, Wu F, Zhang Y, et al. The Immune escape mechanisms of Mycobacterium Tuberculosis. Int J Mol Sci. 2019;20(2):340.30650615 10.3390/ijms20020340
4. Cohen A Mathiasen VD Schön T Wejse C The global prevalence of latent tuberculosis: a systematic review and meta-analysis Eur Respir J 2019 54 3 1900655 10.1183/13993003.00655-2019 31221810
Cohen A, Mathiasen VD, Schön T, Wejse C. The global prevalence of latent tuberculosis: a systematic review and meta-analysis. Eur Respir J. 2019;54(3):1900655.31221810 10.1183/13993003.00655-2019
5. Xia P Tao P Zhao X Anterior debridement combined with autogenous iliac bone graft fusion for the treatment of lower cervical tuberculosis: a multicenter retrospective study J Orthop Traumatol 2023 24 1 48 10.1186/s10195-023-00730-6 37709959
Xia P, Tao P, Zhao X, et al. Anterior debridement combined with autogenous iliac bone graft fusion for the treatment of lower cervical tuberculosis: a multicenter retrospective study. J Orthop Traumatol. 2023;24(1):48.37709959 10.1186/s10195-023-00730-6
6. Adhikari S Basnyat B Extrapulmonary tuberculosis: a debilitating and often neglected public health problem[J] BMJ Case Rep 2018 11 1 pii 10.1136/bcr-2018-226098
Adhikari S, Basnyat B. Extrapulmonary tuberculosis: a debilitating and often neglected public health problem[J]. BMJ Case Rep. 2018;11(1):pii.10.1136/bcr-2018-226098
7. Ruparel S Tanaka M Mehta R Surgical Management of spinal tuberculosis-the past, Present, and Future Diagnostics (Basel) 2022 12 6 1307 10.3390/diagnostics12061307 35741117
Ruparel S, Tanaka M, Mehta R, et al. Surgical Management of spinal tuberculosis-the past, Present, and Future. Diagnostics (Basel). 2022;12(6):1307.35741117 10.3390/diagnostics12061307
8. Pu F Feng J Niu F Diagnostic value of recombinant heparin-binding hemagglutinin adhesin protein in spinal tuberculosis Open Med (Wars) 2020 15 114 8 10.1515/med-2020-0017 32161780
Pu F, Feng J, Niu F, et al. Diagnostic value of recombinant heparin-binding hemagglutinin adhesin protein in spinal tuberculosis. Open Med (Wars). 2020;15:114–8.32161780 10.1515/med-2020-0017
9. Wu X Liang R Xiao Y Application of targeted next generation sequencing technology in the diagnosis of Mycobacterium Tuberculosis and first line drugs resistance directly from cell-free DNA of bronchoalveolar lavage fluid J Infect 2023 86 4 399 401 10.1016/j.jinf.2023.01.031 36706961
Wu X, Liang R, Xiao Y, et al. Application of targeted next generation sequencing technology in the diagnosis of Mycobacterium Tuberculosis and first line drugs resistance directly from cell-free DNA of bronchoalveolar lavage fluid. J Infect. 2023;86(4):399–401.36706961 10.1016/j.jinf.2023.01.031
10. Beviere M Reissier S Penven M The role of Next-Generation sequencing (NGS) in the management of tuberculosis: practical review for implementation in Routine Pathogens 2023 12 8 978 10.3390/pathogens12080978 37623938
Beviere M, Reissier S, Penven M, et al. The role of Next-Generation sequencing (NGS) in the management of tuberculosis: practical review for implementation in Routine. Pathogens. 2023;12(8):978.37623938 10.3390/pathogens12080978
11. Mayer-Barber KD Barber DL Innate and adaptive Cellular Immune responses to Mycobacterium tuberculosis infection Cold Spring Harb Perspect Med 2015 5 12 a018424 10.1101/cshperspect.a018424 26187873
Mayer-Barber KD, Barber DL. Innate and adaptive Cellular Immune responses to Mycobacterium tuberculosis infection. Cold Spring Harb Perspect Med. 2015;5(12):a018424.26187873 10.1101/cshperspect.a018424
12. Adikesavalu H Gopalaswamy R Kumar A Autophagy Induction as a host-Directed Therapeutic Strategy against Mycobacterium tuberculosis Infection[J] Med (Kaunas) 2021 57 6 522
Adikesavalu H, Gopalaswamy R, Kumar A, et al. Autophagy Induction as a host-Directed Therapeutic Strategy against Mycobacterium tuberculosis Infection[J]. Med (Kaunas). 2021;57(6):522.
13. Liu W Zhou J Niu F Mycobacterium tuberculosis infection increases the number of osteoclasts and inhibits osteoclast apoptosis by regulating TNF-α-mediated osteoclast autophagy[J] Exp Ther Med 2020 20 3 1889 98 32782497
Liu W, Zhou J, Niu F, et al. Mycobacterium tuberculosis infection increases the number of osteoclasts and inhibits osteoclast apoptosis by regulating TNF-α-mediated osteoclast autophagy[J]. Exp Ther Med. 2020;20(3):1889–98.32782497
14. Watson RO Bell SL MacDuff DA The Cytosolic Sensor cGAS detects Mycobacterium tuberculosis DNA to induce type I interferons and activate autophagy Cell Host Microbe 2015 17 6 811 9 10.1016/j.chom.2015.05.004 26048136
Watson RO, Bell SL, MacDuff DA, et al. The Cytosolic Sensor cGAS detects Mycobacterium tuberculosis DNA to induce type I interferons and activate autophagy. Cell Host Microbe. 2015;17(6):811–9.26048136 10.1016/j.chom.2015.05.004
15. Van Dis E Sogi KM Rae CS STING-Activating adjuvants elicit a Th17 Immune Response and protect against Mycobacterium tuberculosis infection Cell Rep 2018 23 5 1435 47 10.1016/j.celrep.2018.04.003 29719256
Van Dis E, Sogi KM, Rae CS, et al. STING-Activating adjuvants elicit a Th17 Immune Response and protect against Mycobacterium tuberculosis infection. Cell Rep. 2018;23(5):1435–47.29719256 10.1016/j.celrep.2018.04.003
16. Dunn RN Ben Husien M Spinal tuberculosis: review of current management Bone Joint J 2018 100–B 4 425 31 10.1302/0301-620X.100B4.BJJ-2017-1040.R1 29629596
Dunn RN, Ben Husien M. Spinal tuberculosis: review of current management. Bone Joint J. 2018;100–B(4):425–31.29629596 10.1302/0301-620X.100B4.BJJ-2017-1040.R1
17. Goletti D Delogu G Matteelli A Migliori GB The role of IGRA in the diagnosis of tuberculosis infection, differentiating from active tuberculosis, and decision making for initiating treatment or preventive therapy of tuberculosis infection Int J Infect Dis 2022 124 Suppl 1 S12 9 10.1016/j.ijid.2022.02.047 35257904
Goletti D, Delogu G, Matteelli A, Migliori GB. The role of IGRA in the diagnosis of tuberculosis infection, differentiating from active tuberculosis, and decision making for initiating treatment or preventive therapy of tuberculosis infection. Int J Infect Dis. 2022;124(Suppl 1):S12–9.35257904 10.1016/j.ijid.2022.02.047
18. Qiao J Yang L Feng J Analysis of efficacy and safety of linezolid-based chemotherapeutic regimens for patients with postoperative multidrug-resistant spinal tuberculosis Int J Infect Dis 2022 118 264 9 10.1016/j.ijid.2022.03.020 35339715
Qiao J, Yang L, Feng J, et al. Analysis of efficacy and safety of linezolid-based chemotherapeutic regimens for patients with postoperative multidrug-resistant spinal tuberculosis. Int J Infect Dis. 2022;118:264–9.35339715 10.1016/j.ijid.2022.03.020
19. Wang Y Luo J Alu A cGAS-STING pathway in cancer biotherapy Mol Cancer 2020 19 1 136 10.1186/s12943-020-01247-w 32887628
Wang Y, Luo J, Alu A, et al. cGAS-STING pathway in cancer biotherapy. Mol Cancer. 2020;19(1):136.32887628 10.1186/s12943-020-01247-w
20. Liu N Pang X Zhang H The cGAS-STING pathway in bacterial infection and bacterial immunity Front Immunol 2022 12 814709 10.3389/fimmu.2021.814709 35095914
Liu N, Pang X, Zhang H, et al. The cGAS-STING pathway in bacterial infection and bacterial immunity. Front Immunol. 2022;12:814709.35095914 10.3389/fimmu.2021.814709
21. Gries CM Bruger EL Moormeier DE Cyclic di-AMP released from Staphylococcus aureus Biofilm induces a macrophage type I Interferon Response Infect Immun 2016 84 12 3564 74 10.1128/IAI.00447-16 27736778
Gries CM, Bruger EL, Moormeier DE, et al. Cyclic di-AMP released from Staphylococcus aureus Biofilm induces a macrophage type I Interferon Response. Infect Immun. 2016;84(12):3564–74.27736778 10.1128/IAI.00447-16
22. Guarda G Braun M Staehli F Type I interferon inhibits interleukin-1 production and inflammasome activation Immunity 2011 34 2 213 23 10.1016/j.immuni.2011.02.006 21349431
Guarda G, Braun M, Staehli F, et al. Type I interferon inhibits interleukin-1 production and inflammasome activation. Immunity. 2011;34(2):213–23.21349431 10.1016/j.immuni.2011.02.006
23. Wassermann R Gulen MF Sala C Mycobacterium tuberculosis differentially activates cGAS- and inflammasome-dependent Intracellular Immune responses through ESX-1 Cell Host Microbe 2015 17 6 799 810 10.1016/j.chom.2015.05.003 26048138
Wassermann R, Gulen MF, Sala C, et al. Mycobacterium tuberculosis differentially activates cGAS- and inflammasome-dependent Intracellular Immune responses through ESX-1. Cell Host Microbe. 2015;17(6):799–810.26048138 10.1016/j.chom.2015.05.003
24. Sabir N Hussain T Shah SZA IFN-β: a contentious player in Host-Pathogen Interaction in Tuberculosis Int J Mol Sci 2017 18 12 2725 10.3390/ijms18122725 29258190
Sabir N, Hussain T, Shah SZA, et al. IFN-β: a contentious player in Host-Pathogen Interaction in Tuberculosis. Int J Mol Sci. 2017;18(12):2725.29258190 10.3390/ijms18122725
25. Li Q Liu C Yue R cGAS/STING/TBK1/IRF3 signaling pathway activates BMDCs Maturation following Mycobacterium bovis infection Int J Mol Sci 2019 20 4 895 10.3390/ijms20040895 30791397
Li Q, Liu C, Yue R, et al. cGAS/STING/TBK1/IRF3 signaling pathway activates BMDCs Maturation following Mycobacterium bovis infection. Int J Mol Sci. 2019;20(4):895.30791397 10.3390/ijms20040895
26. Majlessi L Brosch R Mycobacterium tuberculosis meets the Cytosol: the role of cGAS in anti-mycobacterial immunity Cell Host Microbe 2015 17 6 733 5 10.1016/j.chom.2015.05.017 26067600
Majlessi L, Brosch R. Mycobacterium tuberculosis meets the Cytosol: the role of cGAS in anti-mycobacterial immunity. Cell Host Microbe. 2015;17(6):733–5.26067600 10.1016/j.chom.2015.05.017
27. Naidoo K Dookie N Can the GeneXpert MTB/XDR deliver on the promise of expanded, near-patient tuberculosis drug-susceptibility testing? Lancet Infect Dis 2022 22 4 e121 7 10.1016/S1473-3099(21)00613-7 35227392
Naidoo K, Dookie N. Can the GeneXpert MTB/XDR deliver on the promise of expanded, near-patient tuberculosis drug-susceptibility testing? Lancet Infect Dis. 2022;22(4):e121–7.35227392 10.1016/S1473-3099(21)00613-7
28. Acharya B Acharya A Gautam S Advances in diagnosis of tuberculosis: an update into molecular diagnosis of Mycobacterium tuberculosis Mol Biol Rep 2020 47 5 4065 75 10.1007/s11033-020-05413-7 32248381
Acharya B, Acharya A, Gautam S, et al. Advances in diagnosis of tuberculosis: an update into molecular diagnosis of Mycobacterium tuberculosis. Mol Biol Rep. 2020;47(5):4065–75.32248381 10.1007/s11033-020-05413-7
29. Chen L Liu C Ye Z Comparison of Clinical Data between patients with complications and without complications after spinal tuberculosis surgery: a propensity score matching analysis Front Surg 2022 9 815303 10.3389/fsurg.2022.815303 35425806
Chen L, Liu C, Ye Z, et al. Comparison of Clinical Data between patients with complications and without complications after spinal tuberculosis surgery: a propensity score matching analysis. Front Surg. 2022;9:815303.35425806 10.3389/fsurg.2022.815303
30. La Manna MP Tamburini B Orlando V LIODetect®TB-ST: evaluation of novel blood test for a rapid diagnosis of active pulmonary and extra-pulmonary tuberculosis in IGRA confirmed patients Tuberculosis (Edinb) 2021 130 102119 10.1016/j.tube.2021.102119 34411890
La Manna MP, Tamburini B, Orlando V, et al. LIODetect®TB-ST: evaluation of novel blood test for a rapid diagnosis of active pulmonary and extra-pulmonary tuberculosis in IGRA confirmed patients. Tuberculosis (Edinb). 2021;130:102119.34411890 10.1016/j.tube.2021.102119
31. Li LS Yang L Zhuang L Ye ZY Zhao WG Gong WP From immunology to artificial intelligence: revolutionizing latent tuberculosis infection diagnosis with machine learning Mil Med Res 2023 10 1 58 38017571
Li LS, Yang L, Zhuang L, Ye ZY, Zhao WG, Gong WP. From immunology to artificial intelligence: revolutionizing latent tuberculosis infection diagnosis with machine learning. Mil Med Res. 2023;10(1):58.38017571
32. Chen DY Chen YM Lin CF Lo CM Liu HJ Liao TL MicroRNA-889 inhibits Autophagy to maintain mycobacterial survival in patients with latent tuberculosis infection by Targeting TWEAK mBio 2020 11 1 e03045 19 10.1128/mBio.03045-19 31992621
Chen DY, Chen YM, Lin CF, Lo CM, Liu HJ, Liao TL. MicroRNA-889 inhibits Autophagy to maintain mycobacterial survival in patients with latent tuberculosis infection by Targeting TWEAK. mBio. 2020;11(1):e03045–19.31992621 10.1128/mBio.03045-19
