
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00733-8
10.1016/j.psj.2024.104154
104154
MANAGEMENT AND PRODUCTION
Lambda-cyhalothrin induces heart injury in chickens by regulating cytochrome P450 enzyme system and inhibiting Nrf2/HO-1 pathway
Zhang Haoran *
Pan Liying *
Pu Zhaohong *
Wang Xiaoxu *
Zhang Jiaqi *
Wang Ye *
Chang Qingqing *
Laghari Farooque *
Zhang Runxiang zhangrunxiang@neau.edu.cn
*†1
⁎ College of Animal Science and Technology, Northeast Agricultural University, Harbin, Heilongjiang 150030, PR China
† Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture and Rural Affairs, Harbin, Heilongjiang 150030, PR China
1 Corresponding author: zhangrunxiang@neau.edu.cn
02 8 2024
10 2024
02 8 2024
103 10 1041545 6 2024
29 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Lambda-cyhalothrin (LCT) is a common pyrethroid insecticide widely used for ectoparasite control and hygiene pest prevention in poultry and this study aimed to investigate the mechanisms of LCT-induced cardiac injury in chickens. Low, medium, and high-dose LCT exposure models in chickens were established and hematoxylin and eosin (H&E) staining, dihydroethidium (DHE) staining, TUNEL staining, immunofluorescence, biochemical analysis, and gene expression analysis were used to study the effects of LCT exposure on the chicken heart. The results showed that LCT exposure increased the serum levels of creatine kinase (CK) and lactate dehydrogenase (LDH), led to muscle fiber breakage and inflammatory cell infiltration and caused cardiac tissue damage. The DHE staining and biochemical analysis revealed that LCT exposure resulted in the excessive accumulation of ROS, decreased activities/levels of catalase (CAT), total superoxide dismutase (T-SOD), and glutathione (GSH), and increased levels of the oxidative damage marker malondialdehyde (MDA). The TUNEL staining indicated that LCT exposure increased apoptosis possibly through the elevated expression of pro-apoptotic genes in the mitochondrial pathway, the reduced expression of anti-apoptotic genes, the upregulation of pro-inflammatory factors and the downregulation of anti-inflammatory factors. Here, LCT exposure significantly inhibited the expression of genes in the Nrf2/HO-1 pathway and activated the expression of genes in the CYP450 enzyme system. Compared to the low-dose group, the high-dose LCT exposure group showed lower levels of apoptosis and inflammation, possibly related to the low oxidative stress levels mediated by the decreased expression of the CYP450 enzyme system. In conclusion, LCT exposure induces oxidative stress, apoptosis, and inflammation in chicken hearts, which may be associated with the inhibition of the Nrf2/HO-1 pathway and activation of the CYP450 enzyme system. This study provides a theoretical basis for the safer use of insecticides in poultry production.

Key words

Lambda-cyhalothrin
chicken
oxidative stress
Cytochrome P450
Nrf2/HO-1 pathway
==== Body
pmcINTRODUCTION

Pyrethroids are derivatives of naturally occurring pyrethrins and comprise a class of broad-spectrum insecticides capable of controlling various pests. As a new type of biopesticide, pyrethroids are characterized by low toxicity, broad-spectrum activity, and high efficiency, gradually replacing the more hazardous organochlorine and organophosphorus insecticides. Pyrethroid insecticides are divided into Type I and Type II based on whether their structure contains an α-cyano group (Singh, et al., 2022).

Lambda-Cyhalothrin (LCT) is a Type II pyrethroid insecticide with broad insecticidal activity. It interferes with the nervous system of pests by inhibiting sodium ion channels and preventing the normal transmission of nerve signals, leading to paralysis and death. It is widely used for controlling ectoparasites in poultry and can effectively combat various ectoparasites, including lice, mites, and ticks, which pose health threats to poultry by causing skin irritation, anemia, and infectious diseases. In some poultry farms, LCT is also used to combat houseflies to prevent the spread of pathogenic microorganisms (Xu, et al., 2023). Commercial LCT is usually diluted with water and sprayed in poultry houses and evenly sprayed on the feathers and skin of poultry to control ectoparasites and sanitary pests. However, due to the low affinity of the water-diluted insecticide to poultry feathers, a large amount of the diluted insecticide falls on the ground, in cages, and even in feed during spraying, leading to accidental ingestion by poultry. Some of the insecticide also floats in the air and is inhaled by people and poultry, wasting the insecticide and posing health risks to humans and poultry (Pan, et al., 2009). Additionally, due to the increased frequency of LCT use in recent years, it is frequently detected in soil, water ecosystems, and organisms. In the Sonora region of Mexico, LCT had the highest concentration of pyrethroid insecticides in the soil, reaching 6.5 μg/kg. High concentrations of LCT have also been detected in soil in the Togo region of Africa and farms in Spain. Research in Kenya indicates that LCT residues are high on the surfaces of fruits and vegetables and in surface water (Fernandez-Alvarez, et al., 2010; Mawussi, et al., 2014; Moreno-Villa, et al., 2012; Chaka, et al., 2023). Therefore, LCT pollution is widespread. According to World Health Organization (WHO) recommendations, the acceptable daily intake (ADI) of LCT for humans is 0 to 0.02 mg/kg body weight. In animals, the half-life of LCT ranges from several hours to a few days. It is primarily metabolized in the liver through processes such as hydrolysis, oxidation, and conjugation, resulting in relatively less toxic metabolites, which are excreted from the body through urine and feces. It poses a threat to the health of humans and animals during its metabolic process.

It is known that pyrethroid insecticides exhibit cardiotoxicity, whereas Deltamethrin has been shown to induce cardiac damage in various animals. For example, Deltamethrin can induce cardiac injury and fibrosis in rats, leading to lymphocyte and tissue cell infiltration in the heart and subendocardial edema. It can also interfere with heart development in zebrafish, and induce cardiotoxicity in crucian carp (Haverinen and Vornanen, 2016; Feriani, et al., 2020; Ghazouani, et al., 2020; Liu, et al., 2021; Tekeli, et al., 2021). Cypermethrin causes DNA damage in rat cardiomyocytes, reduced cell membrane fluidity, increased cholesterol content, and increased protein and lipid oxidation, leading to cardiac injury and fibrosis (Ghazouani, et al., 2020). Studies have shown that Fenpropathrin affects heart rate, stroke volume, cardiac output, fractional shortening, and ejection fraction in zebrafish larvae (Saputra, et al., 2023). Additionally, short-term and long-term exposure to pyrethroids negatively affects the human cardiovascular system, with a possible positive correlation between pyrethroid exposure and increased risk of coronary heart disease (Han, et al., 2017). Cardiac damage is often accompanied by oxidative stress, a state of imbalance between oxidation and antioxidation in the body characterized by oxidation levels exceeding the cell's antioxidant capacity, leading to cell damage. Oxidative stress can cause cardiac injury and when excess oxidative products accumulate, they disrupt the normal physiological functions of the cardiomyocytes and non-cardiomyocytes, leading to cardiac inflammation, cardiomyocyte apoptosis, fibrosis, and hypertrophy (Liu, et al., 2023). Nuclear factor erythroid 2-related factor 2 (Nrf2) is central to oxidative stress and cardiac protection. Decreased Nrf2 expression results in increased oxidative stress markers and induces cell damage. Studies have shown that Deltamethrin can inhibit the Nrf2/HO-1 pathway and induce myocardial injury in quail (Yang, et al., 2022). Meanwhile, the cytochrome P450 enzyme system (CYP450s) is a superfamily of proteins containing heme as a cofactor, playing a crucial role in the metabolism of many harmful substances, especially xenobiotics. Ultimately, the activation of CYP450s induces the production of excess reactive oxygen species (ROS), thereby inducing oxidative stress (Zheng, et al., 2019).

Despite the evidence of the cardiotoxic effect of these pyrethroid insecticides, there is little research on the damage and mechanism of LCT on the hearts of poultry. With the transferring of laying hens from conventional cages to alternative systems, such as furnished cages, aviaries, and free-range systems, the increased incidence of ectoparasite infection has become a serious health and welfare problem for poultry production (Wei, et al., 2022). Therefore, this study simulated the strategies for controlling ectoparasites and hygienic pests in poultry farms, using commercial LCT to establish low-, medium-, and high-dose exposure models in chickens. The aim was to explore the impact of LCT on the heart of chickens, and to investigate the potential mechanisms of LCT-induced heart damage based on the Nrf2/HO-1 pathway and the CYP450 enzyme system, providing data for the toxicological risk assessment of LCT in the environment and the effective management of pyrethroid pesticide application in the poultry industry.

MATERIALS AND METHODS

Animals and Treatments

All animal experiments are conducted in strict compliance with the applicable regulations of Northeast Agricultural University's Experimental Animal Ethics Committee (NEAUEC202376). A total of 80 healthy 1-day-old chicks (Hy-Line Pink) were purchased from Harbin Pioneer Breeding Farm (Harbin, China). According to Harbin Pioneer Breeding Farm, no pesticides were used during the incubation and transportation of these chicks. Upon arrival at our laboratory, the chicks were housed in uncontaminated cages in the environment-controlled room with appropriate temperature, humidity, and lighting. The chicks were randomly divided into four groups: a control group (0 mg/kg/d body weight [b.w.]), a low-dose LCT group (10 mg/kg/d b.w.), a medium-dose LCT group (50 mg/kg/d b.w.), and a high-dose LCT group (200 mg/kg/d b.w.). The LCT was diluted with distilled water and uniformly sprayed on the surface of the feed. To better control the chicks' intake of LCT during the experiment, and due to the lack of specific LD50 data for chicks, we referred to the Environmental Protection Agency (EPA) Guidelines for Ecological Risk Assessment and chose 1/20 of the LD50 for mallards (3,950 mg/kg) as the highest exposure level (200 mg/kg/d b.w.) (U.S. Environmental Protection Agency, 1998; ECHA, 2011). Then, 1/4 and 1/20 of the 200 mg/kg/d b.w. were selected as the medium and low doses, respectively. The LCT (50 g/L) was purchased from Zhongbao Green Agricultural Technology Group Co., Ltd. (Beijing, China). The chicks were housed in uncontaminated cages in an environment-controlled room with appropriate temperature, humidity, and lighting. Standard feed and water were provided regularly and ad libitum during the 6-wk exposure experiment. Then, after a 12-h fast, the chickens were euthanized, blood samples were collected, centrifuged, and the supernatant was stored at -80°C. The hearts were dissected out, fixed in 4% paraformaldehyde, or frozen in liquid nitrogen and stored at -80°C for subsequent experiments.

Hematoxylin and Eosin Staining

The chicken heart tissue was initially fixed with 4% paraformaldehyde to prepare slices, which were subsequently dehydrated using a gradient of alcohol in paraffin, embedded in paraffin, and then sectioned into slices measuring 4 μm in thickness. Following dewaxing and drying procedures, the slices were stained with hematoxylin and eosin. The resulting pathological alterations in heart tissue under varying doses of LCT were examined using a light microscope.

Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling Staining

A TUNEL detection kit (Roche, Basel, Switzerland) was utilized to assess apoptosis, following the manufacturer's instructions. First, cardiac tissues were embedded in paraffin, followed by sectioning and deparaffinization procedures. The cardiac tissues were then treated with proteinase K and counterstained with DAPI for nuclear staining. The resulting sections were examined and photographed using a fluorescence microscope (ECLIPSE C1, Nikon, Tokyo, Japan). For each sample, five fields of view were randomly selected and photographed and the fluorescence images were quantitatively analyzed using ImageJ software. The images were converted to 8-bit grayscale images, the region of interest (ROI) was selected, and the mean fluorescence intensity was calculated. Background fluorescence intensity was measured in each image and subtracted from the sample fluorescence intensity. The above steps were repeated to calculate the mean and standard deviation of fluorescence intensity for each sample group.

Biochemical Analysis

The collected serum was utilized to assess markers of heart injury. The activities of creatine kinase (CK) and lactate dehydrogenase (LDH) in the serum were measured using the Chemray800 automatic biochemical analyzer (Rayto Life and Analytical Sciences Co., Ltd, Shenzhen, China).

ROS Detection

The harvested heart tissue sections were incubated in Dihydroethidium (DHE) at 37°C for 40 min, followed by washing with PBS and staining with DAPI for 10 min. The resulting sections were examined and photographed using a fluorescence microscope (ECLIPSE C1, Nikon, Tokyo, Japan). Five fields of view were randomly selected and photographed for each sample group. Fluorescence images were quantitatively analyzed using ImageJ software. The images were converted to 8-bit grayscale images, the ROI was selected, and the mean fluorescence intensity was calculated. Background fluorescence intensity was measured in each image and subtracted from the sample fluorescence intensity. These steps were repeated to calculate the mean and standard deviation of fluorescence intensity for each sample group.

Determination of Antioxidant Capacity

A 10% homogenate of heart tissue was prepared using normal saline, and the content/activity of catalase (CAT), total superoxide dismutase (T-SOD), glutathione (GSH), and malondialdehyde (MDA) in the heart tissue were assessed following the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, China) to evaluate antioxidant capacity.

Immunofluorescence Analysis

The paraffin sections of heart tissue underwent dewaxing and were then incubated with tissue AutoFluo Quencher A for 30 min following antigen retrieval. Subsequently, they were treated with 3% H2O2 at room temperature for 25 min, followed by sealing with 3% BSA for 30 min. The diluted primary antibodies (Nrf2 and IL-1β) were applied to cover the tissue sections, which were then incubated overnight at 4°C. After washing with PBS, the sections were incubated with the secondary antibody for 50 min. They were further treated with TSA-488 staining solution and kept away from light for 10 min. Following PBS rinsing, the sections were restained with DAPI for 5 min, incubated with tissue AutoFluo Quencher B solution for 5 min, rinsed with flowing water for 3 min, and finally examined under a fluorescence microscope (ECLIPSE C1, Nikon, Tokyo, Japan). Five fields of view were randomly selected and photographed for each sample group. Fluorescence images were quantitatively analyzed using ImageJ software. The images were converted to 8-bit grayscale images, the ROI was selected, and the mean fluorescence intensity was calculated. Background fluorescence intensity was measured in each image and subtracted from the sample fluorescence intensity. These steps were repeated to calculate the mean and standard deviation of fluorescence intensity for each sample group.

Quantitative Real-Time PCR Analysis

The total RNA of heart tissue was extracted by Trizol (TaKaRa, Japan) method, and the RNA was reverse transcribed into cDNA by kit. Use the LightCycler®480 system (Roche, Basel, Switzerland) for qRT-PCR. Using GAPDH as the internal reference gene, the primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primers are shown in Table 1. The full names of the abbreviations are shown in Table 2. The data are normalized according to 2-ΔΔCT. The equation for this calculation method is relative expression=2-ΔΔCT. ΔΔCT=ΔCT(test)-ΔCT(calibrator). ΔCT(test)=ΔCT(target, test)-ΔCT(reference, test). ΔCT(calibrator)=ΔCT(target, calibrator)-ΔCT(reference, calibrator).Table 1 The primers used in the present study.

Table 1Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	
Bcl-2	AGGACAACGGAGGATGGGATG	ACCAGAACCAGGCTCAGGATG	
Bax	TGAGCATGTAGCAACGGAAG	AGCAAGCTGATTGACGGTCT	
Bcl-xl	GTGGAGAGCGTGGACAAGGAG	GGTGAGGAGCCATTTGTTGAAGG	
Cyt-C	AGGAGGCAAGCACAAGACTGG	TTTGTTCCTGGGATGTACTTCTTTGG	
Apaf1	CAGAGGTGTATCAGCAAGCCAAG	GACGAACAACCAGACGAGAAAGG	
Capase9	CCGAAGGAGCAAGCACG	AGGTTGGACTGGGATGGAC	
Capase3	AGTCTCTGTGTAGGATGCTGAAGG	TCATATTCTGCCACTCTGCGATTTAC	
NF-κ	GTGTGAAGAAACGGGAACTG	GGCACGGTTGTCATAGATGG	
TNF-α	GGACAGCCTATGCCAACAAGTAC	GCGGTCATAGAACAGCACTACG	
IL-1β	CCCTCCTCCAGCCAGAAAGTG	TGTAGCCCTTGATGCCCAGTG	
IL-6	GAAATCCCTCCTCGCCAATCTG	CCTCACGGTCTTCTCCATAAACG	
IL-10	TGAGGGTGAAGTTTGAGGAAATTAAGG	GAGCTGAGCAGTTGAATGTTAAGTTC	
Inos	GGTATGCTCTGCCTGCTGTTG	GTCTCGCACTCCAATCTCTGTTC	
Nrf2	GGACGGTGACACAGGAACAAC	CTCCACAGCGGGAAATCAGAAAG	
NQO1	CCGAGTGCTTTGTCTACGAGATG	GATCAGGTCAGCCGCTTCAATC	
HO-1	AGAGTGAGAGGACAAGCAGGATG	GACTGTGGTGGCGATGAAGC	
Keap1	ATGTACCAGATCGACAGCGT	AACTCCTCCTGCTTGGAGAC	
CYP1A1	TCTTCCTCTTCCTCACCACCATC	ACTCGCACTGCTTGTACTTCATG	
CYP1A2	CACGGTGCTGAATGGCTACTATATC	GAGGAAACGCTCTGGGTTGAAAG	
CYP1B1	CACCACGACCAACACCTTCATC	GCCGTTCTCATCCAGGAATCTTG	
CYP2C18	GTTGCTTGCCTGCTCTCCATC	TTCACCTCCAGTATGTTCCCTACG	
CYP2D6	AGACCTGGAACCCTGCTTACATC	ACCATTCTCTTCAGCCTCCTTACC	
CYP3A4	CTTTGTCTTTGCTGGCTATGAAACC	ATCTCATCCTGGAGTCGCTTCTG	
CYP3A5	AGAAGGATCGTGAAAGGGAGACTC	GAATGCTTGTGACAGGACCTCTAT	
GAPDH	GTAGTGAAGGCTGCTGCTGATG	CAAAGGTGGAGGAATGGCTGTC	

Table 2 The full name of the abbreviations in the present study.

Table 2Abbreviation	The full name	
LCT	Lambda-cyhalothrin	
CK	Creatine kinase	
LDH	Lactate dehydrogenase	
CAT	Catalase	
T-SOD	Total superoxide dismutase	
GSH	Glutathione	
MDA	Malondialdehyde	
Bax	Bcl-2 associated X protein	
Cyt-C	Cytochrome C	
Apaf1	Apoptotic protease activating factor 1	
Caspase9	Cysteinyl aspartate specific proteinase 9	
Caspase3	Cysteinyl aspartate specific proteinase 3	
c-Caspase9	cleaved Cysteinyl aspartate specific proteinase 9	
c-Caspase3	cleaved Cysteinyl aspartate specific proteinase 3	
Bcl-xl	B-cell lymphoma-XL	
Bcl-2	B cell lymphoma/leukemia 2	
NF-κB	Nuclear factor-kappa B	
TNF-α	Tumor necrosis factor-α	
IL-6	Interleukin-6	
IL-1β	Interleukin-1β	
iNOS	inducible Nitric oxide synthase	
IL-10	Interleukin-10	
Nrf2	Nuclear factor erythroid 2-related factor 2	
HO-1	Heme oxygenase-1	
NQO1	NAD(P)H: quinone oxidoreductase 1	
Keap1	Kelch-like ECH-associated protein 1	
CYP450	CytochromeP450	
ARE	Antioxidant response element	
TMT	Trimethyltin chloride	
TUNEL	TdT-mediated dUTP nick end labeling	
DHE	Dihydroethidium	
DAPI	4′,6-Diamidino-2-phenylindole	
CYP1A1	CytochromeP1A1	
CYP1A2	CytochromeP1A2	
CYP1B1	CytochromeP1B1	
CYP2C18	CytochromeP2C18	
CYP2D6	CytochromeP2D6	
CYP3A4	CytochromeP3A4	
CYP3A5	CytochromeP3A5	

Western Blot

Cell lysis buffer for Western and IP (adding PMSF protease inhibitor) (Beyotime, Shanghai, China) was used to extract proteins from heart tissue. Protein samples (80 V/30 min and 120 V/60 min) were separated by SDS-PAGE gel and transferred to PVDF membrane. Seal the PVDF film in TBST containing 5% skim milk for 2 h. Then incubated overnight with the first antibody: GAPDH, Nuclear factor erythroid 2-related factor 2 (Nrf2), Heme oxygenase-1 (HO-1), Nuclear factor-kappa B (NF-κB), Tumor necrosis factor-α (TNF-α), Interleukin-6 (IL-6), Cysteinyl aspartate specific proteinase 9 (Caspase9), cleaved-Cysteinyl aspartate specific proteinase 9 (c-Caspase9), Cysteinyl aspartate specific proteinase 3 (Caspase3), cleaved-Cysteinyl aspartate specific proteinase 3 (c-Caspase3). The concentration and supplier of the first antibody are shown in Table S1 (Supplementary material). On the second day, the second antibody which was washed PVDF membrane and coupled with HRP was incubated at room temperature for 1 h. The images were observed on a western blot imaging equipment (G: BOX Chemi XX9, Hong Kong, China). GAPDH was used as internal reference and control as standard for relative quantification.

Bioinformatics Analysis

The correlations between oxidative stress indicators and the gene expression data measured by qRT-PCR were analyzed separately using the Spearman correlation coefficient (https://www.omicstudio.cn). A significance level (p-value threshold) of 0.05 was chosen, with correlations only considered significant if the p-value was less than 0.05. The specific significance levels were denoted as: P < 0.05: *, P < 0.01: **, and P < 0.001: ***. This correlation analysis aimed to explore the degree of association between different gene expression levels to assess their synergistic effects or interactions under experimental conditions. The STRING 12.0 online database (https://cn.string-db.org) was used to construct protein-protein interaction (PPI) networks for proteins with different expressions. By entering the names of the proteins to be analyzed in the database and selecting Gallus gallus as the organism, this analysis helps to reveal the interaction between different proteins within the cell. Additionally, pathway enrichment analysis of differentially expressed genes was conducted using Metascape (https://metascape.org) to identify relevant biological pathways and functional modules.

Statistical Analysis

All data were analyzed using Prism 9.0.0 software (GraphPad, America), and the results were derived from a minimum of 3 independent experiments. The data are presented as mean ± SD. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05).

RESULTS

LCT Exposure-Induced Chicken Heart Injury

To assess the impact of LCT on cardiac injury markers, we evaluated the serum levels of CK and LDH in samples from the control group and LCT-treated groups (Figures 1A and 1B). Compared with the control group, the serum CK activity in the LCT-treated groups increased significantly (P < 0.05), and the LDH activity in the LCT50 and LCT200 groups also increased significantly (P < 0.05). There was also an increase in LDH activity in the LCT10 group (P > 0.05). The results of the H&E staining are shown in Figure 1D, where the upper part of Figure 1D corresponds to the morphological observation of the hearts in each group (Figure 1C). The staining results showed that the myocardial cells in the control group had a neat microstructural morphology, uniform arrangement of myocardial fibers, and uniform staining. In contrast, the myocardial cells in the LCT-treated groups showed disordered arrangement, contraction, or even dissolution (green arrows). A large inflammatory cell infiltration was also observed in the LCT-treated groups (blue arrows). These results indicate that LCT exposure can cause cardiac injury in chickens.Figure 1 Effects of LCT on serum parameters and cardiac morphology in chickens. (A) CK enzyme activity in serum. (B) LDH enzyme activity in serum. (C) Cardiac morphology observation. (D) H&E staining. The results show that LCT treatment causes disordered arrangement, shrinkage, and even dissolution of myocardial cells (green arrows), along with inflammatory cell infiltration (blue arrows). Scale bar = 50 μm. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 6).

Figure 1

LCT Exposure Induced Oxidative Stress in Chicken Hearts

The DHE probe experiments were conducted on chicken heart tissues to detect ROS levels (Figure 2A), with Figure 2B showing the relative fluorescence expression of ROS. The results showed that, under LCT exposure, compared with the control group, the fluorescence intensity of DHE in the myocardial tissues of the LCT-treated groups increased, and the ROS content increased significantly (P < 0.05). Results also detected changes in some oxidative stress markers (T-SOD, MDA, CAT, and GSH), as shown in Figures 2C, 2D, 2E, and 2F. Compared with the control group, the activities/levels of T-SOD, CAT, and GSH in the LCT-treated groups decreased significantly (P < 0.05), while the MDA content increased significantly (P < 0.05) in the LCT-treated groups (Figure 2B). Additionally, the ROS levels and MDA content in the LCT200 group were significantly lower than those in the LCT10 group (P < 0.05), and the CAT enzyme activity in the LCT200 group was significantly higher than that in the LCT10 group (P < 0.05). The ROS levels were positively correlated with MDA expression and negatively correlated with the activity/content of GSH, CAT, and T-SOD (Figure 2G). These results indicate that LCT impairs the antioxidant capacity of chicken heart tissues, leading to oxidative stress, whereas higher doses of LCT result in lower levels of oxidative stress.Figure 2 Effects of LCT exposure on ROS levels and antioxidant capacity in chicken hearts. (A, B) DHE staining and fluorescence intensity analysis. Red fluorescence signals represent ROS levels, while blue fluorescence signals indicate DAPI-stained nuclei. Scale bar = 100 μm. (C, D, E, F) Detection of T-SOD, MDA, CAT, and GSH activity/content. (G) Correlation analysis of oxidative stress indicators. Each group was tested in triplicate. Data were analyzed using one-way ANOVA. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 3).

Figure 2

LCT Exposure Induced Apoptosis in Chicken Hearts

The TUNEL analysis showed that there were few apoptotic cells in the hearts of the control group, while the number of apoptotic cells in the LCT-treated groups increased significantly (identified by the green-stained nuclei of cells with DNA strand breaks) (P < 0.05) (Figure 3A). Figure 3B shows the relative fluorescence intensity of the TUNEL analysis.Figure 3 Effects of LCT exposure on apoptosis levels in chicken hearts. (A, B) TUNEL staining and fluorescence intensity analysis. Green fluorescence signals represent apoptosis levels, while blue fluorescence signals indicate DAPI-stained nuclei. Scale bar = 100 μm. (C) mRNA expression levels of apoptosis-related genes (Bax, Bcl-2, Bcl-xl, Cyt-C, Apaf1, Caspase9, and Caspase3). (D) Heatmap of mRNA expression levels of apoptosis-related genes. (E, F) Protein expression levels of apoptosis-related genes (Caspase9, c-Caspase9, Caspase3, and c-Caspase3). Each group was tested in triplicate. Data were analyzed using one-way ANOVA. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 6).

Figure 3

The effect of LCT treatment on the mRNA levels of apoptosis-related genes (Bax, Bcl-2, Bcl-xl, Cyt-C, Apaf1, Caspase9, and Caspase3) is shown in Figures 3C, and D. The qRT-PCR results showed that LCT treatment significantly increased the mRNA expression levels of Bax, Cyt-C, Apaf1, Caspase9, and Caspase3 (P < 0.05), while significantly decreasing the mRNA expression levels of Bcl-2 and Bcl-xl (P < 0.05). The effect of LCT treatment on the protein expression of the apoptosis-related genes Caspase9, c-Caspase9, Caspase3, and c-Caspase3 is shown in Figures 3E, and 3F, signifying that LCT treatment significantly increased the protein expression of Caspase9, c-Caspase9, Caspase3, and c-Caspase3 (P < 0.05). Furthermore, we found that compared with the LCT50 group, the mRNA expression levels of Bax, Cyt-C, Apaf1, Caspase9, and Caspase3 in the LCT200 group decreased significantly, while the expression level of Bcl-2 increased significantly in this group (P < 0.05). Compared with the LCT10 group, the mRNA expression levels of Cyt-C, Caspase9, and Caspase3 in the LCT200 group decreased significantly (P < 0.05). Additionally, compared with the LCT10 group, the protein expression levels of Caspase9, c-Caspase9, and c-Caspase3 in the LCT200 group were significantly downregulated (P < 0.05). This suggests that LCT induces cardiac apoptosis by upregulating the expression of pro-apoptotic factors and inhibiting the expression of anti-apoptotic factors. Meanwhile, compared with the LCT low-dose group, high-dose LCT exposure leads to lower levels of apoptosis.

LCT Exposure Induced Inflammation in Chicken Hearts

Morphological results showed that LCT treatment resulted in inflammatory infiltration of cardiac tissue. Next, the expression level of the inflammatory cytokine IL-1β in cardiac tissue was analyzed by immunofluorescence. As shown in Figures 4A and 4B, the red fluorescence intensity in the LCT treatment group was significantly higher than that in the control group (P < 0.05). This suggests that LCT exposure induces inflammation in cardiac tissue.Figure 4 Effects of LCT exposure on inflammation levels in chicken hearts. (A, B) Immunofluorescence analysis and quantification of IL-1β protein. Red fluorescence signals represent IL-1β protein expression levels, while blue fluorescence signals indicate DAPI-stained nuclei. Scale bar = 100 μm. (C) mRNA expression levels of inflammation-related genes (NF-κB, TNF-α, IL-1β, IL-6, IL-10, and iNOS). (D) Heatmap of mRNA expression levels of inflammation-related genes. (E, F) Protein expression levels of inflammation-related genes (NF-κB, TNF-α, and IL-6). Each group was tested in triplicate. Data were analyzed using one-way ANOVA. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 6).

Figure 4

The effects of LCT treatment on the mRNA levels of inflammation-related genes (NF-κB, TNF-α, IL-1β, IL-6, IL-10, and iNOS) are shown in Figures 4C and 4D. The qRT-PCR results showed that LCT treatment significantly increased the mRNA expression levels of NF-κB, TNF-α, IL-1β, IL-6, and iNOS (P < 0.05), while the mRNA expression level of IL-10 was significantly decreased (P < 0.05). The effects of LCT treatment on the protein expression of the inflammation pathway-related genes NF-κB, TNF-α, and IL-6 are shown in Figures 4E and 4F, signifying that compared to the control group, the protein expression levels of NF-κB, TNF-α, and IL-6 were significantly increased in the LCT treatment group (P < 0.05). Additionally, it was found that the fluorescence intensity of IL-1β in the LCT200 group was significantly lower than that in the LCT10 and LCT50 groups (P < 0.05). The mRNA expression levels of NF-κB, TNF-α, and IL-1β in the LCT200 group were significantly lower than those in the LCT10 and LCT50 groups (P < 0.05), and the mRNA expression levels of IL-6 and iNOS in the LCT200 group were significantly lower than those in the LCT50 group (P < 0.05). The protein expression levels of NF-κB in the LCT200 group were significantly lower than those in the LCT10 group (P < 0.05), and the protein expression levels of TNF-α and IL-6 in the LCT200 group were significantly lower than those in the LCT10 and LCT50 groups (P < 0.05). This suggests that LCT induces inflammation in the heart by upregulating the expression of pro-inflammatory factors and inhibiting the expression of anti-inflammatory factors. Meanwhile, compared with the low-dose LCT group, high-dose LCT exposure leads to lower levels of inflammation.

LCT Exposure Inhibited Nrf2/HO-1 Signal Pathway in Chicken Hearts

The expression levels of Nrf2 in cardiac tissue were analyzed by immunofluorescence. As shown in Figures 5A and 5B, the red fluorescence intensity in the LCT treatment group was significantly lower than that in the control group (P < 0.05). This indicates that LCT exposure inhibits the expression of Nrf2 in cardiac tissue.Figure 5 Effects of LCT exposure on the Nrf2/HO-1 signaling pathway in chicken hearts. (A, B) Immunofluorescence analysis and quantification of Nrf2 protein. Red fluorescence signals represent Nrf2 protein expression levels, while blue fluorescence signals indicate DAPI-stained nuclei. Scale bar = 100 μm. (C) mRNA expression levels of genes related to the Nrf2/HO-1 signaling pathway (Nrf2, HO-1, NQO1, and Keap1). (D) Heatmap of mRNA expression levels of genes related to the Nrf2/HO-1 signaling pathway. (E, F) Protein expression levels of genes related to the Nrf2/HO-1 signaling pathway (Nrf2 and HO-1). Each group was tested in triplicate. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 6).

Figure 5

The effects of LCT treatment on the mRNA levels of genes related to the Nrf2 signaling pathway (Nrf2, HO-1, NQO1, and Keap1) are shown in Figures 5C and 5D. The qRT-PCR results showed that compared to the control group, LCT treatment significantly increased the mRNA expression of Keap1 (P < 0.05), while significantly decreased the mRNA expression of Nrf2, HO-1, and NQO1 (P < 0.05). The effects of LCT treatment on the protein expression of Nrf2 and HO-1 are shown in Figures 5E and F, signifying that compared to the control group, the protein expression levels of Nrf2 and HO-1 in the LCT treatment group were decreased significantly (P < 0.05). These results suggest that LCT can inhibit the Nrf2/HO-1 signaling pathway.

LCT Exposure Activated the CYP450s in Chicken Hearts

The effect of LCT treatment on mRNA of CYP450 enzyme system-related genes (CYP1A1, CYP1A2, CYP1B1, CYP2C18, CYP2D6, CYP3A4, and CYP3A5) is shown in Figures 6A and 6C. The qRT-PCR results showed that LCT treatment significantly increased the expression of CYP1A1, CYP1A2, CYP1B1, CYP2C18, CYP2D6, CYP3A4, and CYP3A5 (P < 0.05). Meanwhile, the relative expression levels of CYP1A2, CYP2C18, CYP2D6, and CYP3A4 mRNA in the LCT200 group were significantly lower than those in the LCT50 group (P < 0.05), and the relative expression level of CYP1B1 mRNA in the LCT200 group was significantly lower than that in the LCT10 group (P < 0.05). These results indicate that LCT exposure activates the expression of CYP450 enzyme family-related genes in chicken heart, and compared to the LCT low-dose group, high-dose LCT exposure causes partially lower levels of CYP450s gene expression.Figure 6 Effects of LCT exposure on the CYP450 enzyme system in chicken hearts and bioinformatics analysis of differentially expressed genes. (A) mRNA expression levels of genes related to the CYP450 enzyme system (CYP1A1, CYP1A2, CYP1B1, CYP2C18, CYP2D6, CYP3A4, and CYP3A5). (B) Protein-protein interaction network diagram. (C) Heatmap of mRNA expression levels of genes related to the CYP450 enzyme system. (D) Correlation analysis of genes related to apoptosis, inflammation, the Nrf2/HO-1 pathway, and CYP450s. (E) PPI network. Each group was tested in triplicate. Data were analyzed using one-way ANOVA. Significant differences between groups are indicated by different letters (P < 0.05). Conversely, groups with the same letters are considered to have no significant differences (P > 0.05) (mean ± SD, n = 6).

Figure 6

Bioinformatics Analysis of LCT Exposure on Chicken Hearts

The Spearman correlation coefficient was used to compare the correlation between apoptosis, inflammation, the Nrf2/HO-1 pathway, and the CYP450s-related genes (Figure 6D). The correlation analysis showed that in chicken cardiac tissue, the expression of genes promoting apoptosis and inflammation is positively correlated with the expression of CYP450s-related genes and Keap1, and negatively correlated with the expression of Nrf2, HO-1, and NQO1. The expression of genes inhibiting apoptosis and inflammation is negatively correlated with the expression of CYP450s-related genes and Keap1 and positively correlated with the expression of Nrf2, HO-1, and NQO1 genes. The PPI analysis indicates that these pathways may play important roles under LCT exposure. STRING analysis explored the relationship between the proteins detected in this study (Figure 6B). Metascape was used to further explore the relationship between gene expression after LCT exposure and the listed information of GO terms (top 20 terms) (Figure 6E).

DISCUSSION

As non-cage systems gradually replace cage systems, poultry becomes more exposed to pests and ectoparasites in the environment, significantly increasing the risk of ectoparasite infection, where insecticides are an effective means to control these ectoparasites (Wei, et al., 2022). However, the increased use of insecticides results in substantial residues in the environment, gradually increasing the risk of harm to poultry. In recent years, pyrethroids have gradually replaced other insecticides, becoming widely used in the control of ectoparasites and hygienic pests in poultry (Xu, et al., 2023). However, the harm caused to poultry by the application of pyrethroid insecticides should not be overlooked. To this end, this study investigated the specific mechanisms of cardiac damage caused by LCT, a commonly used pyrethroid, in chickens by constructing an LCT exposure model. According to the results, LCT was found to stimulate an excessive generation of ROS in the heart, causing oxidative damage, apoptosis, and inflammation. Additionally, LCT-induced damage may be associated with the activation of the CYP450s and the inhibition of the Nrf2/HO-1 pathway.

When myocardial cells are damaged or necrotic, the integrity of the cell membrane is compromised, leading to the release of intracellular creatine kinase (CK) into the bloodstream, which serves as an important marker of myocardial injury. When myocardial cells are damaged or necrotic, Lactate dehydrogenase (LDH) is also released from the damaged cells into the bloodstream (Zhang et al., 2024a). Our results indicate that exposure to different concentrations of LCT can cause an increase in the serum levels of CK and LDH. Additionally, histological observations of heart tissue through H&E staining showed varying degrees of damage after exposure to different concentrations of LCT, manifested as changes in cell morphology, disruption of muscle fibers, and infiltration of inflammatory cells. These results suggest that exposure to LCT can cause cardiac injury in chickens.

Existing studies have shown that cardiac tissue damage is often associated with oxidative stress, which occurs when there is an imbalance between ROS production and the antioxidant defense system (Wu, et al., 2022). The antioxidants SOD, CAT, and GSH play important roles in combating oxidative damage (Zhang, et al., 2022). Research indicates that polystyrene nanoplastic treatment results in an imbalance between ROS production and the antioxidant system, causing myocardial cell damage (Wu, et al., 2022), which is similar to the findings of our study. In addition to increased ROS, LCT exposure reduced the activity/content of GSH, CAT, and T-SOD and increased the content of MDA in the myocardium, indicating that LCT exposure induces oxidative stress and leads to myocardial oxidative damage. Interestingly, we found that high-dose LCT exposure led to lower levels of oxidative stress. Under high doses, cells might initiate an adaptive response mechanism or an over-activation of the antioxidant system to counteract the increase in oxidative stress. This could include the activation of increased levels of antioxidant enzyme activity, such as T-SOD and CAT, to eliminate ROS. These adaptive responses can reduce intracellular ROS levels, thereby mitigating the extent of oxidative stress.

Apoptosis is the process by which normal cells undergo death either spontaneously or in response to adverse stimuli. It is an active, highly ordered process controlled by genes and a series of enzymes. In this context, the translocation of anti-apoptotic proteins (Bcl-xl, Bcl-2) leads to cell survival, while an increase in the pro-apoptotic protein, Bax, induces apoptosis. The combined activity of Bax and Bcl-2 coordinates programmed cell death by stimulating mitochondrial membrane permeability and the release of Cyt-C from the mitochondria into the cytoplasm. The Cyt-C then forms a complex with Apaf1 and Caspase9, further activating Caspase3, generating cleaved Caspase3, and transmitting the apoptotic signal for the execution phase (Jeong and Seol, 2008). It is known that LCT induces the expression of apoptosis-related genes in the embryos of Larimichthys polyactis and that it causes DNA damage in mammalian cells, promoting genomic instability at the chromosomal level (Zhan, et al., 2022). Similarly, commercial LCT may cause DNA single-strand breaks, cytotoxicity, and apoptosis in CHO-K1 cells (Laborde, et al., 2023). Additionally, LCT can induce apoptosis in human blood lymphocytes (Muranli, 2013). In our study, TUNEL staining results indicated that LCT significantly increased the apoptosis in chicken myocardial cells by reducing the levels of Bcl-xl and Bcl-2 and promoting the expression of Bax, Cyt-C, Apaf1, Caspase9, Caspase3, c-Caspase9, and c-Caspase3. Therefore, these results suggest that LCT stimulates the occurrence and development of apoptosis in chicken heart cells. Interestingly, compared to the low-dose LCT group, high-dose LCT exposure resulted in lower levels of apoptosis, which may be related to lower levels of oxidative stress. Oxidative stress is a key factor in inducing apoptosis and when the level of ROS in the body is excessively high, it can cause damage to cell membranes, proteins, and DNA. This damage can activate the intracellular apoptosis signaling pathways. For example, by damaging mitochondria, ROS leads to the release of Cyt-C into the cytoplasm, thereby activating apoptosis-related caspases and initiating apoptosis. The release of Cyt-C from mitochondria not only directly activates apoptosis-related caspases but also triggers additional ROS production, which further promotes apoptosis. Some apoptosis-related proteins (such as Bax) can also induce ROS production and release by acting on the mitochondrial membrane. The results of this study indicate that LCT exposure leads to a significant increase in apoptosis, along with a marked increase in oxidative stress indicators such as ROS and MDA. Therefore, oxidative stress may be one of the important mechanisms through which LCT induces apoptosis in myocardial cells, with LCT promoting apoptosis by inducing oxidative stress.

Oxidative stress not only leads to apoptosis but also activates redox-sensitive transcription factors, which can trigger inflammatory responses. Here, NF-κB is a powerful inflammatory mediator that also participates in major biological processes like embryonic development and tissue damage (Cai, et al., 2023; Li, et al., 2024). When NF-κB is activated and translocated to the nucleus in response to pro-inflammatory stimuli, it accumulates in the nucleus, enhancing the production of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α). Then, IL-10, with its potent anti-inflammatory properties, inhibits the expression of inflammatory cytokines such as IL-1β, IL-6, and TNF-α (Kumari, et al., 2023). Due to the adverse effects of this oxidative stress, the body upregulates inflammation-related genes and suppresses anti-inflammatory gene expression, activating and amplifying the inflammatory response. Thus, fluctuations in intracellular levels of inflammatory cytokines are increasingly recognized as markers of cardiac injury (Wu, et al., 2022). In this study, histopathological analysis showed inflammatory cell infiltration caused by LCT exposure in myocardial cells, where the cardiac inflammatory response was due to LCT-induced upregulation of NF-κB and pro-inflammatory factors (IL-1β, IL-6, and TNF-α) and the inhibition of the anti-inflammatory mediator (IL-10). Additionally, we observed an increase in iNOS mRNA expression in LCT-treated chicken heart tissues, consistent with previous reports. This suggests that LCT may increase the reactive nitrogen species involved in the inflammatory process (Kumari, et al., 2023). Based on these results, we propose that LCT-induced myocardial cell injury is mediated by triggering an inflammatory response. Compared to the low-dose LCT group, high-dose LCT exposure resulted in lower levels of inflammation, likely due to lower oxidative stress mediated by immunosuppression, reducing the release of inflammatory mediators (NF-κB, TNF-α, IL-6, and IL-1β) and subsequently decreasing inflammation. Additionally, the inflammatory response itself may exacerbate oxidative stress by increasing the generation of free radicals, thereby creating a vicious cycle (Mittal, et al., 2014).

The Nrf2/HO-1 pathway is key in maintaining redox homeostasis under pesticide exposure and plays a critical role in protecting organisms from oxidative stress-induced cellular damage (Chen and Maltagliati, 2018; Li, et al., 2024). In this study, the downregulation of Nrf2, HO-1, and NQO1, along with the upregulation of Keap1, indicates that LCT weakens the proteins or genes related to oxidative stress resistance, thereby promoting oxidative damage. Therefore, the Nrf2/HO-1 signaling pathway may play a crucial role in the occurrence of oxidative stress injury induced by LCT exposure in chicken myocardia. The CYP450 enzyme system (CYP450s) is a crucial detoxification metabolic system that can induce oxidative stress. When organisms are exposed to LCT or other xenobiotics, the activity of CYP450 enzymes typically increases to accelerate metabolism and the elimination of these substances, reducing their toxicity. The core function of the CYP450s is to facilitate the excretion of xenobiotic compounds by converting them into more water-soluble metabolites through reactions such as hydroxylation, demethylation, and oxidation (Li, et al., 2023; Zhang et al., 2024b), but during this metabolic process, the CYP450s generate ROS. While low concentrations of ROS contribute to cell signaling and gene expression regulation, high concentrations can cause oxidative stress, damaging cell membranes, proteins, and DNA. Thus, certain CYP450 enzymes are closely associated with the occurrence and development of heart damage as the intermediate metabolites produced during metabolism may have toxic effects on cardiac tissue, leading to cell damage and inflammatory responses (Zhang et al., 2024b). Studies have shown that the activation of CYP450s is involved in cadmium-induced mitochondrial apoptosis in pig hearts and that upregulated CYP450s and oxidative stress-induced inflammation in chicken hearts (Guo, et al., 2020; Zhao, et al., 2021). Similarly, in this study, the mRNA expression levels of CYP1A1, CYP1A2, CYP1B1, CYP2C18, CYP2D6, CYP3A4, and CYP3A5 were upregulated in the heart tissues of chickens exposed to LCT, suggesting that CYP450s might be activated under LCT stimulation, suppressing the Nrf2 pathway, and activating oxidative stress and inducing cardiac damage. Furthermore, some studies suggest that high doses of chemical exposure can inhibit the expression of CYP450 enzymes through a negative feedback mechanism (Li, et al., 2023; Zhang et al., 2024b). Our results show that, compared to the low-dose LCT exposure group, high-dose LCT exposure led to decreased expression levels of CYP450s genes. This might be due to the excessive metabolic burden on myocardial cells or the direct toxic effects of high-dose LCT.

It is known that Nrf2 and CYP450s are both crucial in the oxidative stress response, where Nrf2 enhances cellular antioxidant capacity by upregulating the expression of antioxidant genes, thereby reducing damage caused by oxidative stress. On the other hand, CYP450 enzymes metabolize exogenous and endogenous compounds to reduce the accumulation of potentially harmful substances and impact oxidative stress levels. Studies have shown that Nrf2 can directly and indirectly regulate the expression of certain CYP450 genes. For instance, Nrf2 regulates the expression of genes such as CYP2A6, CYP1A1, and CYP1A2 through ARE elements suggesting that Nrf2 maintains the cellular redox balance not only through antioxidant gene pathways but also by modulating CYP450 enzyme expression (Ma, 2013; Xu, et al., 2005). However, activation of CYP450 enzymes may also produce more ROS, exacerbating oxidative stress. Therefore, there is a complex feedback loop between Nrf2 and CYP450 that directs detoxification and antioxidant responses. In our study, LCT exposure led to the suppression of Nrf2/HO-1 pathway-related gene expression while activating CYP450s-related genes. This suggests that the downregulation of the Nrf2 pathway may increase susceptibility to LCT toxicity, while the CYP450s may play a role in the metabolism and detoxification of LCT. Thus, the interplay between the Nrf2 pathway and the CYP450s impacts oxidative stress and cellular damage in the context of LCT toxicity.

Ultimately, it is evident that LCT can induce oxidative stress in chicken myocardia, and promote the inflammation and apoptosis of myocardial cells, with the Nrf2/HO-1 pathway and CYP450 system playing key roles in this process. Additionally, high doses of LCT may trigger certain protective or compensatory mechanisms in the heart to some extent, partially inhibiting the expression of CYP450s-related genes, leading to lower levels of oxidative stress, reduced cell apoptosis, and the initiation of immunosuppression. It is worth noting that the commercial product of LCT used in this study is more closely related to practical application scenarios, simulating real-world usage conditions and thus possessing greater practical significance. However, the lack of the use of standard products for experimentation is also a limitation of this study, which should be addressed in future research. Importantly, the results of this study indicate that even the lowest dose of LCT used in these experiments poses a threat to chicken myocardial tissue. Therefore, in poultry production management, when using LCT for external parasite control, attention should be paid to the dosage of LCT relevant to the external parasite, to ensure the health and safety of poultry while maintaining production and economic benefits.

CONCLUSIONS

In conclusion, our study demonstrates that LCT can induce oxidative stress in chicken myocardia, and promote apoptosis and inflammation in myocardial cells. The Nrf2/HO-1 pathway and the CYP450 enzyme system are vital elements in this process. Meanwhile, high doses of LCT can induce lower levels of apoptosis and inflammation, which may be related to the initiation of an adaptive response mechanism or the overstimulation of the antioxidant system by cells. Our research provides a theoretical basis for further exploration of the health risks associated with insecticides. It lays a foundation in toxicological research for the safer use of insecticides for external parasite control in poultry production.

DISCLOSURES

The authors declare no conflicts of interest.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

This study was supported by the Heilongjiang Province Modern Agricultural Industry Technology Collaborative Innovation and Promotion System Project and the “Academic Backbone” Fund of Northeast Agricultural University.

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104154.
==== Refs
REFERENCES

Cai J. Liu P. Zhang X. Shi B. Jiang Y. Qiao S. Liu Q. Fang C. Zhang Z. Micro-algal astaxanthin improves lambda-cyhalothrin-induced necroptosis and inflammatory responses via the ROS-mediated NF-κB signaling in lymphocytes of carp (Cyprinus carpio L.) Fish Shellfish Immunol. 139 2023 108929
Chaka B. Osano A.M. Wesley O.N. Forbes P.B.C. Seasonal variation in pesticide residue occurrences in surface waters found in Narok and Bomet Counties, Kenya Environ. Monitoring Assess. 195 2023 1050
Chen Q.M. Maltagliati A.J. Nrf2 at the heart of oxidative stress and cardiac protection Physiol. Genom. 50 2018 77 97
ECHA (European Chemicals Agency), 2011. Directive 98/8/EC concerning the placing biocidal products on the market. Inclusion of active substances in Annex I or IA to Directive 98/8/EC. Assessment Report lambda-cyhalothrin Product-type 18 (Insecticide). Accessed June 2022. https://echa.europa.eu/documents/10162/6707c237-87db-9346-5b81-c72cc3c35d3f.
Feriani A. Tir M. Gómez-Caravaca A.M. Contreras M.D.M. Talhaoui N. Taamalli A. Segura-Carretero A. Ghazouani L. Mufti A. Tlili N. Allagui M.S. HPLC-DAD-ESI-QTOF-MS/MS profiling of Zygophyllum album roots extract and assessment of its cardioprotective effect against deltamethrin-induced myocardial injuries in rat, by suppression of oxidative stress-related inflammation and apoptosis via NF-κB signaling pathway J. Ethnopharmacol. 247 2020 112266.
Fernandez-Alvarez M. Lamas J.P. Garcia-Chao M. Garcia-Jares C. Llompart M. Lores M. Dagnac T. Monitoring of pesticide residues in dairy cattle farms from NW Spain J. Environ. Monitoring: JEM 12 2010 1864 1875 20721413
Ghazouani L. Feriani A. Mufti A. Tir M. Baaziz I. Mansour H.B. Mnafgui K. Toxic effect of alpha cypermethrin, an environmental pollutant, on myocardial tissue in male wistar rats Environ. Sci. Pollut. Res. Int. 27 2020 5709 5717 31119542
Guo K. Ge J. Zhang C. Lv M.W. Zhang Q. Talukder M. Li J.L. `Cadmium induced cardiac inflammation in chicken (Gallus gallus) via modulating cytochrome P450 systems and Nrf2 mediated antioxidant defense Chemosphere 249 2020 125858
Han J. Zhou L. Luo M. Liang Y. Zhao W. Wang P. Zhou Z. Liu D. Nonoccupational Exposure to Pyrethroids and Risk of Coronary Heart Disease in the Chinese Population Environ. Sci. Technol. 51 2017 664 670 27966923
Haverinen J. Vornanen M. Deltamethrin is toxic to the fish (crucian carp, Carassius carassius) heart Pesticide Biochemistry And Physiology 129 2016 36 42 27017879
Jeong S.Y. Seol D.W. The role of mitochondria in apoptosis BMB Rep. 41 2008 11 22 18304445
Kumari A. Srivastava A. Jagdale P. Ayanur A. Khanna V.K. Lambda-cyhalothrin enhances inflammation in nigrostriatal region in rats: regulatory role of NF-κB and JAK-STAT signaling Neurotoxicology 96 2023 101 117 10.1016/j.neuro.2023.04.003 37060950
Laborde M.R.R. Larramendy M.L. Soloneski S. Cytotoxic and genotoxic profiles of the pyrethroid insecticide lambda-cyhalothrin and its microformulation Karate® in CHO-K1 cells Mutation Res. Genetic Toxicol. Environ. Mutagenesis 891 2023 503682
Li P.R. Shi Y. Ju D. Liu Y.X. Wang W. He Y.S. Zhang Y.Y. Yang X.Q. Metabolic functional redundancy of the CYP9A subfamily members leads to P450-mediated lambda-cyhalothrin resistance in Cydia pomonella Pest Management Sci. 79 2023 1452 1466
Li X. Wu Q. Chen D. Bai Y. Yang Y. Xu S. Environment-relevant concentrations of cadmium induces necroptosis and inflammation; baicalein maintains gill homeostasis through suppressing ROS/ER stress signaling in common carps (Cyprinus carpio L.) Environ. Pollut. (Barking, Essex: 1987) 340 2024 122805
Liu X. Gao Q. Feng Z. Tang Y. Zhao X. Chen D. Feng X. Protective effects of spermidine and melatonin on deltamethrin-induced cardiotoxicity and neurotoxicity in zebrafish Cardiovasc. Toxicol. 21 2021 29 41 32651933
Liu Z.Y. Song K. Tu B. Lin L.C. Sun H. Zhou Y. Li R. Shi Y. Yang J.J. Zhang Y. Zhao J.Y. Tao H. Crosstalk between oxidative stress and epigenetic marks: new roles and therapeutic implications in cardiac fibrosis Redox Biol. 65 2023 102820
Ma Q. Role of nrf2 in oxidative stress and toxicity Ann. Rev. Pharmacol. Toxicol. 53 2013 401 426 23294312
Mawussi G. Scorza Júnior R.P. Dossa E.L. Alaté K.K. Insecticide residues in soil and water in coastal areas of vegetable production in Togo Environ. Monitoring Assess. 186 2014 7379 7385
Mittal M. Siddiqui M.R. Tran K. Reddy S.P. Malik A.B. Reactive oxygen species in inflammation and tissue injury Antioxid. Redox Signal. 20 2014 1126 1167 23991888
Moreno-Villa, E. D., M. L. Aldana-Madrid, M. I. Silveira-Gramont, G. Rodriguez-Olibarria, and M. J. R. I. d. C. A. Meza-Montenegro. 2012. Analysis of pyrethroid pesticides in soil and waters of agricultural and urban areas of yaqui and mayo valley. 28:303-310.
Muranli F.D. Genotoxic and cytotoxic evaluation of pyrethroid insecticides λ-cyhalothrin and α-cypermethrin on human blood lymphocyte culture Bullet. Environ. Contamination Toxicol. 90 2013 357 363
Pan B. Liang D. Zhang Y. Wang H. Wang M. Comparative efficacy of oil solution and wettable powder of lambda-cyhalothrin to naturally occurring Ornithonyssus sylviarum infestation of chickens Vet. Parasitol. 164 2009 353 356 19577369
Saputra F. Lai Y.H. Roldan M.J.M. Alos H.C. Aventurado C.A. Vasquez R.D. Hsiao C.D. The effect of the pyrethroid pesticide fenpropathrin on the cardiac performance of zebrafish and the potential mechanism of toxicity Biology 12 2023 1214
Singh S. Mukherjee A. Jaiswal D.K. de Araujo Pereira A.P. Prasad R. Sharma M. Kuhad R.C. Shukla A.C. Verma J.P. Advances and future prospects of pyrethroids: toxicity and microbial degradation Sci. Total Environ. 829 2022 154561
Tekeli M.Y. Eraslan G. Çakır Bayram L. Soyer Sarıca Z. Effect of diosmin on lipid peoxidation and organ damage against subacute deltamethrin exposure in rats Environ. Sci. Pollut. Res. Int. 28 2021 15890 15908 33242198
U.S. Environmental Protection Agency Guidelines for Ecological Risk Assessment 1998 U.S. Environmental Protection Agency Washington, D.C EPA/630/R-95/002F
Wei H. Feng Y. Ding S. Nian H. Yu H. Zhao Q. Bao J. Zhang R. Keel bone damage affects behavioral and physiological responses related to stress and fear in two strains of laying hens J. Anim. Sci. 100 2022 1 10
Wu H. Guo J. Yao Y. Xu S. Polystyrene nanoplastics induced cardiomyocyte apoptosis and myocardial inflammation in carp by promoting ROS production Fish Shellfish Immunol. 125 2022 1 8 35504440
Xu C. Li C.Y. Kong A.N. Induction of phase I, II and III drug metabolism/transport by xenobiotics Arch. Pharmacal Res. 28 2005 249 268
Xu X. Yu Y. Ling M. Ares I. Martínez M. Lopez-Torres B. Maximiliano J.E. Martínez-Larrañaga M.R. Wang X. Anadón A. Martínez M.A. Oxidative stress and mitochondrial damage in lambda-cyhalothrin toxicity: a comprehensive review of antioxidant mechanisms Environ. Pollut. (Barking, Essex: 1987) 338 2023 122694
Yang X. Fang Y. Hou J. Wang X. Li J. Li S. Zheng X. Liu Y. Zhang Z. The heart as a target for deltamethrin toxicity: Inhibition of Nrf2/HO-1 pathway induces oxidative stress and results in inflammation and apoptosis Chemosphere 300 2022 134479
Zhan W. Weng H. Liu F. Han M. Lou B. Wang Y. Joint toxic effects of phoxim and lambda-cyhalothrin on the small yellow croaker (Larimichthys polyactis) Chemosphere 307 2022 136203
Zhang H.J. Fu Y. Zhang H. Lai Z.Q. Dong Y.F. Sophocarpine alleviates doxorubicin-induced heart injury by suppressing oxidative stress and apoptosis Sci. Rep. 14 2024 428 38172265
Zhang S.P. Bai B. Chen G.M. Wang Y.Q. Hu C. Liu X.F. Gao P. Li Y.T. Fu N.X. Yang X.Q. Secondary metabolites in host pears defense against two fruit borers and cytochrome-P450-mediated counter-defense iScience 27 2024 109518
Zhang H. Zhao F. Gai X. Cai J. Zhang X. Chen X. Zhu Y. Zhang Z. Astilbin attenuates apoptosis induced by cadmium through oxidative stress in carp (Cyprinus carpio L.) head kidney lymphocyte Fish Shellfish Immunol. 125 2022 230 237 35577320
Zhao X. Li X. Wang S. Yang Z. Liu H. Xu S. Cadmium exposure induces mitochondrial pathway apoptosis in swine myocardium through xenobiotic receptors-mediated CYP450s activation J. Inorganic Biochem. 217 2021 111361
Zheng S. Jin X. Chen M. Shi Q. Zhang H. Xu S. Hydrogen sulfide exposure induces jejunum injury via CYP450s/ROS pathway in broilers Chemosphere 214 2019 25 34 30253253
