
==== Front
Int J Parasitol Drugs Drug Resist
Int J Parasitol Drugs Drug Resist
International Journal for Parasitology: Drugs and Drug Resistance
2211-3207
Elsevier

S2211-3207(24)00041-1
10.1016/j.ijpddr.2024.100560
100560
Article
Benzaldehyde stimulates autophagy via the sonic hedgehog signaling pathway in mouse brain astrocytes after treatment with Angiostrongylus cantonensis excretory-secretory products
Chen Kuang-Yao d000018229@cgu.edu.tw
abc⁎
Cheng Chien-Ju a
Chang Yuan-Ting d
Lin Yi-Hsuan b
Huang Yi-Hao b
Lin Sheng-Yu b
Wang Lian-Chen abc
Jhan Kai-Yuan a
Chiu Cheng-Hsun c
a Department of Parasitology, College of Medicine, Chang Gung University, Taoyuan, 333, Taiwan
b Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, 333, Taiwan
c Molecular Infectious Disease Research Center, Chang Gung Memorial Hospital, Taoyuan, 333, Taiwan
d Department of Medical Biotechnology and Laboratory Science, College of Medicine, Chang Gung University, Taoyuan, 333, Taiwan
⁎ Corresponding author. Department of Parasitology, College of Medicine, Chang Gung University, Taoyuan, 333, Taiwan. d000018229@cgu.edu.tw
12 8 2024
12 2024
12 8 2024
26 10056028 4 2024
1 8 2024
11 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Autophagy is a vital cellular process responsible for digesting various cytoplasmic organelles. This process plays a crucial role in maintaining cell survival and homeostasis, especially under conditions that cause nutrient deficiency, cellular damage, and oxidative stress. Neuroangiostrongyliasis is an infection caused by the parasitic nematode Angiostrongylus cantonensis and is considered as an emerging disease in many parts of the world. However, effective therapeutic strategies for neuroangiostrongyliasis still need to be further developed. In this study, we investigated the effects of benzaldehyde treatment on autophagy and sonic hedgehog (Shh) signaling in A. cantonensis-infected mice and its mechanisms. First, we found autophagosome generation in the central nervous system after A. cantonensis infection. Next, benzaldehyde combined with albendazole treatment reduced eosinophilic meningitis and upregulated the expression of Shh signaling- and autophagy-related molecules in A. cantonensis-infected mouse brains. In vitro experiments demonstrated that benzaldehyde could induce autophagy via the Shh signaling pathway in A. cantonensis excretory-secretory products (ESPs)-treated mouse astrocytes. Finally, benzaldehyde treatment also decreased lipid droplet accumulation and increased cholesterol production by activating the Shh pathway after ESPs treatment. In conclusion, these findings suggested that benzaldehyde treatment could alleviate brain damage by stimulating autophagy generation through the Shh signaling pathway.

Graphical abstract

Image 1

Highlights

• The autophagy was induced in the central nervous system after A. cantonensis infection.

• Benzaldehyde treatment reduced eosinophilic meningitis in mouse brain.

• The benzaldehyde induces autophagy via the Shh signaling pathway in ESPs-treated astrocytes.

• The benzaldehyde effects lipid droplet and cholesterol production by activating the Shh pathway.

Keywords

Angiostrongylus cantonensis
Benzaldehyde
Excretory-secretory products
Autophagy
Sonic hedgehog
==== Body
pmc1 Introduction

Excretory-secretory products (ESPs) play an important role in the survival and infection of parasitic helminths within their hosts. ESPs found in parasitic helminths contain a diverse range of molecules, such as proteins, lipids, glycans, and nucleic acids. These molecules play a crucial role in helping parasites penetrate the host's defensive barriers, evade the host's immune system, acquire nutrients, and modulate host physiology (Smyth et al., 2023; Yordanova et al., 2023). Elucidating the composition and functions of ESPs is important for understanding complex host-parasite interactions and developing strategies to control helminth infections.

Angiostrongylus cantonensis is a zoonotic and parasitic nematode with the ability to infect humans and cause the clinical condition known as neuroangiostrongyliasis along with severe neurological damages. (Chen et al., 2023a). In the clinic, it is known to cause eosinophilic meningitis and meningoencephalitis, leading to severe symptoms such as headaches, fever, nausea, vomiting, neck stiffness, photophobia, blurred vision, and neurological abnormalities (Wang et al., 2006). The administration of anthelmintics and/or corticosteroids for the treatment of neuroangiostrongyliasis remains a topic of ongoing research. There is currently no definitive consensus on the optimal treatment approach for this parasitic infection (Sawanyawisuth et al., 2008; Barratt et al., 2016; Jacob et al., 2022).

The life cycle of A. cantonensis involves two hosts: the definitive host (rats) and the intermediate host (mollusk). In the definitive host, adult worms reproduce in the right ventricle and pulmonary artery. Afterward, female worms release eggs that subsequently hatch into first-stage larvae (L1) while residing in the pulmonary capillaries. The larvae proceed to migrate through the gastrointestinal tract and eventually are released through the host's feces. The intermediate host becomes infected with the L1 by ingestion, and the larvae develop into third-stage larvae (L3). Upon consumption of the intermediate host that contains infective L3 by an abnormal host (human), these larvae reach the central nervous system and mature into fifth-stage larvae (L5). It is during this stage that severe immune responses, physical damage, and potentially fatal outcomes can occur (Carvalho et al., 2022; Turck et al., 2022). Understanding the life cycle and transmission pathways of A. cantonensis is crucial for implementing effective prevention and control measures to reduce the risk of infection in humans (Jhan et al., 2020).

In the human central nervous system (CNS), Astrocytes is the most abundant glia cells, and its plays a major role for modulation of the neurons activation and immune responses after pathogen infection via secretion of regulatory proteins or cytokines. Astrocytes also can form the blood-brain barrier (BBB) in brain with endothelial cells to regulate molecules transportation. Moreover, previous studies have confirmed that astrocytes are the most important cells for secretion of the Sonic hedgehog protein in the CNS (Xia et al., 2012). Our previous studies have shown that the Sonic hedgehog pathway can downregulate the oxidative stress and cell apoptosis induced by ESPs in mouse astrocytes. The results also demonstrated that the viability of astrocytes was decreased in ESPs treatment, but the Shh signaling pathway was activated (Chen et al., 2017). Conversely, the upregulation of the Shh pathway resulted in a reduction of oxidative stress within astrocytes.

Gastrodia elata (Tianma), a traditional Chinese herbal medicine, is known for its anti-oxidative stress and anti-inflammatory properties in humans. It has also been used to alleviate headaches and dizziness (Huang et al., 2007). Benzaldehyde is a chemical constituent from aqueous extract of G. elata that can reduces inflammation, cell migration, and proliferation (Moon et al., 2012; Kong et al., 2016). Benzaldehydes is known to contain two commonly chemical derivatives, 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA). The two compounds have a hydroxide group (OH) attached to the meta position of the phenolic ring. The OH group possesses higher intracellular antioxidative activity.

In our previous studies, we demonstrated that the formation of autophagosomes is stimulated by A. cantonensis L5 ESPs, and autophagy-related molecules like LC3B, Beclin, and p62 are upregulated. Furthermore, A. cantonensis ESPs cause an increase in the autophagy-related molecules by activating the sonic hedgehog signaling pathway (Chen et al., 2020). Based on our previous investigation showing that benzaldehyde is effective at treating A. cantonensis L5 ESPs-treated mouse astrocytes (Chen et al., 2021, 2022), we aimed to elucidate the detailed function and molecular mechanism of the sonic hedgehog signaling pathway in autophagy following benzaldehyde treatment. These findings will help elucidate the role of the sonic hedgehog signaling pathway in response to benzaldehyde treatment following stimulation with A. cantonensis L5 ESPs and the potential crosstalk between this pathway and autophagy in mouse astrocytes.

2 Materials and methods

2.1 Ethical approval

All animal procedures in this study were approved by the Chang Gung University Institutional Animal Care and Use Committee (IACUC) in Taiwan (CGU111-167) and followed the guideline for Laboratory Animal Facilities and Care (The Council of Agriculture. Executive Yuan, ROC). Rats and mice were housed in plastic cages and provided with food and water ad libitum. The experimental animals were sacrificed by anesthesia with isoflurane (1 ml/min).

2.2 Parasite and laboratory animals

This study utilized a strain of A. cantonensis from Taiwan, which has been continuously maintained in our laboratory via Biomphalaria glabrata snails and Sprague‒Dawley (SD) rats. BALB/c mice (8 weeks old) were procured from BioLASCO Taiwan Co., Ltd. in Taiwan. SD rats were obtained from the National Laboratory Animal Center (Taiwan). All procedures involving the experimental animals and their care were reviewed and approved by the Chang Gung University Institutional Animal Care and Use Committee (IACUC).

2.3 Experimental infection and drug administration

L3 of A. cantonensis were isolated from infected snails by digestion with 0.6% (w/v) pepsin-HCl (pH 2–3) for 1 h (Chen et al., 2022). Each animal was inoculated with 25 L3 (for mice) or 50 L3 (for rats) by orogastric gavage. The infected animals were separately housed in plastic cages and provided with food and drinking water ad libitum. A. cantonensis L3 was isolated from infected snails by digestion with 0.6% (w/v) pepsin-HCl (pH 2–3). For drug treatment, each mouse received albendazole (10 mg/kg/day) (Sigma‒Aldrich, USA) alone or in combination with 3-HBA (10 mg/kg/day) (Sigma‒Aldrich, USA) for 14 days after 7 days postinfection. Mice in the experimental groups were sacrificed on the 21st day after infection for collection of brain specimens. Moreover, rats were also sacrificed on the 21st day after infection for collection of living A. cantonensis L5 then used to ESPs collection.

2.4 Cell culture

N this study, a mouse brain astrocytic cell line (CRL2535) obtained from ATCC (American Type Culture Collection) was utilized. The cells were cultured in Dulbecco's modified Eagle's medium/F-12 (DMEM/F-12) (Corning, USA) supplemented with 10% fetal bovine serum (FBS) sourced from Gibco (USA). Additionally, the culture medium contained penicillin and streptomycin. The cells were grown in culture flasks coated with poly-L-lysine and maintained at a temperature of 37 °C in an atmosphere of 5% CO2. For the experimental procedure, the cells were seeded onto a 10 cm culture dish and incubated in serum-free DMEM/F-12 for 24 h. Before stimulation with A. cantonensis ESPs, the cells were pretreated with the inhibitor for 1 h.

2.5 Preparation of A. cantonensis L5 excretory/secretory products

To obtain ESPs, living A. cantonensis L5 were collected from the brain tissues of infected rats on Day 21 postinfection. The rats were anesthetized with 3% (v/v) isoflurane. Under a dissecting microscope, larvae were carefully separated from the tissue debris. Subsequently, the worms underwent a series of washes, including saline, phosphate-buffered saline (PBS), distilled water, and RPMI (Roswell Park Memorial Institute) medium containing a high concentration of antimycotic solution (consisting of 200 units/ml penicillin G, 200 μg/ml streptomycin sulfate, and 0.5 mg/ml amphotericin B) from Sigma‒Aldrich, St. Louis, USA. After the washing steps, the worms were incubated in RPMI medium without fetal bovine serum (FBS) for various time intervals, specifically 24, 48, 72, and 96 h, at a temperature of 37 °C with 5% CO2. Following incubation, the ESPs were concentrated using Amicon Ultra15 10K centrifugal filter devices (Merck Millipore, Germany). Finally, we obtained the concentrated and purified ESPs in the supernatant through removing the impurities by centrifugation for 3000×g. To determine the protein concentration of the ESPs, a Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA) was employed according to the manufacturer's instructions (Chen et al., 2020). The concentrated ESPs obtained were then utilized to treat astrocytes, and subsequent changes in molecular expression levels were analyzed.

2.6 RNA extraction and quantitative real-time PCR (qRT‒PCR)

In this study, TRIzol® Reagent was used to isolate total RNA from the different samples. cDNA synthesis and qRT‒PCR were performed using an iScript™ cDNA Synthesis Kit and an iQ™ SYBR® Green Supermix kit (Bio-Rad, USA). The 20-μl PCR mixture contained 1 μg reverse transcription product, master mix, and 0.5 μM real-time forward and reverse primers. The primer sequencing of the target gene is shown below. Here, 60S rRNA was used as an internal control for normalization in all experimental groups. Bio-Rad CFX Connect was used to detect gene expression in astrocytes. The primer sequences were as follows: 5′- CAAGATCCCAGTGATTATAGAGCG’ (sense) and 5′- ACTTCGGAGATGGGAGTGGA -3' (antisense) for LC3B; 5′- AACTCACAGCTCCATTACTTACCA -3' (sense) and 5′- CTGTAGACATCATCCTGGCTGG -3' (antisense) for Beclin; 5′- TACCCACATCTCCCACCAGA -3' (sense) and 5′- ACAATGGTGGAGGGTGCTTC -3' (antisense) for p62; 5′- TGATTATCGATTACGGCACACACT -3' (sense) and 5′- CGGTCGTGACTTCCTGAGACA -3' (antisense) for ATG16; 5′- CAAGAACTCGCTGATCCAGATG -3' (sense) and 5′- GGTGTCCTGGAGGTACTGGGTAT -3' (antisense) for mTOR; and 5′- TGTGTCCGTCGTGGATCTGA -3' (sense) and 5′- GATGCCTGCTTCACCACCTT -3' (antisense) for GAPDH.

2.7 Protein extraction and western blotting

Total protein was extracted using lysis buffer containing protease inhibitors (Roche Diagnostics, Switzerland). Subsequently, the proteins were separated by 12% SDS‒PAGE and then transferred onto nitrocellulose membranes. These membranes were then incubated with specific antibodies against various proteins, including LC3B, Beclin, p62, mTOR, ATG1, and β-actin (Proteintech, USA). The membranes were incubated with HRP-linked secondary antibody (Sigma–Aldrich, USA). Finally, the immunoreactive bands were visualized using an ECL (Enhanced chemiluminescence) reagent (EMD Millipore, USA) and a ChemiDoc Imaging System (Bio-Rad, USA).

2.8 Immunohistochemical staining

Brain sections were initially incubated at room temperature and then treated with a mixture of 3% (v/v) H2O2 in methanol. Subsequently, the sections were exposed to a solution of 0.1% (v/v) Tween 20 in PBS for 10 min. Next, the sections were immersed in 5% (v/v) goat serum for 1 h and then placed in a primary antibody solution at 4 °C overnight. The sections were placed in a secondary antibody solution at room temperature for 1 h. An avidin-biotin-peroxidase complex (ABC) reagent was employed at room temperature for 1 h. Finally, the coloration process was initiated by adding a DAB (3,3′-diaminobenzidine) reaction solution. Each section was mounted with a suitable mounting medium and left to dry at room temperature after counterstaining with hematoxylin.

2.9 Autophagy staining

Cultured astrocytes treated with 250 μg/ml ESPs or 3-HBA were collected. Autophagy induction was detected in astrocytes by the CYTO-ID® Autophagy Detection Kit 2.0 (Enzo, USA) and Autophagy Assay Kit (Sigma‒Aldrich, USA) using immunomicroscopy.

2.10 Lipid droplet assay

Cultured astrocytes treated with 250 μg/ml ESPs or 3-HBA were collected. Subsequently, the commercial working solution (Dojindo Laboratories Co., Ltd., Japan) was added, and then the cells were cultured at 37 °C for 2 h. Finally, red fluorescence expression was detected using immunomicroscopy (ex/em: 586/647).

2.11 Cholesterol uptake assay

Cultured astrocytes treated with 250 μg/ml ESPs or 3-HBA were collected. Cholesterol expression was detected in astrocytes by a cholesterol uptake assay (Abcam, U.K.) using immunomicroscopy (GFP, ex/em: 469/525).

2.12 Statistical analysis

This study employed Two-way ANOVA and Student's t tests to compare the expression levels by utilizing GraphPad Prism 8.0 software (GraphPad, USA). The data are represented as the mean ± standard deviation (SD). Differences were considered statistically significant according to the P value.

3 Results

3.1 Benzaldehyde treatment induces autophagy in the cerebrum of mice infected with A. cantonensis

First, we wanted to investigate autophagy levels in the mouse cerebrum after A. cantonensis infection, and transmission electron microscopy (TEM) was employed to detect autophagosomes in vivo. The results showed that a number of autophagosome-like structures were observed in the cytoplasm of brain cells after A. cantonensis infection (Fig. 1a). Previous studies have confirmed that A. cantonensis infection in nonpermissive hosts (other than rats) can lead to eosinophilic meningitis and thickening of the meninges (Wang et al., 2006; Jhan et al., 2021). Therefore, we next examined whether benzaldehyde upregulates the expression of an autophagy biomarker (LC3B) in the meninges following A. cantonensis infection. The results showed that mice exhibited thickening of the meninges, accompanied by a significant upregulation in LC3B expression within the meninges following A. cantonensis infection. Moreover, the expression level of LC3B in the meninges was obviously increased after benzaldehyde combined with albendazole treatment. Furthermore, eosinophilic meningitis was also alleviated (Fig. 1b). These data suggested that benzaldehyde has the potential to induce autophagy in the central nervous system of mice after A. cantonensis infection.Fig. 1 Benzaldehyde stimulates autophagy generation in the Angiostrongylus cantonensis-infected mouse brain. (a) The formation of autophagic-like vacuoles was detected by using transmission electron microscopy (TEM) in the central nervous system (arrow). (b) The changes in eosinophilic meningitis and LC3B expression are detected in A. cantonensis-infected mice after drug treatment. N: normal, Inf: infection, Inf + Alb: infection + albendazole (10 mg/kg/day), and Inf + Alb+3-HBA: infection + albendazole (10 mg/kg/day)+3-HBA (10 mg/kg/day).

Fig. 1

3.2 Benzaldehyde treatment upregulated the expression of autophagy-related molecules in the brains of mice infected with A. cantonensis

To investigate autophagy in the A. cantonensis-infected and drug-treated mouse brain, the mice were divided into four groups: normal, infection, infection + albendazole, and infection + albendazole+3-HBA. Next, we analyzed the mRNA and protein levels of autophagy-related molecules, including LC3B, Beclin, p62, and mTOR, in the cerebral cortex and hippocampus. The levels of mRNA and protein were determined by real-time PCR and western blotting. As presented in Fig. 2a and b, the data showed that A. cantonensis upregulated autophagy-related molecule expression in the cerebral cortex and hippocampus. Moreover, the molecular expression levels were higher in the 3-HBA combined with albendazole therapy group than in the infected groups or the albendazole alone treatment group. These results suggested that 3-HBA combined with albendazole stimulated autophagy at the transcriptional and translational levels in the A. cantonensis-infected mouse brain, especially in the cerebral cortex and hippocampus.Fig. 2 Benzaldehyde induces autophagy-related molecule expression in the Angiostrongylus cantonensis-infected mouse brain. Quantitative PCR and western blotting were used to detect the gene (a) and protein (b) expression of autophagy-related molecules (LC3B, Becline, p62, and mTOR) in each treatment group in vivo (cerebral cortex and hippocampus). N: normal, Inf: infection, Inf + Alb: infection + albendazole, Inf + Alb+3-HBA: infection + albendazole+3-HBA. The data was expressed as the means ± SDs from independent experiments (n = 5). #P < 0.05, ##P < 0.01, ###P < 0.001, compared with the normal group; *P < 0.05, **P < 0.01, ***P < 0.001, compared with the infection group.

Fig. 2

3.3 Benzaldehyde treatment upregulated the expression of sonic hedgehog signaling pathway-related molecules in the brains of mice infected with A. cantonensis

To assess sonic hedgehog signaling pathway activation in the A. cantonensis-infected mouse brain, we determined the expression of sonic hedgehog signaling-related molecules, including Shh, Ptch, and Smo, in the cerebral cortex and hippocampus. The results showed that compared with the infected group or albendazole alone treatment group, the 3-HBA combined with albendazole treatment group significantly induced sonic hedgehog signaling activation (Fig. 3a and b).Fig. 3 Benzaldehyde induces sonic hedgehog signaling activation in the Angiostrongylus cantonensis-infected mouse brain. Quantitative PCR and western blotting were used to detect the gene (a) and protein (b) expression of sonic hedgehog signaling -related molecules (Shh, Smo, and Gli-1) in each treatment group in vivo (cerebral cortex and hippocampus). N: normal, Inf: infection, Inf + Alb: infection + albendazole, Inf + Alb+3-HBA: infection + albendazole+3-HBA. The data was expressed as the means ± SDs from independent experiments (n = 5). #P < 0.05, ##P < 0.01, ###P < 0.001, compared with the normal group; *P < 0.05, **P < 0.01, ***P < 0.001, compared with the infection group.

Fig. 3

3.4 Benzaldehyde upregulates autophagy-related molecule expression through the shh signaling pathway after A. cantonensis ESP treatment

To investigate the impact of the Shh signaling pathway on autophagy in A. cantonensis ESP-treated astrocytes after benzaldehyde therapy, we employed specific drugs to modulate the pathway. Cyclopamine, a Shh signal inhibitor, was employed to inhibit the pathway, while a recombinant Sonic hedgehog peptide from mice (rShh) and a Smoothened receptor agonist (SAG) were utilized to enhance the signaling pathway. Moreover, our previous study has detected the cell viability in different concentration of 3-HBA treatment in A. cantonensis L5 ESPs treated astrocytes by the CCK8 assay. The results showed that 0.5 mM 3-HBA are the suitable concentration for treatment in our experiment (Chen et al., 2022). First, we analyzed the mRNA and protein levels of autophagy-related molecules, such as LC3B, Beclin, p62, and ATG16, in mouse astrocytes after treatment with A. cantonensis ESPs or drugs by real-time PCR and western blotting. The results demonstrated that the gene and protein expression levels were significantly elevated after A. cantonensis ESPs or 3-HBA treatment. Moreover, the expression levels were significantly higher in the cells pretreated with rShh or SAG than in those treated with ESPs and 3-HBA alone. In contrast, the expression levels were significantly lower in the cells pretreated with cyclopamine than in those treated with ESPs and 3-HBA alone (Fig. 4a and b). These data suggested that 3-HBA can induce autophagy in astrocytes through the Shh signaling pathway after treatment with A. cantonensis L5 ESPs.Fig. 4 Benzaldehyde induces autophagy-related molecule expression in A. cantonensis excretory-secretory products treated mouse astrocytes through the sonic hedgehog pathway. Cells were pretreated with recombinant Shh (r-Shh) (0.5, 2 μg/ml), Shh agonist (SAG) (1, 5 μM), and cyclopamine (Cyclo) (5, 20 μM) for 1 h and then incubated with 250 μg/ml A. cantonensis L5 excretory/secretory products (ESPs) and 0.5 mM 3-HBA and for 12 h. The (a) mRNA and (b) protein expression levels were detected. The data are expressed as the means ± SD from three independent experiments (n = 3). ##P < 0.01, and ###P < 0.001, compared to control. *P < 0.05, **P < 0.01, and ***P < 0.001, compared to cells exposed to ESPs and 3-HBA.

Fig. 4

3.5 Benzaldehyde induces autophagy generation through the shh signaling pathway after A. cantonensis ESPs treatment

To monitor the effect of 3-HBA on autophagy in astrocytes via the Shh signaling pathway, a Shh signaling inhibitor (cyclopamine), a recombinant Sonic hedgehog peptide from mice (rShh), and Smo agonist (SAG) were used to block or activate the signaling pathway. Next, the cells were incubated with A. cantonensis L5 ESPs in the absence or presence of 3-HBA, and then two different autophagy detection kits were used to detect autophagosomes by double immunofluorescence staining (Fig. 5a and b). The results showed that the fluorescence intensity was significantly elevated in ESPs treatment. Moreover, 3-HBA further increased ESPs-induced autophagy. Furthermore, the fluorescence intensity was higher in the cells pretreated with rShh or SAG and lower in the cells pretreated with cyclopamine than in those treated with ESPs and 3-HBA alone. These results demonstrated that 3-HBA can induce autophagy through the Shh signaling pathway.Fig. 5 Benzaldehyde stimulates autophagy generation in A. cantonensis excretory-secretory products treated mouse astrocytes through the sonic hedgehog pathway. Cells were pretreated with recombinant Shh (r-Shh) (0.5, 2 μg/ml), Shh agonist (SAG) (1, 5 μM), and cyclopamine (Cyclo) (5, 20 μM) for 1 h and then incubated with 250 μg/ml A. cantonensis L5 excretory/secretory products (ESPs) and 0.5 mM 3-HBA and for 12 h. Finally, (a) CYTO-ID® Autophagy Detection Kit and (b) Autophagy Assay Kit were employed to detect the autophagy generation by immunomicroscopy.

Fig. 5

3.6 Benzaldehyde reduces lipid accumulation through the shh signaling pathway after A. cantonensis ESPs treatment

Previous research has shown that lipids play an important role in autophagy induction. Some studies found that protein degradation in the lysosome is inhibited by autophagy in free fatty acid-treated cells. In contrast, lipid generation was induced in liver injury by activating autophagy in rats (Kurt et al., 2015; Lu et al., 2020; Russo et al., 2014). Lipid droplets can accumulate within cells in response to cellular stress, such as oxidative stress or endoplasmic reticulum (ER) stress. To clarify whether benzaldehyde has a function in the suppression of A. cantonensis ESPs-induced lipid draft accumulation through Shh signaling, we used rShh, SAG, and cyclopamine to regulate Shh pathway activation. As presented in Fig. 6, the expression of lipid rafts was upregulated in the cytoplasm of astrocytes after A. cantonensis ESPs treatment. In contrast, pretreatment with rShh and SAG significantly reduced ESPs-induced lipid raft accumulation as determined by immunofluorescence staining. Moreover, pretreatment with cyclopamine increased ESPs-induced lipid draft accumulation. These results indicated that Shh signaling participated in the degradation of lipids to form autophagosomes in ESPs-treated astrocytes after benzaldehyde treatment.Fig. 6 Benzaldehyde reduces lipid droplet accumulation in A. cantonensis excretory-secretory products treated mouse astrocytes through the sonic hedgehog pathway. Cells were pretreated with recombinant Shh (r-Shh) (0.5, 2 μg/ml), Shh agonist (SAG) (1, 5 μM), and cyclopamine (Cyclo) (5, 20 μM) for 1 h and then incubated with 250 μg/ml A. cantonensis L5 excretory/secretory products (ESPs) and 0.5 mM 3-HBA and for 12 h. Finally, the Lipid droplet Assay Kit was employed to detect the lipid droplet accumulation by immunomicroscopy.

Fig. 6

3.7 Benzaldehyde increases cholesterol levels through the shh signaling pathway after A. cantonensis ESPs treatment

Previous studies have demonstrated that the expression of intracellular cholesterol is upregulated via activation of the Shh pathway. This finding indicates that molecules associated with the Shh pathway may play a role in regulating intracellular cholesterol levels, which is a crucial step in the activation of Shh signaling (Bidet et al., 2011). Therefore, we further determined whether benzaldehyde increases cholesterol levels in astrocytes through the Shh pathway by detection with an immunofluorescence assay (Fig. 7). First, we found that cholesterol expression in the cytoplasm was upregulated in A. cantonensis ESPs-stimulated astrocytes after benzaldehyde treatment. In contrast, cholesterol expression was significantly upregulated with rShh and SAG treatment, whereas it was downregulated when treated with cyclopamine. These data demonstrated that Shh signaling is involved in cholesterol generation in A. cantonensis ESPs-stimulated astrocytes after benzaldehyde treatment. These data demonstrated the involvement of the Shh signaling pathway in cholesterol production in astrocytes stimulated by A. cantonensis ESPs, particularly following treatment with benzaldehyde.Fig. 7 Benzaldehyde enhances cholesterol generation in A. cantonensis excretory-secretory products treated mouse astrocytes through the sonic hedgehog pathway. Cells were pretreated with recombinant Shh (r-Shh) (0.5, 2 μg/ml), Shh agonist (SAG) (1, 5 μM), and cyclopamine (Cyclo) (5, 20 μM) for 1 h and then incubated with 250 μg/ml A. cantonensis L5 excretory/secretory products (ESPs) and 0.5 mM 3-HBA and for 12 h. Finally, the cholesterol uptake assay Kit was employed to detect the cholesterol generation by immunomicroscopy.

Fig. 7

4 Discussion

In this study, the animal experiment results found that benzaldehyde can induce autophagy in the central nervous system of mice after A. cantonensis infection, such as cerebral cortex and hippocampus. In our previous studies, substantial progress regarding the impact of A. cantonensis, the causative agent of angiostrongyliasis, on cellular processes and potential therapeutic interventions was made. Furthermore, we discovered that A. cantonensis ESPs stimulate the activation of the Shh signaling pathway, which subsequently enhances autophagy expression (Chen et al., 2020). Autophagy is a cellular process in which damaged or unnecessary components in a cell are broken down and recycled, such as misfolded proteins, organelles, or other cellular components (Romano et al., 2023; Zuo et al., 2023). Autophagy can be caused by a variety of cell stresses, such as nutrient deficiency, cell injury, oxidative stress, ER stress, or pathogen infection. It also plays a role in several physiological processes, including the development, immune response, and maintenance of cell quality control (Jimenez-Moreno et al., 2023; Li et al., 2023; Sharma et al., 2023; Shen et al., 2023; Tian et al., 2023; Wang et al., 2023). In parasite infection, recent studies have revealed that autophagy may be induced in host cells and plays an important role in the immune response against infections with parasites such as Toxoplasma gondii, Entamoeba histolytica, Trypanosoma cruzi, and Eimeria tenella (Li et al., 2020; Vanrell et al., 2022; Ahmadpou et al. 2023; Zhang et al., 2023).

To clarify the pathogenesis of A. cantonensis, we used A. cantonensis L5 ESPs to treat mouse astrocytes then elucidated the molecular mechanism of cellular response. The data found that A. cantonensis L5 ESPs causes sonic hedgehog signaling activation and autophagy generation in mouse astrocytes. The study of ESPs provides valuable insights into the relationship between hosts and parasites such as nematodes, trematodes, and cestodes, such as Dirofilaria immitis, Echinococcus spp., and Taenia crassiceps (Crowe et al., 2017; Kronenberg et al., 2023; Machado et al., 2023; Morales-Ruiz et al., 2023). In our previous studies, we profiled, identified, and characterized the ESPs of A. cantonensis L5. The proteomic data showed that a total of 51 protein spots were identified. Next, we identified the immunoreactive proteins from a reference map of A. cantonensis L5 ESPs (Chen et al., 2019). These immunoreactive proteins can serve as important biomarkers for future research on the interactions between A. cantonensis and its hosts.

In our previous study for functional analysis of A. cantonensis L5 ESPs, the results showed that astrocytes may induce oxidative stress and cell apoptosis. Interestingly, the data showed that activating the Shh pathway had a protective effect. Moreover, activating the Shh signaling pathway led to a significant reduction in astrocyte apoptosis (Chen et al., 2017). Furthermore, the study revealed that the level of ROS in astrocytes decreased when the Shh pathway was overexpressed. This increase in Shh pathway activity was associated with elevated levels of antioxidants. In another study, host immune responses were investigated and the researchers found that NF-κB could stimulate cytokine secretion through the Shh signaling pathway in ESPs-treated astrocytes (Chen and Wang, 2017). Therefore, this study we elucidated the molecular mechanism of the sonic hedgehog signaling pathway in autophagy following benzaldehyde treatment. The data showed that Shh signaling plays an important role in benzaldehyde induced autophagy after A. cantonensis L5 ESPs treatment in the cell experiment.

The discovery of Hedgehog (Hh) in Drosophila marked a substantial breakthrough in understanding segmental patterning and embryonic development, and Hh works with other Hh signaling-related molecules. Hh represents a family of secreted proteins that play a crucial role in animal development, particularly in tissue and organ morphogenesis (McMahon et al., 2003). Among mammals, three hedgehog homologs have been identified: Sonic hedgehog (Shh), Desert hedgehog (Dhh), and Indian hedgehog (Ihh) (Shimada and Kato, 2022). Notably, Shh is the most abundantly expressed molecule among these three types. Recent investigations have shed light on the important role of the Shh pathway in neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease. However, the specific mechanisms underlying its impact on parasitic infection remain unclear (Malave et al., 2021; Yang et al., 2021).

Next, we started to evaluate the therapeutic effect of 3-HBA at the molecular level. In our previous studies, we demonstrated that benzaldehyde could support brain cell survival by regulating the expression levels of ER stress- and oxidative stress-related pathway (Chen et al., 2022). In the animal study, we initially evaluated the therapeutic efficiency of Benzaldehyde in A. cantonensis-infected mice (Chen et al., 2023b). Therefore, this study extends previous findings to explore whether 3-HBA can regulate autophagy, lipid, and cholesterol production through activation of the Shh signaling pathway, ultimately affecting the generation of cellular apoptosis and inflammatory responses. We used sonic hedgehog pathway inhibitor (Cyclopamine), recombinant shh (rShh), and activator (SAG) to clarify the relationship between Shh pathway and autophagy. Next, we also found that 3-HBA can regulate lipid and cholesterol production via Shh signaling pathway. A. cantonensis can cause severe inflammation and neuropathological damage, including eosinophilic meningitis and eosinophilic meningoencephalitis in humans. Some previous studies demonstrated that the relationship between inflammation and lipid metabolism is very close. They found the inflammatory cytokines (TNF-α and IL-6) can affect the lipoproteins production and clearance. These cytokines also can regulate molecular mechanism involved in the metabolism of cholesterol. Finally, the lipid metabolism related disorders are induced by inflammation, such as Atherosclerosis (Popa et al., 2007; Shi et al., 2019; Garcia et al., 2023). Therefore, 3-HBA may inhibit inflammatory response in the CNS via reducing lipid accumulation.

In this study, we demonstrated that 3-HBA represent potential therapeutic drugs for the treatment of human angiostrongyliasis. G. elata is a Chinese herbal medicine containing the bioactive component benzaldehyde. Benzaldehyde has been found to reduce the inflammatory response by suppressing the expression levels of VCAM-1, ICAM-1, CD40, phospho-NF-κB, phospho-p38, and HIF-1α, indicating its potential as a therapeutic agent for managing inflammatory conditions (Kong et al., 2016). Additionally, benzaldehyde exhibits promising potential as an anticancer drug, as it can inhibit cell migration (Kochi et al., 1980). Overall, benzaldehyde offers multiple health benefits. It exerts antioxidant effects by reducing oxidative stress and inhibiting ROS production. Furthermore, it possesses anti-inflammatory properties by downregulating key inflammatory markers. In our research on benzaldehyde therapy, the data revealed that 3-HBA and 4-HBA can elevate the cell viability of astrocytes by inhibiting the expression of apoptosis-related molecules, suggesting their potential as therapeutic drugs for human angiostrongyliasis (Chen et al., 2021). Thus, further research is needed to explore and fully understand the mechanisms underlying these beneficial effects and to ascertain their therapeutic potential in various health conditions.

The aim of this study was to characterize the biological importance of sonic hedgehog signaling in A. cantonensis infection and its response to benzaldehyde treatment (Fig. 8). This study demonstrated that A. cantonensis ESPs induces the sonic hedgehog signaling pathway activation, cholesterol production, and lipid accumulation. Next, we clarify the sonic hedgehog signaling can reduce lipid accumulation by stimulating the autophagy production. Finally, the drug treatment experiment data found that benzaldehyde has the protective function by activating the sonic hedgehog signaling pathway to achieve the therapeutic effect of astrocytes after A. cantonensis ESPs treatment. Furthermore, this study provides new insights into the development of therapeutic strategies for angiostrongyliasis.Fig. 8 Summary of functional studies on Benzaldehyde in mouse brain astrocytes after A. cantonensis L5 ESPs treatment. This study shows that Benzaldehyde enhances autophagy and cholesterol generation via the sonic hedgehog signaling pathway. Created using Biorender.com.

Fig. 8

CRediT authorship contribution statement

Kuang-Yao Chen: Writing – review & editing, Writing – original draft, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Chien-Ju Cheng: Writing – review & editing, Validation, Methodology, Investigation, Formal analysis, Data curation. Yuan-Ting Chang: Writing – review & editing, Validation, Methodology, Formal analysis, Data curation. Yi-Hsuan Lin: Writing – review & editing, Methodology, Investigation, Formal analysis, Data curation. Yi-Hao Huang: Writing – review & editing, Methodology, Investigation. Sheng-Yu Lin: Methodology, Investigation. Lian-Chen Wang: Writing – review & editing, Investigation, Funding acquisition, Data curation, Conceptualization. Kai-Yuan Jhan: Writing – review & editing, Methodology. Cheng-Hsun Chiu: Writing – review & editing, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare no competing financial interests.

Acknowledgements

We would like to express our appreciation to the Instrumentation Center, Chang Gung University, Taoyuan, Taiwan for supplying invaluable technical assistance. This work was supported in part by grants from the 10.13039/100020595 National Science and Technology Council , ROC (111-2320-B-182 -037 and 112-2320-B-182 -052 -MY3 ) and the 10.13039/100012553 Chang Gung Memorial Hospital Research Grant (CMRPD1N0081-2 ).
==== Refs
References

Ahmadpour E. Babaie F. Kazemi T. Mehrani Moghaddam S. Moghimi A. Hosseinzadeh R. Nissapatorn V. Pagheh A.S. Overview of apoptosis, autophagy, and inflammatory processes in Toxoplasma gondii infected cells Pathogens 12 2023 253 36839525
Barratt J. Chan D. Sandaradura I. Malik R. Spielman D. Lee R. Marriott D. Harkness J. Ellis J. Stark D. Angiostrongylus cantonensis: a review of its distribution, molecular biology and clinical significance as a human pathogen Parasitology 143 2016 1087 1118 27225800
Bidet M. Joubert O. Lacombe B. Ciantar M. Nehmé R. Mollat P. Brétillon L. Faure H. Bittman R. Ruat M. Mus-Veteau I. The hedgehog receptor patched is involved in cholesterol transport PLoS One 6 2011 e23834
Carvalho M.S.N. Carvalho M.R. Santos J.A.O. Barbosa N.D. Melo L.C. Costa F.H.M. Carvalho J.P.F. Messias H.B.G. Fonseca S.A. Souza M.A. Ferreira-Júnior G.C. Lima R.F. Costa J.G. Cavalcanti M.G.S. Matos-Rocha T.J. Epidemiological, clinical and laboratory aspects of Angiostrongylus cantonensis infection: an integrative review Braz. J. Biol. 82 2022 e262109
Chen K.Y. Chiu C.H. Wang L.C. Anti-apoptotic effects of Sonic hedgehog signalling through oxidative stress reduction in astrocytes co-cultured with excretory-secretory products of larval Angiostrongylus cantonensis Sci. Rep. 7 2017 41574
Chen K.Y. Lu P.J. Cheng C.J. Jhan K.Y. Yeh S.C. Wang L.C. Proteomic analysis of excretory-secretory products from young adults of Angiostrongylus cantonensis Mem. Inst. Oswaldo Cruz 114 2019 e180556
Chen K.Y. Cheng C.J. Cheng C.C. Jhan K.Y. Chen Y.J. Wang L.C. The excretory/secretory products of fifth-stage larval Angiostrongylus cantonensis induces autophagy via the Sonic hedgehog pathway in mouse brain astrocytes PLoS Neglected Trop. Dis. 14 2020 e0008290
Chen K.Y. Chen Y.J. Cheng C.J. Jhan K.Y. Chiu C.H. Wang L.C. 3-Hydroxybenzaldehyde and 4-Hydroxybenzaldehyde enhance survival of mouse astrocytes treated with Angiostrongylus cantonensis young adults excretory/secretory products Biomed. J. 44 2021 S258 S266 35300947
Chen K.Y. Chen Y.J. Cheng C.J. Jhan K.Y. Wang L.C. Benzaldehyde attenuates the fifth stage larval excretory-secretory product of Angiostrongylus cantonensis-induced injury in mouse astrocytes via regulation of endoplasmic reticulum stress and oxidative stress Biomolecules 12 2022 177 35204678
Chen K.Y. Chen Y.J. Cheng C.J. Jhan K.Y. Chiu C.H. Wang L.C. The therapeutic effect of tanshinone IIA in mouse astrocytes after treatment with Angiostrongylus cantonensis fifth-stage larval excretory-secretory products J. Microbiol. Immunol. Infect. 2023 S1684-1182, 00085-00083
Chen K.Y. Cheng C.J. Chen Y.J. Chiu C.H. Wang L.C. Protective effect of benzaldehyde combined with albendazole against brain injury induced by Angiostrongylus cantonensis infection in mice Int. J. Antimicrob. Agents 62 2023 106963
Chen K.Y. Wang L.C. Stimulation of IL-1β and IL-6 through NF-κB and sonic hedgehog-dependent pathways in mouse astrocytes by excretory/secretory products of fifth-stage larval Angiostrongylus cantonensis Parasites Vectors 10 2017 445 28950910
Crowe J. Lumb F.E. Harnett M.M. Harnett W. Parasite excretory-secretory products and their effects on metabolic syndrome Parasite Immunol. 39 5 2017 10.1111/pim.12410
Garcia C. Andersen C.J. Blesso C.N. The role of lipids in the regulation of immune responses Nutrients 15 2023 3899 37764683
Huang N.K. Chern Y. Fang J.M. Lin C.I. Chen W.P. Lin Y.L. Neuroprotective principles from Gastrodia elata J. Nat. Prod. 70 2007 571 574 17381154
Jacob J. Steel A. Howe K. Jarvi S. Management of rat lungworm disease (neuroangiostrongyliasis) using anthelmintics: recent updates and recommendations Pathogens 12 2022 23 36678371
Jhan K.Y. Lai G.J. Chang P.K. Tang R.Y. Cheng C.J. Chen K.Y. Wang L.C. Angiostrongylus cantonensis causes cognitive impairments in heavily infected BALB/c and C57BL/6 mice Parasites Vectors 13 2020 405 32778140
Jhan K.Y. Cheng C.J. Jung S.M. Lai Y.J. Chen K.Y. Wang L.C. Co-therapy of albendazole and dexamethasone reduces pathological changes in the cerebral parenchyma of Th-1 and Th-2 dominant mice heavily infected with Angiostrongylus cantonensis: histopathological and RNA-seq analyses Biomolecules 11 2021 536 33917604
Jimenez-Moreno N. Salomo-Coll C. Murphy L.C. Wilkinson S. Signal-retaining autophagy indicator as a quantitative imaging method for ER-phagy Cells 12 2023 1134 37190043
Kochi M. Takeuchi S. Mizutani T. Mochizuki K. Matsumoto Y. Saito Y. Antitumor activity of benzaldehyde Cancer Treat Rep. 64 1980 21 23 6929727
Kong B.S. Im S.J. Lee Y.J. Cho Y.H. Do Y.R. Byun J.W. Ku C.R. Lee E.J. Vasculoprotective effects of 3-hydroxybenzaldehyde against VSMCs proliferation and ECs inflammation PLoS One 11 2016 e0149394
Kronenberg P.A. Reinehr M. Eichenberger R.M. Hasler S. Laurimäe T. Weber A. Deibel A. Müllhaupt B. Gottstein B. Müller N. Hemphill A. Deplazes P. Monoclonal antibody-based localization of major diagnostic antigens in metacestode tissue, excretory/secretory products, and extracellular vesicles of Echinococcus species Front. Cell. Infect. Microbiol. 13 2023 1162530
Kurt R. Chandra P.K. Aboulnasr F. Panigrahi R. Ferraris P. Aydin Y. Reiss K. Wu T. Balart L.A. Dash S. Chaperone-Mediated autophagy targets IFNAR1 for lysosomal degradation in free fatty acid treated HCV cell culture PLoS One 10 2015 e0125962
Li X. Zhang Y. Zhao Y. Qiao K. Feng M. Zhou H. Tachibana H. Cheng X. Autophagy activated by peroxiredoxin of Entamoeba histolytica Cells 9 2020 2462 33198056
Li N. Yi B.J. Saleem M.A.U. Li X.N. Li J.L. Autophagy protects against Cd-induced cell damage in primary chicken hepatocytes via mitigation of oxidative stress and endoplasmic reticulum stress Ecotoxicol. Environ. Saf. 259 2023 115056
Lu N.S. Chiu W.C. Chen Y.L. Peng H.C. Shirakawa H. Yang S.C. Fish oil up-regulates hepatic autophagy in rats with chronic ethanol consumption J. Nutr. Biochem. 77 2020 108314
Machado C.D.C. Alarcón-Torrecillas C. Pericacho M. Rodríguez-Escolar I. Carretón E. Montoya-Alonso J.A. Morchón R. Involvement of the excretory/secretory and surface-associated antigens of Dirofilaria immitis adult worms in the angiogenic response in an in-vitro endothelial cell model Vet. Parasitol. 318 2023 109939
Malave L. Zuelke D.R. Uribe-Cano S. Starikov L. Rebholz H. Friedman E. Qin C. Li Q. Bezard E. Kottmann A.H. Dopaminergic co-transmission with sonic hedgehog inhibits abnormal involuntary movements in models of Parkinson’s disease and L-Dopa induced dyskinesia Commun. Biol. 4 1 2021 1071 34552196
McMahon A.P. Ingham P.W. Tabin C.J. Developmental roles and clinical significance of hedgehog signaling Curr. Top. Dev. Biol. 53 2003 1 114 12509125
Moon C.Y. Ku C.R. Cho Y.H. Lee E.J. Protocatechuic aldehyde inhibits migration and proliferation of vascular smooth muscle cells and intravascular thrombosis Biochem. Biophys. Res. Commun. 423 2012 116 121 22640742
Morales-Ruiz V. López-Recinos D. Castañeda M.G. Guevara-Salinas A. Parada-Colin C. Gómez-Fuentes S. Espitia-Pinzón C. Hernández-González M. Adalid-Peralta L. Characterization of excretory/secretory products of the Taenia crassiceps cysticercus involved in the induction of regulatory T cells in vivo Parasitol. Res. 122 2023 1489 1497 37115316
Popa C. Netea M.G. van Riel P.L. van der Meer J.W. Stalenhoef A.F. The role of TNF-alpha in chronic inflammatory conditions, intermediary metabolism, and cardiovascular risk J. Lipid Res. 48 2007 751 762 17202130
Romano P.S. Akematsu T. Besteiro S. Bindschedler A. Carruthers V.B. Chahine Z. Coppens I. Descoteaux A. Alberto Duque T.L. He C.Y. Heussler V. Le Roch K.G. Li F.J. de Menezes J.P.B. Menna-Barreto R.F.S. Mottram J.C. Schmuckli-Maurer J. Turk B. Tavares Veras P.S. Salassa B.N. Vanrell M.C. Autophagy in protists and their hosts: when, how and why? Autophagy Rep 2 2023 2149211
Russo R. Cassiano M.G. Ciociaro A. Adornetto A. Varano G.P. Chiappini C. Berliocchi L. Tassorelli C. Bagetta G. Corasaniti M.T. Role of D-Limonene in autophagy induced by bergamot essential oil in SH-SY5Y neuroblastoma cells PLoS One 9 2014 e113682
Sawanyawisuth K. Sawanyawisuth K. Treatment of angiostrongyliasis Trans. R. Soc. Trop. Med. Hyg. 102 2008 990 996 18501934
Sharma P. Kaushal N. Saleth L.R. Ghavami S. Dhingra S. Kaur P. Oxidative stress-induced apoptosis and autophagy: balancing the contrary forces in spermatogenesi Biochim. Biophys. Acta, Mol. Basis Dis. 1869 2023 166742
Shen J. Fu Y. Liu F. Ning B. Jiang X. Ursolic acid promotes autophagy by inhibiting akt/mTOR and TNF-α/TNFR1 signaling pathways to alleviate pyroptosis and necroptosis in Mycobacterium tuberculosis-infected macrophage Inflammation 46 2023 1749 1763 37212951
Shi J. Fan J. Su Q. Yang Z. Cytokines and abnormal glucose and lipid metabolism Front. Endocrinol. 10 2019 703
Shimada I.S. Kato Y. Ciliary signaling in stem cells in health and disease: Hedgehog pathway and beyond Sem. Cell Dev. Biol. 129 2022 115 125
Smyth D.J. White M.P.J. Johnston C.J.C. Donachie A.M. Campillo Poveda M. McSorley H.J. Maizels R.M. Protection from T cell-dependent colitis by the helminth-derived immunomodulatory mimic of transforming growth factor-β, Hp-TGM Discov Immunol. 2 2023 kyad001
Tian G. Li J. Zhou L. Ginsenoside Rg1 regulates autophagy and endoplasmic reticulum stress via the AMPK/mTOR and PERK/ATF4/CHOP pathways to alleviate alcohol-induced myocardial injury Int. J. Mol. Med. 52 2023 56 37232350
Turck H.C. Fox M.T. Cowie R.H. Paratenic hosts of Angiostrongylus cantonensis and their relation to human neuroangiostrongyliasis globally One Health 15 2022 100426
Vanrell M.C. Martinez S.J. Muñoz L.I. Salassa B.N. Gambarte Tudela J. Romano P.S. Induction of autophagy by ursolic acid promotes the elimination of Trypanosoma cruzi amastigotes from macrophages and cardiac cells Front. Cell. Infect. Microbiol. 12 2022 919096
Wang L.C. Jung S.M. Chen C.C. Wong H.F. Wan D.P. Wan Y.L. Pathological changes in the brains of rabbits experimentally infected with Angiostrongylus cantonensis after albendazole treatment: histopathological and magnetic resonance imaging studies J. Antimicrob. Chemother. 57 2006 294 300 16319180
Wang X. Bi C. Xin X. Zhang M. Fu H. Lan L. Wang M. Yan Z. Pyroptosis, apoptosis, and autophagy are involved in infection induced by two clinical Klebsiella pneumoniae isolates with different virulence Front. Cell. Infect. Microbiol. 13 2023 1165609
Xia Y.P. Dai R.L. Li Y.N. Mao L. Xue Y.M. He Q.W. Huang M. Huang Y. Mei Y.W. Hu B. The protective effect of sonic hedgehog is mediated by the phosphoinositide 3-kinase/AKT/Bcl-2 pathway in cultured rat astrocytes under oxidative stress Neuroscience 209 2012 1 11 22402346
Yang C. Qi Y. Sun Z. The Role of Sonic Hedgehog Pathway in the Development of the Central Nervous System and Aging-Related Neurodegenerative Diseases Front. Mol. Biosci. 8 2021 711710 34307464
Yordanova I.A. Elizalde-Velázquez L.E. Hartmann S. Immunization with excretory-secretory molecules of intestinal nematodes induces antigen-specific protective memory Th2 cell responses Eur. J. Immunol. 53 2023 e2250237
Zhang L. Zhang H. Du S. Song X. Hu D. In vitro transcriptional response of Eimeria tenella to toltrazuril reveals that oxidative stress and autophagy contribute to its anticoccidial effect Int. J. Mol. Sci. 24 2023 8370 37176073
Zuo H. Chen C. Sa Y. Therapeutic potential of autophagy in immunity and inflammation: current and future perspectives Pharmacol. Rep. 75 2023 499 510 37119445
