
==== Front
STAR Protoc
STAR Protoc
STAR Protocols
2666-1667
Elsevier

S2666-1667(24)00413-1
10.1016/j.xpro.2024.103248
103248
Protocol
Protocol for genetic engineering in Drosophila suzukii using microinjection
Yan Ying ying.yan@agrar.uni-giessen.de
123∗
Schetelig Marc F. marc.schetelig@agrar.uni-giessen.de
1∗∗
1 Institute for Insect Biotechnology, Department of Insect Biotechnology in Plant Protection, Justus-Liebig-University Gießen, Winchesterstraße 2, 35394 Gießen, Germany
∗ Corresponding author ying.yan@agrar.uni-giessen.de
∗∗ Corresponding author marc.schetelig@agrar.uni-giessen.de
2 Technical contact

3 Lead contact

14 8 2024
20 9 2024
14 8 2024
5 3 103248© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Summary

The spotted wing Drosophila (Drosophila suzukii Matsumura) is recognized globally as a significant economic pest. Here, we present a protocol for genetic engineering in D. suzukii using microinjection. We describe steps for genetic engineering techniques, including transposon-mediated germline transformation, recombinase-mediated genome targeting, and CRISPR-mediated gene editing. This protocol can significantly expand the toolkit for functional genomics and genetic control studies of this pest.

For complete details on the use and execution of this protocol, please refer to Schetelig and Handler,1 Schetelig et al.2 Yan et al.,3 and Yan et al.4

Graphical abstract

Highlights

• Step-by-step microinjection protocol for a global pest Drosophila suzukii

• Methods for state-of-the-art genetic engineering techniques

• Description for fly food cooking, egg collection, and needle preparation

• Guidance on verification and breeding scheme for transgene or mutation

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

The spotted wing Drosophila (Drosophila suzukii Matsumura) is recognized globally as a significant economic pest. Here, we present a protocol for genetic engineering in D. suzukii using microinjection. We describe steps for genetic engineering techniques, including transposon-mediated germline transformation, recombinase-mediated genome targeting, and CRISPR-mediated gene editing. This protocol can significantly expand the toolkit for functional genomics and genetic control studies of this pest.

Subject areas

Biotechnology and bioengineering
CRISPR
Genetics
Molecular Biology
==== Body
pmcBefore you begin

Fly stock culturing and food preparation

Timing: 4–6 weeks

Maintaining healthy fly stocks is essential for successful microinjection, free from viruses, fungi, mites, or other contaminants. The flies should be well-fed, fully grown, and have a balanced sex ratio.1. Food Preparation (Table 1).a. Flour Mix: For 8 L (L) of food, combine 80 g (g) of soy flour, 640 g of corn flour, and 144 g of yeast. The flour mix can be stored at 15°C–30°C in plastic containers for up to three months.

b. Molasses-Malt Mix: For 8 L, mix 176 g of molasses with 640 g of malt in plastic bottles. Store at 15°C–30°C for up to three months.

c. Nipagin Stock: Weigh 8 g of Nipagin, store in a 50-mL Falcon tube at 4°C. Dissolve in 40 mL 70% ethanol (2 g/10 mL) when ready to use.

d. Start the food cooking: Use the Mediaclave MC 10 to cook 8 L of food. Start with 3.6 L pre-heated VE water at 60°C. Add the molasses-malt mix to the pot, and rinse the mix bottle in 0.2 L warm tap water and add it to the pot.

e. Add 1.6 L tap water into the pot.

f. Dissolve the agar in a glass beaker with 1.6 L tap water using microwave and add the completely dissolved agar to the pot. Rinse the glass beaker with 0.2 L warm tap water and add it to the pot. Use heat-protective gloves.

g. Add the flour mix slowly (in 2–3 min) to avoid clots.

h. Initiate a 40-min cooking program, and after cooling to 60°C, add 16 g Nipagin and and 50 mL propionic acid, stirring for 5 min before dispensing.

i. Dispensing: Pour the mix into small (50 mL tube, 29 × 95 mm, 15 mL of food per vial) or large (175 mL tube, 50 × 100 mm, 30 mL of food per vial) plastic vials. Leave to air-dry overnight at 15°C–30°C, then plug and store at 4°C.

Table 1 Ingredients for the D suzukii artificial food

Ingredients	Manufacturer	Final concentration	
Tap water	N/A	450 mL/L	
Distilled water	N/A	450 mL/L	
Thread agar	Gewürzmühle Brecht, Germany	8 g/L	
Soy flour	Reformhaus, Germany	10 g/L	
Corn flour	Reformhaus, Germany	80 g/L	
Yeast	Reformhaus, Germany	18 g/L	
Malt	CSM Deutschland GmbH, Ulm, Germany	80 g/L	
Molasses	Grafschafter Krautfabrik, Germany	22 g/L	
Nipagina	Alfa Aesar Co., Inc., USA	2 g/L	
Proprionic acida	Carl Roth, Germany	6.25 mL/L	
a Add Nipagin and propionic acid after the cooking mix cool down to 60°C.

2. Fly Preparation.a. For various genetic modifications, use appropriate strains: WT for transposon-mediated germ-line transformation,1,5 strains with recombination sites for recombinase-mediated cassette exchange,2,5 and Cas9-expressing lines for CRISPR editing.4,6

b. Use large food vials to maintain the population. One week before the injection day, transfer 1–3 weeks old flies to fresh vials every two days to ensure they are fit and well-fed.

c. Set the photoperiod to either 12L:12D or 14L:10D. Females typically become active for egg-laying 2–3 h into the light period; starting the light period at 5 am facilitates egg collection from 8 am.

Note: In a controlled environment (25°C and 55%–60% humidity), it takes 13–21 days for egg-to-adult development of our D. suzukii USA wild-type (WT) strain.7 Adults aged 2–4 weeks are optimal for egg collection as females are most active in egg-laying during this period in our system.

Needle preparation

Timing: 2 h

3. We use a Needle Puller (P-2000, Sutter Instrument Co., USA) for pulling needles. The recommended program settings for borosilicate glass capillaries (0.58 × 1.00 × 100 mm) with inner filaments are: Heat = 350, Filament = 4, Velocity = 50, Delay = 225, Pull = 150. The effects of each parameter on needle shape are detailed in the puller manual and a D. melanogaster needle preparation protocol.8 Notably, the Delay parameter affects the taper length and tip diameter, with shorter delays resulting in longer tapers and smaller tips. Lower heat and higher pull strength yield more rigid needles. For D. suzukii, optimal needles are fine-tipped, stiff, and sharp, leading us to adjust the settings to: Heat = 345, Filament = 4, Velocity = 45, Delay = 180, Pull = 160.

4. Opening the blunt end of the needle can be done through grinding (Microelectrode Beveler) or etching (chemical or laser). In their absence, tips can be manually opened by bending them on a hard surface, like a glass slide, or using extra fine forceps (e.g., neoLab, 2–1033, tip width 0.1 mm) on the injection day.

Note: Pulling parameters should be tailored to each experimental setup, considering variations in glass capillaries, Puller equipment, and needle opening methods. It's advisable to create and test reference needles with diverse settings to optimize for injection requirements. Good needles should allow smooth injection without clotting, easy penetration of the embryos and satisfactory survival rates (embryos to adult) of the injected flies.

Injection mixture preparation

Timing: 2–3 h

5. Depending on the genetic engineering systems, different plasmid DNA or RNA are needed for the injection mix.a. For Transposon-mediated Germ-line Transformation: Essential components include a donor plasmid carrying transposon’s terminal repeats (TRs) and a helper plasmid with transposon coding sequence under a germline or constitutive promoter. The helper plasmid’s transposase recognizes the TRs, integrating the transgene randomly into the genome. The piggyBac transposon is predominantly used for D. suzukii’s germline transformation. Prepare and mix the donor and helper plasmids at 500 to 200 ng/μL, respectively, in injection buffer (5 mM KCl, 0.1 mM NaH2PO4, pH 6.8). Higher concentrations (700 and 300 ng/μL for donor and helper, respectively) increased transformation efficiency but reduced hatch rates.9 Helper plasmids like phsp-pBac and Dm-mhyPBase, or synthetic piggyBac RNA at 100–300 ng/μL can be used.10 The piggyBac RNA helper can be produced by in vitro transcription (mMESSAGE mMACHINE T7 Transcription Kit or HiScribe T7 Arca mRNA kit) and used for injection. For this purpose, a transcription template can be generated by PCR using phsp-pBac plasmid as DNA template and primer pairs pBac-mRNA-F and pBac-mRNA-R. Purify mRNA with a transcription clean-up kit. For injection mix with either DNA or RNA helper, remove particles by filtering the mix with Millex-HV 0.45 μm or applying high-speed centrifuge.

b. For Recombinase-mediated Genome Targeting: Essential components include a donor plasmid with recombination sites (e.g., lox, FRT, attP) and a phenotypical marker and a helper plasmid with integration enzyme coding sequence. The enzyme (e.g., Cre recombinase, Flippase, or phiC31 integrase) facilitates recombination, leading to DNA integration or cassette exchange, depending on the setup. Mix the donor and helper plasmids in a 500 to 200 ng/μL ratio. Filter or centrifuge the mixture before injection.

c. For CRISPR-mediated Gene Editing: Essential components include Cas9 protein (for DNA cleavage) and a guide RNA (gRNA) directing Cas9 to the target. Design gRNAs with minimal off-target effects using CRISPOR, CHOPCHOP, and Geneious bioinformatic tools. Cas9-induced double-stranded breaks can be repaired by non-homologous end-joining (NHEJ) or homology-directed repair (HDR), with the latter requiring a repair template (ssODN or linear dsDNA). Use recombinant Cas9 protein (300 ng/μL) and synthesized gRNAs (80 ng/μL) in injection buffer or plasmids expressing these components (see key resources table). For HDR, adjust template DNA concentration based on size and form; consider mutating the PAM sequence in the repair template to ensure knock-in efficiency.

Note: Filtration or centrifugation is crucial for removing particles that could block needles but may lead to plasmid DNA or RNA loss. Measure DNA/RNA concentration before and after to adjust initial amounts, ensuring desired concentrations in the final injection mix.

Preparation of egg collection plates

Timing: 2 h

6. D. suzukii females have a serrated ovipositor, allowing them to lay eggs inside soft-skinned fruit or artificial food. For egg collection, a transparent medium is optimal.a. We utilize grape-juice-agar plates for this purpose (Table 2), because eggs are easy to recognize and remove from those plates after egg laying.Table 2 Ingredients for the grape-juice-agar medium

Ingredients	Manufacturer	Final concentration	
VE water	N/A	700 mL/L	
Grape juice	Rewe Bio Roter Grape juice (100%)	300 mL/L	
Thread agar	Gewürzmühle Brecht, Germany	8 g/L	

b. Combine 8 g agar with 700 mL VE water in a 1 L glass beaker. Heat in a microwave until the agar dissolves, stirring occasionally to prevent overboiling. Use heat-protective gloves.

c. Place the beaker on a magnetic stirrer, carefully insert a magnetic stir bar, and stir until well mixed. Cool the mixture to 60°C–70°C while stirring.

d. Preheat 300 mL of 100% Bio grape juice to 50°C–60°C in the microwave (avoid boiling), then add it to the agar mixture. Continue stirring until fully integrated.

e. In a sterile environment, pour 20–25 mL of the grape-juice-agar mixture into each petri dish. Allow cooling at room temperature (RT) for 1 h.

f. Store the plates at 4°C for up to 3 months. Prewarm to RT before use for egg collection.

Preparation of injection documentation sheet

Timing: 10 min

7. A structured data collection sheet is recommended to facilitate the documentation of injection procedures. This sheet should include the following information.a. Insect strain: note the specific strain of insects used.

b. Injection date: Record the date when the injection was performed.

c. Injected component/plasmids (concentration): Detail the components or plasmids injected, including their concentrations.

d. Types of needles (pulling program): Specify the needle types, referencing the pulling program parameters.

e. Time for egg collection: Log the time spent on egg collection.

f. Dechorionation time: Note the duration of dechorionation.

g. Desiccation time: Record the time allocated for desiccation.

h. Number of injected eggs: Count the total number of eggs injected.

i. Eggs without leakage: Tally the eggs that did not leak post-injection.

j. Hatched larvae: Count the number of larvae that successfully hatched.

k. Injected insects (G0) with transient expression or somatic mutation: Record instances of transient fluorescent expression if a fluorescent marker is included in the donor plasmid, or somatic mutations if a phenotypical gene is targeted by the CRISPR system.

l. G0 pupae and adults: Count the number of individuals reaching pupae and adult stages.

m. Number of G0 individual or group crosses: Document the number of crosses, specifying if they were individual or group.

n. Number of fertile G0 flies: Count the fertile G0 flies.

o. Number of G0 crosses producing positive G1: Record the G0 crosses that resulted in positive G1 offspring.

p. Number of positive G1 individuals from each G0 cross: Tally the positive G1 individuals from each G0 cross.

Note: This comprehensive approach will support calculating the survival rates of injected flies and the genetic system's transmission rate, thereby aiding in the trouble-shooting, refinement and optimization of the injection process.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Chemicals, peptides, and recombinant proteins	
	
Recombinant Cas9 protein	PNA Bio	CP01-200	
	
Critical commercial assays	
	
mMESSAGE mMACHINE T7 Transcription Kit	Thermo Fisher Scientific	#AM1340	
MegaClear transcription clean-up kit	Thermo Fisher Scientific	AM1908	
HiScribe T7 Arca mRNA kit	NEB	#2060S	
HiScribe T7 High Yield RNA Synthesis Kit	NEB	E2040S	
	
Oligonucleotides	
	
Primer: pBac-mRNA-F: GAAACTAATACGACTCACTA
TAGGGAGAGCCGCCACATGGGTAGTTCTTTAGACGATG	This paper	N/A	
Primer: pBac-mRNA-R: CTTATTAGTCAGTCAGAAACAAC	This paper	N/A	
Primer: pBac-XhoI-F: ACGACCGCGTGAGTCAAAATGACG	This paper	N/A	
Primer: pBac-XhoI-R: ATCAGTGACACTTACCGCATTGACA	This paper	N/A	
Primer: pBac-NheI-F: CAGTGACACTTACCGCATTGACAAGCACGCCTCAC	This paper	N/A	
Primer: pBac-NheI-R: CCTCGATATACAGACCGATAAAACAC	This paper	N/A	
Primer: pBac-MspI-F: CTTTTATCGAATTCCTGCAGC	This paper	N/A	
Primer: pBac-MspI-R: CCTCGATATACAGACCGATAAAACAC	This paper	N/A	
	
Recombinant DNA	
	
pBS-hsp70-Cas9	Drosophila Genomics Resource Center	#1359	
pBS-vasa-Cas9	Drosophila Genomics Resource Center	#1340	
pBS-Hsp70-Cas9	Addgene	#46294	
pnos-Cas9-nos	Addgene	#62208	
pCFD1-dU6:1gRNA	Addgene	#49408	
pCFD1-dU6:2gRNA	Addgene	#49409	
pCFD1-dU6:3gRNA	Addgene	#49410	
pCFD4-U6:1_U6:3tandemgRNAs	Addgene	#123366	
	
Software and algorithms	
	
CRISPOR	Concordet and Haeussler	http://crispor.tefor.net/	
CHOPCHOP	Labun et al.	https://chopchop.cbu.uib.no	
Geneious Prime software and a CRISPR plugin	Kearse et al.	https://www.geneious.com	
	
Other	
	
Mediaclave	Integra, Switzerland	MC 10	
Needle puller	Sutter Instrument Co., USA	P-2000	
Micro-injector	Eppendorf	FemtoJet 4i	
Micro-manipulator	Narishige, Japan	MN 151	
Borosilicate capillaries	Science Products, Germany	GB100F-10 with filament	
Fine forceps	neoLab	2–1033 (0.1 mm)	
Halocarbon oil 700	Sigma-Aldrich	H8898-100ML	

Step-by-step method details

Preparing the injection station

Timing: 30 min

Follow these steps to effectively prepare for the injection process, which can commence during egg collection time.1. Loading the Needle.a. Load 1–3 μL of the injection mix into a needle using a microloader tip.

b. Mount the needle onto the micro-manipulator.

c. Open the needle as previously described in the “needle preparation” section.

2. Microscope Preparation.a. Place a glass slide with halocarbon oil 700 (Sigma-Aldrich) under the microscope.

b. Align and adjust the needle tip into the halocarbon oil, focusing on the needle tip with appropriate illumination.

c. Angle the needle holder downward (about 15°–30°) relative to the stage surface.

d. Ensure the tube connecting the needle to the pressure regulator is not kinked.

e. Apply high injection pressure (Pi > 3000 hPa) to expel air from the needle, visible as air bubbles emerging from the needle tip under the microscope. Once the liquid expels, indicating no air is left, switch the constant pressure (Pc) to a value that maintains a steady, slow liquid flow.

3. Preparation of Dechorionation and Injection Slides (preferably done the day before).a. For dechorionation slides, attach double-sided tape (about 1 × 2 cm) to a glass slide.

b. Cut the double-sided tape into small strips (approximately 0.1 × 2 cm) using a razor blade or scalpel for injection slides.

c. Use the razor blade or forceps to place a single strip in the center of a glass slide for egg placement during injection.

Note: If feasible, maintain the injection station's environment at 20°C–21°C to decelerate embryo development.

Egg collection

Timing: 30 min

To efficiently collect freshly laid eggs (<30 min old) for injection (see Methods video S1), follow these steps.4. Yeast Preparation: Mix brewer’s yeast with water in approximately a 1:1 ratio. Spread the freshly dissolved yeast in a small circle in the center of an egg collection plate to encourage egg-laying.

5. Fly Transfer.a. Briefly anesthetize flies in their vials using CO2.

b. Transfer 200–400 flies into an egg collection cylinder (15 cm high, 8.7 cm diameter) with an opening that fits the egg collection plate.

c. Secure the plate on top of the cylinder with tape.

d. Once flies regain consciousness, invert the cylinder so the plate faces upwards.

e. Conduct egg collection at 22°C–25°C and 45%–65% humidity.

6. Collection Plate Replacement.a. After 30 min, invert the cylinder and gently tap, e.g., on a soft table mats or white packaging foam, causing flies to fall to the mesh side without damaging equipment (see Methods video S2).

b. Quickly replace the plate with a new one and invert the cylinder again for subsequent collections.

Alternatives: If an egg collection cylinder is unavailable, large drosophila food vials (e.g., 175 mL volume) can substitute egg collection with smaller Petri dishes.

Methods video S1. "Egg Collection on Grape-Juice Agar Plate and a Plastic Cylinder", related to step 4

Illustrates the method for collecting eggs using a grape-juice agar plate and plastic cylinder.

Methods video S2. "Changing the Grape-Juice Agar Plate for Egg Collection", related to step 6

Showcases the replacing process for the grape-juice agar plates during egg collection.

Dechorionation and desiccation of eggs

Timing: 60 min

To prepare eggs no more than 2 h old for injection, follow these procedures.7. Harvesting Eggs (20 min).a. Under a microscope, focus on the agar surface of the collection plate.

b. Use forceps to carefully pick up each egg by its two distinctive white filaments (see Methods video S3). For dechorionation by forceps, transfer 50–100 eggs to the double-sided tape on a dechorionation slide. For dechorionation by bleach, clear the agar surface of yeast paste and deceased flies, and use forceps to gently move the eggs to the agar surface.

8. Dechorionation (30 min).a. By Forceps: Roll the egg on the tape with forceps under the microscope until the chorion membrane adheres to the tape and the egg is freed (see Methods video S4). Arrange the dechorionated eggs in a uniform orientation on the tape strip of the injection slide. The micropyle can identify the egg’s orientation at the anterior end. Avoid using old eggs, identifiable by cellularization or segmentation, as D. suzukii can lay fresh and nearly hatching eggs. The latter is only when rearing conditions are not optimal.

b. By Bleach: Use a 50 mL Falcon tube with gauze fabric (mesh size approximately 74 μm) as an egg dechorionator (Figure 1A). Collect the eggs on the agar surface in distilled water, and transfer them to the dechorionator. Submerge the dechorionator in a 50% bleach (50% Chlorix solution (2,86 g of hypochlorite per 100 mL) and 50% water) solution for 2.5 min, gently moving it up and down for efficient dechorionation. Rinse the eggs in freshly distilled water several times to remove bleach residue (Figure 1B). Eggs are then ready to be placed on the injection slide.Figure 1 Egg dechorionation steps

(A) Displays the egg dechorionator, a device constructed for efficiently removing the chorion layer from eggs using a bleach solution.

(B) Illustrates the steps involved in the bleach-based dechorionation protocol, including applying bleach and subsequent washing steps to ensure thorough cleaning without harming the eggs.

9. Desiccation (5–10 min).a. Depending on environmental conditions, allow the eggs to air-dry for 5–10 min. Modify the desiccation time during the injection: reduce the time if the embryos are overdried (Figure 2A), and increase the time if embryos always leak after pulling out the needle injection (Figure 2B).Figure 2 Examples of unusable embryos for injection

(A) Illustrates embryos that have dried out due to excessive desiccation.

(B) Shows an embryo that has leaked following injection, attributed to insufficient desiccation time.

(C) Displays an embryo at the early stages of cellularization, (D) an embryo at the late stages of cellularization, and (E) an older embryo with developed organs, collected as a result of D. suzukii’s facultative ovoviviparity, indicating these embryos are not suitable for injection.

b. Cover the eggs with halocarbon oil 700 and proceed with the injection.

Methods video S3. "Egg Harvest", related to step 7

Details the egg harvesting process.

Methods video S4. "Egg Dechorionation with Forceps and Tape", related to step 8

Shows the technique of dechorionating eggs using forceps and double-sided tape.

Microinjection

Timing: 30 min

To inject the mixture into the posterior end of eggs no more than 2 h old, ensuring minimal damage for high hatch and fertility rates, follow these steps under a microscope.10. Adjusting the Needle.a. Lift the needle from the halocarbon oil using the Z-axis control, creating enough space to switch the initial glass slide for the injection slide without contact.

b. Immerse the needle tip in the halocarbon oil on the injection slide and approach the first egg on the tape strip using the micro-manipulator’s X-, Y-, and Z-axis controls.

c. Align the needle with the egg’s posterior end and focus.

11. Testing the Needle and Injection Pressure.a. Test and fine-tune the pressure of the micro-injector by injecting the mixture into the halocarbon oil. The released mixture should be smaller than the embryo’s posterior end.

b. Carefully move the needle tip toward the embryo’s posterior side. Upon penetration, aim the tip towards the pole cell region (next to the posterior end) in the embryo.

c. Avoid inserting the needle too far into the embryo to prevent embryo fatality.

d. Apply pressure to observe the mixture forming a temporary “cloud” within the embryo tissue (see Methods video S5), indicating successful injection.

e. Gently withdraw the needle and check for embryo leakage before proceeding to the next egg.

12. Active Injection.a. Injection pressure varies significantly depending on the needle tip and the liquid mixture. Adjust the pressure so the “cloud” is always visible but without causing embryo leakage. Typically, pressures range from 500 to 1500 psi depending on the needle opening.

b. Inject only young embryos (2–3 h old) during embryonic cycles 9–13, targeting the stage when pole cell nuclei form buds in syncytial blastoderm and before cellularization. Avoid injecting cellularization stages.

c. Label the injected slides and store them in a petri dish with a lid (Figure 3A). Place black filter paper moistened with distilled water at the bottom to ensure suitable humidity for the injected eggs. Keep everything levelled, as any oil leakage from the injection slides will lead to loss of embryos due to desiccation.Figure 3 Incubation of injected embryos

(A) A Petri dish setup showing a black filter paper moistened with distilled water at the bottom to maintain appropriate humidity for the injected eggs and facilitate the identification of hatched larvae.

(B) An oxygen chamber setup with wet paper tissues at the bottom to sustain humidity levels during incubation, indicating the chamber should be filled with oxygen and sealed effectively to prevent leaks.

Methods video S5. "Microinjection of D. suzukii Eggs", related to step 11

Demonstrates the microinjection process for Drosophila suzukii eggs.

Egg hatching

Timing: 2 days

To recover larvae from injected eggs, follow these steps on the first and second day after injection.13. Egg Incubation.Optional: Prepare an oxygen chamber by placing a wet paper tissue at the bottom (Figure 3B). Transfer Petri dishes containing injected slides into the chamber and seal it tightly. Connect one tube from the chamber to an oxygen source for input and leave the other tube open as an exit. Initiate oxygen flow for about 5 s, then close the exit tube with a plastic clip. Close the input tube and turn off the oxygen supply. The chamber lid’s shape indicates air tightness: an apically curved lid signifies no leakage, while a flat lid suggests improper sealing.

a. Store the sealed oxygen chamber in a rearing incubator set at 22°C–25°C and 55%–60% humidity overnight. We observed that the oxygen chamber may slightly increase the hatching rates.

b. Alternatively, the plates with injection slides can be stored directly in a controlled environment without an oxygen chamber.

14. Larvae Collection.a. The following morning, open the oxygen chamber and inspect the injection slides under a microscope.

b. Use a fine brush (e.g., < 1 mm for the diameter of the brush body) to transfer hatched larvae onto wet filter paper to absorb excess halocarbon oil. Then, move the cleaned larvae into a food vial with a stirred food surface for easier larval entry.

c. Document the number of transferred larvae on the documentation sheet, ensuring fewer than 50 larvae are placed per vial to prevent overcrowding.

d. Return the Petri dishes to the oxygen chamber, reintroducing oxygen as previously described. Continue collecting larvae every 4–5 h throughout the day and the following day, which typically yields most larvae. While larvae are generally collected within two days, some may emerge on the third day.

15. Collection Based on Transient Expression: Larvae showing transient marker gene expression (s) can be identified under a fluorescence microscope for eggs injected with plasmids carrying a fluorescent gene cassette (Figure 4). This confirms the successful delivery of the injection mixture and allows for the selective grouping of these larvae into food vials for subsequent analysis or breeding.Figure 4 Transient fluorescent expression in embryos and larvae

(A) Depicts the arrangement of injected eggs on a glass slide with black filter paper underneath for enhanced visibility of transient fluorescent expression derived from marker genes (GFP and DsRed). Subsequent images show the varying patterns of expression among individual embryos. Panels show injected embryos (G0) under bright field (BF; A1), or GFP filter (A2), or GFP filter and higher magnification (A3).

(B) Shows newly hatched larvae with and without fluorescent expression. Notably, stronger transient fluorescent expression is often observed in the body part adjacent to the posterior end compared to the anterior end. Panels show a group of G0 first instar larvae under GFP (B1) or DsRed (B2) filter, or single G0 larvae under Dark field (DF; B3), GFP (B4) or DsRed (B5) filter.

Note: These steps ensure the efficient recovery and categorization of larvae post-injection, facilitating further developmental and genetic analysis.

G0 crossing and G1 screening

Timing: 3–4 weeks

This section outlines the recovery process for transgenic or mutant flies, highlighting the identification and breeding strategies for such individuals.16. Characterizing Injected Flies (G0): The presence of transgene-based transient expression or CRISPR-mediated mosaic mutations can be validated at specific developmental stages. The transient fluorescent expression is normally more pronounced at early larval stages than later stages. Adults (imago) are typically used to confirm mosaic mutation phenotypes, indicating successful Cas9/gRNA delivery.

17. Crossbreeding Injected Flies (G0): Based on transgenesis or mutagenesis efficiency, G0 flies may be crossed either individually or in groups with an excess of wild-type (WT) virgin flies, ideally at a 1:5 ratio, in small food vials. To ensure ample G1 offspring collection, flies should be relocated to fresh vials bi-daily over two weeks.

18. Screening Transgenic/Mutant G1 Flies: G1 flies carrying the transgene or mutation can be identified using (fluorescent) microscopy at appropriate developmental stages. The success rate of identifying such G1 flies depends on the number of pole cells in the G0 fly that incorporated the injected DNA. If the positive G1 can be identified before adult stage, it is preferable to collect them as virgins for downstream breeding.

19. Identifying Recessive or Phenotypically Neutral Mutations: Mutations that are recessive or lack visible phenotypic alterations can be pinpointed through non-lethal genotyping methods.11

Downstream works for transposon-mediated germ-line transformation

Timing: 1–2 months

20. Start from G1, follow these procedures for segregation analysis, breeding of the transgene allele into homozygosity, and genomic insertion verification.a. Segregation Analysis: backcross transgenic G1 flies to wild-type to analyze transgene segregation. This helps determine the chromosomal location of the transgene based on the proportion and sex ratio of fluorescent offspring, assuming a single insertion site (Figure 5).Figure 5 Transgene integration, segregation, and homozygous breeding scenarios

(A) Outlines a breeding strategy for a single autosome insertion, detailing the process from backcrossing transgenic G1 males with WT females to establishing a homozygous line by G4.

(B) Describes the procedure for a single X chromosome insertion, highlighting the differences in fluorescent intensity between heterozygous and homozygous females and the method to establish a hemizygous line.

(C) Details the strategy for a single Y chromosome insertion, where all fluorescent offspring develop into males, allowing for the confirmation and establishment of a Y-linked line by G2. Red letter A, X, and Y stands for the autosome, X and Y chromosome with transgene integration, respectively. The red, light red and light green body of the flies represent homozygous, heterozygous and WT phenotypes for the transgene, respectively.

b. Homozygous Breeding.i. Depending on the transgene’s chromosomal location, execute an appropriate breeding scheme (Figure 5).

ii. For transgenes under tissue-specific or ubiquitous promoters, differentiate between heterozygous and homozygous flies by comparing fluorescent intensity in specific tissues or whole body. For constitutive markers, third-instar larval stage is an ideal period for screening.

iii. Homozygous flies typically exhibit higher fluorescence intensity than heterozygous ones, facilitating their identification and selection for further breeding.

c. Insertion Site Verification.i. Perform inverse PCR to identify the transposon vector’s 5′ and 3′ flanking genomic insertion sites.

ii. Extract high-quality genomic DNA from homozygous flies and digest it with restriction enzymes (XhoI, MspI, NheI) overnight that do not cut within the transgene sequence.

iii. Precipitate and self-ligate restriction fragments at 16°C for 24 h.

iv. Conduct PCR on circularized fragments using specific primer pairs oriented in opposite directions within the transposable ends (see key resources table). Optimize PCR conditions for specificity and amplification efficiency.

v. If the initial PCR does not yield precise products, employ nested primers for a second PCR.

vi. Isolate PCR products, extract DNA from agarose gels, and subclone into vectors for sequencing. Compare the insert sequence to D. suzukii genomic sequences12,13 using BLAST for precise insertion site determination.

Note: These steps enable precise identification of the transgene's genomic insertion site and facilitate breeding homozygous transgenic lines, which is critical for ensuring stable trait expression and facilitating downstream functional analyses.

Downstream works for recombinase-mediated genome targeting

Timing: 1–2 months

21. Start from G1, follow these steps to breed the resulting allele into homozygosity and verify recombinase-mediated cassette exchange or integration events.a. Insertion Site Verification: The insertion site of the landing site line, established via transposon-mediated germ-line transformation, can be determined using the method from 19c. This involves inverse PCR to identify the flanking genomic sequences around the insertion site.

b. Despite the design for a single integration or double exchange events using landing sites, unintended recombination might occur.14 To detect exchange or integration events.i. Observe G1 flies for phenotypical changes indicative of recombination. Exchange events are inferred from substituting an existing marker in the landing site strain with a new marker from the recombination donor construct. In contrast, integration events are suggested by adding the recombination marker alongside the existing marker.

ii. Perform genomic PCR targeting landing site flanking sequences to confirm molecularly integration. Sequence the PCR products to identify the nature of the recombination event precisely.

c. Homozygous Breeding: G1 flies exhibiting recombination events should be bred to achieve homozygosity following the breeding approach from 19b. This typically involves selecting individuals showing the desired recombination marker and breeding them through successive generations to stabilize the trait.

Note: These methods allow for the meticulous verification of recombinase-mediated genetic modifications and the establishment of homozygous lines for further genetic studies or applications.

Downstream works for CRISPR-mediated gene editing

Timing: 1–2 months

22. Start from G0, consider the following guidelines to verify CRISPR-mediated mutation events and breed the mutation allele into homozygosity.a. Mutation Verification.i. To verify somatic mutations in G0 flies, perform genomic PCRs using primers flanking the gRNA target site. Subclone PCR fragments and sequence multiple clones.

ii. Quick detection of mutant alleles or separation from WT alleles in G0 flies can also be done using techniques such as the heteroduplex mobility assay (HMA), PCR/restriction enzyme (RE) assay, T7 endonuclease I (T7EI) assay, Surveyor nuclease assay, PAGE-based genotyping assay, high-resolution melting (HRM) analysis, and annealing at critical temperature PCR (ACT-PCR) assay.15,16

iii. To verify mutation events in G1 flies, perform similar genomic PCRs using G1 flies. Sequencing these amplicons will disclose the specific mutations induced.

b. Off-target Analysis.i. Given the potential for Cas nuclease to induce off-target mutations, analyze possible non-target interactions, considering factors like delivery methods, Cas variants, sgRNA sequence, and host species.

ii. Identify and genotype putative off-target sequences, focusing on sequences within 1–3 nucleotide mismatches in the PAM-proximal region of the guide sequence and having an NGG or NAG PAM sequence for detailed off-target analysis.

c. Homozygous Breeding.i. The breeding strategy to achieve homozygosity may mirror that described for transgenic flies, tailored to the chromosomal locations of the targeted sites.

ii. Cross G1 flies with autosome mutations individually to WT flies and, in the G2 generation, select mutant flies by phenotype or genotype. Inbreed G2 mutants from the same G1 parent and screen for homozygous mutants in the G3 generation.

iii. Homozygous mutants often exhibit more severe phenotypes than heterozygotes. If phenotypic differences are not discernible, employ non-lethal genotyping and identify mutation alleles via sequencing results.

Note: This approach ensures the precise identification of CRISPR-induced mutations and facilitates the systematic breeding of homozygous mutant lines for further genetic studies or applications.

Expected outcomes

This protocol delineates genetic engineering techniques, including transposon, recombinase, and CRISPR systems for targeting the invasive pest Drosophila suzukii. In piggyBac-mediated transformation, transgene cassettes less than 15 kb are routinely integrated into the genome with efficiencies ranging from 2% to 20%, as reported in various studies.1,10 For genome targeting using the CRE recombinase system, a 3.2 kb cassette was successfully exchanged into the landing-site line at a 20% efficiency.2 The CRISPR-mediated gene editing approach has shown mutagenesis efficiencies of up to 20% with the injection of Cas9 protein and significantly higher, up to 86%, when utilizing a hsp70-Cas9 strain.3,4,17 Beyond these applications, the injection protocol is also suitable for conducting in vivo transient analyses or RNAi experiments. The detailed steps for preparation, injection, screening, and breeding offer insights into genetic manipulation in D. suzukii and serve as a valuable reference for similar procedures in other insect species.

Limitations

The success rates of transgenesis, recombination, or mutagenesis in genetic engineering efforts, such as those targeting Drosophila suzukii, can be influenced by various factors, including the characteristics of the transgenes, exchange cassettes or knock-in templates (such as size and the potential toxicity of the protein product) as well as the efficiency of the transposase, recombinase, or Cas nuclease involved. When these factors lead to low success rates, injecting a larger number of embryos may necessitate. This increase in injections escalates the workload associated with subsequent processes like crossing, screening, breeding, and molecular analysis, presenting a considerable challenge.

To mitigate these challenges and enhance overall efficiency, it is critical to troubleshoot the injection process and optimize the functional components within the injection mixture. Adjusting the concentration of key elements, improving the stability of the injection mixture, and refining the injection techniques to minimize embryo mortality can lead to higher success rates. Moreover, developing more efficient screening and breeding strategies to identify successful genetic modifications quickly can significantly reduce the workload. Such optimization efforts are essential for advancing genetic engineering methodologies and achieving desired outcomes more efficiently.

Troubleshooting

Troubleshooting common issues in the genetic engineering process involves addressing challenges from egg collection to the injection phase. Here are summarized solutions for a few identified problems.

Problem 1

Flies don’t lay (enough) eggs on the injection day.

Potential solution

Ensure that 2–4-week-old flies are well-fed, fully grown, and have a balanced sex ratio. Optimize environmental conditions for egg collection within 22°C–25°C and 45%–65% humidity. Enhance egg-laying by adding watery brewer’s yeast to the collection plate or food vial, utilize sufficient flies, and minimize disturbances during collection.

Problem 2

The embryos are dried out (Figure 2A) or always leak after injection (Figure 2B).

Potential solution

Carefully adjust the desiccation time based on the injection site’s temperature and humidity to prevent embryos from drying out or leaking post-injection.

Problem 3

During the injection, embryos at the starting (Figure 2C) or ending (Figure 2D) phase of cellularization, or embryos with developed organs (Figure 2E) are found.

Potential solution

Limit the number of eggs per injection round to reduce the time needed for collection, dechorionation, and desiccation. Maintain the injection station’s environment at 20°C–21°C to slow embryo development. Since D. suzukii can lay developed eggs first, it’s essential to discard these older eggs before proceeding with injections.

Problem 4

During the injection, the needle tip is not sharp enough to go through the vitelline membrane.

Potential solution

Re-process the needle using recommended opening methods or replace it. Consult the needle puller manual (https://www.sutter.com/manuals/P-2000_OpMan.pdf) for guidance on crafting suitable needles.

Problem 5

The needle is too open and always causes damage or leakage of the embryos.

Potential solution

Replace the needle and refine the opening technique to minimize embryo damage and leakage.

Problem 6

The needles are often blocked and need to be replaced regularly.

Potential solution

Implement filtration or centrifugation of the injection mixture to eliminate particles that could obstruct the needle.

Addressing these specific challenges through targeted troubleshooting and optimization strategies can significantly improve genetic engineering efficiency and success rates in Drosophila suzukii or other model organisms.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dr. Ying Yan (Ying.Yan@agrar.uni-giessen.de).

Technical contact

Further information and requests for techniques and protocols should be directed to and will be fulfilled by the technical contact, Dr. Ying Yan (Ying.Yan@agrar.uni-giessen.de).

Materials availability

All materials can be purchased from the mentioned (or other) manufacturers.

Data and code availability

This study did not generate or analyze any data sets.

Acknowledgments

This work was supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) within project numbers 470105316 /YA 502/3-1 and Justus-Liebig-University Giessen with the JLU’s Student Assistant Fund in 2023 and 2024 (project numbers 60001166) to Y.Y. We are grateful for the exceptional technical support provided by Bashir Hosseini, particularly with the Drosophila suzukii embryonic microinjections. Our thanks also extend to Annemarie Scheld for her assistance in demonstrating the bleach-based dechorionation protocol.

Author contributions

Y.Y. performed the experiments. Y.Y. and M.F.S. wrote the manuscript. All authors have approved the manuscript.

Declaration of interests

The authors declare no competing interests.

Supplemental information can be found online at https://doi.org/10.1016/j.xpro.2024.103248.
==== Refs
References

1 Schetelig M.F. Handler A.M. Germline transformation of the spotted wing drosophilid, Drosophila suzukii, with a piggyBac transposon vector Genetica 141 2013 189 193 10.1007/s10709-013-9717-6 23564446
2 Schetelig M.F. Yan Y. Zhao Y. Handler A.M. Genomic targeting by recombinase-mediated cassette exchange in the spotted wing drosophila, Drosophila suzukii Insect Mol. Biol. 28 2019 187 195 10.1111/imb.12537 30187585
3 Yan Y. Ziemek J. Schetelig M.F. CRISPR/Cas9 mediated disruption of the white gene leads to pigmentation deficiency and copulation failure in Drosophila suzukii J. Insect Physiol. 126 2020 104091 10.1016/j.jinsphys.2020.104091
4 Yan Y. Kobayashi Y. Huang C. Liu B. Qian W. Wan F. Schetelig M.F. Highly efficient temperature inducible CRISPR-Cas9 gene targeting in Drosophila suzukii Int. J. Mol. Sci. 22 2021 6724 10.3390/ijms22136724
5 Ahmed H.M.M. Heese F. Wimmer E.A. Improvement on the genetic engineering of an invasive agricultural pest insect, the cherry vinegar fly, Drosophila suzukii BMC Genet. 21 2020 139 10.1186/s12863-020-00940-5 33339511
6 Kandul N.P. Belikoff E.J. Liu J. Buchman A. Li F. Yamamoto A. Yang T. Shriner I. Scott M.J. Akbari O.S. Genetically encoded CRISPR components yield efficient gene editing in the invasive pest Drosophila suzukii CRISPR J. 4 2021 739 751 10.1089/crispr.2021.0032 34661429
7 Yan Y. Hosseini B. Scheld A. Pasham S. Rehling T. Schetelig M.F. Effects of antibiotics on the in vitro expression of tetracycline-off constructs and the performance of Drosophila suzukii female-killing strains Front Bioeng Biotech 11 2023 876492 10.3389/fbioe.2023.876492
8 Miller D.F.B. Holtzman S.L. Kaufman T.C. Customized microinjection glass capillary needles for P-element transformations in Drosophila melanogaster Biotechniques 33 2002 366 367 10.2144/02332rr03 12188189
9 Schetelig M.F. Schwirz J. Yan Y. A transgenic female killing system for the genetic control of Drosophila suzukii Sci. Rep. 11 2021 12938 10.1038/s41598-021-91938-1
10 Häcker I. Rehling T. Schlosser H. Mayorga-Ch D. Heilig M. Yan Y. Armbruster P.A. Schetelig M.F. Improved piggyBac transformation with capped transposase mRNA in pest insects Int. J. Mol. Sci. 24 2023 15155 10.20944/preprints202308.2202.v1
11 Carvalho G.B. Ja W.W. Benzer S. Non-lethal PCR genotyping of single Drosophila Biotechniques 46 2009 312 314 10.2144/000113088 19450239
12 Chiu J.C. Jiang X. Zhao L. Hamm C.A. Cridland J.M. Saelao P. Hamby K.A. Lee E.K. Kwok R.S. Zhang G. Genome of Drosophila suzukii, the spotted wing drosophila G3 (Bethesda) 3 2013 2257 2271 10.1534/g3.113.008185 24142924
13 Paris M. Boyer R. Jaenichen R. Wolf J. Karageorgi M. Green J. Cagnon M. Parinello H. Estoup A. Gautier M. Near-chromosome level genome assembly of the fruit pest Drosophila suzukii using long-read sequencing Sci. Rep. 10 2020 11227 10.1038/s41598-020-67373-z
14 Häcker I. Harrell Ii R.A. Eichner G. Pilitt K.L. O'Brochta D.A. Handler A.M. Schetelig M.F. Cre/lox-recombinase-mediated cassette exchange for reversible site-specific genomic targeting of the disease vector, Aedes aegypti Sci. Rep. 7 2017 43883 10.1038/srep43883
15 Wang K. Hiruki C. Heteroduplex mobility assay detects DNA mutations for differentiation of closely related phytoplasma strains J. Microbiol. Methods 41 2000 59 68 10.1016/S0167-7012(00)00137-8 10856778
16 Hua Y. Wang C. Huang J. Wang K. A simple and efficient method for CRISPR/Cas9-induced mutant screening Journal of Genetics and Genomics 44 2017 207 213 10.1016/j.jgg.2017.03.005 28416245
17 Kalajdzic P. Schetelig M.F. CRISPR/Cas-mediated gene editing using purified protein in Drosophila suzukii Entomol. Exp. Appl. 164 2017 350 362 10.1111/eea.12599
