
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00730-2
10.1016/j.psj.2024.104151
104151
IMMUNOLOGY, HEALTH AND DISEASE
The synergy effect of matrine and berberine hydrochloride on treating colibacillosis caused by an avian highly pathogenic multidrug-resistant Escherichia coli
Meng Jinwu
Wang Weiran
Ding Jinxue
Gu Bolin
Zhou Fanting
Wu Desheng
Fu Xiang
Qiao Mingyu
Liu Jiaguo liujiaguo@njau.edu.cn
1
MOE Joint International Research Laboratory of Animal Health and Food Safety and Traditional Chinese Veterinary Medicine Research Center, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, PR China
1 Corresponding author: liujiaguo@njau.edu.cn
31 7 2024
10 2024
31 7 2024
103 10 10415111 4 2024
27 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Infection by multidrug-resistant avian pathogenic Escherichia coli (APEC) in chickens always leads to the uselessness of antibiotics, highlighting the need for alternative antibacterial agents. Sophora flavescens and Coptis chinensis have been a classical combination used together in Traditional Chinese Medicine (TCM) formulas to treat diseases with similar symptoms to colibacillosis for an extended period, but the effect of their active ingredients' combination on APEC infection remains unstudied. The objective of this study was to explore the synergistic effect of matrine and berberine hydrochloride on colibacillosis caused by an isolated multidrug-resistant APEC. In this study, a highly pathogenic E. coli was isolated from the liver of a diseased chicken in a farm suspected of colibacillosis, and it was resistant to multiple antibiotics. The LD50 of the strain was approximately 3.759×108 CFU/mL. The strain harbored several antibiotic resistance genes and virulence genes. Matrine and berberine hydrochloride have synergistic antibacterial effect against the isolated strain in vitro. The combined use of matrine and berberine hydrochloride exhibited synergistic effects in the treatment of APEC infection by regulating the organ indices, improving the pathological situation, decreasing the bacterial load, and regulating the inflammatory factors to enhance the survival rate of chickens in vivo. These results provided a foundation for revealing the effective effects and possible mechanisms of matrine and berberine hydrochloride as potential antimicrobial agents on diseases caused by multidrug-resistant APEC in chickens.

Key words

Escherichia coli
resistance
matrine
berberine hydrochloride
anti-bacterial effect
==== Body
pmcINTRODUCTION

Avian pathogenic Escherichia coli (APEC) are prevalent pathogenic bacteria in the poultry industry, capable of inducing systemic infection and distinctive fibrous lesions such as polyserositis, septicemia, and primarily extra-intestinal diseases in chickens(Dho-Moulin and Fairbrother, 1999; Fancher et al., 2020). APEC infection often leads to high mortality rates among chickens, while survivors experience compromised weight gain, reduced feed conversion efficiency, diminished egg production, and decreased hatching rates during subsequent rearing stages(Ghunaim et al., 2014; Galal et al., 2018).

Several virulence factors contribute to the pathogenicity of APEC strains, such as including a wide range of structural (fimbriae, pili, curli, flagella) and secreted components (toxins, iron-acquisition systems)(Croxen and Finlay, 2010; Kathayat et al., 2021; Pakbin et al., 2021). Notably, virulence genes related to these virulence factors play crucial roles in various aspects of APEC infection. For instance, fimC, tsh, papA, focG, and flgE are implicated in adhesion mechanisms, colonization efficiency, biofilm formation ability, motility properties and intracellular survival capacity of APEC strains(Jones et al., 1993; Kobayashi et al., 2010). Moreover, Vat, sta, stx1, stx2, hlyA, pic, and espC could induce cell lysis and damage, induce host cell vacuolization, colonization, motility, biofilm formation, agglutination, formation of outer membrane vesicles(Koronakis et al., 1988; Spurbeck et al., 2012; Melton-Celsa, 2014). IutA, iucD, aerJ, iucA, iucB, iroN, fyuA, and irp2 participate in efficient uptake of iron and manganese from the host(Chouikha et al., 2008; Tuntufye et al., 2012).

Antibiotics have been employed as the primary strategy for preventing or treating APEC infections. However, prolonged usage or misuse of antibiotics has resulted in the emergence and selective advantage of antibiotic-resistant bacteria, thereby impeding their effectiveness(Han et al., 2020). Currently, drug resistance is escalating significantly, with multidrug resistance becoming increasingly prevalent(Croxen and Finlay, 2010; Wang et al., 2020b). In a study investigating genetic determinants associated with antibiotic resistance in APEC, 10 strains isolated from Egyptian broiler farms exhibited high levels of resistance to ampicillin, tetracycline, naphthyric acid, and chloramphenicol. Furthermore, several resistant genes were identified including dfrA1, aadA1, aadA23, tetA, tetB,blaTEM, aphA1, sul1(Awad et al., 2016). The presence of these antibiotic-resistant genes contributes to the dissemination and propagation of antibiotic resistance. The profound drug resistance observed among these foodborne pathogens poses a significant threat to human health since many bacteria are zoonotic pathogens capable of transferring their resistant genes horizontally to human pathogenic bacteria. Therefore, relevant efforts should be made to explore novel therapeutic agents for the management of infection diseases in food animals.

Traditional Chinese Medicine (TCM) has long been utilized for the treatment of infectious diseases. For instance, the combination of Sophora flavescens and Coptis chinensis in formulas like "Huang Lian Ku Shen decoction" and "Huang Lian Shen Mai Yin" has been traditionally employed to address "Shi Re" in both humans and animals(Wang et al., 2003; Wang et al., 2020a). According to TCM theory, Sophora flavescens and Coptis chinensis are all representative drugs for clearing heat and drying dampness, and their combination could enhance each other's effectiveness(He et al., 2015). Matrine isolated from Sophora flavescens exhibits antibacterial activity against various bacterium, including Acinetobacter baumannii, Mycobacterium tuberculosis, and Streptococcus agalactiae(Kan et al., 2020; Li et al., 2022; Zhang et al., 2023). The extract derived from Coptis chinensis exhibits potential in preserving intestinal barrier integrity by modulating intestinal flora imbalance and suppressing inflammatory responses in ulcerative colitis rats(Xie et al., 2022). Previous studies have demonstrated diverse pharmacological activities of berberine extracted from Sophora flavescens, including hypoglycemic, antibacterial, antioxidant, anti-inflammatory, anti-tumor, blood lipid regulation, and antiarrhythmic effects(Lv et al., 2023). Nevertheless, the therapeutic role and underlying mechanisms of the combined active constituents from Sophora flavescens and Coptis chinensis against APEC-induced diseases remain to be elucidated.

In 2018, a suspected outbreak of colibacillosis occurred in a chicken farm located in Anhui province, China, resulting in a significant morbidity and mortality rate among the chickens. Despite the administration of multiple antibiotics, the desired therapeutic effect was not achieved. Therefore, the pathogen causing the disease was isolated, identified and analyzed. In this study, a highly pathogenic and multidrug-resistant E. coli (MDREC) from diseased chicken in a commercial chicken farm was isolated. Multiple antibiotic resistance genes and virulence genes were observed in this strain. Matrine and berberine hydrochloride showed a synergistic effect on treating the colibacillosis caused by this strain in vivo through decreasing the bacterial load and regulating the inflammatory factors. This study provided a foundation for revealing the effective effects and possible mechanisms of matrine and berberine hydrochloride as potential antimicrobial agents on diseases caused by MDREC.

MATERIALS AND METHODS

Chemical Reagents and Bacterial Strains

The Luria-Bertani (LB) medium, Nutrient Agar medium, Maconkey Agar medium, and Eosin-Methylene Blue Agar medium were purchased from Qingdao Haibo Biotechnology Co., Ltd. The Gram-staining kit was purchased from Beijing Solarbio Science and Technology Co., Ltd. The DNA extraction kit and ELISA kits (IL-1β, IL-6, and TNF-α) were purchased from Nanjing Aogene Biotechnology Co., Ltd. The antibiotic disks were purchased from Hangzhou Binhe Microbial Reagent Co., Ltd. The DNA ladder markers (2000 bp) were purchased from Nanjing SinoMol Biotechnology Co., Ltd. The matrine (≥ 98%) was purchased from Shanghai Yuanye Bio-Technology Co., Ltd. The berberine hydrochloride (≥ 98%) was purchased from Sa'en Chemical Technology (Shanghai) Co., Ltd. The cefotaxime sodium for injection was purchased from Hefei Dubang Biopharmaceutical Co., Ltd.

The standard strain ATCC 25922 was stored at –80 °C in the laboratory. The isolated E. coli was isolated from a sick chicken collected from a chicken farm in Anhui province. Both strains were cultured in LB broth with shaking of 180 rpm/min at 37°C.

Isolation and Purified Culture

The liver of a diseased chicken was collected following the specified guidelines for collecting pathological materials, and the pathogen responsible for this disease was isolated through liver homogenate coated on nutrient agar plates. Subsequently, a single colony was selected and cultured in LB Medium after purification. Following incubation at 37°C for 18 h, the isolate was initially identified based on colony morphology. A single colony with good growth condition was picked up and stained with a gram stain kit according to the provided instructions. The operation steps follow the instructions of the kit. After staining, morphological characteristics of the isolated bacteria were observed under a light microscope (Nikon E100, Japan).

Biochemical Examinations

The isolated strain was further identified through biochemical assays, including sugar fermentation tests, indole test, MR and VP tests, citrate test, and motility test. The basic mediums for sugar fermentation were made up according to the following formula: 10.0 g of peptone, 5.0 g of beef extract, 3.0 g of sodium chloride, 2.0 g of disodium hydrogen phosphate, and 0.024 g of bromthymol blue in 1 L ddH2O. After dissolution, it was divided and supplemented with 0.5% (w/v) glucose, lactose, maltose, mannitol and sucrose, respectively. Other biochemical tubes were purchased from Qingdao hopebio Biotechnology Co., LTD., and used according to the instructions.

PCR of 16S rRNA Gene Sequences and Sequence Analysis

A single colony of the isolate was picked into LB medium and cultured at 37°C for 10 h. The DNA of the isolate was extracted following the instructions provided by the DNA extraction kit. Molecular identification of the isolate was conducted based on the nucleotide sequence analysis of 16S rRNA, and the sequences of universal primers were 27F: AGAGTTTGATCCTGGCTCAG and 1492R: TACGACTTAACCCCAATCGC. The target gene was amplified with synthetic primers using the extracted DNA as a template. PCR amplification was performed as follows: initial denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s. The amplification products were resolved in 1% agarose gel, purified by the product purification kit, and sequenced by Sangon Biotech (Shanghai) Co., Ltd. The obtained sequences were compared with the nucleic acid data in GenBank by online blast program (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 21 April 2021) and the phylogenetic tree was created by MEGA 7.0.

Animal Regression Test and Pathogenicity Assessment

Sixty healthy one-day-old chickens were purchased from Nanjing Tegeili planting professional cooperatives in Nanjing, Jiangsu province, China. After 7 d of feeding, the chickens were divided into 5 groups as shown in Table 6: five E. coli infection groups (OD600nm = 2.010, 1.498, 0.929, 0.498, and 0.253, respectively) and blank control (BC) group. The bacterial amount could calculated according to Figure S1. After cultivation for 10 h, the bacterial suspension was centrifuged and washed three times with sterile normal saline to remove the culture solution and metabolic waste. The precipitate was then resuspended with sterile normal saline and diluted to different concentrations. Bacterial suspensions at different concentrations (0.25 mL) were intraperitoneally inoculated into the infection groups of chickens, while an equal volume of normal saline was injected into the BC group chickens. The mortality rate was monitored every 12 h until no further deaths occurred in the infected group during two consecutive observation time points. Upon death of an infected chicken, various organs including liver, heart, spleen, lung, and kidney were aseptically removed and suspended in sterile PBS for bacterial testing. Pathogens were subsequently isolated and identified through morphological examination, microscopic analysis, biochemical characterization, and PCR identification.

Antibiotics Susceptibility Test

The antimicrobial susceptibility of the isolate was determined using the K-B drug-sensitive disk method provided by the Clinical and Laboratory Standards Institute (CLSI, 2018; Humphries et al., 2021). After cultured at 37°C for 10h, the bacterial suspension was diluted to 1 × 108 CFU/mL and coated on the surface of Mueller-Hinton Agar (MHA) plates. Subsequently, disks containing various antibiotics were applied onto the prepared plates. The plates were then incubated at 37°C for 18h. The diameters of zones without visible bacterial growth were measured and compared with the standard values from CLSI and the instructions. Quality control was performed using standard strain ATCC25922.

PCR Detection of Antibiotic-Resistant Genes and Virulence Genes

Based on the published resistance and virulence genes of E. coli, primers were designed using Primer 6.0 software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information for each primer is shown in Tables 1 and 2. The PCR procedure was conducted as previously described, followed by electrophoresis of the resulting PCR products on a 1% agarose gel to compare their sizes with those of target genes using standard DNA ladder markers.Table 1 The information on the antibiotic-resistant gene sequences used to draw the primers.

Table 1Gene		Primer sequence (5′ to 3′)	Gene placement	Size (bp)	Gene bank Acc. No.	
BlaSHV	F	CTATCGCCAGCAGGATCTGG	5828-5809	543	OQ658192.1	
R	ATTTGCTGATTTCGCTCGGC	5286-5305	
BlaCTX-2	F	GGAAGACTGGGTGTGGCATT	122262-122243	574	CP124467.1	
R	TATCCCCCACAACCCAGGAA	121689-121708	
BlaTEM	F	TCCTTGAGAGTTTTCGCCCC	23058-23039	634	CP134933.1	
R	TGACTCCCCGTCGTGTAGAT	22425-22444	
ermA	F	GCACAAAGCGACTACAACCG	3431723-3431742	359	CP006027.1	
R	AAGTTGGCATCCACCCACAT	3432081-3432062	
ermB	F	AAGCCATGCGTCTGACATCT	8641-8622	309	CP135503.1	
R	TTGGCGTGTTTCATTGCTTGA	8333-8353	
aadA1	F	GTACCAAATGCGGGACAACG	87956-87975	542	CP135246.1	
R	AGGTAGTTGGCGTCATCGAG	88497-88478	
aac(6′)-Ⅰb	F	TGCGATGCTCTATGAGTGGC	4633-4652	360	LC771587.1	
R	GGGTCCGTTTGGATCTTGGT	4992-4973	
aph(3′)- Ⅱα	F	TGACTGGGCACAACAGACT	52286-52268	717	CP134921.1	
R	TCAAGAAGGCGATAGAAGGC	51570-51589	
rmtB	F	TCCCCCAAACAGACCGTAGA	16430-16359	547	CP135503.1	
R	AGTTCGCCTCCATGCCTTTT	16886-16867	
armA	F	TGGGGGTCTTACTATTCTGCC	113826-113846	509	CP064006.1	
R	TCCATTCCCTTCTCCTTTCCAG	114334-114313	
qnrS	F	GGCACCGCAACTTTTCACAT	67905-67924	489	OR509737.1	
R	ATTGCCCCCAGACATCTTCG	68393-68374	
qepA	F	CGTTATTCGCATTCGCCTCG	77069-77088	1200	CP125007.1	
R	CCACCAGCACCAGCACC	78268-78252	
oqxA	F	CATACCAACCTCGTCTCCCG	665185-665204	687	CP125885.1	
R	GACGATGACGCTATCCCCAG	665871-665852	
TetA	F	CAGGCAGAGCAAGTAGAGGG	15532-15551	378	CP135672.1	
R	ATTCTGCATTCACTCGCCCA	15909-15890	
TetB	F	TTTCGCCCCATTTAGTGGCT	75268-75249	708	CP127266.1	
R	TCGCTAACCACTTTGGCGTA	74561-74580	
TetC	F	GGAGCCACTATCGACTACGC	12192-12173	748	AP027168.1	
R	CGTCATCTACCTGCCTGGAC	11445-11464	

Table 2 The information on the virulence gene sequences used to draw the primers.

Table 2Gene		Primer sequence (5′ to 3′)	Gene placement	Size (bp)	Gene bank Acc. No.	
fimC	F	GCCGATGGTGTAAAGGAT	4659625-4659642	337	CP107281.1	
R	CCGTCAGGTAATAGGGTGT	4659961-4659943	
Tsh	F	ACGGTCAATAATGAACTCG	55273-55255	488	CP134367.1	
R	CAGGAATATGCACCTCCC	54786-54803	
eaeA	F	CAGGAGCACAATGCGTCTTC	58-77	591	U38618.1	
R	ACCAGGTCCAGCCTTCATCA	648-629	
Vat	F	TCCTGGGACATAANGGTCAG	3650453-3650472	978	CP134905.1	
R	GTGTCAGAACGGAATTGT	3651430-3651413	
yijp	F	GCGTGAATACGACACCAACG	1763-1782	773	AF112861.1	
R	AACATTGCGACCTTGTATTGCC	2535-2514	
Stx1	F	TTCCATGACAACGGACAGCA	1468328-1468347	830	CP060997.1	
R	ATCCTGAACCTGACGCACAG	1469157-1469138	
Stx2	F	GGCACTGTCTGAAACTGCTCC	19748-19728	255	CP133131.1	
R	TCGCCAGTTATCTGACATTCTG	19494-19515	
Lt	F	GGTTTCTGCGTTAGGTGGAA	24459-24440	605	CP122717.1	
R	GGGACTTCGACCTGAAATGT	23855-23874	
Sta	F	GAAACAACATGACGGGAGGT	1777-1758	229	CP122724.1	
R	GCACAGGCAGGATTACAACA	1549-1568	
colV	F	ACGGATGCTCAGTTTCT	3088-3104	307	CP134661.1	
R	TGTGCTTGGCGTCATAG	3394-3378	
ompA	F	CCCATGAAAACCAACTGGGC	1116145-1116126	845	CP107281.1	
R	GATCTCTACGCGACGATCCG	1115301-1115320	
Iss	F	AGCAACCCGAACCACTTGAT	28819-28800	615	CP134661.1	
R	AACAGTGCAGATGAGCTCCC	28205-28224	
hlyA	F	AGATCATCCCCCTCTCCACC	81694-81675	780	CP122592.1	
R	GAAGGGGGTTCAGGACAAGG	80915-80934	
iroN	F	AATCCGGCAAAGAGACGAACCGCCT	59151-59127	553	OM735810.1	
R	GTTCGGGCAACCCCTGATTTGACTTT	58599-58624	
iucD	F	AGTTCTATCGCTTCCTTAC	9462-9444	400	OM735810.1	
R	GAGACCCAGTTTATTTCC	9063-9080	
iutA	F	GGCTGGACATCATGGGAACTGG	163402-163381	302	CP135211.1	
R	CGTCGGGAACGGGTAGAATCG	163101-163121	
Irp2	F	CGCGAGCGGCTCATACAGG	754755-754773	236	CP135709.1	
R	TCGTCGGGCAGCGTTTCT	754990-754973	
fyuA	F	ACCGTTATCGCCATTCTG	1946887-1946870	235	CP135458.1	
R	CTGTGAAGTCTGGGCATTAG	1946654-1946673	

Minimal Inhibit Concentrations of Drugs

The MICs of several antibiotics, matrine, and berberine hydrochloride against the isolate were determined by the continuous broth micro-dilution method by CLSI guidelines (CLSI, 2018). The bacterial suspension was diluted with MHB to 2 × 105 CFU/mL. 50 μL serial dilutions of drugs and 50 μL diluted bacterial suspension were added to the wells of 96-well plates, followed by incubating with shaking of 120 rpm/min at 37°C for 18 h. MICs were defined as the absence of visible turbidity in the well. The results were compared with that obtained from the standard strain ATCC25922, and each experiment was conducted at least 3 times.

Antibacterial Activity of Matrine Combined With Berberine Hydrochloride

The inhibitory effect of the combination of matrine and berberine hydrochloride on isolated bacteria was determined by checkerboard microdilution method. In brief, different concentrations of matrine solution (25 μL) were added to each row of a 96-well plate, while different concentrations of berberine hydrochloride solution (25 μL) were added to each column. Subsequently, 50μL bacterial solution was added to each well, resulting in a final concentration of isolated bacteria at 1 × 106CFU/mL. After sample addition, the 96-well plate was cultured with shaking of 120 rpm/min at 37°C for 18 h. The results were expressed as fractional inhibitory concentration index (FICI). by calculating with the formula: FICI = MICAB/MICA + MICBA/MICB (MICAB is the MIC value of drug A after the combined action of the two drugs; MICA is the MIC value of drug A acting alone. MICBA is the MIC value of drug B after the combination of the two drugs; MICB is the MIC value of drug B acting alone).

Synergy Antibacterial Effect of Matrine and Berberine Hydrochloride in Vivo

360 chickens were purchased from Nanjing Tegeili Planting Professional Cooperative and fed in Experimental Animal Center of Nanjing Agricultural University. Following 7 d adaptive breeding, the chickens were randomly allocated into 6 groups: the blank control (BC) group, the E. coli control (EC) group, the matrine treatment (Mat) group, the berberine hydrochloride treatment (Ber) group, the combination of matrine and berberine hydrochloride treatment (Mat + Ber) group, and the cefotaxifur sodium treatment (CS) group. The chickens in the BC group were kept separately from the chickens in the infected groups. The chickens were intraperitoneally injected with 0.25 mL of MDREC bacterial suspension at a concentration of 7.38 × 108 CFU/mL, except for the BC group, which received an equivalent volume of normal saline. The chickens in the Mat group received subcutaneous injection of matrine (0.5 mg/kg/d), in the Ber group received berberine hydrochloride (0.02 mg/kg/d), in the Mat + Ber group received Mat + Ber (0.5 mg/kg/d matrine and 0.02 mg/kg/d berberine hydrochloride), and in the CS group received 0.1 mg/feather/d, whereas both the EC and BC groups were given subcutaneous injections of an equivalent volume of normal saline.

After infection, chicken mortality was observed every 6 h till 60 h, when no deaths were recorded in two observation points and the overall health of surviving chickens returned to normal. At 10 and 58 h post-inoculation with bacteria, 6 chickens were selected randomly and anesthetized with CO2. Blood samples were collected from the carotid artery, incubated at 37°C for 30 min, and centrifuged at 3000 rpm/min for 10 min to obtain the serum. The levels of IL-6, IL-1β, and TNF-α in serum were measured following the instructions of the ELISA kits. The liver, heart spleen, lung, and kidney were collected, weighed, and divided. Part of the organs were homogenized in sterile normal saline with two grading beads, diluted by ten-fold serial dilution, and then plated on the surface of MAC plates to enumerate bacterial count after cultured at 37°C for 18 h. The bacterial load in each organ was normalized to grams of tissue. A portion of the liver and spleen were fully fixed with 4% paraformaldehyde, followed by histopathological examination with hematoxylin-eosin staining.

Compliance With Ethical Standards

The animal research and facilities were carried out according to the experimental practices and standards. All experimental protocols were approved by the Laboratory Animal Center of Nanjing Agricultural University (IACUC2020076).

Statistical Analysis

The statistical results were expressed as mean ± standard deviation. Data analysis was performed using IBM SPSS Statistics 19.0 software (IBM Corporation, Armonk, NY). The survival rate was assessed by the chi-square test. The median lethal dose (LD50) of the isolated strain was calculated through the probability Unit Weighted Regression Method (Bliss Method). Differences among groups were analyzed by one-way ANOVA and Duncan's multiple range test. P < 0.05 was considered as statistically significant difference.

RESULTS

Purification and Morphological Characteristics

The pathogen responsible for the disease was isolated by inoculating a suspension of liver tissue onto an LB agar plate. Numerous colonies with consistent size and shape were observed on the LB agar plates (Figures 1A-1C). Round, smooth, moist and slightly raised red colonies appeared on McConkey agar medium (Figure 1D). The colonies grown on Eosin-Methylene Blue Agar plate were blackish and mildly metallic, indicative of lactose-fermenting bacteria that stained positively red due to methylene blue binding (Figure 1E). On nutrient agar medium, the surface is smooth and shiny, and the colony edge is neat, wet and white (Figure 1F). After Gram-staining, red, uniform coloring, single or paired, capsule-free Gram-negative bacteria were seen under a light microscope (Figure 1G).Figure 1 The isolation and identification of the pathogeny. (A-C) Results of liver tissue suspension coating on LB Agar plate. (A: Dilute at 1:10; B: Dilute at 1:100; C: Dilute at 1:1000). (D-F) Characteristics of the colony on different mediums (D: Maconkey Agar medium; E: Eosin-Methylene Blue Agar medium; F: Nutrition Broth Agar medium). (G) Classic morphology of isolates in the light microscope (×1000). H: PCR of 16S rRNA of the isolated strain. (M: Marker, 1-3: the strip of the isolated strain, 4: negative control). I: Phylogenetic tree analysis of isolate. The tree was constructed using the Neighbor-Joining method based on the gene 16S rRNA. The sequence of the isolate was determined in this study. Gen Bank accession numbers were displayed behind the strain.

Figure 1

Biochemical Identification

The isolate exhibited the ability to ferment various sugars, including glucose, lactose, maltose, mannitol, and sucrose, resulting in the production of acid and gas. In the indole test, the isolate could decompose Tryptophan in the medium to produce indole. It was positive for MR, negative for VP test and citrate test. In the semi-solid agar, cloud-like turbid growth was observed along the puncture line indicating its motility (Figure 2).Figure 2 Biochemical identification of the isolated strain. (A-E) Sugar fermentation test. (A: glucose. B: lactose. C: maltose. D: mannitol. E. sucrose). F: Indole test. G: MR test. H: VP test. I: Citrate test. J: semi-solid agar test.

Figure 2

Phylogenetic Analysis of 16S rRNA Gene Sequence

To genetically classify the isolated strain, molecular methods were employed. The DNA of the isolate was extracted and PCR products of expected size were obtained after PCR with bacterial 16S rRNA gene sequence-specific primers. The agarose gel electrophoresis and DNA sequence showed that the 1445bp gene was amplified (Figure 1H). The resulting PCR sequence was compared to sequences in NCBI using BLAST program, and phylogenetic analysis revealed that the isolate belonged to E. coli (Figure 1I). Finally, the sequence was deposited in NCBI with GenBank accession number OQ600604.1.

Susceptibility Assessment

To further elucidate its biological characteristics, susceptibility testing was conducted on this isolated strain using 20 different antibiotics from 9 categories. Among the tested antibiotics, the isolated strain exhibited sensitivity only to ceftriaxone, cefotaxime, cefepime, amikacin, fosfomycin, and chloramphenicol. However, it displayed resistance to most antibiotics including ampicillin, amoxicillin, gentamicin, streptomycin, ciprofloxacin, norfloxacin, ofloxacin, levofloxacin, sulfisoxazole compound, rifampicin, tetracycline, and erythromycin (Table 3). These findings unequivocally demonstrate that the isolated strain is a multidrug-resistant E. coli (MDREC) variant with resistance observed against 12 out of the 20 tested antibiotics.Table 3 Drug susceptibility of the isolated bacteria. (n ≥ 3).

Table 3Antibiotics	Drug contents (μg/piece)	Criteria for inhibition zone (mm)	Measured inhibition zone (mm)	Results	
Resistance (R)	Intermediate (I)	Sensitivity (S)	
β-lactams							
 Ampicillin	10	11	12-14	15	6.35	R	
 Amoxicillin	20	13	14-16	17	6.35	R	
 Ceftriaxone	30	13	14-22	23	30.83 ± 0.29	S	
 Cefotaxime	30	14	15-21	22	30.88 ± 1.55	S	
 Cefepime	30	18	19-24	25	27.75 ± 0.35	S	
Aminoglycosides							
 Gentamicin	10	12	13-14	15	6.84 ± 0.52	R	
 Kanamycin	30	13	14-17	18	15.00 ± 0.71	I	
 Streptomycin	10	11	12-14	15	9,40 ± 2.33	R	
 Amikacin	30	14	15-16	17	18.83 ± 1.89	S	
Quinolones							
 Ciprofloxacin	5	15	16-20	21	11.30 ± 1.15	R	
 Norfloxacin	10	12	13-16	17	9.63 ± 1.55	R	
 Ofloxacin	5	12	13-15	16	8.83 ± 0.29	R	
 Levofloxacin	5	13	14-16	17	10.50 ± 1.32	R	
Sulfamides							
 Sulfisoxazole	300	12	13-16	17	6.35	R	
 Compound Sulfamethoxazole	1.25/23.75	10	11-15	16	6.35	R	
Rifampicin	5	16	17-19	20	8.75 ± 0.35	R	
fosfomycin	200	12	13-15	16	32.00	S	
Tetracycline	30	14	15-18	19	6.35	R	
Erythromycin	15	13	14-22	23	6.35	R	
Chloramphenicol	30	12	14-17	18	21.40 ± 1.19	S	

The MICs of Common Antibiotics

To assess the severity of drug resistance in the isolated strain, the MICs of 5 commonly used antibiotics to it were tested The MIC of ampicillin, sulfafurazole, streptomycin sulfate, gentamycin sulfate, and ciprofloxacin to the isolated strain were 0.16 mg/mL, 10.24 mg/mL, 0.04 mg/mL, 0.08 mg/mL, and 0.01 mg/mL, whereas those against ATCC25922 were 0.008 mg/mL, 0.004 mg/mL, 0.008 mg/mL, 0.001 mg/mL, and 0.00001 mg/mL. The resistant fold was 20, 2,560, 5, 80, and 1,000 times that of ATCC 25922, respectively (Table 4). These results indicated that the resistance level of this strain was very severe, and also gave an interpretation to the ineffective use of several antibiotics in the chicken farm.Table 4 The MICs of the commonly used antibiotics. (mg/mL, n ≥ 3).

Table 4Antibiotics	The isolated strain	ATCC25922	Resistant fold	
Ampicillin	0.16	0.008	20	
Sulfafurazole	10.24	0.004	2560	
Streptomycin Sulfate	0.04	0.008	5	
Gentamycin Sulfate	0.08	0.001	80	
Ciprofloxacin	0.01	0.00001	1000	
Matrine	6.25	6.25	1	
Berberine hydrochloride	1	1	1	

Animal Regression Test and Toxicity Test

To further determine the pathogenicity of the isolated strain, varying doses of the bacterial suspension were intraperitoneally administered to chickens. Consequently, high concentrations of the strain induced lethargy and clustering among chicken flocks (Figure 3E). Initially, high-humidity feces adhered to the ejaculatory cavity (Figure 3F), while severe diarrhea resulted in yellow-white loose stools (Figure 3G). Necropsy revealed white-yellow fibrin exudate on liver and heart surfaces of deceased chickens (Figure 3H). Conversely, BC group chickens exhibited normal characteristics. The observed symptoms were consistent with those exhibited by sick chickens on the farm. The survival rates of the chickens inoculated with the strain at concentrations of 3.218 × 109, 1.609 × 109, 8.045 × 108, 4.022 × 108, and 1.975 × 108 CFU/mL were 0, 20, 30, 50, and 90, respectively (Table 5). The LD50 of the strain was about 3.759 × 108 CFU/mL. These results strongly suggest that the isolated strain is highly pathogenic to chickens and capable of causing colibacillosis and mortality even at relatively low infectious doses. Furthermore, successful isolation and identification of the pathogen from regressed chicken samples (Fig. S2). These results indicated that the pathogenic E. coli was corresponding to Koch's principle.Figure 3 Animal regression test (n = 10). (A-D) The characteristics of chicken in the BC group. (A: chick with normal spirit. B: clean ass. C: normal stool. D: The viscera of normal chickens). (E-H) The characteristics of chicken in infected groups. (E: chick with poor spirit. F: diarrhea. G: yellow-white loose stool. H: The viscera of infected chickens).

Figure 3

Table 5 The survival rate of chickens infected by different concentrations of the isolated strain.

Table 5Groups	OD600nm	Bacterial concentration (CFU/mL)	Sample	Survival	Survival rate (%)	
A	2.010	3.218×109	10	0	0c	
B	1.498	1.609×109	10	2	20c	
C	0.929	8.045×108	10	3	30bc	
D	0.498	4.022×108	10	5	50abc	
E	0.253	1.975×108	10	9	90ab	
BC	——	——	10	10	100a	
a-c Values in a column without the same superscripts are significant different (P < 0.05).

PCR Detection of Virulence Genes and Antibiotic-Resistant Genes

Because of the high pathogenicity and the high antibiotic resistance of the strain, its virulence genes and antibiotic-resistant genes were tested. As shown in Figure 4, the isolated strain harbored several virulence genes, such as fimC, eaeA, yijp, stx1, ompA, Iss, hlyA, iroN, iucD, and iutA, which may contribute to the high pathogenicity of the isolated strain in chickens. As shown in Figure 5, the isolated strain has several resistant genes, such as blaTEM, ermA, ermB, aadA1, qnrS, qepA, oqxA, tetA, tetB and tetC. The presence of these resistance genes shed some light on the reason why the strain was resistant to so many antibiotics.Figure 4 Examination of virulence genes of the isolated strain. M: Marker; 1: fimC; 2: tsh; 3: eaeA; 4: Vat; 5: yijp; 6: Stx1; 7: Stx2; 8: Lt; 9: sta; 10: colV; 11: ompA; 12: Iss; 13: hlyA; 14: iroN; 15: iucD; 16: iutA; 17: irp2; 18: fyuA.

Figure 4

Figure 5 Examination of antibiotic-resistant genes in the isolated strain. A. (M: Marker, 1: blaSHV, 2: blaCTX-2, 3: blaTEM); B. (M: Marker, 1: ermA, 2: ermB); C. (M: Marker, 1: aadA1, 2: aac(6′)-Ⅰb, 3: aph(3′)- Ⅱα, 4: rmtB); D. (M: Marker, 1: armA, 2: qnrS, 3: qepA, 4: oqxA); E. (M: Marker, 1: tetA, 2. tetB; 3: TetC).

Figure 5

Synergy Antibacterial Effect of Matrine Combined With Berberine Hydrochloride in Vitro

The MIC of matrine against MDREC was determined to be 6.25 mg/mL, while the MIC of berberine hydrochloride was found to be 1 mg/mL (Table 4). However, when matrine and berberine hydrochloride were combined, concentrations as low as 3.13 mg/mL of matrine reduced the MIC of berberine hydrochloride to 0.02 mg/mL, followed by reductions to 0.06 mg/mL with a concentration of 1.56 mg/mL matrine, 0.13 mg/mL with a concentration of 0.78 mg/mL matrine, and finally down to 0.5 mg/mL with a concentration of 0.39mg/ml matrine; corresponding to reduction multiples of 64,16,8, and 2 respectively. The FICI of 1.56 mg/mL Mat + 0.06 mg/mL Ber was 0.31, and that of 0.78 mg/mL Mat + 0.13 mg/mL Ber was 0.25, which indicating the synergistic effect of matrine combined with berberine hydrochloride against the isolated strain (Table 6).Table 6 The synergistic effect of matrine combined with berberine hydrochloride.

Table 6Drugs	Berberine hydrochloride	
Concentration	MIC	Reduce multiple	FICI	
Matrine	3.13	0.02	64	0.52	
1.56	0.06	16	0.31	
0.78	0.13	8	0.25	
0.39	0.5	2	0.63	
0	1			

The Synergy Antibacterial Effect of Matrine and Berberine Hydrochloride in Vivo

Survival Rate of Chickens

The mortality rate of chickens in each group is depicted in Figure 6 and Table 7. At 60 h after infection, only 36.7% (11/30) of chickens in the EC group survived, significantly lower than that in the BC group (P < 0.05). Among all treatment groups, the CS group had the highest survival rate, reaching 70% (21/30), followed by the Mat + Ber group with a survival rate of 60% (18/30). The survival rates of the CS group and the Mat+Ber group were higher than that of the Mat group (46.7%) and the Ber group (46.7%).Figure 6 The survival rate curve of chickens treated by Mat and Ber. Note: n = 30. EC: E. coli infected control group; CS: Cefotaxifur sodium treated group; Mat: Matrine treated group; Ber: Berberine hydrochloride treated group; Mat + Ber: Matrine combined with berberine hydrochloride treated group; BC: Blank control group.

Figure 6

Table 7 The survival rate of chicken treated by different drugs. (n = 30).

Table 7Group	Sample	Survival	Survival rate(%)	
EC	30	11	36.7b	
CS	30	21	70.0b	
Mat	30	14	46.7b	
Ber	30	14	46.7b	
Mat+Ber	30	18	60b	
BC	30	30	100a	
a-c Values in a column without the same superscripts are significant different (P < 0.05).

Pathological Changes in Autopsy

The autopsy results of each group are shown in Figure 7. In the EC group, a large amount of white-yellow fibrous exudate was observed in the abdominal cavity of chickens at 10 h and 58 h postinfection. Cellulose exudation was also found in the Mat and Ber groups at these time points, albeit to a lesser extent compared to the EC group. Occasional exudates were observed in the CS group and Mat + Ber group. Notably, all inoculation groups exhibited visibly enlarged livers when compared to the BC group; however, the CS group and Mat + Ber group showed relatively better liver conditions than both the Mat and Ber groups.Figure 7 The dissection situation of chicks in each group. (n = 6).

Figure 7

Changes in Organ Indices

The organ indices of the chickens in each group were shown in Figure 8. At 10 h, the organ indices of the liver, heart, spleen, and kidneys in the EC group were higher than those in the BC group, with significant differences of liver and spleen (P < 0.05). Generally, all treatment groups showed lower organ indices than that of the EC group; however, a significant decrease was observed only in spleen index of Mat + Ber treated chickens (P < 0.05). Furthermore, no significant difference was found between Mat + Ber and BC groups regarding liver, heart, spleen, lungs or bursa of fabricius indices (P > 0.05).Figure 8 The changes of organ indices. Note: n = 6; 10 h: at 10 h after bacteria injection; 58 h: at 58 h after bacteria injection. Bars in each figure without the same superscript mean significant difference (P < 0.05). The same as follows.

Figure 8

At 58 h, the organ indices of the liver, heart, and spleen in the EC group were still significantly higher than those in the BC group (P < 0.05). The spleen condition at 58 h remained consistent with that observed 10 h. Similarly, there was no significant difference in the organ indices of the liver, heart, spleen, and kidneys between the Mat + Ber group and the BC group (P > 0.05). In each infection group, a notable reduction was observed in the organ index of the bursa of Fabricius when compared to that of the BC group (P < 0.05). These results indicated that the co-administration of matrine and berberine hydrochloride demonstrates efficacy in mitigating MDREC-induced organ swelling in chickens.

Changes in Bacterial Load

The bacterial loads in different tissues of chickens in each group are presented in Figure 9. At 10 h post-infection, the liver, heart, spleen, lung, and kidney of infected chickens exhibited a high bacterial burden, while no bacteria were detected in the organs of chickens from the BC group. The bacterial load in various organs in both CS and Mat + Ber groups was significantly lower than that in the EC group (P < 0.05), with no significant difference observed between the Mat + Ber and CS groups (P > 0.05). Furthermore, there was no significant difference between the Mat and Ber groups when compared to the EC group (P > 0.05).Figure 9 The bacterial loadings of tissues. Note: n = 6; a-d Values in a column without the same superscripts are significant different (P < 0.05).

Figure 9

At 58 h, the bacterial load in each infected group exhibited a decrease compared to that at 10 h, indicating the progression of colibacillosis. No significant difference was observed in the bacterial load within the liver among the infected groups (P > 0.05). The Mat + Ber group demonstrated a lower bacterial load in the heart, spleen, lung, and kidney compared to the EC group (P < 0.05). Except for the heart, there were no significant differences in bacterial load between the CS group and EC group within other organs (P > 0.05).

Histopathological Changes of Liver

Since it was found that this strain could cause obvious apparent lesions in the liver, the histopathological changes of the chicken livers in each group were evaluated using H&E staining (Fig. 10). In the BC group at 10 h and 58 h, the liver tissue exhibited a normal structure with well-organized hepatic cell cords and intact hepatocyte morphology. However, in the EC group at 10 h and 58 h, there was a loss of normal liver architecture accompanied by enlarged sinusoidal spaces. Hepatocytes displayed rupture and nuclear lysis, along with infiltration of numerous inflammatory cells between them. Similar to the BC group, both CS group at 10 h and Mat + Ber group at 10 h and 58 h showed clear structural characteristics upon examination. Nevertheless, in the CS group at 58 h, slight swelling of liver cells resulted in an unclear arrangement of hepatic cords. Notably, both Mat group and Ber group exhibited enlarged sinusoidal spaces with significant infiltration of inflammatory cells among hepatocytes.Figure 10 The effects of Matrine combined with berberine hydrochloride on the Hepatic histopathological changes of chickens infected by MDREC (H&E staining).

Figure 10

Changes of Inflammatory Factors in Serum

The levels of inflammatory factors in the serum of each group are shown in Figure 11. At 10 h and 58 h, the levels of IL-1β, IL-6, and TNF-α in the chicken serum in the EC group were significantly higher than that in the BC group (P < 0.05). All treatment groups exhibited significantly lower levels of these inflammatory factors compared to the EC group (P < 0.05). The combination uses of Mat and Ber demonstrated superior efficacy among all treatment drugs. Specifically, at 10 h in the Mat + Ber group, IL-1β was significantly lower than that in both CS and Mat groups (P < 0.05), while IL-6 and TNF-α were significantly lower than those in the CS group (P < 0.05), and IL-6 and TNF-α were significantly lower than that in the CS group (P < 0.05). at 58 h in the Mat + Ber group, both IL-1β and IL-6 were significantly lower than those in CS, Mat, and Ber groups (P < 0.05), whereas TNF-α was significantly lower than that observed in both CS and Mat groups (P < 0.05).Figure 11 The changes of cytokines in serum. Note: n = 6; a-f Values in a column without the same superscripts are significant different (P < 0.05).

Figure 11

DISCUSSION

Chicken colibacillosis is a significant contributor to morbidity and mortality in poultry globally, resulting in substantial economic losses and widespread animal suffering(Kromann and Jensen, 2022). Antibiotic treatment remains the preferred approach when APEC infections or outbreaks occur on farms(Ouckama, 2010; Landoni and Albarellos, 2015). As the misuse and abuse of antibiotics continue, the resistance of APEC has become increasingly severe(Davies and Davies, 2010). A study investigating APEC isolates from China between 2019 and 2020 revealed that among the analyzed strains, 57 were highly resistant to gentamicin, cefotaxime, and ofloxacin. (Hu et al., 2022). In this study, out of the tested panel of twenty antibiotics, the isolated strain displayed resistance towards twelve tested antibiotics, including ampicillin, amoxicillin, gentamicin, streptomycin, ciprofloxacin, norfloxacin, ofloxacin, levofloxacin, sulfisoxazole compound, rifampicin, tetracycline, and erythromycin. The MICs of several commonly used antibiotics also corresponded with the results of antibiotic susceptibility testing (Table 4). The presence of antibiotic-resistance genes is a key factor mediating bacterial resistance to antibiotics(Shi et al., 2022). The strain harbored several antibiotic resistance genes, including blaTEM, ermA, ermB, aadA1, qnrS, qepA, oqxA, tetA, tetB, and tetC.

Poultry-related E. coli diseases are considered opportunistic infections, resulting from factors such as stress, immunosuppression, co-infection, or poor welfare. However, it is important to note that the virulence of different strains can also vary(Collingwood et al., 2014; Guabiraba and Schouler, 2015). ICR mice received intraperitoneal injections of 0.5 mL E coli ATCC25922 (3×108 cfu/mL) all died within 30 h(Shen et al., 2014). When chicken embryos were exposed to E. faecalis and E. coli, a significant increase in neonatal mortality was observed (27%) (Karunarathna et al., 2022). The LD50 of bacteria is a measure of virulence, representing the minimum number required to cause half of an animal of a certain weight or age to die within a specified time and route of infection(Baron, 1996; Kaiser, 1998). In WL hens embryo, the LD50 of three virulent strains ranged from < 2.7 to 5.3 log10 CFU(Landman et al., 2021). In a study of another E. coli strain, its LD50 to mice was 4.49 × 108 CFU/mL(Meng et al., 2023). The pathogenicity of the isolated strain in this study to chickens were evaluated. The LD50 of E. coli OQ600604.1 was 3.759×108 CFU/mL, indicating its high pathogenicity. Different virulence and pathogenic factors or mechanisms enable APEC to cause colibacillosis in poultry, so the virulence genes encoding these disease-causing agents were also examined, and fimC, eaeA, yijp, stx1, ompA, Iss, hlyA, iroN, iucD, and iutA genes were observed.

Due to its high pathogenicity, a significant number of chicken deaths were observed on the farm. The ineffectiveness of several commonly used antibiotics prompted the search for alternative drugs against this MDREC. The combination use of Sophora flavescens and Coptis chinensis France in some formulas to treat bacterial infections according to TCM theory attracted our attention. Some components in Sophora flavescens or Coptis chinensis France have antibacterial activity, including matrine, kushenol C, kushenol A, kushenol Q, kushenol R, berberine, and polysaccharide (Yang et al., 2021). The antibacterial effects of matrine and berberine hydrochloride alone or in combination were tested in vitro, revealing a synergistic effect. Subsequently, their efficacy was confirmed by treating MDREC infection in chickens. Bacterial load serves as an important indicator for evaluating the antibacterial activity of drugs in vivo. In this study, the combination uses of matrine and berberine hydrochloride significantly reduced the bacterial load in most organs at 10 h and 58 h. Conversely, there were few differences observed in the EC group, Mat group, and Ber group. These findings align with necropsy results, organ indices, and histopathological changes, indicating a synergistic effect with the combination use of matrine and berberine hydrochloride. Sophora flavescens exhibited potential as an immunomodulatory drug by reducing the levels of TNF-α and IL-1β in serum in vivo (Sun et al., 2023). Additionally, matrine demonstrated efficacy in alleviating symptoms and pathological changes while down-regulating TNF-α, IL-1β, and IL-6 expression in septic mice(Wang et al., 2023). Coptis chinensis was found to regulate inflammatory responses through suppressing pro-inflammatory factor expression(Li et al., 2023). In this study, the combination use of Mat and Ber reduced the levels of IL-1β, IL-6, and TNF-α in the serum to regulate the inflammation caused by E. coli infection.

CONCLUSIONS

This study demonstrates that the disease of these chickens in the farm were caused by a highly pathogenic multidrug-resistant E. coli strain with several resistant genes and virulence genes. Matrine and berberine hydrochloride could synergically treat the infection of this strain by regulating the organ indices, improving the pathological situation, decreasing the bacterial load, and regulating the inflammatory factors. These results indicating matrine combined with berberine hydrochloride have the potential as treatment agent to treat the infection diseases caused by multidrug-resistant avian pathogenic E. coli in chickens.

DISCLOSURES

The authors declare no conflicts of interest.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

This work was supported by Key Special Projects for the 14th Five Year Plan (2022YFD1801102 ), the Fundamental research funds for the central universities (KYYJ201803 ), the National Natural Science Foundation of China (Grant Nos. 31772784 and 31572557 ) and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104151.
==== Refs
REFERENCES

Awad A. Arafat N. Elhadidy M. Genetic elements associated with antimicrobial resistance among avian pathogenic Escherichia coli Ann. Clin. Microbiol. Antimicrob. 15 2016 59 27887603
Baron S. Medical Microbiology 4th edition 1996 University of Texas Medical Branch at Galveston Galveston, TX Chapter 7 https://www.ncbi.nlm.nih.gov/books/NBK8526/
Chouikha I. Bree A. Moulin-Schouleur M. Gilot P. Germon P. Differential expression of iutA and ibeA in the early stages of infection by extra-intestinal pathogenic E. coli Microbes. Infect. 10 2008 432 438 18403237
Collingwood C. Kemmett K. Williams N. Wigley P. Is the concept of avian pathogenic Escherichia coli as a single pathotype fundamentally flawed? Front. Vet. Sci. 1 2014 5 26664913
Croxen M.A. Finlay B.B. Molecular mechanisms of Escherichia coli pathogenicity Nat. Rev. Microbiol. 8 2010 26 38 19966814
Davies J. Davies D. Origins and evolution of antibiotic resistance Microbiol. Mol. Biol. Rev. 74 2010 417 433 20805405
Dho-Moulin M. Fairbrother J.M. Avian pathogenic Escherichia coli (APEC) Vet. Res. 30 1999 299 316 10367360
Fancher C.A. Zhang L. Kiess A.S. Adhikari P.A. Dinh T. Sukumaran A.T. Avian pathogenic Escherichia coli and Clostridium perfringens: challenges in no antibiotics ever broiler production and potential solutions Microorganisms 8 2020 1533 33036173
Galal H.M. Tawfek A.M. Abdrabou M.I. Hessain A.M. Alhaaji J.H. Kabli S.A. Elbehiry A. Alwarhi W.K. Moussa I.M. Recent approaches for control of E. coli and respiratory complex in Middle East Saudi J Biol Sci 25 2018 1302 1307 30505174
Ghunaim H. Abu-Madi M.A. Kariyawasam S. Advances in vaccination against avian pathogenic Escherichia coli respiratory disease: potentials and limitations Vet Microbiol 172 2014 13 22 24878325
Guabiraba R. Schouler C. Avian colibacillosis: still many black holes FEMS Microbiol. Lett 362 2015 fnv118 26204893
Han T. Zhang Q. Liu N. Wang J. Li Y. Huang X. Liu J. Wang J. Qu Z. Qi K. Changes in antibiotic resistance of Escherichia coli during the broiler feeding cycle Poult. Sci. 99 2020 6983 6989 33248614
He X. Fang J. Huang L. Wang J. Huang X. Sophora flavescens Ait.: traditional usage, phytochemistry and pharmacology of an important traditional Chinese medicine J. Ethnopharmacol. 172 2015 10 29 26087234
Hu Z. Chen X. Wang Z. Guo G. Xu Z. Zhou Q. Wei X. Liu Y. Zhou L. Tan Z. Zhang W. Whole-genome analyses of APEC carrying mcr-1 in some coastal areas of China from 2019 to 2020 J. Glob. Antimicrob. Resist. 30 2022 370 376 35787986
Humphries R. Bobenchik A.M. Hindler J.A. Schuetz A.N. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing M100, 31st Edition J. Clin. Microbiol. 59 2021 e21321
Jones C.H. Pinkner J.S. Nicholes A.V. Slonim L.N. Abraham S.N. Hultgren S.J. FimC is a periplasmic PapD-like chaperone that directs assembly of type 1 pili in bacteria Proc. Natl. Acad. Sci. U S A 90 1993 8397 8401 8104335
Kaiser K.L. Correlations of Vibrio fischeri bacteria test data with bioassay data for other organisms Environ. Health Perspect. Suppl 2 1998 583 591
Kan L.L. Liu D. Chan B.C. Tsang M.S. Hou T. Leung P.C. Lam C.W. Wong C.K. The flavonoids of Sophora flavescens exerts anti-inflammatory activity via promoting autophagy of Bacillus Calmette-Guerin-stimulated macrophages J. Leukoc. Biol. 108 2020 1615 1629 32794339
Karunarathna R. Ahmed K.A. Goonewardene K. Gunawardana T. Kurukulasuriya S. Liu M. Gupta A. Popowich S. Ayalew L. Chow-Lockerbie B. Willson P. Ngeleka M. Gomis S. Exposure of embryonating eggs to Enterococcus faecalis and Escherichia coli potentiates E. coli pathogenicity and increases mortality of neonatal chickens Poult. Sci. 101 2022 101983
Kathayat D. Lokesh D. Ranjit S. Rajashekara G. Avian pathogenic Escherichia coli (APEC): an overview of virulence and pathogenesis factors, zoonotic potential, and control strategies Pathogens 10 2021 467 33921518
Kobayashi R.K. Gaziri L.C. Vidotto M.C. Functional activities of the Tsh protein from avian pathogenic Escherichia coli (APEC) strains J. Vet. Sci. 11 2010 315 319 21113100
Koronakis V. Cross M. Hughes C. Expression of the E.coli hemolysin secretion gene hlyB involves transcript anti-termination within the hly operon Nucleic Acids Res. 16 1988 4789 4800 2455277
Kromann S. Jensen H.E. In vivo models of Escherichia coli infection in poultry Acta Vet. Scand. 64 2022 33 36461003
Landman W. Buter G.J. Dijkman R. van Eck J. In vivo typing of Escherichia coli obtained from laying chickens with the E. coli peritonitis syndrome Avian Pathol. 50 2021 436 446 34351217
Landoni M.F. Albarellos G. The use of antimicrobial agents in broiler chickens Vet. J. 205 2015 21 27 25981931
Li M. Tian F. Guo J. Li X. Ma L. Jiang M. Zhao J. Therapeutic potential of Coptis chinensis for arthritis with underlying mechanisms Front. Pharmacol. 14 2023 1243820
Li P. Chai W.C. Wang Z.Y. Tang K.J. Chen J.Y. Venter H. Semple S.J. Xiang L. Bioactivity-guided isolation of compounds from Sophora flavescens with antibacterial activity against Acinetobacter baumannii Nat. Prod. Res. 36 2022 4340 4348 34592853
Lv T. Zhang C. Hu L. Wang C. Li S. Wang H. Qi W. Berberine in sepsis: effects, mechanisms, and therapeutic strategies J. Immunol. Res. 2023 2023 4452414
Melton-Celsa A.R. Shiga Toxin (Stx) classification, structure, and function Microbiol. Spectr. 2 2014 24 2013
Meng J. Wang J. Zhu J. Li S. Qiu T. Wang W. Ding J. Wang W. Liu J. Bacteriostatic effects of yujin powder and its components on clinical isolation of multidrug-resistant avian pathogenic Escherichia coli Vet Sci 10 2023 328 37235411
Ouckama R. Antibiotics and poultry–a comment Can Vet J 51 2010 345 20592821
Pakbin B. Bruck W.M. Rossen J. Virulence factors of enteric pathogenic Escherichia coli: a review Int. J. Mol. Sci. 22 2021 9922 34576083
Performance Standards for Antimicrobial Susceptibility Testing CLSI supplement M100 28th ed 2018 Clinical and Laboratory Standards Institute Wayne, PA 30 37
Shen W.C. Wang X. Qin W.T. Qiu X.F. Sun B.W. Exogenous carbon monoxide suppresses Escherichia coli vitality and improves survival in an Escherichia coli-induced murine sepsis model Acta Pharmacol. Sin. 35 2014 1566 1576 25399652
Shi X. Xia Y. Wei W. Ni B.J. Accelerated spread of antibiotic resistance genes (ARGs) induced by non-antibiotic conditions: roles and mechanisms Water Res 224 2022 119060
Spurbeck R.R. Dinh P.J. Walk S.T. Stapleton A.E. Hooton T.M. Nolan L.K. Kim K.S. Johnson J.R. Mobley H.L. Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract Infect. Immun. 80 2012 4115 4122 22966046
Sun P. Zhao X. Zhao W. Chen L. Liu X. Zhan Z. Wang J. Sophora flavescens-Angelica sinensis in the treatment of eczema by inhibiting TLR4/MyD88/NF-kappaB pathway J. Ethnopharmacol 322 2023 117626
Tuntufye H.N. Ons E. Pham A.D. Luyten T. Van Gerven N. Bleyen N. Goddeeris B.M. Escherichia coli ghosts or live E. coli expressing the ferri-siderophore receptors FepA, FhuE, IroN and IutA do not protect broiler chickens against avian pathogenic E. coli (APEC) Vet. Microbiol. 159 2012 470 478 22633153
Wang J. Qi F. Wang Z. Zhang Z. Pan N. Huai L. Qu S. Zhao L. A review of traditional Chinese medicine for treatment of glioblastoma Biosci. Trends 13 2020 476 487 31866614
Wang Y. Zhou J. Li X. Ma L. Cao X. Hu W. Zhao L. Jing W. Lan X. Li Y. Gong X. Chen Q. Stipkvits L. Szathmary S. Tarasiuk K. Pejsak Z. Liu Y. Genetic diversity, antimicrobial resistance and extended-spectrum beta-lactamase type of Escherichia coli isolates from chicken, dog, pig and yak in Gansu and Qinghai Provinces, China J. Glob. Antimicrob. Resist 22 2020 726 732 32659505
Wang J. Wang Z. Tang G. TCM treatment of extrasystole with huanglian shengmai yin–a report of 357 cases J. Tradit. Chin. Med. 23 2003 35 37 12747194
Wang X. Wu F.P. Huang Y.R. Li H.D. Cao X.Y. You Y. Meng Z.F. Sun K.Y. Shen X.Y. Matrine suppresses NLRP3 inflammasome activation via regulating PTPN2/JNK/SREBP2 pathway in sepsis Phytomedicine 109 2023 154574
Xie Q. Li H. Ma R. Ren M. Li Y. Li J. Chen H. Chen Z. Gong D. Wang J. Effect of Coptis chinensis franch and Magnolia officinalis on intestinal flora and intestinal barrier in a TNBS-induced ulcerative colitis rats model Phytomedicine 97 2022 153927
Yang Y. Vong C.T. Zeng S. Gao C. Chen Z. Fu C. Wang S. Zou L. Wang A. Wang Y. Tracking evidences of Coptis chinensis for the treatment of inflammatory bowel disease from pharmacological, pharmacokinetic to clinical studies J. Ethnopharmacol 268 2021 113573
Zhang F.L. Yang L. He W.H. Xie L.J. Yang F. Wang Y.H. Huang A.G. In vivo antibacterial activity of medicinal plant Sophora flavescens against Streptococcus agalactiae infection J. Fish Dis 46 2023 977 986 37294673
