
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00668-0
10.1016/j.psj.2024.104089
104089
MANAGEMENT AND PRODUCTION
The therapeutic efficacy of neem (Azadirecta indica) leaf extract against coinfection with Chlamydophila psittaci and low pathogenic avian influenza virus H9N2 in broiler chickens
Hegazy Ahmed M.E. *
Morsy Amira M. †
Salem Heba M. ‡
Al-zaban Mayasar I. §
Alkahtani Abdullah M. #
Alshammari Naheda M. ǁ
El-Saadony Mohamed T. ¶
Altarjami Lamaia R. ⁎⁎
Bahshwan Safia M.A. ††
AL-Qurashi Mada M. ††
El-Tarabily Khaled A. ktarabily@uaeu.ac.ae
‡‡1
Tolba Hala M.N. ⁎
⁎ Department of Avian and Rabbit Medicine, Faculty of Veterinary Medicine, Zagazig University, Zagazig, 44511, Egypt
† Reference Laboratory for Quality Control on Poultry Production, Department of Poultry Diseases, Animal Health Research Institute, Arish Branch, Agriculture Research Center (ARC), Egypt
‡ Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, 12211, Egypt
§ Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, Riyadh, 11671, Saudi Arabia
# Department of Microbiology and Clinical Parasitology, College of Medicine, King Khalid University, Abha, 61421, Saudi Arabia
ǁ Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia
¶ Department of Agricultural Microbiology, Faculty of Agriculture, Zagazig University, Zagazig, 44511, Egypt
⁎⁎ Department of Chemistry, College of Science and Arts, King Abdulaziz University, Rabigh, 21991, Saudi Arabia
†† Biological Sciences Department, College of Science and Arts, King Abdulaziz University, Rabigh, 21911, Saudi Arabia
‡‡ Department of Biology, College of Science, United Arab Emirates University, Al Ain, 15551, United Arab Emirates
1 Corresponding author. ktarabily@uaeu.ac.ae
10 7 2024
10 2024
10 7 2024
103 10 1040895 5 2024
6 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Avian chlamydiosis is a serious avian infection that carries a significant zoonotic danger to the poultry industry. The respiratory co-infections caused by the low pathogenic avian influenza virus H9N2 (LPAIV H9N2) also cause significant financial losses in the poultry industry. The purpose of this study was to examine the pathogenicity of Chlamydophila psittaci, and LPAIV H9N2 individually and in combination in broiler chickens, as well as to determine whether or not aqueous neem (Azadirachta indica) leaf extract is effective against infections caused by these pathogens. Therefore, 120 broiler cobb chicks were equally divided into 4 groups (30 birds each) with triplicates with 10 birds. Broilers in group 1 (G1) were infected with only C. psittaci, broilers in group 2 (G2) were infected with only LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control). At 21 d postinfection (dpi), birds in G1, G2, and G3 were divided into 3 subgroups of 10 birds each: subgroup (A) remained infected and untreated (positive control), subgroup (B) infected and received oxytetracycline for 5 consecutive d, and subgroup (C) infected and received 8% aqueous neem leaf extract for 5 consecutive d. The multiplication of C. psittaci in birds in G1, in various tissues was evaluated using Giemsa staining and the data showed that multiplication was much higher in the lung, spleen, and liver from 6 h to 21 dpi, but low in the heart from 8 to 21 dpi. During simultaneous co-infection in G3, the birds developed significant clinical symptoms and postmortem lesions (PM). Quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect viral shedding from oropharyngeal and cloacal swabs between 2 dpi and 8 dpi, with cycle threshold (CT) values ranging from 22 to 24. In contrast, bacterial shedding began 6 h after infection and continued until 21 dpi, with CT values ranging from 23 to 26. Administration of an aqueous neem leaf extract at an 8% concentration (Group C) resulted in a numerical rise in average body weight across all treatment groups in the third and fourth week, as well as a reduction in LPAIV H9N2 and C. psittaci replication in the respiratory and gut of treated birds compared to those treated with oxytetracycline (Group B). Overall, respiratory co-infections pose a considerable risk to the poultry business, which is a big threat. To control C. psittaci and LPAIV H9N2 in broiler chickens, oral supplementation of 8% aqueous neem leaf extract is recommended. This treatment improves the birds' performance, as evidenced by an increase in their average body weight. In addition, the application of 8% aqueous neem leaf extract lowers C. psittaci replication within tissues and diminishes LPAIV H9N2 shedding.

Key words

Avian chlamydiosis
LPAI H9N2
neem
organic poultry
respiratory co-infections
==== Body
pmcINTRODUCTION

The intracellular Gram-negative bacteria Chlamydophila psittaci causes avian chlamydiosis, a disease of birds (Stokes et al., 2021; Yehia et al., 2024). Avian chlamydiosis is widespread in wild, confined, and aviary birds. All birds can become infected with avian chlamydiosis, but pet birds, particularly parrots (such as budgies, lorikeets, and cockatiels), are the most common carriers of illness to humans (Stokes et al., 2021; Szymańska-Czerwińska et al., 2023; Xie et al., 2024).

Avian chlamydiosis has varying degrees of host specificity and follows a distinct, biphasic replication growth cycle, while some chlamydial species typically infect any species, including domestic, wild host species, and humans, other chlamydiales have been shown to be host species (Borel et al., 2018). Currently, more than fourteen species have been formally categorized, along with an additional four species that have been identified but not yet cultivated (Laroucau et al., 2020).

The host species, age, immunological condition, and virulence of the bacterial strain all influence the severity of the disease in birds (Ravichandran et al., 2021). Zoonotic C. psittaci can infect humans and cause psittacosis, a severe illness that can progress to pneumonia in approximately 83% of cases and significant fatality if ignored (Branley et al., 2014). According to Sachse et al. (2015), most C. psittaci strains are host-specific, and the degree to which they cause illness depends on the host species and the state of health of the individual (Yin et al., 2013).

Avian chlamydiosis has a significantly more complex epidemiology, implying that species such as C. psittaci, Chlamydia avium, Chlamydia gallinacea, Chlamydophila pecorum, Chlamydophila abortus, and Chlamydia trachomatis may have a role in the disease's etiology (Stokes et al., 2021). According to Kaleta and Taday, (2003), approximately 450 bird species from 30 various orders are vulnerable to C. psittaci. Yin et al. (2013) classified C. psittaci according to the well-established ompA genotypes A-F and EB. Certain genotypes, including B, C, D, F, and EB, have been found to be present in chickens (Dickx et al., 2010). Until recently, broilers were the most common hosts of C. psittaci genotypes B and D (Yin et al., 2013). It has been observed that genotypes B and D are frequently found in broiler flocks (Yin et al., 2013).

Pet owners, veterinary technicians, and staff of pet stores and poultry farms are the individuals who are most frequently to be exposed to the bacterium and subsequently develop an infection because of their exposure (Branley et al., 2014). To prevent and control diseases, it is necessary to quarantine newly bought birds for at least 30 d. This includes good husbandry techniques, testing the birds regularly, cleaning hands, and other basic hygiene procedures (Smith et al., 2012).

The etiology of Chlamydia is unknown, although Grayston and Wang (1975) reported that in Turkey, Chlamydia infection via the respiratory route resulted in the presence of Chlamydia in the lungs, air sacs, and mesentery within 4 h. Chlamydia was discharged into the blood 48 h after exposure and was detectable throughout the body (Yin et al., 2013).

C. psittaci quickly spreads throughout the host body, resulting in systemic infection, and the bacteria can avoid the action of host pro-inflammatory mediators more effectively than other chlamydial species (Sachse et al., 2015). Because a large number of C. psittaci is shed by droppings and nasal discharges, aerosol dispersion and, on occasion, ingestion of contaminated feed are the predominant modes of chlamydial transmission (Vanrompay, 2020). The majority of chicken C. psittaci outbreaks are clinically characterized by lethargy, respiratory symptoms, anorexia, conjunctivitis, diarrhea, and emaciation (Harkinezhad et al. 2009). However, the infection can also be asymptomatic (Sachse et al., 2015).

Additionally, the respiratory co-infections that are brought on by the immunosuppressive virus known as low pathogenic avian influenza virus H9N2 (LPAIV H9N2) are responsible for enormous financial losses in the poultry sector (Abd El-Hack et al., 2022). The H9N2, an LPAIV, has spread to domestic birds in several countries, resulting in severe economic losses from lower egg production or increased mortality due to co-infection with other diseases (El Nagar et al., 2024; Yehia et al., 2024). According to Sun and Liu (2015) and Umar et al. (2016), when specific pathogen-free (SPF) chickens’ contract LPAIV H9N2 and C. psittaci simultaneously, it often leads to severe pneumonia and high fatality rates.

More recently, it has been noticed that LPAIV H9N2 and C. psittaci frequently result in mixed infections in clinical situations, resulting in considerable economic losses (Chu et al., 2016). Furthermore, in SPF chickens, coinfection of C. psittaci with LPAIV H9N2, Ornithobacterium rhinotracheale, and Aspergillus fumigatus causes severe pneumonia and increased mortality (Chu et al., 2017).

Diagnosing chlamydiosis in a live bird can be problematic since it varies based on the species, time since exposure, and the overall health of the animal (Yehia et al., 2024). The most used diagnostic tests include serology, organism culture, and polymerase chain reaction (PCR) assays (Yin et al., 2013).

The use of antibiotics such as oxytetracycline, macrolides, and doxycycline was crucial in the therapy of C. psittaci (Balsamo et al., 2017). These drugs inhibit the development of Chlamydia ribosomal proteins however these antibiotics should be applied as long treatment course to be effective against C. psittaci (Balsamo et al., 2017). This is despite the fact that the pathogens are highly responsive to avian and human over-the-counter medications (Jawad et al., 2014; Vanrompay, 2020). On the other hand, sustained exposure to antibiotics was associated with an increased the incidence or existence of drug resistance developing in Chlamydia (Rodolakis and Laroucau., 2015).

The current global trend is towards the use of non-toxic, all-natural products for the control of various avian diseases. Recently, it has been shown that Azadirecta indica, often known as neem, possesses a wide range of therapeutic properties (Hegazy et al., 2022). These properties include immunomodulatory, anti-inflammatory, antiviral and antibacterial properties, particularly against C. psittaci (Hegazy et al., 2022; Hegazy et al., 2023). Quercetin and ß-sitosterol were identified as the first pure polyphenolic flavonoids from fresh neem leaves, and they demonstrated antimicrobials properties. Neem extracts and its active components shown a strong favorable effect against drug-resistant and biofilm-forming bacteria, as well as antiviral activity against Newcastle disease virus (Mahmood et al., 2018; Wylie and Merrell, 2022). In terms of the influence of neem extract on poultry nutrition, Nath et al. (2023) found that dietary supplementation with neem leaf powder (2 g/kg) has the potential to increase broiler chicken development performance. Alternatively, broiler chickens can be given cinnamon oil (100 mg/kg) along with neem leaf powder (2 g/kg) as a growth promoter in their food for optimal health and improved productivity (Nath et al., 2023).

Despite the increasing prevalence of chlamydiosis in hens, there has been a lack of investigations on the pathophysiology of avian chlamydiosis in poultry (Szymańska-Czerwińska et al., 2023). As a result, the current study investigates the efficacy of aqueous neem leaf extract 8% and antibiotic (oxytetracycline) as control measures against the pathogenicity of C. psittaci with LPAIV H9N2 and their influence on the body performance of the treated birds.

MATERIALS AND METHODS

Preparation of Study Materials

Preparation of Bacterial Inoculum

C. psittaci used in the current study was previously isolated from Sharqia Governorate, Egypt, in 2014 (Tolba et al., 2019). The isolate was passed 3 times in the yolk sac (YS) of SPF eggs. It was stored at -80°C as a 20% YS suspension in sucrose phosphate glutamate (SPG) until use (Alethae et al., 2014).

The infective dose of the suspension was estimated using Vero cell inoculation. The tissue culture infective dose (TCID) was determined (Reed and Muench, 1938). The bacterial stock was diluted in SPG buffer before being used to obtain concentration 106 TCID/mL (Vanrompay et al., 1993).

Preparation of Aqueous Neem Leaf Extract (8%)

Neem leaves of middle-aged green trees were collected from the Agricultural orchards of the Faculty of Agriculture, Zagazig University. The leaves were dried in an oven at 37°C then ground in a metallic grinder (Leila, 1977). The ground leaves were weighed, and the leaves were extracted in hot distilled water (50°C) for 5 to 8 h at room temperature (Hegazy et al., 2018). The neem aqueous extract was administered for 5 successive d at 21 d post the challenge.

Oxytetracycline

Oxytetracycline HCl (200 mg, Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) was used to treat C. psittaci-infected chicks for continuous 5 d at 21 d postinfection (dpi) at a dose of 20 mg/kg live body weight (BW) in drinking water (Rodolakis and Mohamad, 2010).

Ethical Approval

This investigation was conducted with the permission of the faculty of Veterinary Medicine, Zagazig University, and in line with the guidelines of the committee with approval number ZU-IACUC/2/F/41/2023.

Virus Challenge

The virus used in the experimental challenge was LPAIV H9N2 Egyptian isolate (A/chicken/Egypt/S6/2018) (Gado et al., 2022). The virus was propagated using 9 to 11-days-old SPF embryonated chicken eggs via inoculation in the allantoic sac as recommended by the World organization for animal health OIE (2018).

The LPAI H9N2 strain was prepared, and embryo infective dose (EID50) was evaluated by the presence/absence of dead embryos and via testing for hemagglutinin (HA) according to Reed and Muench (1938). The viral stock was then diluted in sterile saline before using to obtain concentration 106 EID50/ml (Abdel Hamid et al., 2016).

Experimental Design

At 1-day-old, 120 broiler chicks were split into 4 equal groups (30 chicks/group with triplicate including 10 birds/replicate). The chicks were raised in a controlled environment on a deep litter system on straw bedding material and supplied with water and commercial balanced ration without any additives ad libidum with adjusted temperature and humidity according to birds' requirements.

During the first week of bird incubation, oropharyngeal and cloacal swabs were collected from ten randomly selected birds and subjected to quantitative real-time polymerase chain reaction (qRT-PCR) to ensure that the birds were free from C. psittaci and LPAIV H9N2 infections.

At 7 d of age, 3 groups of broilers were infected (G1 by 0.2 ml of C. psittaci 106 TCID/ml); (G2 by dropping of 50 µL of LPAIV H9N2 inoculums (106 EID50/mL) in both nostrils; (G3 simultaneous infection with both C. psittaci and LPAIV H9N2 in both nostrils; and G4 remained not challenged and non-treated with any therapeutic or preventive treatment (negative control). All the chickens have been observed for clinical signs and mortality daily till the end of the experiment (35 d).

G1, G2, and G3 were subdivided into 3 subgroups 10 chicks per each. At 21 dpi, the first subgroup (A) was kept untreated as a positive control, the second subgroup (B) was treated with oxytetracycline for 5 successive d, and the third subgroup (C) was treated with aqueous neem leaf extract 8% for 5 successive d.

Birds and feed in all groups were weighed at the age of 7th, 14th, 21st, 28th, and 35th (the end point of the experiment) to find out the BW and feed conversion ratio (FCR). Chickens in all groups were individually checked for symptoms and mortality, necropsy was performed, and lesions were recorded all over the experiment.

Cytological Examination

Impression smears from the cut surfaces from the liver, lung, heart, and spleen of humanly sacrificed birds (one bird/group in every checkpoint) at 6, 24, and 48 h, 4, 8, 10, 14, and 21 dpi. After being immersed in methanol for 5 min for fixation, they were dipped in a sealed staining jar with freshly prepared, diluted Giemsa stain (1 volume of stock stain plus 49 volume of neutral distilled water) and then kept at 37°C for the entire night. After successfully cleaning the slides with distilled water and alcohol, they were viewed under an oil immersion lens to check for Chlamydia inclusion bodies (Enany et al., 2009).

Viral RNA and Bacterial DNA Extraction Using qRT-PCR

According to the manufacturer's instructions, RNA was isolated from swabs using the QIAamp viral RNA extraction kit (Qiagen, Hilden, Germany) (Qiagen # 52904) from the allantoic fluid. Applying a Stratagen MX3005P real-time PCR instrument (Applied Biosystem, Thermo Fisher Scientific, Waltham, MA, USA) and the quantitect probe RT-PCR kit (Qiagen), all allantoic fluids were tested for the LPAIV H9N2 subtype applying qRT-PCR.

The qRT-PCR cycle parameters for LPAIV H9N2 were 6.125 μl of R 50 pmol of each primer, 30 pmol of the probe, 0.25 µl of quantitect RT mix, and 5 µL of template RNA combined with RNase-free water. Reverse transcription was carried out for 30 min at 50 °C. Forty cycles of denaturation at 94°C for 30 s, followed by the first denaturation at 95 °C for 15 min, the 40 s annealing and extension process at 60 °C was carried out as described by Shabat et al. (2010). Table 1 displays the primers used for C. psittaci and (LPAIV H9N2).Table 1 Oligonucleotide primers used for Chlamydophila psittaci and low pathogenic avian influenza virus (LPAIV H9N2).

Table 1Target gene	Primers sequences	Reference	
Chlamydophila psittaci pmp	ATGAAACATCCAGTCTACTGG	Sareyyüpoğlu and Cantekin (2009)	
TTGTGTAGTAATATTATCAAA	
Virus	Gene	Primer/ probe sequence 5′-3′	Reference	
AI H9	HA	H9F GGAAGAATTAATTATTATTGGTCGGTAC	Shabat et al. (2010)	
H9R GCCACCTTTTTCAGTCTGACATT	
H9 Probe FAM]AACCAGGCCAGACATTGCGAGTAAGATCC[TAMRA]	

From infected yolk sac membranes, chromosomal DNA for C. psittaci was extracted using the QIA amp DNA micro kit (Qiagen # 51304) (Sareyyüpoğlu and Cantekin, 2009). The SYBR green qRT-PCR cycle conditions for C. psittaci was carried out by adding 8.5 µL R 12.5 µL of the 2x QuantiTect SYBR Green PCR master mix, 20 pmol of each primer, and 3 µL of template DNA combined with RNase-free water.

Forty cycles of denaturation at 94°C for 30 s each, followed by the initial denaturation at 94°C for 5 min, 30 s of annealing at 50°C, and 30 s of extension at 72°C was carried out as described by Sareyyüpoğlu and Cantekin (2009). The dissociation curve involves a single cycle of denaturation, annealing at 50°C for 1 min, and final denaturation at 94 °C for 1 min (Sareyyüpoğlu and Cantekin, 2009).

Virus and Bacterial Shedding

In sterile phosphate-buffered saline (PBS) containing a 2 % antibiotic solution of penicillin streptomycin-neomycin for LPAIV H9N2 samples only, oropharyngeal, and cloacal swab samples were collected from experimental chickens at 6, 24, and 48 h, 4, 6, 8, 10, 14, and 21 dpi. All samples were frozen and stored at ‒80 °C until they were exposed to qRT-PCR for the detection of challenged AIV H9N2 virus and C. psittaci.

Statistical Analysis

The data were presented as mean ± SEM (standard error of mean). The four treatment groups with varying time management styles were evaluated for their effects on certain biological variables using one-way analysis of variance (ANOVA) and post hoc Duncan multiple range tests. P < 0.05 was used as the threshold for statistical significance. Graph Pad Prism 8.0.2 and the Statistical Package for Social Sciences version 24.0 (SPSS, IBM Corp., Armonk, NY, USA) were used for all analyses and visualizations (GraphPad Software, Inc., San Diego, CA, USA).

RESULTS

Clinical Manifestations and Mortalities

There were no deaths observed in any of the groups throughout the 35-d experimental period. The negative control group (G4) of chickens that were not infected remained healthy throughout the experiment, with no mortalities. In contrast, chickens in G1 subgroup A, which were infected with C. psittaci, exhibited clinical signs at 4 dpi, including lethargy, rhinitis, conjunctivitis, and mild dyspnea, which persisted until 17 dpi (Figure 1). Additionally, mild intermittent diarrhea (green watery) was observed from 10 to 14 dpi. The clinical indications of the birds in G1 subgroups B and C were less severe following the treatment course than those in G1 subgroup A.Figure 1 Clinical signs of chickens in G1, which were infected with the Chlamydophila psittaci only but untreated (positive control) (G1, subgroup A). A: clinical signs at 4 days post-infection including dullness, sleepy appearance, difficult respiration (mild dyspnoea); B and C: chicks at 17 days post-infection, showing ruffled feathers, general dullness, and sleepy appearance.

Figure 1

In chickens infected with LPAIV H9N2 (G2), tracheal rales started at 4 dpi and reached to peak at 7 dpi in 18 out of 30 (60%) challenged birds and persisted till the end of the observation time. Depression, and ruffled feathers also appeared at 3 dpi in 8 out of 30 (26.6%). Additionally, greenish and whitish diarrhea was seen in 11 out of 30 birds with a percentage of 36.6 % on the 5th and 6th dpi and continued till the end of the observation period. After the treatment course in G2 subgroups B and C, the birds showed improvement in clinical signs in comparison with untreated birds in G2 subgroup A.

In chickens that were infected with C. psittaci and LPAIV H9N2 (G3), severe respiratory symptoms started at 2 dpi, which was in 16 out of 30 birds (53.3%). From 10-14 dpi onwards, all chickens showed marked depression, severe conjunctivitis, swelling in eyelids, facial oedema surrounding the eye, anorexia, head shaking, rhinitis, gasping, and exacerbating dyspnoea (mostly sitting on the floor with closed eyes), also green watery droppings were observed (Figure 2). After the treatment course, birds of G3 subgroups B and C, showed improvement in the clinical signs in comparison with birds in G3 subgroup A.Figure 2 Clinical signs of chickens of infected with Chlamydophila psittaci and low pathogenic avian influenza virus LPAIV H9N2, (G3) but untreated (positive control) (G3, subgroup A). A and B: severe symptoms started at 2 days post infection, which was marked depression, severe conjunctivitis, and swelling in eyelids; C: clinical signs of birds in G3, subgroup A at 14 days post-infection showing conjunctivitis; D: clinical signs of birds in G3 at 17 days post-infection showing sever conjunctivitis, swelling in eyelids, and difficult respiration.

Figure 2

In all challenged groups (G1, G2, and G3), respiratory signs started with low incidence, but the incidence increased during the mid-infection and then decreased during the late infection. The clinical signs of the current investigation are presented in Table 2.Table 2 The score of the clinical signs throughout the experiment.

Table 2Group clinical signs	Group 1 (A)	Group 2 (A)	Group 3 (A)	Group 4	
Coughing and sneezing	1	1	3	0	
Passiveness (depression and anorexia)	1	1	3	0	
Respiratory distress	1	1	2	0	
Nasal and ocular discharge (rhinitis)	1	1	2	0	
Ruffled feather	1	1	2	0	
Dyspnoea	1	1	3	0	
Green watery droppings	1	2	3	0	
Conjunctivitis	1	1	3	0	
Gasping and head shaking	0	0	2	0	
Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control). (0) absence of apparent clinical disease signs, (1) mild signs, (2) moderate signs, and (3) severe signs.

Macroscopic Lesions

The macroscopic postmortem (PM) lesions and lesion scores of different experimental groups were presented in Table 3 and Figures 3, 4, 5, and 6. Chickens in G4 which remained not challenged and nontreated with any therapeutic or preventive treatment (negative control) did not exhibit any macroscopic lesions. G1 subgroup A and G2 subgroup A had similar mean lesion scores, but G2 had the highest total mean scores per tissue over all dpi, except for the trachea, lung, and spleen, as described with the score system as in Table 3 and Figure 5.Table 3 Mean scores for the macroscopic lesions in chickens infected groups.

Table 3Lesions groups	Group1 (A)	Group 2 (A)	Group 3 (A)	Group 4	
Congestion of lung	1	2	3	0	
Tracheal congestion	1	2	3	0	
Catarrhal exudates in trachea	1	1	2	0	
Pericarditis	1	0	3	0	
Perihepatitis and necrosis in liver	1	1	3	0	
Enlargement and necrosis of spleen	1	2	2	0	
congestion of kidney with enlarged	1	1	3	0	
Congestion in liver and lung	1	1	3	0	
Opacity in air sac	1	1	3	0	
Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control). (0) no lesions, (1) slight legions, (2) moderate lesions, and (3) severe lesions.

Figure 3 Postmortem (PM) lesions were most severe for G3 (blue arrow). A: mild airsacculitis; B and C: severe fibrinous airsacculitis. Broilers in group 3 (G3) were infected with Chlamydophila psittaci and low pathogenic avian influenza virus LPAIV H9N2.

Figure 3

Figure 4 Postmortem (PM) lesions were most severe for G3. A and B: fibrinous pericarditis (red star), fibrinous perihepatitis (blue star); C: hemorrrhages on tracheal rings (blue arrow). Broilers in group 3 (G3) were infected with Chlamydophila psittaci and low pathogenic avian influenza virus LPAIV H9N2.

Figure 4

Figure 5 The score of the clinical signs of non-infected and infected chickens with Chlamydophila psittaci, and low pathogenic avian influenza virus LPAIV H9N2. Broilers in group 1 (G1) were infected with only C. psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control).

Figure 5

Figure 6 The score of the necropsy findings of non-infected and infected chickens with Chlamydophila psittaci and low pathogenic avian influenza virus LPAIV H9N2. Broilers in group 1 (G1) were infected with only C. psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control).

Figure 6

The subgroup C (birds treated with aqueous neem leaf extract 8%) in both groups G1 and G2 showed lesion score lesser than those treated with oxytetracycline in subgroups G1 (B) and G2 (B).

PM lesions were most severe for birds in G3 subgroup A as birds showed severe fibrinous pericarditis, airsacculitis, perihepatitis with liver necrosis, serositis, congestion in both lung, kidney and liver, and some birds showed hemorrhages on tracheal rings (Figure 3, Figure 4) and total mean scores per tissue over all dpi were always higher than for G1 and G2 (Figure 6).

Birds in G3 subgroup B treated with oxytetracycline showed less severe lesions when compared with nontreated G3 subgroup A. On the other hand, birds in G3 subgroup C treated with aqueous neem leaf extract (8%) showed the smallest lesion score when compared with G3 subgroup A, and G3 subgroup B. The birds in G3 subgroup C treated with aqueous neem leaf extract (8%) showed improvement in both clinical signs and PM lesions followed by birds in G3 subgroup B which were treated with oxytetracycline when compared with the infected and untreated (positive control) chickens in G3 subgroup A.

C. psittaci Replication in Tissues

C. psittaci was not found in broilers in group 4 (G4) which remained not challenged and non-treated with any therapeutic or preventive treatment (negative control) as well as broilers in group 2 (G2) were challenged with only LPAIV H9N2.

Whereas broilers in G1 subgroup A, which were infected with C. psittaci strain resulted in higher replication in the lung from 6 h to 21 dpi as well as spleen and liver from 8-14 dpi while low replication was in the heart from 8-21 dpi. After the treatment course, the infected and treated birds with 8% aqueous neem leaf extract for 5 consecutive d (G1 subgroup C) showed more diminished C. psittaci replication in the lung, spleen, liver, and heart tissues than birds in G1 subgroup B which were infected and treated birds with oxytetracycline.

Table 4 and Figure 7 showed that chickens infected with C. psittaci and LPAIV H9N2 (G3) had enhanced replication in the lung from 6 h to 21 dpi, as well as the spleen, liver, and heart from 4 to 21 dpi. The treated birds in G3 subgroup C exhibited a more significant reduction in C. psittaci replication in the lung, spleen, liver, and heart tissues following the treatment course than in birds in G3 subgroup B. C. psittaci replication in the tissues of birds in G3 (co-infection) was more detectable than in birds in G1.Table 4 Detection of Chlamydophila psittaci by impression smears from different organs in different times of infected chickens.

Table 4Groups	Challenge	Time post challenge	Number of birds	Lung	Spleen	Heart	liver	
G1 (A)	Chlamydophila psittaci	6 h	1	+	-	-	-	
			2	+	-	-	-	
			3	+	-	-	-	
		4 d	1	++	-	-	+	
			2	++	+	-	+	
			3	++	-	-	-	
		8 d	1	+++	++	+	++	
			2	+++	++	+	-	
			3	+++	++	-	++	
		10 d	1	++	+++	+	++	
			2	++	+++	+	+	
			3	++	++	+	++	
		14 d	1	++	+++	+	+++	
			2	++	++	+	+++	
			3	+	++	+	+++	
		21 d	1	+	++	+	+	
			2	+	-	+	++	
			3	+	+	++	+	
G3 (A)	Chlamydophila psittaci and LPAIV H9N2	6 h	1	+	-	-	-	
			2	+	-	-	-	
			3	+	-	-	-	
		4 d	1	+++	+	++	++	
			2	+++	+	++	+	
			3	+++	+	++	+	
		8 d	1	++++	+++	++	++	
			2	+++	+++	+	++	
			3	++++	+++	+	++	
		10 d	1	++++	++++	++	+++	
			2	+++	+++	++	+++	
			3	+++	+++	++	++	
		14 d	1	++++	++++	++	++++	
			2	+++	++++	++	++++	
			3	++	+++	+++	++++	
		21 d	1	++	++	++	++	
			2	++	+	++	+++	
			3	++	++	++	++	
Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, and broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2.

Figure 7 Chlamydial inclusions impression smear of experimentally cobb chicken 10 days post-infection (G1, A), stained with Giemsa stain in different organs. A: spleen; B: lung; C: Heart and D: liver. Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, and chicken in subgroup (A) remained infected and untreated (positive control).

Figure 7

C. psittaci and LPAI H9N2 Shedding

Birds in G4 which remained not challenged and non-treated with any therapeutic or preventive treatment (negative control) showed neither C. psittaci nor LPAIV H9N2 shedding in all the detection time points. For chickens in G1 subgroup A that were exclusively infected with C. psittaci and left untreated (positive control), the tracheal and cloacal shedding began at 6 h post-infection and lasted until 21 dpi, with cycle threshold (CT) values ranging from 23 to 26.

After the treatment course, birds in G1 subgroup C that were exclusively infected with C. psittaci and received 8% aqueous neem leaf extract for 5 consecutive d showed lesser C. psittaci shedding followed by birds in G1 subgroup B that were exclusively infected with C. psittaci and received oxytetracycline for 5 consecutive d when compared with birds in G1 subgroup A that were exclusively infected with C. psittaci and left untreated (positive control).

Furthermore, chickens infected with only LPAIV H9N2 and left untreated (positive control) (G2 subgroup A), the tracheal and cloacal shedding started from 2 dpi to 8 dpi with CT ranging from 22 to 24. Cloacal and tracheal swabs were qPCR positive (CT < 40) as shown in Figures 8, 9, and 10.Figure 8 Amplification curve for cloacal and tracheal swabs in chickens infected with Chlamydophila psittaci (G1, A) after 6 h post-infection. Broilers in group 1 (G1) were infected with only C. psittaci, and chicken in subgroup (A) remained infected and untreated (positive control).

Figure 8

Figure 9 Amplification curve for cloacal and tracheal swabs in chickens infected with Chlamydophila psittaci (G 1, A) after 21 days post-infection. Broilers in group 1 (G1) were infected with only C. psittaci, and chickens in subgroup (A) remained infected and untreated (positive control).

Figure 9

Figure 10 Amplification curve for cloacal and tracheal swabs in chickens infected with low pathogenic avian influenza virus LPAIV H9N2 (Group 2, A) after 2 days post-infection. Broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2 and chickens in subgroup (A) remained infected and untreated (positive control).

Figure 10

After the treatment course, birds in G2 subgroup C that were exclusively infected with only LPAIV H9N2 and received 8% aqueous neem leaf extract for 5 consecutive d showed lesser LPAIV H9N2 shedding followed by birds in G2 subgroup B that were exclusively infected with LPAIV H9N2 and received oxytetracycline for 5 consecutive d when compared with birds in G2 subgroup A that were exclusively infected with LPAIV H9N2 and left untreated (positive control).

Birds in G3 subgroup A which were infected with C. psittaci and LPAIV H9N2, and left untreated (positive control) showed the highest C. psittaci and LPAIV H9N2 shedding that started from 6 h post infection and continued to 21 dpi with CT ranging from 23-26 for C. psittaci. The shedding of LPAIV H9N2 started from 2 dpi to 8 dpi with CT ranging from 23-26 followed by birds in G3 subgroup B which were infected with C. psittaci and LPAIV H9N2 and received oxytetracycline for 5 consecutive d. Birds in G3 subgroup C which were infected with C. psittaci and LPAIV H9N2 and received 8% aqueous neem leaf extract for 5 consecutive d showed minimal shedding for both C. psittaci and LPAIV H9N2.

Effect of Treatment With Oxytetracycline and Neem Leaf on Body Performance

As presented in Table 5, at 14 d of birds age, birds in G4 which remained not challenged and non-treated with any therapeutic or preventive treatment (negative control) showed a significant (P < 0.05) increase in BW when compared with G1 (infected with only C. psittaci), G2 (infected with only LPAIV H9N2), and G3 (infected with both with C. psittaci and LPAIV H9N2). Birds in G3 challenged with C. psittaci and LPAIV H9N2 showed a significant (P < 0.05) decrease in BW when compared with G1 and G2 (Table 5 and Figure 11). At 2-days-old, birds in G4 showed a significant increase in BW when compared with birds in G1, G2, and G3 while birds in G3 showed the lowest BW when compared with birds in G1 and G2 (Table 5 and Figure 11).Table 5 Comparison between the average body weight test after a specific time among treated groups.

Table 5Groups	14-days-old	21-days-old	28-days-old	35-days-old	
G1	A	429.00 ± 8.51 c	718.64 ± 23.75 ef	1,316.00 ± 43.01 h	2,140.56 ± 78.23 f	
B	437.00 ± 8.40 b	816.60 ± 23.80 c	2,147.50 ± 115.28 c	2,280.00 ± 193.27 e	
C	439.00 ± 8.30 b	828.61 ± 23.80 b	2,446.00 ± 112.90 a	2,673.00 ± 126.13 a	
G2	A	376.60 ± 6.49 e	725.02 ± 17.12 e	1,207.50 ± 33.03 j	1,804.44 ± 40.77 h	
B	387.63 ± 6.49 d	734.06 ± 17.14 d	2,020.10 ± 67.05 f	2,346.83 ± 74.57 d	
C	388.67 ± 6.49 d	736.00 ± 17.10 d	2,032.50 ± 67.08 e	2,345.83 ± 74.57 d	
G3	A	349.67 ± 7.03 g	657.55 ± 8.86 h	1,293.50 ± 46.73 i	1,908.33 ± 87.89 g	
B	345.66 ± 7.02 g	676.45 ± 8.80 g	1,832.00 ± 1.114 g	2,125.00 ± 20.25 f	
C	356.65 ± 7.01 f	689.57 ± 8.86 f	2,254.00 ± 56.24 b	2,550.00 ± 79.62 c	
G4	689.22 ±7.97 a	1,350.23 ±13.43 a	2,078.00 ± 12.41 d	2,610.00 ± 71.41 b	
Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control). At 21 days post-infection (dpi), birds in G1, G2, and G3 were divided into 3 subgroups of 10 birds each: subgroup (A) remained infected and untreated (positive control), subgroup (B) infected and received oxytetracycline for 5 consecutive days, and subgroup (C) infected and received 8% aqueous neem leaf extract for 5 consecutive days. Values are means ± standard errors, and the values with the same letter within a column are not significantly (P > 0.05) different according to Duncan multiple range tests.

Figure 11 The average body weight (weekly) for all groups including all subgroups (A, B, and C) for each group in different weeks before wk 1 (14-days-old), wk 2 (21-days-old), wk 3 (28-days-old), and after treatment wk 4 (35 days old). Broilers in group 1 (G1) were infected with only Chlamydophila psittaci, broilers in group 2 (G2) were infected with only low pathogenic avian influenza virus LPAIV H9N2, broilers in group 3 (G3) were infected with C. psittaci and LPAIV H9N2, and broilers in group 4 (G4) remained not challenged and non-treated with any therapeutic or preventive treatment (negative control).

Figure 11

At 28-days-old, after treatment with oxytetracycline in subgroups B and neem extract in subgroups C, the birds in G1 subgroup C showed a significant (P < 0.05) increase in BW followed by birds in G3 subgroup C. On the other hand, birds in G1 subgroup B, and birds in G3 subgroup A (challenged with C. psittaci and LPAIV H9N2 and untreated) showed the lowest BW compared to other groups (Table 5).

At the end of the experiment (35-days-old), the birds in G1 which were infected with C. psittaci and treated with neem extract (subgroup C) showed a significant (P < 0.05) increase in BW followed by birds in G4 subgroup C, followed by birds in G3 subgroup C then birds in G2 subgroup C (Table 5). The results demonstrated that all of the subgroups treated with neem extract had a substantial increase in BW when compared to birds treated with oxytetracycline in G1 subgroup B, G2 subgroup B, and G3 subgroup B (Table 5).

At 35-days-old, the birds in challenged untreated subgroups (G1 subgroup A, G2 subgroup A, and G3 subgroup A) showed the lowest BW when compared with treated groups and negative control birds in G4.

Figure 11 showed that in the first week, G4 had the highest average BW, followed by G1, while G2 and G3 had low average BW. In the second week, birds in G4 showed higher average BW than birds in G1, but birds in G3 and G4 showed lower average BW. In the second week, birds in G4 showed higher average BW than birds in G1, but birds in G3 and G4 showed lower average BW.

In the third week, birds in G1 which were infected with C. psittaci and treated with neem extract (subgroup C) had the highest average BW when compared to those infected with C. psittaci and treated with oxytetracycline (subgroup B). Similarly, birds in G3 subgroup C which were infected with C. psittaci and LPAIV H9N2 and treated with neem extract had the highest average BW when compared to those treated with oxytetracycline (G3 subgroup B) (Table 5 and Figure 11).

In general, subgroups (B and C) in both G1 and G3 (treated with oxytetracycline and neem extract) had higher average BW than G1 and G3 subgroup A which remained infected and untreated (positive control). Compared to birds in groups G1 subgroup A, and G2 subgroup A, those in G3 subgroup A had the lowest average BW. In the fourth week, birds in G4 had the best average BW, followed by G1 subgroup C, and G3 subgroup C, while birds in G2 subgroup C had the lowest average BW (Table 5, Figure 11).

DISCUSSION

In birds, C. psittaci causes systemic and respiratory infections that can last for a long period in poor conditions, and birds are prone to mixed infections by C. psittaci and other diseases (Karpinska, et al., 2014). In chickens with respiratory diseases, LPAIV H9N2 and C. psittaci are regularly isolated, but their functions in co-infection are still unknown (Setta et al., 2023). It was established that C. psittaci reduces host immunity to enhance H9N2 infections (Chu et al., 2016; Setta et al., 2023; Yehia et al., 2023).

As previously reported by Yin et al. (2013), the chickens displayed macroscopic PM lesions such as nephritis, thickening of the air sac, and/or septicemia in addition to general clinical signs of illness with respiratory symptoms such as rhinitis, sneezing, and coughing.

In the current investigation, the birds in G3 subgroup A, which were infected with both with C. psittaci and LPAIV H9N2, and remained untreated (positive control), exhibited more severe clinical signs than the other groups, G1 subgroup A (infected with only C. psittaci and remained untreated) and G2 subgroup A (infected with only LPAIV H9N2 and remained untreated). This is because both infections have synergism in action, as C. psittaci reduces immunity and begins secondary infection with LPAIV H9N2, which also has an immunosuppressive impact on the bird's immunity, leading to an exaggeration of the severity of respiratory issues (Sun and Liu, 2015; Umar et al., 2016; Chu et al., 2017).

In the present study, we hypothesized that infection with C. psittaci causes immunological organ damage, modifies the generation of inflammatory mediators, and alters defensive mechanisms specific to individual organs. We also hypothesized that these interactions may increase virus adhesion, making birds more susceptible to LPAIV H9N2 and other illnesses. A recent study found that respiratory diseases were associated with both LPAIV H9N2 and C. psittaci (Yin et al., 2013).

Smears of lung, liver, spleen, kidney, and air sacs can be used to identify C. psittaci using cytological staining techniques, including Giemsa, Giménez, modified Giménez, Ziehl-Neelsen, and Macchiavello's stains (Campbell, 2015). In our study, the pathogenesis of this pathogen develops after the experimental infection, with primary replication taking place in upper respiratory tract epithelial cells. The infection subsequently spreads to epithelial cells and macrophages in the lower respiratory system (lung, abdomen, and thoracic air sacs), and then to the spleen, liver, kidney, and heart muscle. The lesions identified in this investigation were more severe in the lung impression smear stained with Giemsa than in the spleen and heart. After that, bacteria appear in blood plasma and monocytes, resulting in a systemic form that affects various parts of the body (Yin et al., 2013). LPAIV H9N2 began the viral shedding after 2 dpi with increased nasal and cloacal shedding in mid-infection late for C. psittaci but stopped at 10 dpi in LPAIV H9N2.

The confirmatory diagnostic test qRT-PCR revealed nasal and cloacal shedding of the challenged bacteria (C. psittaci) 6 h after infection, which was consistent with the findings of Lagae et al. (2016). The latency of an infection is determined by the amount of nasal and cloacal shedding, as noted by Chu et al. (2016), who reported higher levels of virus shedding and more severe histopathological abnormalities that resulted in long-term damage to the chickens, potentially explaining ongoing pneumonia and air sacculitis in broiler farms.

The current study is regarded as an example of birds having immune suppression due to co-infection with C. psittaci and LPAIV H9N2. More research is needed to determine whether C. psittaci-mediated immune suppression impacts different vaccination programs for avian diseases. Because of its capacity to suppress the manufacture of proteins on the chromosome, oxytetracycline was the most effective antibiotic therapy in our investigation for groups infected with C. psittaci alone rather than mixed groups (Vanrompay, 2020). However, continuous exposure to antibiotics raises the chance of acquiring drug resistance in Chlamydia (Laroucaua et al., 2015; Vanrompay, 2020). While the bacteria in birds respond very effectively to oxytetracycline (Jawad et al., 2014; Vanrompay, 2020), the birds may have considerable negative health outcomes.

From our data, 8% aqueous neem extract alleviates the severity of clinical signs and PM lesions in the treated birds in G1 subgroup C (broilers infected only with C. psittaci), G2 subgroup C (broilers infected only with LPAIV H9N2), and G3 subgroup C (broilers infected with C. psittaci and LPAIV H9N2). Our findings are consistent with those of Siddiqui et al. (1992) and Awasthy et al. (1999), who reported that treatment with aqueous neem leaf extract resulted in milder clinical signs and PM lesions. They also noted that aqueous neem leaf extract, which contains azadirachtin, quercetin, and B-sitosterol, suppresses a variety of pathogenic bacteria, including Salmonella, Klebsiella, and Staphylococcus.

In addition, birds in subgroup C treated with 8% aqueous neem extract in all groups (G1, G2, and G3) in the present study showed superior improvement in both clinical symptoms and PM lesions than birds treated with oxytetracycline in subgroup (B) in all groups (G1, G2, and G3). This observation may have contributed to the immunosuppressive effect of extended antibiotic use in birds' gut microbiota, which had a negative impact on birds' immunological response.

Furthermore, our findings demonstrated a highly significant difference in BW and improved FCR in birds treated with 8% aqueous neem extract compared to other untreated groups. The results were consistent with the findings of Chakravarty and Prasad (1991), who demonstrated that, in comparison to controls, broilers subjected to neem leaf extract had the largest BW increase and superior FCR.

In addition to its medicinal properties, which include immune-modulatory, anti-inflammatory, antiviral, and antibacterial effects (Hegazy et al., 2018; Hegazy et al., 2022; Hegazy et al., 2023), neem also contains macro minerals like magnesium, potassium, and phosphorous as well as micro minerals such as copper, iron, manganese, and zinc, which likely explain its increased body weight gain (Sondhi and Agarwa, 1995). Neem leaves are rich in protein, carbohydrates, minerals, vitamin C, carotene, and other nutrients. Glutamic acid, tyrosine, aspartic acid, amino acids, and a number of fatty acids are also present. According to Alzohairy (2016), the polyphenolic flavonoid quercetin and nimbosterol (β-sitosterol) found mostly in the leaves have the potential to boost the birds' metabolism, productivity, and overall health.

CONCLUSIONS

Avian chlamydiosis is a severe avian pathogen that poses a significant zoonotic risk. Respiratory co-infections caused by the LPAIV H9N2 can cause significant financial losses in the poultry industry. The use of non-toxic, all-natural products is becoming increasingly popular for controlling various avian diseases. Chronic latent or main C. psittaci infections can cause immunological suppression, making birds more vulnerable to other infections. The oral dose of 8% A. indica aqueous leaf extract was efficient in suppressing both C. psittaci and LPAIV H9N2, increasing bird productivity, shedding, and FCR.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

The authors gratefully acknowledge Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2024R84 ), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. The authors extend their appreciation to the Deanship of Scientific Research at King Khalid University for funding this work through large group Research Project under grant number (RGP2/530/44 ).

Funding: This project was funded by Abu Dhabi Award for Research Excellence-Department of Education and Knowledge (Grant #: 21S105) and UAEU Program for Advanced Research (Grant #: 12S169) to K. El-Tarabily.

Author Contributions: Conceptualization, A.M.H., A.M.M., H.M.S., and K.A.E.-T., formal analysis, M.I.A.-z., A.M.A., N.M.A., M.T.E.-S., and L.R.A., investigation, A.M.H., A.M.M., H.M.S. and A.M.S., data curation, S.M.A.B., MM.A.-Q., and H.M.N.T., writing original draft preparation, A.M.H., A.M.M., H.M.S., K.A.E.-T., M.I.A.-z., A.M.A., N.M.A., M.T.E.-S., L.R.A., S.M.A.B., MM.A.-Q., and H.M.N.T., writing final manuscript and editing, A.M.H., A.M.M., H.M.S., and K.A.E.-T., visualization and methodology, A.M.H., A.M.M., H.M.S., M.I.A.-z., A.M.A., N.M.A., M.T.E.-S., L.R.A., S.M.A.B., MM.A.-Q., and H.M.N.T. All authors have read and agreed to the published version of the manuscript.
==== Refs
REFERENCES

Abd El-Hack M.E. El-Saadony M.T. Alqhtani A.H. Swelum A.A. Salem H.M. Elbestawy A.R. Noreldin A.E. Babalghith A.O. Khafaga A.F. Hassan M.I. El-Tarabily K.A. The relationship among avian influenza, gut microbiota and chicken immunity: an updated overview Poult. Sci. 101 2022 102021
Abdel Hamid H.S. Ellakany H.F. Hussien H.A. El-Bestawy A.R. Abdel Baky K.M. Pathogenicity of an avian influenza H9N2 virus isolated from broiler chickens in Egypt Alex. J. Vet. Sci. 51 2016 90
Alethae M.F. Sandra K.C. Page A.P. Supplemental assay method for titration of Chlamydophila felis (formerly feline Chlamydia psittaci) in embryonated chicken eggs. United States Department of Agriculture 2014 Center for Veterinary Biologics Testing Protocol, United States Department of Agriculture Animal and Plant Health Inspection Service Ames, IA, USA 1 16
Alzohairy M. Therapeutics role of Azadirachta indica (Neem) and their active constituents in diseases prevention and treatment Evid. Based. Complement. Alternat. Med. 2016 2016 7382506
Awasthy K.S. Chaurasia O.P. Sinha S.P. Prolonged murine genotoxic effects of crude extracted from Neem Phytotherapy Res 13 1999 81 83
Balsamo G. Maxte A.M. Midla J.W. Murphy J.M. Wohrle R. Edling T.M. Fish P.H. Flammer K. Hyde D. Kutty P.K. Kobayashi M. Helm B. Oiulfstad B. Ritchie B.W. Stobierski M.G. Ehnert K. Tully Jr T.N. Compendium of measures to control Chlamydia psittaci infection among humans (psittacosis) and pet birds (avian chlamydiosis) J. Avian Med. Surg. 31 2017 262 282 28891690
Borel N. Polkinghorne A. Pospischil A. A review on chlamydial diseases in animals: still a challenge for pathologists? Vet. Pathol. 55 2018 374 390 29310550
Branley J.M. Weston K.M. England J. Dwyer D.E. Sorrell T.C. Clinical features of endemic community-acquired psittacosis New Microbes New Infect. 2 2014 7 12 25356332
Campbell T.W. Exotic Animal Hematology and Cytology 4th Ed. 2015 Wiley Blackwell Ames, IA, USA 432
Chakravarty A. Prasad J. Study on the effect of neem leaf extract and neem cake extract on the performance of broiler chicks Indian J. Poult. Sci. 24 1991 37 38
Chu J. Zhang Q. Zhang T. Han E. Zhao P. Khan A. He C. Wu Y. Chlamydia psittaci infection increases mortality of avian influenza virus H9N2 by suppressing host immune response Sci. Rep. 6 2016 29421 27405059
Chu J. Zhang Q. Zuo Z. El-Ashram S. Guo Y. Zhao P. Huang S. He C. Khan A. Co-infection of Chlamydia psittaci with H9N2, ORT and Aspergillus fumigatus contributes to severe pneumonia and high mortality in SPF chickens Sci. Rep. 7 2017 13997 29070907
Dickx V. Beeckman D.S.A. Dossche L. Tavernier P. Vanrompay D. Chlamydophila psittaci in homing and feral pigeons and zoonotic transmission J. Med. Microbiol. 59 2010 1348 1353 20705727
El Nagar E.M. Salem H.M. Gamal M.A. El-Saied M.A. Patho-molecular identification of circulating H9N2 avian influenza virus in Egypt J. Adv. Vet. Res. 14 2024 152 157
Enany M.E. Mousa H.A. Salem H.A. Investigations on the prevalence of chlamydiosis in turkey flocks in Egypt with special emphasis on immunopathological characterization of Chlamydophila psittaci Glob. Vet. 3 2009 424 428
Gado H.A. Ghanem I.A. Selim A.A. Elsafty M.M. Soliman R.A. Eid A.A.M. Efficacy of commercial vaccines against H9N2 avian influenza challenge in chickens Adv. Anim. Vet. Sci. 10 2022 35 48
Grayston J.T. Wang S. New knowledge of chlamydiae and the diseases they cause J. Infect. Dis. 132 1975 87 105 1097546
Harkinezhad T. Geens T. Vanrompay D. Chlamydophila psittaci infections in birds: a review with emphasis on zoonotic consequences Vet. Microbiol. 135 2009 68 77 19054633
Hegazy A.M. Kamel A.M. Rehan I.F. Tolba H. The Effect of neem leaves extract as immunostimulant before chicken infectious anaemia vaccination in broilers Slov. Vet. Res. 60 2023 5 15
Hegazy A.M. Tolba H.M.N. Abd el-Samie L.K. Abdelaziz A.M. Ali A.M.A. Effect of the medicinal plant (Azadirachta indica) on Chlamydophila psittaci infection in broiler chickens Slov. Vet. Res. 55 2018 85 93
Hegazy A.M. Yehia N. Hassan A.F. El-Saadony M.T. Aboelenin S.M. Soliman M.M. Tolba H.M. The potency of newly development H5N8 and H9N2 avian influenza vacccines against the isolated strains in laying hens from Egypt during 2019 Saudi J. Biol. Sci. 28 2022 5310 5316
Jawad Z. Younus M. Rehman M. Munir R. Maqbool A. Shahzad W. Masood S. Muhammad K. Effect of Azadirachta indica on the hepato-renal functions in broilers chickens J. Anim. Plant Sci. 24 2014 1012 1018
Kaleta E.F. Taday E.M. Avian host range of Chlamydophila spp. based on isolation, antigen detection and serology Avian Pathol 32 2003 435 461 14522700
Karpinska T.A. Kozaczynski W. Niemczuk K. Jasik A. Kycko A. Reichert M. Mixed infection by fowlpox virus and Chlamydophila psittaci in a commercial laying hen flock Acta Vet. Hung. 62 2014 42 51 23974932
Lagae S. Dumont A. Vanrompay D. Examination of the in vivo immune response elicited by Chlamydia psittaci in chickens Vet. Immunol. Immunopathol. 170 2016 54 64 26848049
Laroucau K. Ortega N. Vorimore F. Aaziz R. Mitura A. Szymanska-Czerwinska M. Cicerol M. Salinas J. Sachse K. Caro M.R. Detection of a novel Chlamydia species in captive spur-thighed tortoises (Testudo graeca) in southeastern Spain and proposal of Candidatus Chlamydia testudinis Syst. Appl. Microbiol. 43 2020 126071
Laroucaua K. Aaziz R. Meurice L. Servas V. Chossal I. Royer H. De Barbeyrac B. Vaillant V. Moyen J.L. Meziani F. Saschse K. Outbreak of psittacosis in a group of women exposed to Chlamydia psittaci infected chickens Euro. Surveill. 20 2015 21155 26111240
Leila S.F.M. A manual on some Philippine Medicinal Plants (preparation of drug materials) Bot. Soc. 20 1977 78 82
Mahmood M.S. Amir H.W. Abbas R.Z. Aslam B. Rafique A. Evaluation of antiviral activity of Azadirachta indica (Neem) bark extract against Newcastle disease virus. Pak Vet. J. 38 2018 25 28 10.29261/pakvetj/2018.005
Nath S. Mandal G.P. Panda N. Dash S.K. Effect of neem (Azadirachta indica) leaves powder and cinnamon (Cinnamomum zeylanicum) oil on growth performance of broiler chickens Indian J. Anim. Res. 57 2023 340 344 10.18805/IJAR.B-5027
Ravichandran, K., S. Anbazhagan, K. Karthik, M. Angappan, and B. Dhayananth. 2021. A comprehensive review on avian chlamydiosis: a neglected zoonotic disease. Trop. Anim. Health Prod. 53:414.
Reed L.J. Muench H. Simple method of estimating fifty percent endpoints Am. J. Epidemiol. 27 1938 493 497
Rodolakis A. Laroucau K. Chlamydiaceae and chlamydial infections in sheep or goats Vet. Microbiol. 181 2015 107 118 26255554
Rodolakis A. Mohamad K.Y. Zoonotic potential of Chlamydophila Vet. Microbiol. 140 2010 382 391 19345022
Sachse K. Laroucau K. Vanrompay D. Avian chlamydiosis Curr. Clin. Microbiol. Rep. 2 2015 10 21
Sareyyüpoğlu B. Cantekin Z. Use of a multiplex-polymerase chain reaction for detection of Salmonella and Chlamydophila psittaci from caged birds Ankara Üniv. Vet. Fak. Derg. 56 2009 269 273
Setta A. Yehia N. Shakak A.O. Al-Quwaie D.A. Al-Otaibi A.M. El-Saadony M.T. El-Tarabily K.A. Salem H. Molecular detection of highly pathogenic avian influenza H5N8 in commercial broiler chicken farms from 2019 to 2022 Poult. Sci. 102 2023 102639
Shabat M.B. Meir R. Haddas R. Lapin E. Shkoda I. Raibstein I. Perk S. Davidson I. Development of a real-time TaqMan RT-PCR assay for the detection of H9N2 avian influenza viruses J. Virol. Methods. 168 2010 72 77 20435070
Siddiqui S. Faizi S. Siddique B.S. Ghisuddin S. Constituents of Azadirachta indica: isolation and structure elucidation of a new antibacterial tetranortriterpenoid, mahmoodin and a new protolimonoid, naheedin J. Nat. Prod. 55 1992 303 310 1593280
Smith E.I. Reif J.S. Hill A.E. Slota K.E. Miller R.S. Bjork K.E. Pabilonia K.L. Epidemiologic characterization of Colorado backyard bird flocks Avian Dis. 56 2012 263 271 22856180
Sondhi S.M. Agarwa N. Determination of mineral elements in medicinal plants used for the cure of bronchitis, kidney and bladder disorder, skin diseases and gonorrhoea Hamdard Medicus 38 1995 24 29
Stokes H.S. Berg M.L. Bennett A.T.D. A review of chlamydial infections in wild birds Pathogens 10 2021 948 34451412
Sun Y. Liu J. H9N2 influenza virus in China: a cause of concern Protein Cell 6 2015 18 25 25384439
Szymańska-Czerwińska M. Zaręba-Marchewka K. Niemczuk K. New insight on chlamydiae J. Vet. Res. 19 2023 559 565
Tolba H.M.N. Abou Elez R.M.M. Elsohaby I. Risk factors associated with Chlamydia psittaci infections in psittacine birds and bird handlers J. Appl. Microbiol. 126 2019 402 410 30353983
Umar S. Sarfraz S. Mushtaq A. Attique M. Emerging threat of H9N2 viruses in poultry of Pakistan and vaccination strategy Worlds Poult. Sci. J. 72 2016 343 352 10.1017/S0043933916000179
Vanrompay, D. 2020. Avian chlamydiosis. In: Diseases of Poultry. Editor(s): C. M. Logue, L. R. McDougald, V. Nair, D. L. Suarez, S. de Wit, D. Johnson, M. Kromm, T. Y. Prajitno, I. Rubinoff, G. Zavala. John Wiley and Sons: Hoboken, NJ, USA pp. 1086–1107.
Vanrompay D. Andersen A.A. Ducatelle R. Haesebrouck F. Serotyping of European isolates of Chlamydia psittaci from poultry and other birds J. Clin. Microbiol. 31 1993 134 137 8417017
World organization for animal health (OIE). 2018. Avian Influenza (Infection with Avian Influenza Viruses). OIE Terrestrial Manual, Paris, France, 821–843.
Wylie M.R. Merrell D.S. The antimicrobial potential of the neem tree Azadirachta indica Front. Pharmacol. 13 2022 891535
Xie, S., D. H. Tomic, S. M. Chong, and J. Lee. 2024. Avian chlamydiosis, In: Ecology of Wild Bird Diseases. Editor: S. Fereidouni. CRC; Boca Raton, FL, USA, 19.
Yehia N. Mohamed F.H. Al-Zaban M.I. Amer F. Baazaoui N. Khattab M.S. Abd Elhalem Mohamed A. Salem H.M. El-Saadony M.T. El-Tarabily K.A. Omar D.M. The influence of Spirulina extract on pathogenicity, immune response, and vaccine efficacy against H9N2 avian influenza virus in specific pathogen free chickens Poult. Sci. 103 2024 103194
Yehia N. Salem H.M. Mahmmod Y. Said D. Samir M. Mawgod S.A. Sorour H.K. AbdelRahman M.A.A. Selim S. Saad A.M. El-Saadony M.T. El-Meihy R.M. Abd El-Hack M.E. El-Tarabily K.A. Zanaty A.M. Common viral and bacterial avian respiratory infections: an updated review Poult. Sci. 102 2023 102553
Yin L. Lagae S. Kalmar I. Borel N. Pospischil A. Vanrompay D. Pathogenicity of low and highly virulent Chlamydia psittaci isolates for specific-pathogen-free chickens Avian Dis. 57 2013 242 247 24689181
