
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00708-9
10.1016/j.psj.2024.104129
104129
GENETICS AND MOLECULAR BIOLOGY
Ovomucoid gene polymorphism and its influence on quality changes at various storage timepoint of eggs from two strains of Japanese quail
Knaga S. *
Kasperek K. kornel.kasperek@up.lublin.pl
†1
Batkowska J. †
Drabik K. †
Zięba G. †
⁎ Department of Animal Biotechnology and Genetics, Bydgoszcz University of Science and Technology, Bydgoszcz 85-084, Poland
† Institute of Biological Basis of Animal Production, University of Life Sciences in Lublin, Lublin, 20-950, Poland
1 Corresponding author: kornel.kasperek@up.lublin.pl
29 7 2024
10 2024
29 7 2024
103 10 10412925 5 2024
24 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
During storage, irreversible changes occur in eggs, resulting in a decline in their quality, predominantly affecting the albumen. Ovomucoid, a major protein found in egg white, belongs to the Kazal-type serine proteinase inhibitors and serves to protect the embryo from microorganisms. Notably, in chicken eggs, it is a significant allergen. There is a possibility that its polymorphism also influences the quality and stability of table eggs. Hence, this study aimed to evaluate the potential effect of polymorphism in the ovomucoid gene and protein on quality changes during the storage of eggs derived from 2 strains of Japanese quail, encompassing various utility types. Eggs from selected females of laying and meat-type breeds were stored for 14 wk, with egg quality traits assessed 10 times during this duration. DNA was isolated from each female, and sequencing was conducted on all exons of the ovomucoid gene. In total, 5 SNPs were identified in exons and adjacent intronic sequences, with SNP1 (13:12355585), SNP4 (13:12356594), and SNP5 (13:12358538) leading to amino acid substitutions in the ovomucoid protein. Notably, all SNPs except SNP5 were identified in the ovomucoid gene of Japanese quail for the first time. The results demonstrated that in the F33 strain, SNP1, SNP3, and SNP4 exhibited significant associations with egg weight, whereas in the S22 strain, SNP5 significantly affected yolk color and various eggshell quality traits, including eggshell weight, eggshell thickness, and breaking strength, throughout the storage period. Furthermore, a haplotype block containing 2 SNPs (3 and 4) was identified, exhibiting 2 distinct haplotypes that significantly affected egg weight, eggshell weight, and breaking strength at various storage time points during egg quality analyses. These findings provide novel insights into the genetic basis of egg quality during storage and have the potential to be integrated into breeding programs for these strains.

Key words

ovomucoid
polymorphism
Japanese quail
egg quality
storage
==== Body
pmcINTRODUCTION

The ovomucoid of Japanese quails is a glycoprotein found in egg albumen, constituting approximately 10% of all its proteins. Along with its signal peptide, it is composed of 210 amino acids. Purified ovomucoid had a molecular weight of 26 kDa (Takahashi and Asao, 1993; Hao et al., 2023). The molecules of ovomucoid are composed of a single polypeptide chain, which consists of 3 tandem homologous domains (AA1−68, AA65−130, AA131−186), each containing 3 intradomain disulfide bridges (Laskowski et al., 1990). These domains serve as inhibitors of serine proteases from the pancreatic secretory trypsin inhibitor family - Kazal. Proteinase inhibition is due to the formation of a very stable complex between the conformationally constrained reactive site of an ovomucoid domain and the active site of the proteinase (Laskowski and Kato, 1980; Scott et al., 1987). Ovomucoid is a double-headed trypsin inhibitor (i.e. inhibit 2 enzyme molecule per ovomucoid molecule) consisting of an inactive first domain and active second and third domains (Takahashi et al., 1994). In the second and third domains, at positions Lys89 and Lys149, reactive sites are located (Hao et al., 2023). Japanese quail ovomucoid, unlike chicken, acts as an inhibitor of human trypsin (Feeney et al., 1969; Cui et al., 2023). This phenomenon is very important for human nutrition. Amino acid sequence studies of this protein revealed the presence of 4 asparagine residues where sugar chains are attached (Weber et al., 1981; Ma et al., 2021). Carbohydrate moiety constitutes approximately 11% of the protein mass (Lakshminarayanan et al., 2006). The presence of 9 disulfide bridges contributes to the heat stability of Japanese quail ovomucoid. It has been reported to retain about 100% of its original activity over a pH range from 1 to 12 after a 24-h incubation at 37°C, and 70% of its original activity was maintained after a 1-h incubation at 100°C (Takahashi et al., 1994, 2003; Kato and Matsuda, 1997; Porta et al., 2013). The ovomucoid of Japanese quail egg white is known also as a protein component responsible for egg allergy. The antigenic and inhibitory activities of ovomucoid were observed even after proteolytic digestion or exposure to high temperatures, indicating its dependence on the conformational structure of domains tightly folded by disulfide linkages (Takahashi et al., 1994, 2003).

Similarly, to many other proteins, ovomucoid exhibits polymorphism. The earliest and so far the only studies discussing the different forms of this protein were conducted by Kato et al. (1976), later confirmed by Bogard et al. (1980). These researchers observed that the Ser162Gly polymorphism led to the formation of 3 ovomucoid protein phenotypes: S, G, and SG. The G form showed significantly weaker inhibitory properties compared to the S form. Perhaps this polymorphism had an impact on the antimicrobial properties of ovomucoid and/or embryonic growth and development, as the S form was fixed in Japanese quail breeding populations. Confirmation of the effect of ovomucoid gene polymorphism on hatchability comes from studies by Huang et al. (2011) conducted on Tsaiya duck. In these studies, a 3-nucleotide deletion within the intronic sequence resulted in increased expression of ovomucoid protein, which in turn had a negative impact on reproductive traits, particularly hatchability.

During storage, irreversible changes occur in the egg, leading to a decrease in hatchability on one hand and changes in quality characteristics resulting in deterioration of nutritional and taste values on the other. Albumen quality is particularly affected by these changes. Gradual alkalization of the albumen leads to weakening of its gel structure, resulting in dehydration of the thick albumen and decrease of Haugh units. Additionally, water penetration from the albumen into the yolk occurs, leading to an increase in the weight of the yolk and weakening of the vitelline membrane, which may lead to its rupture. Storage is also associated with gradual penetration of microorganisms through the pores of the shell, which may affect both embryo development (hatchery eggs) and the safety of the food product, such as table eggs. Assuming the possibility of polymorphism in the ovomucoid gene and consequently changes in the amino acid sequence and protein conformation, one should also expect different effects of these changes on egg quality traits during storage. Therefore, the aim of our study was to verify this hypothesis.

MATERIALS AND METHODS

Ethics Statement

All experimental procedures were approved by the Local Ethical Commission for Animal Experiments in Lublin (approval no. 35/2021) and were performed in accordance with Polish and European regulations.

Japanese Quail Strains

A total of 120 females from 2 distinct genetic strains (F33 and S22) were used in the study. The F33 strain consisted of unselected meat-type Pharaoh breed quails, which have been maintained at the University of Life Sciences in Lublin for over 80 generations. The S22 strain comprised laying-type quails previously selected for 19 generations for high total cholesterol concentration in egg yolk (Baumgartner et al., 2008) and have not undergone further selection since 2007. Further details on these strains can be found elsewhere (Maiorano et al., 2011; Tavaniello et al., 2014).

The birds were housed in a cage system with controlled environmental conditions adjusted based on age. During the rearing phase, quails were kept in group cages (90 birds per cage). When the birds reached 5 weeks old, females were transferred to smaller cages (4 birds per cage) equipped with nipple drinkers and feeders. Standard lighting conditions (17 h of light and 7 h of darkness) were maintained during the production phase. A balanced complete feed appropriate for their age and production level was provided ad libitum, containing 11 MJ of metabolizable energy, 16.5% crude protein, 5.50% crude fiber, 0.40% assimilable phosphorus, 4.0% calcium, 0.88% lysine, and 0.35% methionine per kilogram during the production phase. Throughout the experiment, birds had unrestricted access to water.

Egg Quality Traits

Starting from 30 weeks of age, 10 consecutive eggs were collected from each female, marked with an individual female number, weighted on the day of laying, and stored for maximum 14 weeks at a temperature of 15°C and a humidity of 70%. On day 1 (1D) and in the 2nd, 3rd, 4th, 9th, 10th, 11th, 12th, 13th, and 14th wk of storage (2W, 3W, 4W, 9W, 10W, 11W, 12W, 13W, 14W), various egg quality traits were assessed. During each measurement period egg weight (EW) were determined, enabling the calculation of egg specific gravity (SG) using Archimedes' principle. Measurements were conducted using a WPS 1200/C electronic scale capable of recording suspended materials (RadWag, Radom, Poland). Breaking strength (BS) was determined using an Instron Testing Machine Instrument Model Mini 55 (Instron Ltd, High Wycombe, UK). Yolk weight (YW) and color (YC), eggshell weight (SW), shell weight per unit surface area (mg/cm2; SWUA), Haugh units (HU), and eggshell thickness (including internal shell membranes-EST) were measured using semi-automated egg quality assessment equipment (TSS-Technical Services and Supplies, York, UK). The equipment included a micro-processor (EQM+), 2 electronic scales (NavigatorXT model AV8101CM from Ohaus Corporation, Pine Brook, NJ, and KERN 440-49 from KERN & Sohn, GmBH, Balingen, Germany), a device for measuring thick albumen height (QCH), a colorimeter (QCC), and a micrometer screw (QCT). Albumen weight (AW) was calculated as the difference between the egg weight and the combined weight of the yolk and shell. Furthermore, the shell (S%), yolk (Y%), and albumen (A%) percentages in the total egg weight were computed. During each measurement period, the pH of the albumen (pH) was determined using a pH meter cp401 (Elmetron, Zabrze, Poland). The percentage weight loss of the eggs during storage (ΔEW) was calculated by subtracting the egg weight in the storage week from the weight of the egg at the time of collection, and multiplying the result by 100.

DNA Extraction

Genomic DNA was extracted from K2EDTA whole blood samples using the DNA Mini Kit (Syngen Biotech, Wroclaw, Poland), following the manufacturer's instructions. DNA quality was assessed by electrophoresis in a 1% agarose gel stained with Symply Safe (EURx, Gdansk, Poland). The gels were visualized under UV light and captured using ScionImage software (Syngen Biotech, Wroclaw, Poland). DNA purity and concentration were determined spectrophotometrically using the DS-11 Spectrophotometer (DeNovix, Wilmington, DE).

Sequencing of the OVM Gene

The primers for PCR were designed using the Primer-BLAST tool (Ye et al., 2012), according to the genomic sequence of Japanese quail ovomucoid gene - OVM (GenBank Accession number NC_029528.1). The synthesis of primers was carried out by Genomed Inc. (Warsaw, Poland). Detailed information regarding all primers can be found in Table 1.Table 1 Primers used for PCR of Japanese quail OVM gene.

Table 1Exon	Sequence (5′ - 3′)1	Product length (bp)	TA (°C)2	
1	F: ATGTCCCTTTGTCCTGTTGC
R: GTCAGGAGCCCTAAGCACA	231	62	
2	F: AAGACTCAGCCTCACTGCAT
R: CACATGCCCTCTTACTCAGCA	236	62	
3	F: ATCCTAGGAGGCCCAACTCA
R: AGGAGCACAAGACCCATTCC	273	62	
4	F: GCACAGCTCTCTAACATGGA
R: GATGCTCCTGAGGCTACTACAG	188	65	
5	F: AGCTCTTCAGCTATCGACTCC
R: AACGTGAATGCAACCAGAGC	195	55	
1 F – Forward, R – Reverse

2 TA - Annealing temperature

The PCR reactions were carried out on Labcycler (Sensoquest, Göttingen, Germany) in a volume of 25 µL reaction comprising 1 µL of DNA (50 ng/μL), 0.05 - 0.1 µL each of forward and reverse primers (0.5 μmol/μL), 8.0 - 9.0 µL of PCR Mix Plus (A&A Biotechnology, Gdansk, Poland), and 14.8 – 15.9 µL of ddH2O (Table 2). All amplifications included an initial denaturing step of 3 min at 95°C, followed by 35 cycles of 30 s at 95°C, 45 s at an optimized annealing temperature (Table 1) and 45 s at 72°C, with a final extension of 5 min at 72°C. PCR products were cleaned using the EPPiCFast according to manufacturer protocol (A&A Biotechnology, Gdansk, Poland). Sequencing was carried out using the BigDye Terminator v. 3.1 kit (ThermoFisher Scientific, Waltham, MA) on an Applied Biosystems Abi Prism 3100-Avant Genetic Analyzer (ThermoFisher Scientific, Waltham, MA). Sequencing reactions were prepared in 10 μL containing 1.5 μL of PCR template (100 ng), 1 μL of forward or reverse primer (3.2 pmol), 0.25 μL of BigDye Terminator v. 3.1 Ready Reaction Mix, 0.875 μL of 5× Sequencing Buffer, 2 μL of BDX64 Buffer (MCLAB, South San Francisco, CA), and 4.8 μL of ddH2O (A&A Biotechnology, Gdansk, Poland). All amplifications were performed using 3 min initial denaturation at 96°C, followed by 30 cycles for 10 s at 94°C, 5 s at 50°C, and 2 minutes at 60°C. The sequencing products were purified using ExTerminator (A&A Biotechnology, Gdansk, Poland). Subsequently, the samples were heated to 95°C for 5 min, cooled on ice for 5 min, and loaded onto the instrument for capillary electrophoresis. Capillary electrophoresis was performed under the following conditions: oven temperature of 50°C; pre-run at 18 kV for 60 seconds; injection at 1.6 kV for 8 s; run at 19.5 kV for 1020 seconds; using a 36 cm capillary length (ThermoFisher Scientific, Waltham, MA); with POP-4 polymer (ThermoFisher Scientific, Waltham, MA); and Z dye set. Bidirectional sequencing was employed for sequencing longer fragments. Sequence data were analyzed using the 3100–Avant AbiPrism Data Collection Software v. 2.0 and Sequencing Analysis v.5.1 (ThermoFisher Scientific, Waltham, MA).Table 2 PCR reaction mixes used for amplification of the targets within OVM gene.

Table 2Reagent	Mix1	Mix2	Mix3	
	Volume [µL]	
PCR Mix Plus4	9	8	8	
Primer Forward (20 µM)	0.1	0.1	0.05	
Primer Reverse (20 µM)	0.1	0.1	0.05	
Nuclease free water	14.8	15.8	15.9	
DNA template5	1	1	1	
Total volume	25	
1 PCR reaction mixes used for amplification of the OVM3, OVM4, OVM5.

2 PCR reaction mixes used for amplification of the OVM1.

3 PCR reaction mixes used for amplification of the OVM2.

4PCR Mix Plus (A&A Biotechnology).

5 ∼50ng DNA template are used per reaction.

Statistical Analysis

Sequence assembly, contig editing, consensus sequence generation, and polymorphism detection were performed using CodonCode Aligner v. 10.0.2 (CodonCode Co., Centerville, MA). Population genetic information was statistically analyzed employing GenAlEx v.6.503 (Peakall and Smouse, 2006). Linkage disequilibrium (LD) between SNPs and haplotype analysis was computed using Haploview software version 4.2 with default settings (Barrett et al., 2005). Haplotypes and diplotypes of all individuals were constructed via PHASE v. 2.1.1 (Stephens et al., 2001). The influence of strain, storage time, and the strain x storage time interaction was presented in our previous work (Knaga et al., 2024). Association analysis between SNPs and phenotypic traits, as well as diplotypes and phenotypic traits, was carried out using general linear model (proc GLM) in SAS v. 9.4 (SAS Institute, Cary, NC). Only genotypes represented by the corresponding number of individuals were included in the analysis. Results are presented solely for traits where the polymorphism exhibited a significant effect.

RESULTS

Ovomucoid Gene Polymorphisms and Population Genetic Structure

In this experiment, 5 pairs of primers were employed to detect polymorphisms in all exons of the Japanese quail ovomucoid gene. In total, 5 polymorphisms were identified (Table 3). Two SNPs were detected in intron 1, proximal to exon 2. The remaining 3 SNPs were identified in exons 1, 3, and 5, all of which were nonsynonymous. The SNP in exon 1, at chromosomal localization 13:12355585 (C>A), resulted in the substitution of aspartate with glutamate at position 24 of the ovomucoid protein (Asp24Glu). The SNP in exon 3, at chromosomal localization 13:12356594 (A>G), caused the substitution of isoleucine with valine at position 112 of the protein (Ile112Val). The mutation in exon 5, at chromosomal localization 13:12358538 (A>G), led to the substitution of glycine with serine at position 162 of the protein (Gly162Ser). Three polymorphisms (SNP1, SNP3, and SNP4) were exclusively identified in the F33 strain (Table 4). Allele frequencies ranged from 0.033 to 0.967. The Polymorphic Information Content (PIC) analysis results indicated that SNP3 and SNP4 exhibited moderate polymorphism (0.25 < PIC < 0.50), except for SNP1, 2, and 5 in the F33 quails, which showed low polymorphism (PIC < 0.25).Table 3 Polymorphisms identified in the OVM gene.

Table 3SNP_ID	Region	Allele	Position
in cDNA	Chromosomal
localization	Codon	AA	Position
in protein	Variant2	
SNP1	exon 1	C>A	13:c.72	13:12355585	GAC/GAA	Asp/Glu	24	ns	
SNP2	intron 1	A>T		13:12356107				int	
SNP3	intron 1	G>A		13:12356124				int	
SNP4	exon 3	A>G	13:c.334	13:12356594	ATA/GTA	Ile/Val	112	ns	
SNP5	exon 5	A>G	13:c.481	13:12358538	AGC/GGC	Ser/Gly	162	ns	
1Polymorphism ID

2 ns-nonsynonymous; int – intronic.

Table 4 Genotypic and allelic frequencies in F33 and S22 Japanese quail strains based on the OVM gene polymorphisms.

Table 4SNP_ID1	Strain	Genotypic frequency	Allelic frequency	HWE2	Ho3	He4	PIC5	Ne6	
		AA	AC	CC	A	C						
SNP1	F33	0.033	0.100	0.867	0.083	0.917	0.058	0.100	0.153	0.143	1.180	
	S22	0.000	0.000	1.000	0.000	1.000	-	0.000	0.000	0.000	1.000	
		AA	AT	TT	A	T						
SNP2	F33	0.000	0.067	0.930	0.033	0.967	0.850	0.067	0.064	0.062	1.069	
	S22	0.233	0.500	0.267	0.483	0.517	0.995	0.500	0.499	0.375	1.998	
		AA	AG	GG	A	G						
SNP3	F33	0.033	0.233	0.733	0.150	0.850	0.642	0.233	0.255	0.252	1.342	
	S22	1.000	0.000	0.000	0.000	1.000	-	0.000	0.000	0.000	1.000	
		AA	AG	GG	A	G						
SNP4	F33	0.033	0.233	0.733	0.150	0.850	0.642	0.233	0.255	0.252	1.342	
	S22	1.000	0.000	0.000	0.000	1.000	-	0.000	0.000	0.000	1.000	
		AA	AG	GG	A	G						
SNP5	F33	0.963	0.000	0.037	0.963	0.037	0.068	0.000	0.153	0.152	1.077	
	S22	0.276	0.103	0.621	0.328	0.672	0.420	0.103	0.441	0.344	1.787	
1 Polymorphism ID.

2 Hardy-Weinberg equilibrium test (p-value).

3 Observed heterozygosity.

4 Expected heterozygosity.

5 Polymorphism information content.

6 Effective allele numbers.

The Effect of Genotype on Egg Quality Traits

Association analyses were conducted between 5 SNPs identified in the OVM fragments and 16 egg quality traits evaluated at 10 time points over a 14-wk storage period (Table 5). For the F33 strain, a highly significant effect of SNP1, SNP3, and SNP4 on EW at the 1D, 2W and 10W was observed. Birds with the AA genotype at SNP1 had the lowest EW. The difference in egg weight between individuals with genotype AA and individuals with the genotype AC, with highest EW throughout the experiment, ranged from 1.30 (1D) to 2.56g (2W) depending on the time point of analysis. For SNP3 and SNP4, females with the AA genotype also exhibited the lowest EW values, while heterozygous individuals (AG) showed the highest values. Association analyses between SNP1, SNP3, and SNP4 and egg quality traits during storage were not conducted for the S22 strain due to lack of variability within these SNPs; birds of this population had only one genotype. In case of SNP5, among the examined females of the F33 strain, there were no heterozygous individuals (AG); however, for the S22 strain, which exhibited all 3 genotypes, a highly significant effect of SNP5 polymorphism on EW at 1D, considering data from all eggs included in the experiment, was demonstrated. Association analysis results indicated that homozygous females (AA or GG genotypes in locus SNP5) had significantly higher average EW at 1D and at 2W, 3W, 9W, and 10W compared to heterozygotes (AG). These differences were evident throughout the storage period, although not statistically significant in all time points. Eggshell quality play a crucial role in laying breeding as it determines its resistance to damage both on the farm and during sorting, packing, and transporting eggs to consumers. In this study, a significant associations between SNP5 and shell quality traits such as SW (3W, 9W, 10W), EST (2W, 4W, 9W, 13W) and BS (1D, 2W, 4W, 12W) were observed. Eggshell quality can be defined by various traits such as shell weight or percentage, shell thickness, dynamic stiffness, specific gravity, and many others. However, it is considered that breaking strength is the most objective in assessing shell resistance to crack and has appropriate genetic correlations with other important traits considered in laying hen breeding criteria. In this study, it was observed that females with the GG genotype (SNP5), thus possessing glycine at position 162 of the protein, had the highest BS value throughout the experiment. The significant influence of genotype on this trait was confirmed in measurements taken on the day of laying (1D) and at 2, 4, and 12 wk of storage. Regarding SW and EST, individuals with the GG genotype also exhibited the highest values of these traits at different time of storage (Table 5). During storage, water diffuses from the egg albumen to the yolk, resulting in an increase in its weight. In this study, heterozygous females (AG) at SNP5 exhibited the lowest YW. A significant difference between heterozygous and homozygous individuals was demonstrated during measurements of this trait at 3, 9, 10, 12, and 14 wk of storage.Table 5 Associations between genotype at a given locus and egg quality traits (mean ± SE) at various storage time point.

Table 5Trait1	SNP	Time point2
Genotype	1D	2W	9W	10W	1D	2W	3W	4W	9W	10W	12W	13W	14W	
F33*	S223	
EW	SNP1	AA	10.05c
(±0.14)	9.30b
(±0.11)	10.80
(±0.20)	9.50b
(±0.18)										
AC	11.35a
(±0.07)	11.86
(±0.12)a	11.66
(±0.19)	11.48a
(±0.20)										
CC	10.82b
(±0.04)	11.41
(±0.08)a	10.99
(±0.09)	10.69
(±0.07)a										
P-value	0.0001	0.015	0.240	0.024										
SNP3	AA	10.58c
(±0.13)	9.21b
(±0.10)	10.85
(±0.14)	9.59b
(±0.15)										
AG	12.10a
(±0.06)	11.75a
(±0.12)	11.72
(±0.19)	11.57a
(±0.22)										
GG	11.56b
(±0.03)	11.30a
(±0.08)	11.03
(±0.09)	10.78a
(±0.07)										
P-value	0.001	0.015	0.281	0.020										
SNP4	AA	10.58c
(±0.13)	9.40b
(±0.11)	10.72
(±0.16)	9.49b
(±0.17)										
AG	12.10a
(±0.06)	11.95a
(±0.12)	11.60
(±0.13)	11.43a
(±0.20)										
GG	11.56b
(±0.07)	11.52a
(±0.07)	10.89
(±0.12)	10.64a
(±0.07)										
P-value	0.001	0.014	0.256	0.029										
SNP5	AA	11.75 (±0.03)	11.53
(±0.09)	11.23
(±0.09)	10.86
(±0.09)	11.21a
(±0.04)	11.03a
(±0.07)	11.13a
(±0.05)	10.54
(±0.19)	10.76a
(±0.05)	10.09ab
(±0.17)	10.37
(±0.07)	10.30
(±0.11)	10.04
(±0.09)	
AG	-	-	-	-	9.70b
(±0.09)	9.75b
(±0.02)	9.20b
(±0.23)	9.85
(±0.25)	8.00b
(±0.11)	8.25b
(±0.06)	8.60
(±0.06)	8.40
(±0.10)	8.50
(±0.10)	
GG	11.89
(±0.10)	11.40
(±0.10)	11.20
(±0.10)	11.40
(±0.10)	11.41a
(±0.04)	11.18a
(±0.08)	11.13a
(±0.09)	11.19
(±0.13)	10.72a
(±0.10)	10.72a
(±0.11)	10.42
(±0.15)	9.97
(±0.18)	10.20
(±0.12)	
P-value	0.614	0.888	0.974	0.543	0.001	0.019	0.001	0.175	0.0001	0.005	0.182	0.276	0.173	
SW	SNP5	AA	1.50
(±0.02)	1.42
(±0.01)	1.41
(±0.01)	1.54
(±0.02)	1.28
(±0.01)	1.31
(±0.02)	1.37a
(±0.02)	1.24
(±0.03)	1.29ab
(±0.02)	1.45ab
(±0.03)	1.29
(±0.02)	1.31
(±0.01)	1.31
(±0.02)	
AG	-	-	-	-	1.25
(±0.06)	1.30
(±0.04)	1.07b
(±0.01)	1.25
(±0.02)	1.10b
(±0.04)	1.05b
(±0.02)	1.10
(±0.02)	1.10
(±0.02)	1.10
(±0.03)	
GG	1.40
(±0.04)	1.30
(±0.02)	1.50
(±0.05)	1.70
(±0.04)	1.38
(±0.02)	1.38
(±0.01)	1.42a
(±0.01)	1.41
(±0.02)	1.41a
(±0.02)	1.54a
(±0.03)	1.38
(±0.02)	1.42
(±0.02)	1.40
(±0.02)	
P-value	0.668	0.395	0.465	0.460	0.160	0.457	0.001	0.063	0.017	0.035	0.091	0.051	0.089	
EST	SNP5	AA	0.174
(±0.026)	0.166
(±0.028)	0.177
(±0.019)	0.162
(±0.029)	0.168
(±0.025)	0.173a
(±0.031)	0.175
(±0.025)	0.178b
(±0.027)	0.168b
(±0.032)	0.167
(±0.031)	0.180
(±0.025)	0.173b
(±0.018)	0.179
(±0.033)	
AG	-	-	-	-	0.167
(±0.031)	0.156b
(±0.040)	0.170
(±0.019)	0.176b
(±0.023)	0.163b
(±0.019)	0.170
(±0.025)	0.174
(±0.018)	0.170b
(±0.026)	0.171
(±0.028)	
GG	0.167
(±0.040)	0.141
(±0.032)	0.197
(±0.035)	0.156
(±0.050)	0.184
(±0.022)	0.183a
(±0.026)	0.180
(±0.020)	0.193a
(±0.022)	0.188a
(±0.027)	0.186
(±0.026)	0.198
(±0.032)	0.194a
(±0.022)	0.189
(±0.027)	
P-value	0.764	0.155	0.087	0.782	0.057	0.037	0.644	0.046	0.009	0.068	0.073	0.002	0.173	
YW	SNP5	AA	3.50
(±0.05)	3.73
(±0.07)	4.42
(±0.06)	4.16
(±0.05)	3.49
(±0.06)	3.70
(±0.09)	4.36a
(±0.11)	3.81
(±0.11)	4.33a
(±0.09)	3.93a
(±0.08)	4.57a
(±0.08)	4.31
(±0.07)	4.37a
(±0.10)	
AG	-	-	-	-	3.45
(±0.09)	2.80
(±0.10)	2.80b
(±0.09)	3.35
(±0.09)	3.10b
(±0.08)	2.75b
(±0.09)	3.30b
(±0.07)	3.50
(±0.08)	3.30b
(±0.05)	
GG	3.30
(±0.06)	3.60
(±0.05)	4.30
(±0.07)	3.60
(±0.05)	3.64
(±0.05)	3.89
(±0.06)	4.04a
(±0.07)	4.02
(±0.06)	4.45a
(±0.04)	4.25a
(±0.06)	4.51a
(±0.04)	4.19
(±0.06)	4.54a
(±0.04)	
P-value	0.663	0.863	0.853	0.266	0.552	0.149	0.003	0.268	0.001	0.002	0.013	0.205	0.025	
BS	SNP5	AA	11.50
(±0.44)	11.67
(±0.27)	12.53
(±0.42)	12.92
(±0.25)	10.45b
(±0.49)	11.96b
(±0.52)	11.78
(±0.58)	10.75b
(±0.54)	11.19
(±0.60)	12.47
(±0.62)	9.81b
(±0.78)	11.52
(±0.71)	12.63
(±0.65)	
AG	-	-	-	-	11.26ab
(±0.12)	12.26ab
(±0.18)	12.16
(±0.64)	13.51ab
(±0.67)	13.36
(±0.70)	13.91
(±0.80)	10.98ab
(±0.35)	13.35
(±0.78)	15.64
(±0.70)	
GG	10.40
(±0.35)	9.09
(±0.29)	7.99
(±0.48)	9.11
(±0.33)	15.76a
(±0.39)	16.23a
(±0.33)	14.86
(±0.47)	15.92a
(±0.43)	14.55
(±0.36)	14.54
(±0.51)	14.65a
(±0.48)	15.15
0.85)	16.02
(±0.59)	
P-value	0.805	0.350	0.285	0.151	0.001	0.005	0.149	0.013	0.102	0.562	0.045	0.322	0.265	
1 Trait: EW – egg weight (g), SW – eggshell weight (g), EST – eggshell thickness (mm), YW – yolk weight (g), BS – breaking strength (N)

2 Time point: 1D – day of laying, 2W – 14W - 2 – 14 week of storage

3 F33 – meat-type Japanese quail strain, S22 - laying-type Japanese quail strain; Means in columns, within a particular time point, with different letters differ significantly at p≤0.05 (Tukey test).

Haplotype Analysis

According to the LD analysis, assessed based on r2 (r2>0.33), 1 LD block was detected (Figures 1A and 1B). This block consisted of 2 SNPs: SNP3 and SNP4, with 2 haplotypes (H1 and H2; Table 6). Based on these 2 haplotypes, 3 diplotypes were identified. LD analysis in the S22 strain did not reveal any haplotypes because only 2 SNPs (SNP2, SNP5) were polymorphic in this population. The results indicated significant associations between the diplotypes and egg weight at 1D, 2W, and 10W (Table 7). Individuals with the H2H2 diplotype (AAAA) demonstrated the lowest values of this trait throughout the egg storage period. A similar trend was observed for eggshell weight; however, only the difference in ESW at 1D between diplotypes was statistically significant. A significant effect of the diplotype on BS at 12 weeks of storage was also observed. At this time point, similar to throughout the storage period, females with the H2H2 diplotype had the highest BS; however, except for 12W, differences between diplotypes were not statistically significant.Figure 1 Linkage disequilibrium coefficient between SNPs in F33 strain. Solid lines mark the identified block. The linkage among SNPs was evaluated based on Dʹ (A) and r2 (B).

Figure 1

Table 6 Haplotype composition of the linkage regions (F33 strain).

Table 6Haplotype	SNPs	Haplotype frequency	
SNP3	SNP4	
H1	G	G	0.85	
H2	A	A	0.15	

Table 7 The effect the diplotype on egg quality traits depending on storage time point (F33 strain).

Table 7Time point1	Diplotype	EW (±SEM)2	SW (±SEM)2	BS (±SEM)2	
1D	H1H1	11.56b (±0.06)	1.45ab (±0.21)	11.60 (±0.83)	
H1H2	12.10a (±0.13)	1.68a (±0.08)	9.84 (±0.87)	
H2H2	10.58c (±0.28)	1.10b (±0.15)	13.00 (±0.79)	
p-value	0.0001	0.019	0.627	
2W	H1H1	11.41a (±0.17)	1.39 (±0.13)	11.09 (±0.67)	
H1H2	11.86a (±0.26)	1.48 (±0.12)	12.50 (±0.50)	
H2H2	9.30b (±0.25)	1.20 (±0.10)	11.61 (±0.59)	
p-value	0.015	0.098	0.431	
3W	H1H1	11.21 (±0.15)	1.42 (±0.17)	12.05 (±0.63)	
H1H2	11.61 (±0.33)	1.48 (±0.13)	11.52 (±0.93)	
H2H2	11.10 (±0.23)	1.30 (±0.11)	15.20 (±0.56)	
p-value	0.45	0.427	0.573	
4W	H1H1	10.79 (±0.21)	1.34 (±0.15)	10.82 (±0.86)	
H1H2	11.03 (±0.60)	1.42 (±0.15)	12.61 (±0.85)	
H2H2	11.20 (±0.33)	1.20 (±0.14)	12.98 (±0.80)	
p-value	0.846	0.326	0.477	
9W	H1H1	11.02 (±0.19)	1.39 (±0.12)	12.39 (±0.96)	
H1H2	11.66 (±0.41)	1.45 (±0.14)	12.38 (±0.63)	
H2H2	10.80 (±0.29)	1.30 (±0.15)	12.77 (±0.88)	
p-value	0.276	0.427	0.996	
10W	H1H1	10.66ab (±0.14)	1.51 (±0.16)	12.01 (±0.69)	
H1H2	11.48a (±0.43)	1.65 (±0.29)	13.63 (±0.81)	
H2H2	9.50 b (±0.35)	1.50 (±0.21)	14.30 (±0.80)	
p-value	0.022	0.308	0.406	
11W	H1H1	10.43 (±0.18)	1.30 (±0.15)	13.00 (±0.69)	
H1H2	10.96 (±0.34)	1.40 (±0.14)	11.53 (±0.71)	
H2H2	9.00 (±0.29)	1.20 (±0.15)	13.33 (±0.89)	
p-value	0.089	0.278	0.624	
12W	H1H1	10.76 (±0.22)	1.35 (±0.13)	9.22b (±0.70)	
H1H2	10.60 (±0.34)	1.33 (±0.08)	12.85a (±0.80)	
H2H2	9.60 (±0.30)	1.25 (±0.11)	13.54a (±0.84)	
p-value	0.386	0.824	0.031	
13W	H1H1	9.37 (±0.39)	1.42 (±0.25)	10.88 (±0.89)	
H1H2	10.47 (±0.45)	1.57 (±0.27)	12.92 (±0.82)	
H2H2	11.10 (±0.54)	2.00 (±0.25)	16.49 (±0.83)	
p-value	0.191	0.093	0.122	
14W	H1H1	10.26 (±0.20)	1.34 (±0.11)	13.09 (±0.88)	
H1H2	10.94 (±0.43)	1.48 (±0.13)	14.66 (±0.64)	
H2H2	8.70 (±0.35)	1.30 (±0.12)	15.87 (±0.69)	
p-value	0.061	0.078	0.540	
1 Time point: 1D – day of laying, 2W – 14W - 2 – 14 week of storage

2 EW: egg weight (g); SW: eggshell weight (g); BS: breaking strength (N); Means in columns, within trait, with different letters differ significantly at p ≤ 0.05 (Tukey test).

DISCUSSION

Ovomucoid Gene Polymorphisms and Population Genetic Structure

In this study, a total of 5 SNPs were identified in the ovomucoid gene of the Japanese quail: 3 in exons and 2 in adjacent intronic regions. All 3 polymorphisms present in the exons were nonsynonymous, leading to an amino acid change in the ovomucoid protein. Furthermore, each of these substitutions was located in a different protein domain, with the Asp24Glu substitution in the first domain, the Val112Ile substitution in the second domain, and the Gly162Ser substitution in the third domain of the ovomucoid protein. The SNPs in exons 1 and 3 resulting in amino acid substitutions at positions 24 and 112 of the ovomucoid protein were identified for the first time and occurred exclusively in the meat-type Pharaoh breed - strain F33. The polymorphism in exon 5 leading to the substitution of glycine with serine at position 162 of the protein (Ser162Gly) had been previously described by Bogard et al. (1980). In the population studied by the authors, the frequencies of the S (Ser/Ser), SG (Ser/Gly), and G (Gly/Gly) phenotypes were 0.636, 0.273, and 0.091, respectively. In the present study, the SG form (AG genotype; Table 4) of ovomucoid was not observed in the F33 strain, whereas the S form (AA genotype; Table 4) occurred in 96% of the birds. Conversely, in the S22 strain, the majority of the birds had the G phenotype (GG genotype; 0.621), while the S and SG phenotypes had frequencies of 0.276 and 0.103, respectively.

Bogard et al. (1980) also demonstrated lower affinity of the G form of ovomucoid to bovine β-trypsin, suggesting that this form exhibits lower inhibitory activity compared to the S form. According to Laskowski et al. (1987), the less inhibitory-active G form was originally the wild-type variant of ovomucoid, while the spread of the more active S form was an example of positive Darwinian selection. The results of these studies seem to confirm this hypothesis, especially considering that the F33 strain has been maintained at the University of Life Sciences in Lublin since 1979, spanning over 80 generations. This strain has never been subjected to artificial selection, so the very high frequency of the S phenotype (genotype AA = 0.96; Table 4) may also be a result of positive selective pressure. Due to the niche nature of production and the belief that Japanese quail are resilient to diseases, there has been a lack of vaccines dedicated to this species in the market for a long time. Environmental pressure may have therefore led to the spread of the more inhibitory-active form of ovomucoid – the S phenotype – within the F33 strain.

Ovomucoid from domestic chicken is considered one of the most common food allergens, unlike ovomucoid from Japanese quail. Hao et al. (2023) compared the protein sequences of ovomucoids from both species as well as the sequences of 9 known epitopes. The homology of ovomucoid in quail eggs and hen eggs reached 77%. Among 9 epitopes of egg ovomucoid, there were different amino acids from quail egg ovomucoid in 8 epitopes. During the bioinformatics analysis, the authors did not consider the Ser162Gly polymorphism of Japanese quail ovomucoid (in the case of the full protein sequence along with the signal peptide, this polymorphism is located at position 186). The same SNP was also detected in the studies presented (Table 3). This polymorphism is part of the epitope with the sequence KTYGNKCNFCNAVVES. In quails with the G phenotype, the presence of Gly at the 4th position makes the sequence of this epitope identical to that in domestic chickens. In individuals with the SS phenotype, the epitope sequences differ, which may affect the spatial structure, thereby potentially reducing allergenicity. Further analyses are necessary to confirm any differences in allergenicity between different forms of Japanese quail ovomucoid.

The first domain of Japanese quail ovomucoid is inactive and lacks the ability to inhibit serine proteases (Takahashi et al., 1994). However, a putative reactive site has been identified within this domain between amino acids 24 and 25 of the mature ovomucoid protein (Weber et al., 1981). This reactive site coincides with the reactive site in domestic chicken ovomucoid (Kato et al., 1987). In close proximity, there is also a disulfide bridge (Cys22) stabilizing the protein structure and a pepsin cleavage site (between Glu25 and Leu26; Takahashi et al., 1999). In the present study, within the F33 strain, we identified substitution at position 24 of the mature Japanese quail ovomucoid protein in the first domain (Asp24Glu), with a frequency of the rarer allele (Glu) being 0.083. Despite the lack of direct evidence, this change may impact the function of the ovomucoid protein, leading to an increase or decrease in inhibitory properties. Therefore, it would be advisable to expand the research to assess the influence of this polymorphism on the structure and functional properties of the protein.

Japanese quail ovomucoid second domain is also an inhibitor against trypsin-like proteinases (Asao et al., 1998). In this study, within the F33 strain, a substitution of valine with isoleucine at position 112 was identified in the second domain (phenotype V was wild-type). Among the analyzed females of this strain, the frequency of phenotype I (Ile/Ile; genotype AA) was only 0.033, while the frequency of phenotype IV (Ile112Val; genotype AA) was 0.233, indicating that in the entire analyzed population, the frequency of individuals possessing isoleucine at position 112 was 0.15. We did not analyze the impact of this substitution on the inhibitory activity on serine proteases, but a spread of this phenotype in the population can be observed, suggesting that this form of ovomucoid may also be subject to positive Darwinian selection. Especially since there was no artificial selection conducted within this strain, and the breeding program entails mating to avoid inbreeding in order to maintain genetic variability at the highest level.

The Effect of Genotype on Egg Quality Traits

In the present study, a significant effect of the OVM polymorphism (SNP5; Ser162Gly) on shell quality traits such as ESW, EST, and BS was observed for the first time in the Japanese quail. No similar associative studies were found in other poultry species either. Only studies on the composition of eggshell matrix proteins in the early phase of mineralization conducted on chickens have revealed the effect of ovomucoid on the eggshell mineralization process (Marie et al., 2015). Ovomucoid was overabundant in the primary stages of eggshell mineralization (5 h after ovulation), but its quantity in the eggshell matrix was also significant during the ACC transformation into calcite aggregates and the formation of larger calcite crystal units. The authors concluded that ovomucoid would play an indirect role in the calcification process by controlling the activity of eggshell matrix proteins, either by inhibiting protein degradation or by modifying the maturation of precursor proteins.

In turn, studies conducted on Tsaiya ducks observed the influence of a 3-nucleotide deletion (g.576_578del) in the ovomucoid gene on hatchability (Huang et al., 2011). Individuals homozygous for the mutation (-/-) exhibited significantly lower hatchability compared to heterozygous birds (±) or those without the deletion (+/+). No observed differences between genotypes regarding fertility, duration of fertility, egg weight, or total number of eggs. This deletion led to the formation of a protein POU domain binding site, which binds transcription factors. The allele with the deletion shows over-expression. Proteases are necessary for embryonic development. Overexpression of ovomucoid can inhibits protease activity, impairing embryonic development and reducing hatchability (Susanti and Yuniastuti, 2020).

The results of these studies exemplify the longstanding associative analyses aimed at identifying genes responsible for economically important traits in livestock animals. While the number of such studies conducted on the Japanese quail is limited due to the niche nature of this species, we can leverage findings from research conducted on the chicken due to their close phylogenetic relationship. The locus of OVM in quail, similar to the domestic chicken, is located on chromosome 13. According to the chicken QTLdb database (accessed in March 2024; Hu et al., 2022), on this chromosome in domestic chicken, QTLs’ have been identified that may influence egg quality traits analyzed in this study, such as egg weight and yolk weight. However, it remains unclear whether the variability of this trait was associated with polymorphism in the ovomucoid gene or possibly other genes present on chromosome 13. Answering this question requires conducting analyses on a significantly larger number of individuals.

Apart from our recent results, in which we demonstrated the effect of SNPs in the lysozyme gene on the eggshell strength of Japanese quail during storage (Knaga et al., 2024), we have not found analogous studies in the literature discussing the effect of gene/protein polymorphisms on changes in egg quality during storage. In these studies, quail eggs were stored for up to 14 weeks. This was based on the assumption that differences in the values of egg quality traits between fresh and stored eggs would increase proportionally with storage time, making it easier to capture any potential effect of polymorphisms in the ovomucoid gene on these traits. In the relatively small populations studied (60 females from each strain), a total of 5 SNPs were identified, of which 3 were missense mutations changing the amino acid sequences in the protein. However, differences in genetic variability were observed between the analyzed populations, as in the S22 strain, only 2 out of 5 SNPs were polymorphic. This meant that the effect of some SNPs and diplotypes on egg quality traits could only be determined in the F33 strain. Additionally, in the F33 strain, not all markers were represented by all genotypes, making inference difficult. Nonetheless, it was possible to identify the association between selected SNPs/diplotypes with 5 traits related to egg quality at various time points (EW, SW, EST, BS, YW). The results of association analyses were not always consistent between the analyzed strains, which can be attributed to the lower variability in the S22 (3 out of 5 SNPs were monomorphic) and the lack of representation of all genotypes at a given locus in the F33. Therefore, it would be advisable to extend the analyses by increasing the number of individuals as well as the number of different strains/populations.

CONCLUSIONS

In the presented study, we identified 5 SNPs. Three of them exhibited non-synonymous mutations. Among these, only the SNP in exon 5, resulting in the Ser162Gly substitution, had been previously described by other authors. Effective breeding program requires the presence of genetic variability within the refined population. The results of the presented study indicate that both investigated strains of quails exhibit variability within the ovomucoid gene and protein. It is remarkable that within the F33 strain, which has been isolated for over 80 generations, there is still high variability observed in the ovomucoid gene. Further investigations may provide insight into whether the variability in OVM within the F33 strain existed in the early generations and was preserved due to appropriately conducted mating program, or if it resulted from mutations followed by positive Darwinian selection.

Association analyses demonstrated the effect of selected SNPs and diplotypes on egg weight, yolk weight as well as egg shell weight, egg shell thickness and breaking strength in different storage timepoints. Therefore, the OVM may be a molecular genetic marker to improve eggshell quality traits in quails.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

This research was funded by University of Life Sciences in Lublin, research grant for young scientists (Funding number: ZIB/MN-1/19 ).
==== Refs
REFERENCES

Asao T. Takahashi K. Tashiro M. Interaction of second and third domains of Japanese quail ovomucoid with ten mammalian trypsins Biochim. Biophys. Acta BBA - Protein Struct. Mol. Enzymol. 1387 1998 415 421
Barrett J.C. Fry B. Maller J. Daly M.J. Haploview: analysis and visualization of LD and haplotype maps Bioinformatics 21 2005 263 265 15297300
Baumgartner J. Končeková Z. Benková J. Peškovičová D. Simenovová J. Csuka J. Changes in egg quality traits associated with long-term selection for lower yolk cholesterol content in Japanese quail Czech J. Anim. Sci. 53 2008 119 127
Bogard W.C. Jr Kato I. Laskowski M. Jr A Ser162/Gly162 polymorphism in Japanese quail ovomucoid J. Biol. Chem. 255 1980 6569 6574 6771272
Cui R. Ji S. Xia M. Fu X. Huang X. Mechanistic studies of polyphenols reducing the trypsin inhibitory activity of ovomucoid: Structure, conformation, and interactions Food Chem. 408 2023 135063
Feeney R.E. Means G.E. Bigler J.C. Inhibition of human trypsin, plasmin, and thrombin by naturally occurring inhibitors of proteolytic enzymes J. Biol. Chem. 244 1969 1957 1960 4238526
Hao M. Yang S. Han S. Che H. The amino acids differences in epitopes may promote the different allergenicity of ovomucoid derived from hen eggs and quail eggs Food Sci. Hum. Wellness 12 2023 861 870
Hu Z.-L. Park C.A. Reecy J.M. Bringing the Animal QTLdb and CorrDB into the future: meeting new challenges and providing updated services Nucleic Acids Res 50 2022 D956 D961 34850103
Huang H.-L. Cheng Y.-S. Huang C.-W. Huang M.-C. Hsu W.-H. A novel genetic marker of the ovomucoid gene associated with hatchability in Tsaiya ducks (Anas platyrhynchos) Anim. Genet. 42 2011 421 427 21749425
Kato I. Schrode J. Wilson K.A. Laskowski Jr M. Evolution of proteinase inhibitor Peeters H. Peptides of the Biological Fluids 1976 Pergamon Oxford, U.K 235 243
Kato I. Schrode J. Kohr W.J. Laskowski M. Chicken ovomucoid: determination of its amino acid sequence, determination of the trypsin reactive site, and preparation of all three of its domains Biochemistry 26 1987 193 201 3548816
Kato Y. Matsuda T. Glycation of proteinous inhibitors:  loss in trypsin inhibitory activity by the blocking of arginine and lysine residues at their reactive sites J. Agric. Food Chem. 45 1997 3826 3831
Knaga S. Kasperek K. Luchowska A. Drabik K. Próchniak T. Zięba G. Batkowska J. The relationship between lysozyme gene polymorphism and quality changes during the storage of eggs derived from two commercial strains of Japanese quail Poult. Sci. 2024 103792
Lakshminarayanan R. Loh X.J. Gayathri S. Sindhu S. Banerjee Y. Kini R.M. Valiyaveettil S. Formation of transient amorphous calcium carbonate precursor in quail eggshell mineralization:  an in vitro study Biomacromolecules 7 2006 3202 3209 17096552
Laskowski M. Apostol I. Ardelt W. Cook J. Giletto A. Kelly C.A. Lu W. Park S.J. Qasim M.A. Whatley H.E. Wieczorek A. Wynn R. Amino acid sequences of ovomucoid third domain from 25 additional species of birds J. Protein Chem. 9 1990 715 725 2073323
Laskowski M. Kato I. Protein Inhibitors of Proteinases Annu. Rev. Biochem. 49 1980 593 626 6996568
Laskowski M. Kato I. Kohr W.J. Park S.J. Tashiro M. Whatley H.E. Positive Darwinian selection in evolution of protein inhibitors of serine proteinases Cold Spring Harb. Symp. Quant. Biol. 52 1987 545 553 3502622
Ma J. Zhou J. Chen L. Zhang H. Wang Y. Fu L. Effects of deglycosylation and the Maillard reaction on conformation and allergenicity of the egg ovomucoid J. Food Sci. 86 2021 3014 3022 34151424
Maiorano G. Knaga S. Witkowski A. Cianciullo D. Bednarczyk M. Cholesterol content and intramuscular collagen properties of pectoralis superficialis muscle of quail from different genetic groups Poult. Sci. 90 2011 1620 1626 21673181
Marie P. Labas V. Brionne A. Harichaux G. Hennequet-Antier C. Rodriguez-Navarro A.B. Nys Y. Gautron J. Quantitative proteomics provides new insights into chicken eggshell matrix protein functions during the primary events of mineralisation and the active calcification phase J. Proteomics 126 2015 140 154 26049031
Peakall R. Smouse P.E. genalex 6: genetic analysis in Excel. Population genetic software for teaching and research Mol. Ecol. Notes 6 2006 288 295
Porta R. Giosafatto C.V.L. di Pierro P. Sorrentino A. Mariniello L. Transglutaminase-mediated modification of ovomucoid: effects on its trypsin inhibitory activity and antigenic properties Amino Acids 44 2013 285 292 22105613
Scott M.J. Huckaby C.S. Kato I. Kohr W.J. Laskowski M. Tsai M.J. O'Malley B.W. Ovoinhibitor introns specify functional domains as in the related and linked ovomucoid gene J. Biol. Chem. 262 1987 5899 5907 3571241
Stephens M. Smith N.J. Donnelly P. A new statistical method for haplotype reconstruction from population data Am. J. Hum. Genet. 68 2001 978 989 11254454
Susanti R. Yuniastuti A. Hatchability genotype of Central Javanese local ducks based on ovomucoid gene J. Phys. Conf. Ser. 1567 2020 032042
Takahashi K. Asao T. An improved method for purification of ovomucoid from Japanese quail egg white Bull. Mukogawa Women's Univ. Nat. Sci. 40 1993 21 25
Takahashi K. Horiguhi M. Bando N. Tsuji H. Ogawa T. Asao T. Immunochemical characterization of ovomucoid from Japanese quail egg white using monoclonal antibodies J. Nutr. Sci. Vitaminol. (Tokyo) 45 1999 491 500 10575639
Takahashi K. Kitao S. Tashiro M. Asao T. Kanamori M. Inhibitory specificity against various trypsins and stability of ovomucoid from Japanese quail egg white J. Nutr. Sci. Vitaminol. (Tokyo) 40 1994 593 601 7751977
Takahashi K. Terada C. Tashiro M. Asao T. Effects of heat treatment and pepsin digestion on trypsin inhibitory activity and ovomucoid antigenicity of japanese quail egg white J. Food Biochem. 27 2003 423 434
Tavaniello S. Maiorano G. Siwek M. Knaga S. Witkowski A. Di Memmo D. Bednarczyk M. Growth performance, meat quality traits, and genetic mapping of quantitative trait loci in 3 generations of Japanese quail populations (Coturnix japonica) Poult. Sci. 93 2014 2129 2140 24931963
Weber E. Papamokos E. Bode W. Huber R. Kato I. Laskowski M. Crystallization, crystal structure analysis and molecular model of the third domain of Japanese quail ovomucoid, a Kazal type inhibitor J. Mol. Biol. 149 1981 109 123 7310876
Ye J. Coulouris G. Zaretskaya I. Cutcutache I. Rozen S. Madden T.L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction BMC Bioinformatics 13 2012 134 22708584
