
==== Front
Clin Exp Reprod Med
Clin Exp Reprod Med
CERM
Clinical and Experimental Reproductive Medicine
2233-8233
2233-8241
Korean Society for Reproductive Medicine

38853132
10.5653/cerm.2023.06415
cerm-2023-06415
Original Article
Protective effects of Withania somnifera against cyclophosphamide-induced testicular damage in rats
Withania somnifera reduces testicular damages
http://orcid.org/0000-0002-7256-8389
Jafari Mehrana 1 2
http://orcid.org/0009-0006-7511-2885
Akbari Ahmad 1
http://orcid.org/0000-0003-3450-316X
Esmailpour Zeynab 3
http://orcid.org/0000-0002-3436-0176
Nadi Zahra 3
http://orcid.org/0000-0002-1248-6314
Baazm Maryam 1 4
1 Traditional and Complementary Medicine Research Center (TCMRC), Arak University of Medical Sciences, Arak, Iran
2 Student Research Committee, Semnan University of Medical Sciences, Semnan, Iran
3 Students Research Committee, Arak University of Medical Sciences, Arak, Iran
4 Department of Anatomy, School of Medicine, Arak University of Medical Sciences, Arak, Iran
Corresponding author: Maryam Baazm Department of Anatomy, School of Medicine, Arak University of Medical Sciences, Basij Square, Sardasht, Arak, Iran Tel: +98-91-6662-1131 Fax: +98-86-3417-3529 E-mail: dr.baazm@arakmu.ac.ir
* This study was supported by the council of Arak University of Medical Sciences (grant number: 3812).

9 2024
10 6 2024
51 3 205212
4 8 2023
23 12 2023
26 12 2023
© 2024. THE KOREAN SOCIETY FOR REPRODUCTIVE MEDICINE
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Objective

Cyclophosphamide (CP) is an alkylating agent commonly used in cancer treatment. It is known to have detrimental effects on the reproductive system, including the potential to cause infertility. Recently, herbal remedies have gained traction as a complementary approach to addressing these side effects. In this study, our goal was to investigate whether the aqueous-alcoholic extract of Withania somnifera (WS) could mitigate the adverse impacts of CP on testicular tissue.

Methods

Animals were randomly assigned to one of the following groups: control, WS (500 mg/kg), CP (100 mg/kg), CP+WS pre-treatment, and CP+WS post-treatment. WS was administered orally through gavage for 1 month. We assessed sperm parameters, testicular histopathology, and the expression of the Bax and Bcl2 genes in the experimental groups.

Results

Sperm parameters (including count, viability, and motility), the number of spermatogonia, the seminiferous tubule diameter, and Bcl2 gene expression, significantly decreased after CP injection (p<0.05). Conversely, the number of immotile sperm and Bax gene expression significantly increased (p<0.05). Treatment with WS, especially when administered as a pre-treatment, ameliorated the sperm parameters, histological alterations, and the expression of apoptosis-related genes (p<0.05).

Conclusion

The data suggest that WS may mitigate the detrimental effects of CP on testicular tissue by reducing apoptosis. Consequently, WS has the potential to be used as an adjunctive therapy to reduce the complications associated with CP treatment.

Apoptosis
Ashwagandha
Cyclophosphamide
Sperm analyses
Testis
==== Body
pmcIntroduction

Anti-cancer treatments such as chemotherapy and radiation therapy can damage germ cells, leading to infertility in cancer survivors. Consequently, the need for infertility treatment after cancer therapy is increasing due to the improved survival rates of cancer patients [1]. Cyclophosphamide (CP) is a chemotherapy agent commonly used in cancer treatment. It acts as an alkylating agent after being metabolized in the liver. It can cross the blood-testicular barrier and potentially harm the reproductive organs [2]. Animal studies have demonstrated that CP treatment can result in oligospermia, reduced testicular weight, and biochemical and histological alterations in the testis and epididymis [3]. Furthermore, variable levels of oligospermia or azoospermia have been observed in men who have received CP treatment [4]. Cell death, apoptosis, and necrosis are harmful consequences of CP administration [5,6].

The exact mechanism by which CP affects the testicles remains unclear; however, numerous studies in this area indicate that CP induces abnormalities and hormonal changes via DNA damage, protamine oxidation, lipid peroxidation of membranes, oxidative stress in mitochondria, adenosine triphosphate depletion, and the modulation of heat shock proteins [7].

The administration of antioxidants during chemotherapy may help to mitigate the side effects of CP on non-target tissues [8]. The potential of plants and other natural resources has long captivated researchers, especially in the treatment of diverse medical conditions. Consequently, herbal remedies and natural antioxidant supplements could play a beneficial role in decreasing the toxicity associated with CP [9].

Withania somnifera (WS), commonly known as ashwagandha, Indian ginseng, winter cherry, ajagandha, and kanaje hindi, is a member of the Solanaceae family and is indigenous to the Eastern Mediterranean and South Asia [10]. WS has antioxidant and anti-apoptosis properties [11], and there is also literature supporting the efficacy of WS in enhancing male fertility [12]. WS has been shown to improve semen quality by modulating reproductive hormone levels and reducing oxidative stress in the seminal plasma of infertile males. It enhances both the quantity and quality of sperm by preventing lipid peroxidation and regulating sex hormone levels [13]. Additionally, WS treatment has been found to increase sperm motility in individuals who smoke or are under physiological stress [14]. Furthermore, in rats subjected to arsenic treatment, WS has been shown to preserve testicular structure and maintain normal function [15]. Considering these beneficial effects of WS, the aim of this study was to investigate the potential of this substance to counteract the adverse effects of CP on testicular tissue and sperm parameters.

Methods

The research conducted adhered to the guidelines established by the National Research Council. Approval for this study, including the animal care methods, was granted by the Ethics Committee of Arak University of Medical Sciences (approval ID: IR.ARAKMU.REC.1400.091). The animals were accommodated in plastic cages situated within an environment that maintained a 12-hour light/dark cycle and a temperature controlled between 22 to 25 °C. They had free access to food and water throughout the study. The data that support findings of this study are available from the corresponding author upon reasonable request.

1. Experimental design

In this study, 30 adult male Wistar rats (200 to 250 g, Pasteur) were randomly assigned to five groups (n=6): control; CP (100 mg/kg, single dose) [16]; WS (500 mg/kg) [17,18]; CP+WS post-treatment; CP+WS pre-treatment (Figure 1). WS was given orally for 1 month [19].

2. Extraction of WS

The roots of WS were acquired from a reputable store and authenticated by the herbarium of Arak University of Medical Sciences. The dried WS was ground into a powder, extracted through maceration with 70% ethanol, and then concentrated using a rotary evaporator to yield a viscous extract [15]. This extract was dissolved in saline, and each animal was administered a daily dose of 500 mg/kg WS for 1 month.

3. Sample collection

One month after treatment, the experimental animals were euthanized under deep anesthesia. The left cauda epididymis and testis were excised. The tail of the epididymis was utilized for the assessment of sperm parameters. For histological examination, one testis was fixed in Bouin's solution, while the other was flash-frozen in liquid nitrogen and stored at –80 °C for subsequent analysis.

4. Sperm parameter analysis

The cauda epididymis was finely minced and then incubated in Ham's/F12 medium (Gibco) for 20 minutes at 37 °C. Subsequently, the proportion of motile sperm was determined by analyzing the pattern of sperm movement [20]. The sperm suspension was diluted at a 1:10 ratio with a fixative solution (1% formalin in phosphate buffered saline), and sperm concentration was quantified using a Neubauer counting chamber [21]. To assess sperm vitality, the Eosin-Nigrosin staining method (Merck) was employed. Through this staining process, non-viable sperm were stained red, while viable sperm remained unstained [22].

5. Testicular histomorphometry

After tissue fixation with Bouin's solution (Merck), the samples were dehydrated, embedded, sectioned, and subsequently stained with hematoxylin and eosin. For each section, at least 100 seminiferous tubules from each animal were analyzed [23], and the number of spermatogonia, as well as the seminiferous diameter, were determined using Image J Analysis software ver.1.33 (National Institutes of Health) [24]. Spermatogonial cells, identifiable by their dark nuclei, are located near the basement membrane

6. Quantitative reverse transcriptase polymerase chain reaction

Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was utilized to evaluate the expression levels of the Bax and Bcl2 genes, as well as CycloA (serving as an internal control), across the various experimental groups. To this end, total RNA was first isolated from testicular tissue using the RNX-plus reagent (Yekta Tajhiz Azma), strictly following the manufacturer's protocol. The RevertAid First Strand cDNA Synthesis Kit (Aryatous) facilitated the synthesis of cDNA from 2 μg of the extracted RNA in a final reaction volume of 20 μL. The qRT-PCR reaction mixture included the following components: cDNA, 5 mmol/L of each forward and reverse primer, and SYBR green reagent (Yekta Tajhiz Azma), with primer sequences detailed in Table 1. Samples were run in duplicate and processed using the LightCycler 96 System (Roche). Relative gene expression was subsequently quantified employing the comparative cycle threshold method (2-ΔΔCT).

7. Statistical analysis

One-way analysis of variance followed by the Tukey post hoc test was used to evaluate differences between the experimental groups. Data are given as mean±standard deviation.

Results

1. Sperm parameter analysis

Our findings demonstrated that in rats treated with CP, the sperm count and the percentage of motile and viable sperm were significantly lower than those in the control group (p<0.001). Conversely, the percentage of immotile sperm was significantly higher (p<0.001). In rats receiving WS treatment, both sperm quantity and quality were dramatically increased. Sperm parameters also significantly improved in the WS pre-treatment group compared to the WS post-treatment group (Table 2).

2. Testis histomorphometry evaluation

Our findings indicate that animals treated with CP exhibited significantly fewer spermatogonia (p<0.001) (Figure 2) and a reduced diameter of the seminiferous tubules compared to the control group (p<0.001) (Figure 3). In rats treated with WS, both pre-treatment and post-treatment groups showed significant preservation of spermatogonia relative to the CP group (p<0.001). Notably, the quantity of spermatogonia was higher in the WS pre-treatment group than in the WS post-treatment group (p<0.001) (Figure 2). Additionally, pre-treatment with WS significantly increased the diameter of the seminiferous tubules compared to the CP group (p<0.0001) (Figures 3, 4).

3. Expression of the Bax and Bcl2 genes

To investigate the anti-apoptotic effects of WS, we analyzed gene expression in testicular tissue, focusing on an apoptotic gene (Bax) and an anti-apoptotic gene (Bcl2), using qRT-PCR. As anticipated, CP significantly upregulated Bax expression (p<0.001) (Figure 5) and downregulated Bcl2 expression (p<0.001) (Figure 6) 1 month post-injection. The mRNA levels of Bax were notably lower in the groups treated with WS compared to the CP group (Figure 5). Conversely, Bcl2 gene expression was significantly higher in both the WS-treated and WS pre-treated groups (p<0.001) (Figure 6).

Discussion

In this study, we evaluated the effects of WS on the side effects of CP in rat testicles. We found that WS administration to rats with CP-induced damage reduced apoptosis and improved testicular histology and sperm parameters. CP is a chemotherapy drug that targets proliferating cells in the testis, such as spermatogonia, and has adverse effects on reproductive health [2]. Our data showed that 1 month after a single dose of CP, there was a decline in sperm quality, a reduction in the number of spermatogonia, and a decrease in the diameter of the seminiferous tubules, while the expression of genes associated with apoptosis was elevated. CP is thought to exert its damaging effects on DNA and spermatogenesis by specifically targeting protamines [7] and to promote apoptosis by upregulating the expression of several genes, including Bax and some caspase family members [25]. Furthermore, CP reduces the levels of key antioxidant molecules in the testis—glutathione, superoxide dismutase, and catalase—thereby increasing the vulnerability of the testis to oxidative damage [25]. Several studies have suggested the use of substances, primarily composed of antioxidants from chemical or natural sources, as prophylactic treatments to protect against CP-induced reproductive toxicity [7].

In this study, we used an aqueous-alcoholic extract of WS root to mitigate the detrimental effects of CP on the testis. It is important to note that WS influences male fertility [26]; however, no research has yet explored its effects on testicular damage induced by CP. WS is a natural compound known for its anti-inflammatory, anti-apoptotic, and antioxidative properties, and withanolides are its primary bioactive constituents [18]. For our experiments, the animals received an oral dose of 500 mg/kg of the WS aqueous extract via gavage. This dosage was selected based on prior studies that have confirmed its effectiveness. Notably, oral administration of WS root extract at doses of 500 and 1,000 mg/kg has shown beneficial effects in the treatment of systemic lupus erythematosus [27]. Furthermore, a daily oral dose of 500 mg/kg of WS extract in male Wistar rats has been found to inhibit oxidative stress in the hippocampus [28], while also reducing tissue inflammation in Wistar rats with methotrexate-induced arthritis [29]. Pawar et al. [30] demonstrated that treatment with WS extract led to a significant increase in antioxidant enzymes. At a high concentration (500 μg/mL), the extract inhibited nitric oxide (NO), hydrogen peroxide (H2O2), and lipid peroxidation [30].

Our results indicated that pre-treatment with WS mitigated testicular damage and improved all sperm parameters in rats with CP-induced damage. Additionally, it appeared to reduce apoptosis in testicular tissue by decreasing Bax expression and increasing Bcl2 expression. Ambiye et al. [31] demonstrated that oligospermia patients who received 675 mg of WS three times daily for 90 days experienced improvements in sperm count, motility, semen volume, and serum testosterone levels. In another study by Nasimi Doost Azgomi et al. [32], men with idiopathic infertility who took six capsules containing 5 g of WS daily for 90 days showed recovery in sperm parameters, including count, motility, and morphology.

Gupta et al. [33] showed that the metabolic profiles of seminal plasma in infertile patients, which include alanine, lactate, citrate, glutamate, glycerophosphocholine, histidine, and phenylalanine, significantly improved after 3 months of oral administration of WS. These improvements correlated with changes in enzymatic, hormonal, and clinical variables [33]. It is important to note that the mechanisms by which WS affects the testis are complex and multifaceted. WS appears to protect the reproductive system via two distinct mechanisms [18]. The first is an oxidative mechanism that involves the regulation of antioxidant enzymes and the modulation of antioxidant activity. The second is a non-oxidative mechanism that affects the hypothalamic-pituitary axis in the pituitary gland, along with its anti-stress activities mediated through this axis [34]. In the latter case, the hypothalamic-pituitary-adrenal axis seems to be the primary pathway, as indicated by decreased cortisol levels and increased hormone levels in men, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH), which reduce stress levels and enhance fertility. Additional research indicates that the active compounds in WS stimulate the thyroid gland to secrete more triiodothyronine (T3) and thyroxine (T4) hormones, leading to a decrease in thyroid-stimulating hormone levels via the hypothalamic-pituitary-thyroid axis [35].

It is believed that the antioxidant activity of WS plays a significant role in preventing inflammation [35]. WS also exhibits anti-inflammatory properties by inhibiting cyclooxygenase activity and suppressing the activation of inflammatory markers mediated by nuclear factor κB (NF-κB) and interleukins [36]. Furthermore, WS modulates various signaling pathways, including NF-κB, Janus kinase (JAK)-signal transducer and activator of transcription (STAT), and activating protein-1 (AP-1), to reduce inflammation [37]. Its derivatives have been found to affect the testis, male reproductive cells, and the homeostasis of endocrine glands, potentially enhancing male fertility [18]. Studies have shown that WS treatment increases the levels of zinc, copper, gold, and iron ions in seminal plasma. These ions improve semen quality by acting as essential cofactors for enzymes in the seminal fluid [38]. These cofactors are crucial for the proper functioning of testicular antioxidant enzymes, which are all reduced following CP injection [25].

WS extract can also imitate the action of gamma-aminobutyric acid (GABA) [13]. By acting on GABA receptors, WS extract promotes the secretion of gonadotropin-releasing hormone and causes the release of FSH, LH, and testosterone [31]. These hormones are essential for normal spermatogenesis and semen quality [31], which are all disturbed by CP [7]. It has been shown that withaferine, the primary constituent of WS, exerts its neuroprotective effects by deactivating Bax and activating Bcl2 [39]. In an experimental model of ischemia and reperfusion, Paul et al. [27] demonstrated that pre-treating rats with 50 mg/kg of WS for one month can reduce apoptosis in the myocardium, preserve myocytes, and protect them from cell death. Our findings suggest that pre-treating animals with WS for a month may help maintain the quality of semen and protect testicular tissue against apoptosis. Therefore, it is conceivable that pre-treatment with WS could mitigate the detrimental effects of CP on testicular tissue.

In conclusion, WS pre-treatment significantly protected testicular tissue from injury caused by CP. The expression of genes related to apoptosis and histopathological changes were markedly improved by the herbal extract of WS. These protective effects of WS therapy may be attributed to its potent anti-apoptotic and antioxidant properties. It has the potential to be used as an adjunct therapy to mitigate the adverse effects of CP in patients.

The current study originated from a proposal approved and supported by the Arak University of Medical Sciences, Arak, Iran.

Figure 1. Timeline of the experiment. CP, cyclophosphamide; WS, Withania somnifera.

Figure 2. Comparison of the number of spermatogonia in different experimental groups. Following Withania somnifera (WS) therapy, there were noticeably more spermatogonia. This increase in the pre-treatment (pre-t) group occurred more rapidly than in the post-treatment (post-t) group. CP, cyclophosphamide; A, significant vs. control; B, significant vs. CP; C, significant vs. post-t group.

Figure 3. Comparison of the seminiferous diameter 1 month after Withania somnifera (WS) therapy. The WS and WS pre-treatment (pre-t) groups showed a significantly higher increase in seminiferous diameter than the cyclophosphamide (CP) group. post-t, post-treatment; A, significant vs. control; B. significant vs. CP.

Figure 4. Light microscopy of testes tissue stained with H&E in different experimental groups: (A) Control, (B) cyclophosphamide (CP), (C) Withania somnifera (WS), (D) CP+WS pre-treatment (pre-t), and (E) CP+WS post-treatment (post-t) group. The bar represents 50 μm.

Figure 5. Real-time polymerase chain reaction analysis of Bax mRNA expression in different experimental groups. Following treatment with Withania somnifera (WS), the expression of Bax was drastically reduced in all treatment groups compared to the cyclophosphamide (CP) group. pre-t, pre-treatment; post-t, post-treatment; A, significant vs. control; B, significant vs. CP.

Figure 6. The mRNA expression of Bcl2 1 month after Withania somnifera (WS) therapy. The WS and WS pre-treatment (pre-t) groups showed a significantly higher increase in the expression of Bcl2 than the cyclophosphamide (CP) group. The WS post-treatment (post-t) also increased the expression of Bcl2, but it was not significant. A, significant vs. control; B, significant vs. CP.

Table 1. Primer sequences of the genes analyzed in this study

Gene	Primer sequences (5'-3')	Product length (bp)	
Bax	Sense	GCTACAGGGTTTCATCCAG		
Antisense	TCCACATCAGCAATCATCC	174	
Bcl2	Sense	AGCGTCAACAGGGAGATG		
Antisense	CCACAAAGGCATCCCAG	118	
CycloA	Sense	GGCAAATGCTGGACCAAACAC		
Antisense	TTAGAGTTGTCCACAGTCGGAGATG	196	

Table 2. Sperm parameter analysis in different experimental groups

Group	Count (×106)	Viability (%)	Progressive (%)	Immobility (%)	
Control	43.75±9.6	81.58±5.5	61.0±7.4	7±2.7	
CP	12.25±2.5a)	31.76±12.6a)	16.25±6.3a)	93.33±11.5a)	
WS	41.17±1.4b)	97.63±1.7b)	67.50±2.9b)	10.±5.5b)	
CP+WS pre-treatment	33.4±5.8b)	87.92±5.0b)	62±18.2b)	8.33±2.6b)	
CP+WS post-treatment	31.65±7.3b)	66.45±9.7	23.7±5	16.25±4.8b)	
Values are presented as mean±standard deviation.

CP, cyclophosphamide; WS, Withania somnifera.

a)Significant vs. control group; b)Significant vs. CP group.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: MJ, AA, ZE, ZN, MB. Data curation: MJ, AA, ZE, ZN, MB. Formal analysis: MJ, AA, ZE, ZN, MB. Funding acquisition: MB. Methodology: MJ, AA, ZE, ZN. Project administration: MB. Visualization: MJ, AA, ZN, ZE, MB. Writing-original draft: MJ. Writing-review & editing: MJ, AA, ZE, ZN, MB.
==== Refs
References

1 Chiba K Fujisawa M Fertility preservation in men with cancer Reprod Med Biol 2014 13 177 84 29662373
2 Liu X Li Q Wang Z Liu F Identification of abnormal protein expressions associated with mouse spermatogenesis induced by cyclophosphamide J Cell Mol Med 2021 25 1624 32 33438283
3 Kim SH Lee IC Baek HS Moon C Kim SH Kim JC Protective effect of diallyl disulfide on cyclophosphamide-induced testicular toxicity in rats Lab Anim Res 2013 29 204 11 24396385
4 Gajjar R Miller SD Meyers KE Ginsberg JP Fertility preservation in patients receiving cyclophosphamide therapy for renal disease Pediatr Nephrol 2015 30 1099 106 25190492
5 Iorga A Dara L Kaplowitz N Drug-induced liver injury: cascade of events leading to cell death, apoptosis or necrosis Int J Mol Sci 2017 18 1018 28486401
6 Johnson SE Ugolkov A Haney CR Bondarenko G Li L Waters EA Whole-body imaging of cell death provides a systemic, minimally invasive, dynamic, and near-real time indicator for chemotherapeutic drug toxicity Clin Cancer Res 2019 25 1331 42 30420445
7 Ghobadi E Moloudizargari M Asghari MH Abdollahi M The mechanisms of cyclophosphamide-induced testicular toxicity and the protective agents Expert Opin Drug Metab Toxicol 2017 13 525 36 28019118
8 Singh K Bhori M Kasu YA Bhat G Marar T Antioxidants as precision weapons in war against cancer chemotherapy induced toxicity: exploring the armoury of obscurity Saudi Pharm J 2018 26 177 90 30166914
9 Lee J Jeong MI Kim HR Park H Moon WK Kim B Plant extracts as possible agents for sequela of cancer therapies and cachexia Antioxidants (Basel) 2020 9 836 32906727
10 Dar NJ Hamid A Ahmad M Pharmacologic overview of Withania somnifera, the Indian Ginseng Cell Mol Life Sci 2015 72 4445 60 26306935
11 Ahmed W Mofed D Zekri AR El-Sayed N Rahouma M Sabet S Antioxidant activity and apoptotic induction as mechanisms of action of Withania somnifera (Ashwagandha) against a hepatocellular carcinoma cell line J Int Med Res 2018 46 1358 69 29392963
12 Tandon N Yadav SS Safety and clinical effectiveness of Withania Somnifera (Linn.) Dunal root in human ailments J Ethnopharmacol 2020 255 112768 32201301
13 Mikulska P Malinowska M Ignacyk M Szustowski P Nowak J Pesta K Ashwagandha (Withania somnifera): current research on the health-promoting activities. A narrative review Pharmaceutics 2023 15 1057 37111543
14 Choudhary D Bhattacharyya S Joshi K Body weight management in adults under chronic stress through treatment with ashwagandha root extract: a double-blind, randomized, placebo-controlled trial J Evid Based Complementary Altern Med 2017 22 96 106 27055824
15 Kumar A Kumar R Rahman MS Iqubal MA Anand G Niraj PK Phytoremedial effect of Withania somnifera against arsenic-induced testicular toxicity in Charles Foster rats Avicenna J Phytomed 2015 5 355 64 26445714
16 Pavin NF Izaguirry AP Soares MB Spiazzi CC Mendez AS Leivas FG Tribulus terrestris protects against male reproductive damage induced by cyclophosphamide in mice Oxid Med Cell Longev 2018 2018 5758191 30228856
17 Kyathanahalli CN Manjunath MJ Oral supplementation of standardized extract of Withania somnifera protects against diabetes-induced testicular oxidative impairments in prepubertal rats Protoplasma 2014 251 1021 9 24488064
18 Sengupta P Agarwal A Pogrebetskaya M Roychoudhury S Durairajanayagam D Henkel R Role of Withania somnifera (Ashwagandha) in the management of male infertility Reprod Biomed Online 2018 36 311 26 29277366
19 Bhargavan D Deepa B Shetty H Krishna AP The protective effect of Withania somnifera against oxidative damage caused by ethanol in the testes of adult male rats Int J Basic Clin Pharmacol 2017 4 1104 8
20 Soleimani MZ Jalali Mashayekhi F Mousavi Hasanzade M Baazm M Alteration in CatSper1 and 2 genes expression, sperm parameters and testis histology in varicocelized rats Int J Reprod Biomed 2018 16 183 90 29766149
21 Hemati U Moshajari M Jalali Mashayekhi F Bayat M Moslemi A Baazm M The effect of curcumin on NRF2/Keap1 signalling pathway in the epididymis of mouse experimental cryptorchidism Andrologia 2022 54 e14532 35882440
22 Tajaddini S Ebrahimi S Behnam B Bakhtiyari M Joghataei MT Abbasi M Antioxidant effect of manganese on the testis structure and sperm parameters of formalin-treated mice Andrologia 2014 46 246 53 23374134
23 Babaei A Kheradmand N Baazm M Nejati N Khalatbari M Protective effect of vitamin E on sperm parameters in rats infected with Candida albicans Andrologia 2020 52 e13593 32400037
24 Fallah Asl H Mashayekhi FJ Bayat M Habibi D Zendedel A Baazm M Role of epididymis and testis in nuclear factor erythroid 2-related factor 2 signaling in mouse experimental cryptorchidism Iran Red Crescent Med J 2019 21 e86806
25 Abd El Tawab AM Shahin NN AbdelMohsen MM Protective effect of Satureja montana extract on cyclophosphamide-induced testicular injury in rats Chem Biol Interact 2014 224 196 205 25446862
26 Durg S Shivaram SB Bavage S Withania somnifera (Indian ginseng) in male infertility: an evidence-based systematic review and meta-analysis Phytomedicine 2018 50 247 56 30466985
27 Paul S Chakraborty S Anand U Dey S Nandy S Ghorai M Withania somnifera (L.) Dunal (Ashwagandha): a comprehensive review on ethnopharmacology, pharmacotherapeutics, biomedicinal and toxicological aspects Biomed Pharmacother 2021 143 112175 34649336
28 Alzoubi KH Al Hilo AS Al-Balas QA El-Salem K El-Elimat T Alali FQ Withania somnifera root powder protects againist post-traumatic stress disorder-induced memory impairment Mol Biol Rep 2019 46 4709 15 31218539
29 Hussain A Aslam B Muhammad F Faisal MN Kousar S Mushtaq A Anti-arthritic activity of Ricinus communis L. and Withania somnifera L. extracts in adjuvant-induced arthritic rats via modulating inflammatory mediators and subsiding oxidative stress Iran J Basic Med Sci 2021 24 951 61 34712426
30 Pawar P Gilda S Sharma S Jagtap S Paradkar A Mahadik K Rectal gel application of Withania somnifera root extract expounds anti-inflammatory and muco-restorative activity in TNBS-induced inflammatory bowel disease BMC Complement Altern Med 2011 11 34 21527003
31 Ambiye VR Langade D Dongre S Aptikar P Kulkarni M Dongre A Clinical evaluation of the spermatogenic activity of the root extract of Ashwagandha (Withania somnifera) in oligospermic males: a pilot study Evid Based Complement Alternat Med 2013 2013 571420 24371462
32 Nasimi Doost Azgomi R Nazemiyeh H Sadeghi Bazargani H Fazljou SM Nejatbakhsh F Moini Jazani A Comparative evaluation of the effects of Withania somnifera with pentoxifylline on the sperm parameters in idiopathic male infertility: a triple-blind randomised clinical trial Andrologia 2018 50 e13041 29770466
33 Gupta A Mahdi AA Shukla KK Ahmad MK Bansal N Sankhwar P Efficacy of Withania somnifera on seminal plasma metabolites of infertile males: a proton NMR study at 800 MHz J Ethnopharmacol 2013 149 208 14 23796876
34 Teixeira MYP de Araujo COD Effect of Withania somnifera in the treatment of male infertility: a literature review J Med Plant Res 2019 13 473 9
35 Wicinski M Fajkiel-Madajczyk A Kurant Z Kurant D Gryczka K Falkowski M Can Ashwagandha benefit the endocrine system?: a review Int J Mol Sci 2023 24 16513 38003702
36 Mishra LC Singh BB Dagenais S Scientific basis for the therapeutic use of Withania somnifera (ashwagandha): a review Altern Med Rev 2000 5 334 46 10956379
37 Kumar P Sharma R Garg N Withania somnifera: a magic plant targeting multiple pathways in cancer related inflammation Phytomedicine 2022 101 154137 35533610
38 Nasimi Doost Azgomi R Zomorrodi A Nazemyieh H Fazljou SM Sadeghi Bazargani H Nejatbakhsh F Effects of Withania somnifera on reproductive system: a systematic review of the available evidence Biomed Res Int 2018 2018 4076430 29670898
39 Prakash J Chouhan S Yadav SK Westfall S Rai SN Singh SP Withania somnifera alleviates parkinsonian phenotypes by inhibiting apoptotic pathways in dopaminergic neurons Neurochem Res 2014 39 2527 36 25403619
