
==== Front
AMB Express
AMB Express
AMB Express
2191-0855
Springer Berlin Heidelberg Berlin/Heidelberg

39225916
1761
10.1186/s13568-024-01761-w
Original Article
Heterologous expression of lasso peptides with apparent participation in the morphological development in Streptomyces
Reyna-Campos Alma Ofelia 12
Ruiz-Villafan Beatriz 1
Macías-Rubalcava Martha Lydia 3
Langley Elizabeth 4
Rodríguez-Sanoja Romina 1
http://orcid.org/0000-0002-6350-5052
Sánchez Sergio sersan@biomedicas.unam.mx

1
1 https://ror.org/01tmp8f25 grid.9486.3 0000 0001 2159 0001 Departamento de Biología Molecular y Biotecnología del Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (UNAM), 04510 CdMx, Mexico
2 grid.9486.3 0000 0001 2159 0001 Posgrado en Ciencias Biológicas, Unidad de Posgrado, UNAM. , CdMx, 04510 Mexico
3 grid.9486.3 0000 0001 2159 0001 Departamento de Productos Naturales, Instituto de Química, UNAM, CdMx, 04510 Mexico
4 https://ror.org/04z3afh10 grid.419167.c 0000 0004 1777 1207 Departmento de Investigación Básica, Instituto Nacional de Cancerología, CdMx, 14080 Mexico
3 9 2024
3 9 2024
2024
14 9729 5 2024
22 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Lasso peptides, ribosomally synthesized and post-translationally modified peptides, are primarily produced by bacteria and some archaea. Streptomyces lasso peptides have been known for their antimicrobial, anticancer, and antiviral properties. However, understanding their role in the morphology and production of secondary metabolites remains limited. We identified a previously unknown lasso peptide gene cluster in the genome of Streptomyces sp. L06. This gene cluster (LASS) produces two distinct lasso peptides, morphosin-1 and − 2. Notably, morphosin-2 is a member of a new subfamily of lasso peptides, with BGCs exhibiting a similar structure. When LASS was expressed in different Streptomyces hosts, it led to exciting phenotypic changes, including the absence of spores and damage in aerial mycelium development. In one of the hosts, LASS even triggered antibiotic formation. These findings open up a world of possibilities, suggesting the potential role of morphosins in shaping Streptomyces’ morphological and biochemical development.

Keywords

Lasso peptide
Streptomyces
Morphology
BGCs
RiPPs
http://dx.doi.org/10.13039/501100006087 Dirección General de Asuntos del Personal Académico, Universidad Nacional Autónoma de México IN205519 issue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2024
==== Body
pmcIntroduction

Peptides are a promising avenue for developing new drugs due to their specificity to biological targets and potential for redesign through chemical synthesis or genetic engineering (Rima et al. 2021). Ribosomally synthesized and post-translationally modified peptides (RiPPs) are a diverse group of natural products with broad chemical diversity and bioactivity (Cao et al. 2021). Lasso peptides represent a subset of RiPPs produced by bacteria and some archaea. They feature an N-terminal macrolactam ring formed by an isopeptide bond between the α-amino group of the first residue and the carboxyl group of the side chain of an aspartate or glutamate (Delgado et al. 2001; Adelman et al. 2004; Kodani et al. 2020). The C-terminal end of these peptides is threaded into the ring and held inside by the steric hindrance generated by bulky amino acids and/or disulfide bridges, creating a unique three-dimensional structure (Fig. 1). This fold provides stability to several lasso peptides against various proteases and temperatures up to 120 °C (Hegemann et al. 2015; Hegemann 2020). Lasso peptides are classified into 4 distinct classes based on the number and position of their disulfide bridges. Class II peptides have no disulfide bonds and are the most abundant (Tietz et al. 2017; Hegemann et al. 2020).

Fig. 1 Schematic representation of a lasso peptide

The biosynthetic gene cluster (BGC) that gives rise to lasso peptides generally comprises a core of three genes. A gene (A) codes for a precursor peptide with a leader sequence and a core sequence (structural sequence), the RiPPs recognition element (RRE) and leader peptidase are encoded as two separated proteins by the genes B1 and B2, respectively, or as a single protein by the gene B1/B2, the gene (C) encoding a lasso cyclase, homologous to asparagine synthetase, which catalyzes the formation of an isopeptide bond to form the macrolactam ring. Sometimes, these BGCs contain additional genes encoding isopeptidases, ABC transporters (D), and other secondary post-translational modification enzymes (Maksimov et al. 2012; Zhu et al. 2016). It is thought that peptides originating from BGCs with ABC transporters could act outside the producing cell due to their requirement to be exported (Hegemann et al. 2015; Bountra et al. 2017; Beis et al. 2019; Smits et al. 2020).

Of the nearly 80 lasso peptides isolated, at least 30 have reported biological activity (Kodani et al. 2020). Notably, these peptides exhibit antimicrobial activity against both Gram-positive (Metelev et al. 2015; Gavrish et al. 2014; Tan et al. 2019) and Gram-negative bacteria (Delgado et al. 2001; Adelman et al. 2004; Kuznedelov et al. 2011; Metelev et al. 2017). Other lasso peptides have antagonist effects against receptors such as the glucagon receptor (Knappe et al. 2010), type B endothelins (Morishita et al. 1994), or the atrial natriuretic factor (Weber et al. 1991). In addition, peptides with anticancer (Um et al. 2013; Elsayed et al. 2015; Son et al. 2018; Guerrero-Garzón et al. 2020) and antiviral properties have been isolated (Helynck et al. 1993; Tsunakawa et al. 1995; Kaweewan et al. 2018). Knowledge about the ecological role they play in nature is scarce; it has been shown that Microcin J25, the lasso peptide most studied, participates in interspecies competition in the microbial community of the gut, where it was first isolated (Li and Rebuffat 2020; Baquero et al. 2024). However, as far as we know, nothing has been established about lasso peptides’ participation in physiology, morphology, and the production of secondary metabolites.

The Streptomyces genus has a peculiar life cycle involving vegetative mycelia, aerial hyphae, and spores. Some subsets of RiPPs have been reported to mediate the morphological development in Streptomyces. Thus, the lanthipeptides SapB and SapT from Streptomyces coelicolor and Streptomyces lavenduligriseus Tu 901 are involved in the emergence of aerial hyphae (Kodani et al. 2004, 2005; Sarksian et al. 2022). The class III lanthipeptide AmfS, a SapB counterpart, from Streptomyces griseus has a morphogenic activity (Takano et al. 2017).

In the genome of Streptomyces sp. L06, we discovered a gene cluster that codes for two lasso peptides, morphosin-1 and − 2. Subsequently, these peptides were heterologously produced, and tests were conducted to study their chemical and biological properties. Morphosin-2 is a member of a new lasso peptide subfamily that has not been previously characterized. We observed that the expression of both lasso peptides harmed the morphological differentiation of three different Streptomyces species used for their expression.

Materials and methods

Bacterial strains

Streptomyces sp. L06 was previously isolated from Amphyterigium adstringens, and deposited in the UNAM-48 WFCC culture collection under accession BM-B-601 (Mexico City) (Caicedo-Montoya et al. 2021). Streptomyces lividans TK24 (Rückert et al. 2015), S. coelicolor M1152 (Gómez-Escribano and Bibb, 2011), and Streptomyces avermitilis SUKA22 (Komatsu et al. 2013) were used as hosts for heterologous expression.

For plasmid propagation, Escherichia coli DH5α was selected. E. coli ET12567/pUZ8002 was used as a DNA donor in the conjugation process with Streptomyces strains. The E. coli strains were grown overnight in LB medium at 37 °C at 200 rpm (Gust 2009).

Sporulation

Spores of S. coelicolor M1152 and S. lividans TK24 were obtained in plate cultures of the MS medium (Kieser et al. 2020), while S. avermitilis SUKA 22 sporulated in the YMS medium (Ikeda et al. 1987). All strains were spread onto their respective sporulation media and incubated at 29 °C for at least 5 days, during which spores matured. Streptomyces strains were stored as spore suspensions in 20% (v/v) glycerol at -20 °C, as previously described (Rocha-Mendoza et al. 2021), or mycelium suspension in 25% (v/v) glycerol at -80 °C (Shepherd et al. 2010).

Bioinformatics analysis

The LASS BGC of Streptomyces sp. L06 was identified using AntiSMASH 7.0 (Blin et al. 2023). We performed alignments of each biosynthetic enzyme within the BGC using Muscle (EBI) (Madeira et al. 2022) to confirm the presence of the preserved residues required for their proper function. We used the two precursor peptides as the query sequence for two individual searches in BLAST-p against the NCBI database of non-redundant protein sequences. All hits were considered potential precursor peptides. To check whether the BLAST-p hits were part of the lasso peptides BGC, we analyzed the genomes available in NCBI GenBank from each hit using antiSMASH 7.0. We also manually analyzed the genes flanking the core region of the BGC to verify their association with other genes.

Sequence Similarity Networks (SSNs) analysis of all precursor peptides and of lasso cyclases present in the LASS-BGCs were generated using Enzyme Similarity Tool (ESI-EST) setting the alignment score threshold 11 and 100, respectively. Both of SSN were visualized with Cytoscape.

Construction of the expression plasmid of the BGC of morphosins

The Streptomyces sp. L06 genomic DNA (gDNA) has been extracted according to Caicedo-Montoya et al. (2021). The gDNA was used to amplify a 4,832 bp fragment containing the LASS BGC genes lassA1, lassA2, lassC, lassB, and lassD. The GC-RICH PCR system (Roche, USA) was employed to amplify this fragment with FW/RV_LassAABCD- primers (Table 1). A NdeI cleavage site was introduced into the first forward primer, and an EcoRI site was introduced into the reverse primer. The amplicon was cloned into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific, USA), to create the TOPO-LASS vector. LASS, derived from the TOPO-LASS vector, and the expression vector pIJ10257 were digested the NdeI and XhoI restriction enzymes and then purified using QIAGEN’s gel extraction kit. Both were linked employing T4 DNA ligase (New England BioLabs, USA). The ligation reaction was transformed into E. coli DH5α cells and transformed colonies were selected with hygromycin (Thermo Fisher Scientific, USA) (50 µg/ml). The final construction, pIJ10257-LASS, was confirmed by sequencing with Seq primers at the Sequencing Unit from our Institute (Table 1).

Table 1 Oligonucleotide primers used in this study. All sequences are provided in the 5´ to 3´ directions. Restriction sites are underlined

Name	Sequence	
Fw_LassAABCD_Ndel	GAACATATGACGCCGGAGATCCACGACG	
Rev_LassAABCD_EcoRI	GTGAATTCGGTGGAGGACTACTACGCGGTC	
Seq-Lass 1 F	GTCATCTCGTTCTCCGC	
Seq-Lass 2 F	CGTGTGGGCGGACTCAG	
Seq-Lass 3 F	GCCGTACTTCAGCCACC	
Seq-Lass 4 F	CAACCGCCACCTCAAAG	
Seq-Lass 5 F	GATTGCCTGCGGTGTTGTG	
Seq-Lass 6R	CGCCTGCATGGAAATC	
Seq-Lass 7R	CGTCATGGTCGTCGCAC	
Seq-Lass 8R	GAGGATCTGACCGACG	
Int-Lass_sco4848	CGTCGTATCCCCTCGGTTG	
Int-Lass_pIJ10257	GAGCCGGGAAAGCTCATTCA	

Heterologous production of morphosins

The construct pIJ10257-LASS was transformed into the non-methylating strain E. coli ET12567/pUZ8002, to conjugate with expression hosts, following the method described by Kieser et al. (2000). For conjugation and subsequent analysis of lasso peptide production, the empty plasmid pIJ10257 under the control of the constitutive promoter ermE, was used as a control. Hygromycin (Sigma-Aldrich, USA) was added at a 50 µg/ml concentration and was used as a selection antibiotic for recombinant Streptomyces strains. The integration of LASS within the genome was verified by PCR using the IntLASS primers (Table 1). The three Streptomyces strains used as expression hosts were grown in their respective sporulation media at 29 °C and monitored for 7–10 days. The control strains were an unmodified strain and a strain with the empty vector pIJ10257.

To prepare a seed culture of each Streptomyces strain containing pIJ10257-LASS, 50 ml of YMG medium supplemented with the selection antibiotic was inoculated with a single colony of each organism in a 250-mL baffled flask and incubated at 200 rpm at 29 °C for 3 days. The seed cultures were then used to inoculate 50 ml of YMG medium. The fermentations were carried out for 7 days at 200 rpm at 29 °C; then, cells were harvested by centrifugation (4,000 rpm for 10 min.). The cell pellets were washed with distilled water and extracted with 30 mL methanol by agitation overnight at room temperature. The methanolic extracts of the mycelium were clarified by centrifugation, evaporated at reduced pressure at 40 °C, and resuspended in 60% acetonitrile. Diaion HP20 resin (3 g) (Sigma-Aldrich, USA) was added to the supernatants of the previous cultures and incubated under agitation (1 h at room temperature). The resin was recovered by filtration and washed with distilled water. Supernatant extracts were eluted from the resin with 30 mL methanol before evaporating under reduced pressure at 40 °C and resuspended in 250 µL 60% acetonitrile.

Antimicrobial activity

As previously reported (Balouiri et al. 2016), the agar diffusion method was used to test the antibacterial activity of supernatant and mycelium extracts against Bacillus subtilis and Micrococcus luteus. For the negative control, 60% acetonitrile was employed. Each extract was used at a concentration of 20 µg/ml.

Effect of supernatant extract containing morphosins on the morphological development of Streptomyces

The anti-sporulation activity was assessed following the method outlined by Strahight et al. (2006) with some adjustments. A 1:10 dilution of a spore suspension of Streptomyces strains carrying only pIJ10258 (1 × 107) was spread as 100 µl on the MS or YMS agar surface in a Petri dish. The culture was then incubated at 29 °C for 48 h until the vegetative mycelium developed. Following this, supernatant extracts containing morphosins were applied to the mycelium. After applying the morphosins sample, the culture was incubated for 48 h to observe the development of Streptomyces. Supernatant extracts from Streptomyces-pIJ10257 and unmodified Streptomyces strains were used as controls. These extracts were obtained as from 250 mL bacterial cultures and suspended in MESS buffer before application.

UPLC/MS analysis

All reagents used in this assay were UPCL/MS grade (J. T. Baker Chemicals USA). 10 µl of each concentrated extract was taken and analyzed using a UPLC/MS AQUITY Xevo G2XSTO (Waters, Mexico). An ACQUITY UPLC C18 BECH 130 A column, 1.7 μm, 2.1 mm x 50 mm (Waters, Mexico), was used at a 300 µl/min flow rate. The gradient was performed using solvent A (water/0.1% formic acid) and solvent B (acetonitrile /0.1% formic acid). The process started with 5% solvent B and was followed by a linear increase of 5–60% solvent B from 1 to 10 min post-injection. From 10 to 11 min, 60-95% solvent B was used, followed by a linear decrease to 5% solvent B from min 11 to 16 min. The UPLC/MS data was recorded in positive ion mode in a m/z 100-3,000 mass range. The capillary voltage was 3 kV, and the cone voltage was 40 V. The source temperature was 180 °C, and the desolvation temperature was 400 °C. A dry gas flow used was 800 L/h.

Results

Bioinformatics analysis

The genome of Streptomyces sp. L06 contains a lasso peptide BGC cluster, which encodes two different lasso peptides, namely morphosin-1 and morphosin-2. These peptides can form a macrolactam ring between G1-E8 and G1-D7 or G1-D9. The cluster also includes a lasso cyclase (LASSC), a RiPP recognition element, a peptidase domain (LASSB), and a peptidase domain (LASSB1/B2, and an ABC-like transporter (LASSD) (Fig. 2A and B).

Fig. 2 (A) Morphosins BGC from Streptomyces sp. L06 and sequence alignment of the precursor peptides. (B) Sequence logo of morphosin-2 family with 27 members. (C) Sequence similarity network analysis of all precursor peptides (D1) and lasso cyclases (D2) contained in LASS BGCs. Orange nodes represent sequences that are included in LASS BGCs with only one peptide precursor. The sequences that are included in LASS BGCs with more than one precursor peptide are represented by the yellow nodes. The pink nodes indicate the precursor peptides that do not have homology with morphosin 2

To determine if this cluster is present in other genomes, the sequences of the precursor peptides were used as a Blast-P query against the non-redundant protein sequence database in NCBI. The morphosin-1 analysis did not yield homologous. The morphosin-2 search generated 47 hits with a percentage of identity > 40%. All the resulting sequences belong to the genus Streptomyces. Manual inspection of the genetic context of each hit confirmed that most of them are precursor peptides encoded in a lasso peptide BGC (LASS BGCs). A total of 27 putative sequences of lasso peptides homologous to morphosin-2 were identified in 40 different Streptomyces strains. The core sequence of morphosin-2 and its 27 homologous sequences were aligned to visualize conserved motifs. We found that the sequences are highly similar, with a motif sequence (GRX3NDX2DKXNYFEX), as shown in Fig. 2C.

The SSNs analysis of precursor peptides showed that all homologous to morphosin 2 formed a clade. The precursor peptides found in the BCGs containing more than one precursor peptide were identified as the closest neighbors to morphosin 2. Three out of the nine precursor peptides unrelated to morphosin 2 were clustered together, while the rest, including morphosin 1, appeared as individual sequences. The analysis of lasso cyclases showed a similar pattern, with only one cluster being formed. The cyclases from the LASS BGCs with multiple peptide precursors were identified as the closest neighbors to the cyclase in morphosin BGC (Fig. 2D).

The variation between BGCs is mainly due to the presence or absence of secondary modification enzymes, especially acetylornithine deacetylase, and the number of precursor peptides in addition to those homologous to morphosin-2. Another factor is whether the lasso peptide RRE is present as a discrete protein (LASSB1) or fused to the leader peptidase (B1/B2). We found several BGCs with up to 2 more precursor peptides. In certain LASS BGCs, the core genes were flanked by two regulators: a regulator of unknown function (LASSR) downstream and a xenobiotic response element (XRE) followed by a small protein with a DUF397 domain (LASSXRE/LASSDUF397), upstream (Fig. 3).

Fig. 3 Comparison of the LASS BGC carrying a peptide precursor homologous to morphosin-2. Arrows indicate genes. Color codes are described in the key

Effect of morphosins expression and supernatant extract containing morphosins on morphological development of Streptomyces

The morphosin BGC (LASS) was expressed in three different strains of Streptomyces (none of which contain a morphosin-like BGC), using the pIJ10257 vector. This plasmid integrates into the single integration site of phage ΦBT, located in the sco4848 gene of S. coelicolor and its orthologs in other Streptomyces species (Gregory et al. 2023). The recombinant strains correctly integrated the pIJ10257-LASS or pIJ10257 (control strain) construct. Differences in phenotype were observed between strains containing LASS and those with unmodified or empty vectors. The latter two showed equivalent development. Strains containing LASS exhibited a phenotype commonly associated with defects in the formation of spores and aerial mycelium (Fig. 4). This was observed as white colonies with a fuzzy appearance. The same figure indicates that S. lividans TK24, containing the LASS region, initiated actinorhodin production, in contrast to the non-conjugated strain or the one with the empty vector.

Fig. 4 Heterologous expression of the LASS BGC in three different strains of Streptomyces leads to defects in their morphological development. Strains expressing the LASS BGC (pIJ1027-LASS), strains carrying the empty plasmid (pIJ10257), and unmodified strains were grown on their sporulation medium for seven days

To further support that morphosins could affect the morphological development of Streptomyces, we applied a supernatant extract containing morphosins to the plain strains carrying only pIJ10257. In Fig. 5a white ring is visible around the inhibition zone, indicating defective sporulation compared to the gray pigmented spores.

Fig. 5 Effect of the morphosin-containing supernatant extract on the Streptomyces strains carrying pIJ10257. (A) S. avermitilis SUKA22-pIJ10257. (B) S. coelicolor M1152-pIJ10257. (C) S. lividans TK24-pIJ10257. (1) morphosin-containing supernatant extract. (2) MESS buffer (3) supernatant extract from Streptomyces-pIJ10257. (4) Supernatant extract from Streptomyces no modified were used

Structural analysis of morphosins

In the UPLC/MS analysis of the supernatant extracts, morphosin-1 was detected at a retention time (RT) of 1.9 min (Fig. 6A). However, morphosin-2, was detected at two different retention times, 1.7 and 2.9 min (Fig. 6B), suggesting that this lasso peptide exists of two distinct conformations, possibly of lasso and branched cyclic. The retention times correspond to hydrophilic peptides, as their primary sequence indicates. The measured m/z ([M + 2 H]2+) of both peptides closely matched with the calculated m/z (< 2 ppm) for the peptide sequences GRGTETREATHTYDMV and GRQSFNDSDKSNYFEN. This is expected for both lasso peptides, considering the loss of a water molecule. The signals of both compounds were also identified in UPLC/MS analysis of the mycelium extracts (Fig. 7A and B). This evidence, combined with the fact that unmodified strains or those with the empty vector didn’t show any changes in their traits, strongly suggests that the observed changes in sporulation in the hosts are directly connected to the presence of lasso peptides within the cells.

Fig. 6 Mass spectrum (right) and extracted ion chromatogram (left) of the [M + 2 H] ions of lasso peptides contained in the supernatant extracts (A) Morphosin-1 (RT 1.94 min; HRESIMS m/z 903.4141 [M + 2 H]2+; calculated for C74H116N24O27S, m/z 903.415399), (B) Morphosin-2 (RT 1.76 and 2.94 min; HRESIMS m/z 945.4050 [M + 2 H]2+; calculated for C80H112N24O30, m/z 945.406086). (C) Signal corresponding to a peptide with a molecular mass of 1870.7054 Da (RT 2.58 min)

Fig. 7 Mass spectrum (right) and extracted ion chromatogram (left) of the [M + 2 H] ions of lasso peptides contained in the mycelium extracts. (A) Morphosin-1 (RT 1.83 min.; HRESIMS m/z 903.4107[M + 2 H]2+; calculated for C74H116N24O27S, m/z 903.415399). (B) Morphosin-2 (RT 1.69 y 2.86 min; HRESIMS m/z 945.4034 [M + 2 H]2+; calculated for C80H112N24O30, m/z 945.406086). C. Signal corresponding to a peptide with a molecular mass of 1870.7054 Da (RT 2.51 min)

In addition, a signal with a RT of around 2.6 min and a m/z ([M + 2 H]2+) of 936.4018 Da was detected in the mycelium and supernatant extracts of the LASS-containing strains. This signal corresponds to a peptide with a molecular mass of 1,870.7 Da, which could be morphosin-2 with the loss of a water molecule (Figs. 6C and 7C).

Antibacterial activity

The antibacterial activity of the mycelium and supernatant extracts of S. avermitilis SUKA 22, which produces morphosin-1 and − 2, was tested against B. subtilis, M. luteus and E. coli. However, no antimicrobial effect could be detected with this assay (not shown).

Discussion

Our research has identified a lasso peptide BGC within the genome of the endophyte Streptomyces sp. L06. This BGC contains two distinct precursor genes whose products can be turned into two different lasso peptides: morphosin-1 and morphosin-2. Morphosin-2 is a member of a particular subfamily of lasso peptides characterized by the GRX3NDX2DKXNYFEX sequence. Initially, this subfamily was classified as an unknown subfamily with only six different sequences (Tietz et al. 2017). However, in this study, we identified 27 different sequences in this subfamily, and reported, for the first time, the production of a lasso peptide from this subfamily.

According to the SSNs analysis six of the nine precursor peptides that are dissimilar to morphosin 2, have sequences quite different from each other. However, the cyclases that modify every precursor peptide have similar sequences. It also highlights the fact that lasso peptide RRE and leader peptidase are encoded separately by most LASS BGCs that contain only one peptide precursor, and two domain B proteins are encoded in all LASS BGCs that have two precursor peptides.

Lasso peptides are known for their high-temperature stability and protease resistance (Hegemann et al. 2020). Our UPLC/MS analysis of supernatant and mycelium extracts showed a signal corresponding to the molecular mass of the morphosin-2 at two different retention times, one of which could correlate with its threaded version and the other with its unthreaded version. This result suggests that the structure of morphosin-2 is labile and can exist in an unthreaded form. Peptides that unthread at temperatures associated with the solvents used for extraction (usually 40 °C) have been reported (Hegemann et al. 2020). Moreover, organic solvents like acetonitrile, used for solubilization and purification, can also cause unthreading of lasso peptides (Koos et al. 2019). In our study, we prepared extracts, containing morphosin-1 and morphosin-2, at temperatures of 40 °C and resuspended them in acetonitrile. Therefore, morphosin-2 could be prone to unthreading due to temperature or organic solvents.

Streptomyces undergo a complex life cycle involving aerial hyphae and spore development. Each stage of this process exhibits a distinct phenotype, so defects in any phase can be visually detected (Jani et al. 2015). The phenotypic changes observed in hosts that contain a LASS in their chromosomes correspond to the absence of spores and damage in aerial mycelium development. A similar phenotype was observed when extract containing morphosins was externally applied to the plain strains carrying only the empty vector. These findings suggest that morphosins cause morphological abnormalities in the development of Streptomyces.

Some RiPPs play a role in forming Streptomyces antibiotics and their morphological development. Two lanthipeptides, SapB and SapT, produced by S. coelicolor and S. lavenduligriseus Tu 109, respectively, contribute to aerial mycelium formation and restore aerial hyphae formation in bld mutants when supplied extracellularly. These peptides act as surfactants, reducing surface tension (Kodani et al. 2004, 2005; Sarksian et al. 2022), but only SapT shows antibacterial activity. Goadsporin, a thiazole/oxazole-modified microcin peptide (TOMM) synthesized by Streptomyces sp., promotes sporulation and/or synthesis of undecylprodigiosin but does not affect the producing strain when applied exogenously (Onaka et al. 2001). Thiostrepton, a thiopeptide produced by a Streptomyces laurentii, stimulates the formation of pellets in S. coelicolor at sub-inhibitory concentrations, but it reduces the production of actinorhodin and undecylprodigiosin (Wang et al. 2017). The three species of Streptomyces tested expressing morphosins exhibited an inhibition of their morphological development. Two of these bacteria are deleted strains for secondary metabolite production (S. coelicolor M1152 and S. avermitilis SUKA 22). However, in S. lividans TK24 grown on MS medium, actinorhodin production was observed only when the LASS fragment was present. Normally, S. lividans TK24 does not produce actinorhodin when it is grown on MS medium (Rebets et al. 2018). These findings suggest that the small molecules produced by Streptomyces could act as signaling molecules in the morphological development of Streptomyces and the production of antibiotics.

In addition, studying the genetic makeup of the core of a BGC can offer valuable insights into the functionality and physiological relationship among the genes of the cluster. This analysis can provide a basis for hypotheses about the function of each gene, the entire cluster, or the compound produced (Kountz et al. 2021). For lasso peptides, regulatory genes that control the production of these compounds are frequently located upstream of the BGC (Mevaere et al. 2018; Guerrero-Garzón et al. 2020). Our research has identified two genes with potential regulatory functions that flank the BGC of interest. One of these regulators, XRE, and a protein bearing the DUF397 domain constitute the XRE/DUF397 system. Recently, 14 different XRE/DUF397 systems from S. coelicolor were studied, and they were found to act as regulators of morphological development and the production of actinorhodin and other secondary metabolites (Riascos et al. 2023). These authors report that overexpression of the sco4678(XRE)/sco4679 (DUF397) system leads to a bald phenotype and increased actinorhodin production in S. coelicolor. Likely, these effects are unrelated to lasso peptides, as S. coelicolor does not produce these compounds. However, this effect is similar to what we observed in S. lividans TK24 when expressing morphosins. It is unknown what causes this effect in Streptomyces hosts, it is speculated that morphosins may act as ligands, activating the XRE/DUF397 pathway. Although in this study, regulatory genes were not cloned, Streptomyces hosts have their own XRE/DUF systems (Riascos et al. 2023). Strains such as S. coelicolor M1152 and S. avermitilis SUKA 22 cannot produce their main antibiotics because they were engineered to delete their antibiotic gene clusters. Hence, only the morphological effect can be observed when the LASS region is present in their genomes. It has been reported that some chemicals that inhibit sporulation can also act as antibiotics against rod-shaped and coccoid Gram-positive bacteria by interfering with cell division, either directly or indirectly. Specific molecules that target DNA can also cause defects in the sporulation process of Streptomyces at subinhibitory concentrations (Jani et al. 2015; McAuley et al. 2019a, b). We tested the antibacterial effect of expressed lasso peptide extracts containing morphosin-1 and − 2 on B. subtilis and M. luteus. However, our results showed no activity against either of the two strains. It is important to note that this does not necessarily mean that lasso peptides are not bioactive. Factors such as low expression, lack of secondary modification enzymes, and purification could have affected the results obtained in our study.

Further research needs to confirm the lasso topology of morphosin-1 and morphosin-2 to establish that LASSC gene encodes a lasso-cyclase capable of catalyzing the creation of macrolactam rings with varying sizes (8 and 9 residues) and with different residues G-E in morphosin-1 and G-D in morphosin-2. Besides, understanding the function of the regulatory genes flanking the core genes that produce lasso peptides will shed light on the role of morphosins in developing morphology and antibiotic production and whether both peptides act together or independently.

In our research, we analyzed the LASS BGC from the genome of Streptomyces sp. L06. Our findings revealed the presence of two genes that encode precursor peptides that can be turned out into lasso peptides with different ring sizes and compositions. Specifically, we identified morphosin-2 as a member of a new lasso peptide subfamily comprising 27 additional lasso peptides. This study represents the first investigation of a member of this subfamily.

Furthermore, our research suggested that the heterologous expression of the LASS BGC affects the morphological development of three Streptomyces strains and induces actinorhodin production in one of them. This finding is a significant step forward in our understanding of lasso peptides and their role in morphological development and antibiotic production in Streptomyces strains.

Acknowledgements

We extend our gratitude to Dr. Silvia Ivonne Mora for her technical support and advice in the UHPLC-Mass analyses. AORC is a doctoral student in the Programa de Ciencias Biológicas, UNAM. She was supported by the doctoral scholarship number 742885, awarded from CONAHCYT, Mexico.

Author contributions

AORC, and SS conceived and designed the study. AORC carried out the experiments and wrote the first version of this manuscript. BRV, MLMR, EL, RRS, and SS, analyzed and monitored the data, contributed with some of the techniques and reagents/materials, and revised and improved the manuscript.

Funding

This project was funded by the grant DGAPA, PAPIIT, UNAM, IN295922 and IN205519. We are grateful for the support provided by the NUATEI institutional program of the Instituto de Investigaciones Biomédicas, UNAM.

Data availability

All data generated or analyzed during this study are included in this manuscript. Requests for any additional information can be made to the corresponding author.

Declarations

Ethics approval

Not applicable.

Competing interests

The authors declare that the research was conducted in the absence of any commercial or financial relationships.

Consent to participate

All authors have their consent to participate.

Consent for publication

All authors have their consent to publish their work.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

Adelman K Yuzenkova J La Porta A Zenkin N Lee J Lis JT Borukhov S Wang MD Severinov K Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25 Mol Cell 2004 14 753 762 10.1016/j.molcel.2004.05.017 15200953
Adelman K, Yuzenkova J, La Porta A, Zenkin N, Lee J, Lis JT, Borukhov S, Wang MD, Severinov K (2004) Molecular mechanism of transcription inhibition by peptide antibiotic Microcin J25. Mol Cell 14:753–762. 10.1016/j.molcel.2004.05.01715200953 10.1016/j.molcel.2004.05.017
Balouiri M Sadiki M Ibnsouda SK Methods for in vitro evaluating antimicrobial activity: a review J Pharm Anal 2016 6 71 79 10.1016/j.jpha.2015.11.005 29403965
Balouiri M, Sadiki M, Ibnsouda SK (2016) Methods for in vitro evaluating antimicrobial activity: a review. J Pharm Anal 6:71–79. 10.1016/j.jpha.2015.11.00529403965 10.1016/j.jpha.2015.11.005
Baquero F Beis K Craik DJ Li Y Link AJ Rebuffat S Salomón R Severinov K Zirah S Hegemann JD The pearl jubilee of microcin J25: thirty years of research on an exceptional lasso peptide Nat Prod Rep 2024 41 469 511 10.1039/d3np00046j 38164764
Baquero F, Beis K, Craik DJ, Li Y, Link AJ, Rebuffat S, Salomón R, Severinov K, Zirah S, Hegemann JD (2024) The pearl jubilee of microcin J25: thirty years of research on an exceptional lasso peptide. Nat Prod Rep 41:469–511. 10.1039/d3np00046j38164764 10.1039/d3np00046j
Beis K Rebuffat S Multifaceted ABC transporters associated to microcin and bacteriocin export Res Microbiol 2019 170 399 406 10.1016/j.resmic.2019.07.002 31401108
Beis K, Rebuffat S (2019) Multifaceted ABC transporters associated to microcin and bacteriocin export. Res Microbiol 170:399–406. 10.1016/j.resmic.2019.07.00231401108 10.1016/j.resmic.2019.07.002
Blin K Shaw S Augustijn HE Reitz ZL Biermann F Alanjary M Fetter A Terlouw BR Metcalf WW Helfrich EJN van Wezel GP Medema MH Weber T antiSMASH 7.0: new and improved predictions for detection, regulation, chemical structures and visualisation Nucleic Acids Res 2023 51 W46 W50 10.1111/cobi.13196 37140036
Blin K, Shaw S, Augustijn HE, Reitz ZL, Biermann F, Alanjary M, Fetter A, Terlouw BR, Metcalf WW, Helfrich EJN, van Wezel GP, Medema MH, Weber T (2023) antiSMASH 7.0: new and improved predictions for detection, regulation, chemical structures and visualisation. Nucleic Acids Res 51:W46–W50. 10.1111/cobi.1319637140036 10.1111/cobi.13196
Bountra K Hagelueken G Choudhury HG Corradi V El Omari K Wagner A Mathavan I Zirah S Yuan Wahlgren W Tieleman DP Schiemann O Rebuffat S Beis K Structural basis for antibacterial peptide self-immunity by the bacterial ABC transporter McjD EMBO J 2017 36 3062 3079 10.15252/embj.201797278 28864543
Bountra K, Hagelueken G, Choudhury HG, Corradi V, El Omari K, Wagner A, Mathavan I, Zirah S, Yuan Wahlgren W, Tieleman DP, Schiemann O, Rebuffat S, Beis K (2017) Structural basis for antibacterial peptide self-immunity by the bacterial ABC transporter McjD. EMBO J 36:3062–3079. 10.15252/embj.20179727828864543 10.15252/embj.201797278
Caicedo-Montoya C Gómez-Román MP Vázquez-Hernández M Mora-Rincón RA Rodriguez-Luna SD Rodríguez-Sanoja R Sanchez S Evolutionary genomics and biosynthetic potential of novel environmental Actinobacteria Appl Microbiol Biotechnol 2021 105 8805 8822 10.1007/s00253-021-11659-3 34716462
Caicedo-Montoya C, Gómez-Román MP, Vázquez-Hernández M, Mora-Rincón RA, Rodriguez-Luna SD, Rodríguez-Sanoja R, Sanchez S (2021) Evolutionary genomics and biosynthetic potential of novel environmental Actinobacteria. Appl Microbiol Biotechnol 105:8805–8822. 10.1007/s00253-021-11659-334716462 10.1007/s00253-021-11659-3
Cao L Do T Link AJ Mechanisms of action of ribosomally synthesized and posttranslationally modified peptides (RiPPs) J Ind Microbiol Biotechnol 2021 48 kuab005 10.1093/jimb/kuab005 33928382
Cao L, Do T, Link AJ (2021) Mechanisms of action of ribosomally synthesized and posttranslationally modified peptides (RiPPs). J Ind Microbiol Biotechnol 48:kuab005. 10.1093/jimb/kuab00533928382 10.1093/jimb/kuab005
Delgado MA Rintoul MR Farías RN Salomón RA Escherichia coli RNA polymerase is the target of the cyclopeptide antibiotic microcin J25 J Bacteriol 2001 183 4543 4550 10.1128/JB.183.15.4543-4550.2001 11443089
Delgado MA, Rintoul MR, Farías RN, Salomón RA (2001) Escherichia coli RNA polymerase is the target of the cyclopeptide antibiotic microcin J25. J Bacteriol 183:4543–4550. 10.1128/JB.183.15.4543-4550.200111443089 10.1128/JB.183.15.4543-4550.2001
Elsayed SS Trusch F Deng H Raab A Prokes I Busarakam K Asenjo JA Andrews BA van West P Bull AT Goodfellow M Yi Y Ebel R Jaspars M Rateb ME Chaxapeptin, a lasso peptide from extremotolerant Streptomyces leeuwenhoekii strain C58 from the hyperarid atacama desert J Org Chem 2015 80 10252 10260 10.1021/acs.joc.5b01878 26402731
Elsayed SS, Trusch F, Deng H, Raab A, Prokes I, Busarakam K, Asenjo JA, Andrews BA, van West P, Bull AT, Goodfellow M, Yi Y, Ebel R, Jaspars M, Rateb ME (2015) Chaxapeptin, a lasso peptide from extremotolerant Streptomyces leeuwenhoekii strain C58 from the hyperarid atacama desert. J Org Chem 80:10252–10260. 10.1021/acs.joc.5b0187826402731 10.1021/acs.joc.5b01878
Gavrish E Sit CS Cao S Kandror O Spoering A Peoples A Ling L Fetterman A Hughes D Bissell A Torrey H Akopian T Mueller A Epstein S Goldberg A Clardy J Lewis K Lassomycin, a ribosomally synthesized cyclic peptide, kills Mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2 Chem Biol 2014 21 509 518 10.1016/j.chembiol.2014.01.014 24684906
Gavrish E, Sit CS, Cao S, Kandror O, Spoering A, Peoples A, Ling L, Fetterman A, Hughes D, Bissell A, Torrey H, Akopian T, Mueller A, Epstein S, Goldberg A, Clardy J, Lewis K (2014) Lassomycin, a ribosomally synthesized cyclic peptide, kills Mycobacterium tuberculosis by targeting the ATP-dependent protease ClpC1P1P2. Chem Biol 21:509–518. 10.1016/j.chembiol.2014.01.01424684906 10.1016/j.chembiol.2014.01.014
Gomez-Escribano JP Bibb MJ Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters Microb Biotechnol 2011 4 207 215 10.1111/j.1751-7915.2010.00219.x 21342466
Gomez-Escribano JP, Bibb MJ (2011) Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microb Biotechnol 4:207–215. 10.1111/j.1751-7915.2010.00219.x21342466 10.1111/j.1751-7915.2010.00219.x
Gregory MA Till R Smith MC Integration site for Streptomyces phage phiBT1 and development of site-specific integrating vectors J Bacteriol 2003 185 5320 5323 10.1128/JB.185.17.5320-5323.2003 12923110
Gregory MA, Till R, Smith MC (2003) Integration site for Streptomyces phage phiBT1 and development of site-specific integrating vectors. J Bacteriol 185:5320–5323. 10.1128/JB.185.17.5320-5323.200312923110 10.1128/JB.185.17.5320-5323.2003
Guerrero-Garzón JF Madland E Zehl M Singh M Rezaei S Aachmann FL Courtade G Urban E Rückert C Busche T Kalinowski J Cao YR Jiang Y Jiang CL Selivanova G Zotchev SB Class IV lasso peptides synergistically induce proliferation of cancer cells and sensitize them to doxorubicin iScience 2020 23 101785 10.1016/j.isci.2020.101785 33294793
Guerrero-Garzón JF, Madland E, Zehl M, Singh M, Rezaei S, Aachmann FL, Courtade G, Urban E, Rückert C, Busche T, Kalinowski J, Cao YR, Jiang Y, Jiang CL, Selivanova G, Zotchev SB (2020) Class IV lasso peptides synergistically induce proliferation of cancer cells and sensitize them to doxorubicin. iScience 23:101785. 10.1016/j.isci.2020.10178533294793 10.1016/j.isci.2020.101785
Gust B Chap. 7. Cloning and analysis of natural product pathways Methods Enzymol 2009 458 159 180 10.1016/S0076-6879(09)04807-1 19374983
Gust B (2009) Chap. 7. Cloning and analysis of natural product pathways. Methods Enzymol 458:159–180. 10.1016/S0076-6879(09)04807-119374983 10.1016/S0076-6879(09)04807-1
Hegemann JD Factors governing the thermal stability of lasso peptides ChemBioChem 2020 21 1–2 7 18 10.1002/cbic.201900364 31243865
Hegemann JD (2020) Factors governing the thermal stability of lasso peptides. ChemBioChem 21(1–2):7–18. 10.1002/cbic.20190036431243865 10.1002/cbic.201900364
Hegemann JD Zimmermann M Xie X Marahiel MA Lasso peptides: an intriguing class of bacterial natural products Acc Chem Res 2015 48 1909 1919 10.1021/acs.accounts.5b00156 26079760
Hegemann JD, Zimmermann M, Xie X, Marahiel MA (2015) Lasso peptides: an intriguing class of bacterial natural products. Acc Chem Res 48:1909–1919. 10.1021/acs.accounts.5b0015626079760 10.1021/acs.accounts.5b00156
Hegemann JD Dit-Foque KJ Xie X Liu HW Begley TP 2.10 - X Lasso peptides: structure, biosynthesis, activities, and Beyond Comprehensive Natural products III 2020 3 New York Elsevier 206 228
Hegemann JD, Dit-Foque KJ, Xie X (2020) 2.10 - X Lasso peptides: structure, biosynthesis, activities, and Beyond. In: Liu HW, Begley TP (eds) Comprehensive Natural products III, 3rd edn. Elsevier, New York, pp 206–228. doi:10.1016/B978-0-12-409547-2.14628-1.
Helynck G Dubertret C Mayaux JF Leboul J Isolation of RP 71955, a new anti-HIV-1 peptide secondary metabolite J Antibiot 1993 46 1756 1757 10.7164/antibiotics.46.1756
Helynck G, Dubertret C, Mayaux JF, Leboul J (1993) Isolation of RP 71955, a new anti-HIV-1 peptide secondary metabolite. J Antibiot 46:1756–1757. 10.7164/antibiotics.46.175610.7164/antibiotics.46.1756
Ikeda H Kotaki H Omura S Genetic studies of avermectin biosynthesis in Streptomyces avermitilis J Bacteriol 1987 169 5615 5621 10.1128/jb.169.12.5615-5621.1987 3680172
Ikeda H, Kotaki H, Omura S (1987) Genetic studies of avermectin biosynthesis in Streptomyces avermitilis. J Bacteriol 169:5615–5621. 10.1128/jb.169.12.5615-5621.19873680172 10.1128/jb.169.12.5615-5621.1987
Jani C Tocheva EI McAuley S Craney A Jensen GJ Nodwell J Streptomyces: a screening tool for bacterial cell division inhibitors J Biomol Screen 2015 20 275 284 10.1177/1087057114551334 25256667
Jani C, Tocheva EI, McAuley S, Craney A, Jensen GJ, Nodwell J (2015) Streptomyces: a screening tool for bacterial cell division inhibitors. J Biomol Screen 20:275–284. 10.1177/108705711455133425256667 10.1177/1087057114551334
Kaweewan I Hemmi H Komaki H Harada S Kodani S Isolation and structure determination of a new lasso peptide specialicin based on genome mining Bioorg Med Chem 2018 26 6050 6055 10.1016/j.bmc.2018.11.007 30448257
Kaweewan I, Hemmi H, Komaki H, Harada S, Kodani S (2018) Isolation and structure determination of a new lasso peptide specialicin based on genome mining. Bioorg Med Chem 26:6050–6055. 10.1016/j.bmc.2018.11.00730448257 10.1016/j.bmc.2018.11.007
Kieser T Bibb MJ Buttner MJ Chater KF Hopwood DA Practical Streptomyces Genetics 2000 Norwich John Innes Foundation
Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces Genetics. John Innes Foundation, Norwich
Knappe TA Linne U Xie X Marahiel MA The glucagon receptor antagonist BI-32169 constitutes a new class of lasso peptides FEBS Lett 2010 584 785 789 10.1016/j.febslet.2009.12.046 20043911
Knappe TA, Linne U, Xie X, Marahiel MA (2010) The glucagon receptor antagonist BI-32169 constitutes a new class of lasso peptides. FEBS Lett 584:785–789. 10.1016/j.febslet.2009.12.04620043911 10.1016/j.febslet.2009.12.046
Kodani S Unno K How to harness biosynthetic gene clusters of lasso peptides J Ind Microbiol Biotechnol 2020 47 703 714 10.1007/s10295-020-02292-6 32705462
Kodani S, Unno K (2020) How to harness biosynthetic gene clusters of lasso peptides. J Ind Microbiol Biotechnol 47:703–714. 10.1007/s10295-020-02292-632705462 10.1007/s10295-020-02292-6
Kodani S Hudson ME Durrant MC Buttner MJ Nodwell JR Willey JM The SapB morphogen is a lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces coelicolor Proc Natl Acad Sci USA 2004 101 11448 11453 10.1073/pnas.0404220101 15277670
Kodani S, Hudson ME, Durrant MC, Buttner MJ, Nodwell JR, Willey JM (2004) The SapB morphogen is a lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces coelicolor. Proc Natl Acad Sci USA 101:11448–11453. 10.1073/pnas.040422010115277670 10.1073/pnas.0404220101
Kodani S Lodato MA Durrant MC Picart F Willey JM SapT, a lanthionine-containing peptide involved in aerial hyphae formation in the streptomycetes Mol Microbiol 2005 58 1368 1380 10.1111/j.1365-2958.2005.04921.x 16313622
Kodani S, Lodato MA, Durrant MC, Picart F, Willey JM (2005) SapT, a lanthionine-containing peptide involved in aerial hyphae formation in the streptomycetes. Mol Microbiol 58:1368–1380. 10.1111/j.1365-2958.2005.04921.x16313622 10.1111/j.1365-2958.2005.04921.x
Komatsu M Komatsu K Koiwai H Yamada Y Kozone I Izumikawa M Hashimoto J Takagi M Omura S Shin-ya K Cane DE Ikeda H Engineered Streptomyces avermitilis host for heterologous expression of biosynthetic gene cluster for secondary metabolites ACS Synth Biol 2013 2 384 396 10.1021/sb3001003 23654282
Komatsu M, Komatsu K, Koiwai H, Yamada Y, Kozone I, Izumikawa M, Hashimoto J, Takagi M, Omura S, Shin-ya K, Cane DE, Ikeda H (2013) Engineered Streptomyces avermitilis host for heterologous expression of biosynthetic gene cluster for secondary metabolites. ACS Synth Biol 2:384–396. 10.1021/sb300100323654282 10.1021/sb3001003
Koos JD Link AJ Heterologous and in vitro reconstitution of fuscanodin, a lasso peptide from Thermobifida fusca J Am Chem Soc 2019 141 928 935 10.1021/jacs.8b10724 30532970
Koos JD, Link AJ (2019) Heterologous and in vitro reconstitution of fuscanodin, a lasso peptide from Thermobifida fusca. J Am Chem Soc 141:928–935. 10.1021/jacs.8b1072430532970 10.1021/jacs.8b10724
Kountz DJ Balskus EP Leveraging microbial genomes and genomic context for chemical discovery Acc Chem Res 2021 54 2788 2797 10.1021/acs.accounts.1c00100 34087065
Kountz DJ, Balskus EP (2021) Leveraging microbial genomes and genomic context for chemical discovery. Acc Chem Res 54:2788–2797. 10.1021/acs.accounts.1c0010034087065 10.1021/acs.accounts.1c00100
Kuznedelov K Semenova E Knappe TA Mukhamedyarov D Srivastava A Chatterjee S Ebright RH Marahiel MA Severinov K The antibacterial threaded-lasso peptide capistruin inhibits bacterial RNA polymerase J Mol Biol 2011 412 842 848 10.1016/j.jmb.2011.02.060 21396375
Kuznedelov K, Semenova E, Knappe TA, Mukhamedyarov D, Srivastava A, Chatterjee S, Ebright RH, Marahiel MA, Severinov K (2011) The antibacterial threaded-lasso peptide capistruin inhibits bacterial RNA polymerase. J Mol Biol 412:842–848. 10.1016/j.jmb.2011.02.06021396375 10.1016/j.jmb.2011.02.060
Li Y Rebuffat S The manifold roles of microbial ribosomal peptide-based natural products in physiology and ecology J Biol Chem 2020 295 34 54 10.1074/jbc.REV119.006545 31784450
Li Y, Rebuffat S (2020) The manifold roles of microbial ribosomal peptide-based natural products in physiology and ecology. J Biol Chem 295:34–54. 10.1074/jbc.REV119.00654531784450 10.1074/jbc.REV119.006545
Madeira F Pearce M Tivey ARN Basutkar P Lee J Edbali O Madhusoodanan N Kolesnikov A Lopez R Search and sequence analysis tools services from EMBL-EBI in 2022 Nucleic Acids Res 2022 50 W276 W279 10.1093/nar/gkac240 35412617
Madeira F, Pearce M, Tivey ARN, Basutkar P, Lee J, Edbali O, Madhusoodanan N, Kolesnikov A, Lopez R (2022) Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Res 50:W276–W279. 10.1093/nar/gkac24035412617 10.1093/nar/gkac240
Maksimov MO Pan SJ James-Link A Lasso peptides: structure, function, biosynthesis, and engineering Nat Prod Rep 2012 29 996 1006 10.1039/c2np20070h 22833149
Maksimov MO, Pan SJ, James-Link A (2012) Lasso peptides: structure, function, biosynthesis, and engineering. Nat Prod Rep 29:996–1006. 10.1039/c2np20070h22833149 10.1039/c2np20070h
McAuley S Huynh A Howells A Walpole C Maxwell A Nodwell JR Discovery of a novel DNA gyrase-targeting antibiotic through the chemical perturbation of Streptomyces venezuelae sporulation Cell Chem Biol 2019 26 1274 1282e4 10.1016/j.chembiol.2019.06.0021 31279606
McAuley S, Huynh A, Howells A, Walpole C, Maxwell A, Nodwell JR (2019a) Discovery of a novel DNA gyrase-targeting antibiotic through the chemical perturbation of Streptomyces venezuelae sporulation. Cell Chem Biol 26:1274–1282e4. 10.1016/j.chembiol.2019.06.002131279606 10.1016/j.chembiol.2019.06.0021
McAuley S Vadia S Jani C Huynh A Yang Z Levin PA Nodwell JR A chemical inhibitor of cell growth reduces cell size in Bacillus subtilis ACS Chem Biol 2019 14 688 695 10.1021/acschembio.8b010662 30848888
McAuley S, Vadia S, Jani C, Huynh A, Yang Z, Levin PA, Nodwell JR (2019b) A chemical inhibitor of cell growth reduces cell size in Bacillus subtilis. ACS Chem Biol 14:688–695. 10.1021/acschembio.8b01066230848888 10.1021/acschembio.8b010662
Metelev M Tietz JI Melby JO Blair PM Zhu L Livnat I Severinov K Mitchell DA Structure, bioactivity, and resistance mechanism of Streptomonomicin, an unusual lasso peptide from an understudied halophilic actinomycete Chemi Biol 2015 22 241 250 10.1016/j.chembiol.2014.11.017
Metelev M, Tietz JI, Melby JO, Blair PM, Zhu L, Livnat I, Severinov K, Mitchell DA (2015) Structure, bioactivity, and resistance mechanism of Streptomonomicin, an unusual lasso peptide from an understudied halophilic actinomycete. Chemi Biol 22:241–250. 10.1016/j.chembiol.2014.11.01710.1016/j.chembiol.2014.11.017
Metelev M Arseniev A Bushin LB Kuznedelov K Artamonova TO Kondratenko R Khodorkovskii M Seyedsayamdost MR Severinov K Acinetodin and klebsidin, RNA polymerase targeting lasso peptides produced by human isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae ACS Chem Biol 2017 12 814 824 10.1021/acschembio.6b01154 28106375
Metelev M, Arseniev A, Bushin LB, Kuznedelov K, Artamonova TO, Kondratenko R, Khodorkovskii M, Seyedsayamdost MR, Severinov K (2017) Acinetodin and klebsidin, RNA polymerase targeting lasso peptides produced by human isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae. ACS Chem Biol 12:814–824. 10.1021/acschembio.6b0115428106375 10.1021/acschembio.6b01154
Mevaere J Goulard C Schneider O Sekurova ON Ma H Zirah S Afonso C Rebuffat S Zotchev SB Li Y An orthogonal system for heterologous expression of actinobacterial lasso peptides in Streptomyces hosts Sci Rep 2018 8 8232 10.1038/s41598-018-26620-0 29844351
Mevaere J, Goulard C, Schneider O, Sekurova ON, Ma H, Zirah S, Afonso C, Rebuffat S, Zotchev SB, Li Y (2018) An orthogonal system for heterologous expression of actinobacterial lasso peptides in Streptomyces hosts. Sci Rep 8:8232. 10.1038/s41598-018-26620-029844351 10.1038/s41598-018-26620-0
Morishita Y Chiba S Tsukuda E Tanaka T Ogawa T Yamasaki M Yoshida M Kawamoto I Matsuda Y RES-701-1, a novel and selective endothelin type B receptor antagonist produced by Streptomyces sp. RE-701. I. characterization of producing strain, fermentation, isolation, physico-chemical and biological properties J Antibiot 1994 47 269 275 10.7164/antibiotics.47.269
Morishita Y, Chiba S, Tsukuda E, Tanaka T, Ogawa T, Yamasaki M, Yoshida M, Kawamoto I, Matsuda Y (1994) RES-701-1, a novel and selective endothelin type B receptor antagonist produced by Streptomyces sp. RE-701. I. characterization of producing strain, fermentation, isolation, physico-chemical and biological properties. J Antibiot 47:269–275. 10.7164/antibiotics.47.26910.7164/antibiotics.47.269
Onaka H Tabata H Igarashi Y Sato Y Furumai T Goadsporin, a chemical substance which promotes secondary metabolism and morphogenesis in streptomycetes. I. purification and characterization J Antibiot 2001 54 1036 1044 10.7164/antibiotics.54.1036
Onaka H, Tabata H, Igarashi Y, Sato Y, Furumai T (2001) Goadsporin, a chemical substance which promotes secondary metabolism and morphogenesis in streptomycetes. I. purification and characterization. J Antibiot 54:1036–1044. 0.7164/antibiotics.54.103610.7164/antibiotics.54.1036
Rebets Y Tsolis KC Guðmundsdóttir EE Koepff J Wawiernia B Busche T Bleidt A Horbal L Myronovskyi M Ahmed Y Wiechert W Rückert C Hamed MB Bilyk B Anné J Friðjónsson Ó Kalinowski J Oldiges M Economou A Luzhetskyy A Characterization of sigma factor genes in Streptomyces lividans TK24 using a genomic library-based approach for multiple gene deletions Front Microbiol 2018 9 3033 10.3389/fmicb.2018.03033 30619125
Rebets Y, Tsolis KC, Guðmundsdóttir EE, Koepff J, Wawiernia B, Busche T, Bleidt A, Horbal L, Myronovskyi M, Ahmed Y, Wiechert W, Rückert C, Hamed MB, Bilyk B, Anné J, Friðjónsson Ó, Kalinowski J, Oldiges M, Economou A, Luzhetskyy A (2018) Characterization of sigma factor genes in Streptomyces lividans TK24 using a genomic library-based approach for multiple gene deletions. Front Microbiol 9:3033. 10.3389/fmicb.2018.0303330619125 10.3389/fmicb.2018.03033
Riascos C Martínez-Carrasco A Díaz M Santamaría RI Role of fourteen XRE-DUF397 pairs from Streptomyces coelicolor as regulators of antibiotic production and differentiation. New players in a complex regulatory network Front Microbiol 2023 14 1217350 10.3389/fmicb.2023.1217350 37492264
Riascos C, Martínez-Carrasco A, Díaz M, Santamaría RI (2023) Role of fourteen XRE-DUF397 pairs from Streptomyces coelicolor as regulators of antibiotic production and differentiation. New players in a complex regulatory network. Front Microbiol 14:1217350. 10.3389/fmicb.2023.121735037492264 10.3389/fmicb.2023.1217350
Rima M Fajloun Z Sabatier JM Bechinger B Naas T Antimicrobial peptides: a potent alternative to antibiotics Antibiot (Basel) 2021 10 1095 10.3390/antibiotics10091095
Rima M, Fajloun Z, Sabatier JM, Bechinger B, Naas T (2021) Antimicrobial peptides: a potent alternative to antibiotics. Antibiot (Basel) 10:1095. 10.3390/antibiotics1009109510.3390/antibiotics10091095
Rocha-Mendoza D Manzo-Ruiz M Romero-Rodríguez A Ruiz-Villafán B Rodríguez-Sanoja R Sánchez S Dissecting the role of the two Streptomyces peucetius var. Caesius glucokinases in the sensitivity to carbon catabolite repression J Ind Microbiol Biotechnol 2021 48 kuab047 10.1093/jimb/kuab047 34383077
Rocha-Mendoza D, Manzo-Ruiz M, Romero-Rodríguez A, Ruiz-Villafán B, Rodríguez-Sanoja R, Sánchez S (2021) Dissecting the role of the two Streptomyces peucetius var. Caesius glucokinases in the sensitivity to carbon catabolite repression. J Ind Microbiol Biotechnol 48:kuab047. 10.1093/jimb/kuab04734383077 10.1093/jimb/kuab047
Rückert C Albersmeier A Busche T Jaenicke S Winkler A Friðjónsson ÓH Hreggviðsson GÓ Lambert C Badcock D Bernaerts K Anne J Economou A Kalinowski J Complete genome sequence of Streptomyces lividans TK24 J Biotechnol 2015 199 21 22 10.1016/j.jbiotec.2015.02.004 25680930
Rückert C, Albersmeier A, Busche T, Jaenicke S, Winkler A, Friðjónsson ÓH, Hreggviðsson GÓ, Lambert C, Badcock D, Bernaerts K, Anne J, Economou A, Kalinowski J (2015) Complete genome sequence of Streptomyces lividans TK24. J Biotechnol 199:21–22. 10.1016/j.jbiotec.2015.02.00425680930 10.1016/j.jbiotec.2015.02.004
Sarksian R Hegemann JD Simon MA Acedo JZ van der Donk WA Unexpected methyllanthionine stereochemistry in the morphogenetic lanthipeptide SapT J Am Chem Soc 2022 144 6373 6382 10.1021/jacs.2c00517 35352944
Sarksian R, Hegemann JD, Simon MA, Acedo JZ, van der Donk WA (2022) Unexpected methyllanthionine stereochemistry in the morphogenetic lanthipeptide SapT. J Am Chem Soc 144:6373–6382. 10.1021/jacs.2c0051735352944 10.1021/jacs.2c00517
Shepherd MD Kharel MK Bosserman MA Rohr J Laboratory maintenance of Streptomyces species Curr Protoc Microbiol Unit 2010 10.1002/9780471729259.mc10e01s18
Shepherd MD, Kharel MK, Bosserman MA, Rohr J (2010) Laboratory maintenance of Streptomyces species. Curr Protoc Microbiol Unit. 10.1002/9780471729259.mc10e01s18. -10E.110.1002/9780471729259.mc10e01s18
Smits SHJ Schmitt L Beis K Self-immunity to antibacterial peptides by ABC transporters FEBS Lett 2020 594 3920 3942 10.1002/1873-3468.13953 33040342
Smits SHJ, Schmitt L, Beis K (2020) Self-immunity to antibacterial peptides by ABC transporters. FEBS Lett 594:3920–3942. 10.1002/1873-3468.1395333040342 10.1002/1873-3468.13953
Son S Jang M Lee B Hong YS Ko SK Jang JH Ahn JS Ulleungdin, a lasso peptide with cancer cell migration inhibitory activity discovered by the genome mining approach J Nat Prod 2018 81 2205 2211 10.1021/acs.jnatprod.8b00449 30251851
Son S, Jang M, Lee B, Hong YS, Ko SK, Jang JH, Ahn JS (2018) Ulleungdin, a lasso peptide with cancer cell migration inhibitory activity discovered by the genome mining approach. J Nat Prod 81:2205–2211. 10.1021/acs.jnatprod.8b0044930251851 10.1021/acs.jnatprod.8b00449
Straight PD Willey JM Kolter R Interactions between Streptomyces coelicolor and Bacillus subtilis: role of surfactants in raising aerial structures J Bacteriol 2006 188 4918 4925 10.1128/JB.00162-06 16788200
Straight PD, Willey JM, Kolter R (2006) Interactions between Streptomyces coelicolor and Bacillus subtilis: role of surfactants in raising aerial structures. J Bacteriol 188:4918–4925. 10.1128/JB.00162-0616788200 10.1128/JB.00162-06
Takano H Matsui Y Nomura J Fujimoto M Katsumata N Koyama T Mizuno I Amano S Shiratori-Takano H Komatsu M Ikeda H Ueda K High production of a class III lantipeptide AmfS in Streptomyces griseus Biosci Biotechnol Biochem 2017 81 153 164 10.1080/09168451.2016.1238297 27691921
Takano H, Matsui Y, Nomura J, Fujimoto M, Katsumata N, Koyama T, Mizuno I, Amano S, Shiratori-Takano H, Komatsu M, Ikeda H, Ueda K (2017) High production of a class III lantipeptide AmfS in Streptomyces griseus. Biosci Biotechnol Biochem 81:153–164. 10.1080/09168451.2016.123829727691921 10.1080/09168451.2016.1238297
Tan S Ludwig KC Müller A Schneider T Nodwell JR The lasso peptide siamycin-I targets lipid II at the Gram-positive cell surface ACS Chem Biol 2019 14 966 974 10.1021/acschembio.9b00157 31026131
Tan S, Ludwig KC, Müller A, Schneider T, Nodwell JR (2019) The lasso peptide siamycin-I targets lipid II at the Gram-positive cell surface. ACS Chem Biol 14:966–974. 10.1021/acschembio.9b0015731026131 10.1021/acschembio.9b00157
Tietz JI Schwalen CJ Patel PS Maxson T Blair PM Tai HC Zakai UI Mitchell DA A new genome-mining tool redefines the lasso peptide biosynthetic landscape Nat Chem Biol 2017 13 470 478 10.1038/nchembio.2319 28244986
Tietz JI, Schwalen CJ, Patel PS, Maxson T, Blair PM, Tai HC, Zakai UI, Mitchell DA (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nat Chem Biol 13:470–478. 10.1038/nchembio.231928244986 10.1038/nchembio.2319
Tsunakawa M Hu SL Hoshino Y Detlefson DJ Hill SE Furumai T White RJ Nishio M Kawano K Yamamoto S Siamycins I and II, new anti-HIV peptides: I. Fermentation, isolation, biological activity and initial characterization J Antibiot 1995 48 433 434 10.7164/antibiotics.48.433
Tsunakawa M, Hu SL, Hoshino Y, Detlefson DJ, Hill SE, Furumai T, White RJ, Nishio M, Kawano K, Yamamoto S (1995) Siamycins I and II, new anti-HIV peptides: I. Fermentation, isolation, biological activity and initial characterization. J Antibiot 48:433–434. 10.7164/antibiotics.48.43310.7164/antibiotics.48.433
Um S Kim YJ Kwon H Wen H Kim SH Kwon HC Park S Shin J Oh DC Sungsanpin, a lasso peptide from a deep-sea streptomycete J Nat Prod 2013 76 873 879 10.1021/np300902g 23662937
Um S, Kim YJ, Kwon H, Wen H, Kim SH, Kwon HC, Park S, Shin J, Oh DC (2013) Sungsanpin, a lasso peptide from a deep-sea streptomycete. J Nat Prod 76:873–879. 10.1021/np300902g23662937 10.1021/np300902g
Wang H Zhao G Ding X Morphology engineering of Streptomyces coelicolor M145 by sub-inhibitory concentrations of antibiotics Sci Rep 2017 7 13226 10.1038/s41598-017-13493-y 29038577
Wang H, Zhao G, Ding X (2017) Morphology engineering of Streptomyces coelicolor M145 by sub-inhibitory concentrations of antibiotics. Sci Rep 7:13226. 10.1038/s41598-017-13493-y29038577 10.1038/s41598-017-13493-y
Weber W Fischli W Hochuli E Kupfer E Weibel EK Anantin–a peptide antagonist of the atrial natriuretic factor (ANF). I. Producing organism, fermentation, isolation and biological activity J Antibiot 1991 44 164 171 10.7164/antibiotics.44.164
Weber W, Fischli W, Hochuli E, Kupfer E, Weibel EK (1991) Anantin–a peptide antagonist of the atrial natriuretic factor (ANF). I. Producing organism, fermentation, isolation and biological activity. J Antibiot 44:164–171. 10.7164/antibiotics.44.16410.7164/antibiotics.44.164
Zhu S Fage CD Hegemann JD Mielcarek A Yan D Linne U Marahiel MA The B1 protein guides the biosynthesis of a lasso peptide Sci Rep 2016 6 35604 10.1038/srep35604 27752134
Zhu S, Fage CD, Hegemann JD, Mielcarek A, Yan D, Linne U, Marahiel MA (2016) The B1 protein guides the biosynthesis of a lasso peptide. Sci Rep 6:35604. 10.1038/srep3560427752134 10.1038/srep35604
