
==== Front
Rheumatology (Oxford)
Rheumatology (Oxford)
brheum
Rheumatology (Oxford, England)
1462-0324
1462-0332
Oxford University Press

38837706
10.1093/rheumatology/keae320
keae320
Basic Science
AcademicSubjects/MED00360
FTY720 ameliorates experimental MPO-ANCA-associated vasculitis by regulating fatty acid oxidation via the neutrophil PPARα–CPT1a pathway
Wang Rui-Xue Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

https://orcid.org/0000-0003-1332-8024
Wang Luo-Yi Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

Han Xiang-Yu Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

Chen Su-Fang Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

Sun Xiao-Jing Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

https://orcid.org/0000-0002-4720-2713
Li Zhi-Ying Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China

https://orcid.org/0000-0001-6003-397X
Little Mark A Trinity Kidney Centre, Trinity Translational Medicine Institute, Trinity College Dublin, Dublin, Ireland
Irish Centre for Vascular Biology, Trinity College Dublin, Dublin, Ireland

Zhao Ming-Hui Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China
Research Units of Diagnosis and Treatment of Immune-mediated Kidney Diseases, Chinese Academy of Medical Sciences, Beijing, China
Peking-Tsinghua Center for Life Sciences, Beijing, China

Chen Min Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, Beijing, China
Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China
Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, Beijing, China
Research Units of Diagnosis and Treatment of Immune-mediated Kidney Diseases, Chinese Academy of Medical Sciences, Beijing, China

Correspondence to: Min Chen, Renal Division, Department of Medicine, Peking University First Hospital; Peking University Institute of Nephrology, No 8, Xishiku Street, Xicheng District, Beijing 100034, China; Key Laboratory of Renal Disease, Ministry of Health of China, No 8, Xishiku Street, Xicheng District, Beijing 100034, China; Key Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education, No 8, Xishiku Street, Xicheng District, Beijing 100034, China; Research Units of Diagnosis and Treatment of Immune-mediated Kidney Diseases, Chinese Academy of Medical Sciences, No 8, Xishiku Street, Xicheng District, Beijing 100034, China. E-mail: chenmin74@sina.com
R.-X.W. and L.-Y.W. contributed equally.

9 2024
05 6 2024
05 6 2024
63 9 25782589
04 6 2023
17 5 2024
01 7 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of the British Society for Rheumatology.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com

Abstract

Objectives

Increasing studies demonstrated the importance of C5a and anti-neutrophil cytoplasmic antibody (ANCA)-induced neutrophil activation in the pathogenesis of ANCA-associated vasculitis (AAV). Sphingosine-1-phosphate (S1P) acts as a downstream effector molecule of C5a and enhances neutrophil activation induced by C5a and ANCA. The current study investigated the role of a S1P receptor modulator, FTY720, in experimental autoimmune vasculitis (EAV) and explored the immunometabolism-related mechanisms of FTY720 in modulating ANCA-induced neutrophil activation.

Methods

The effects of FTY720 in EAV were evaluated by quantifying haematuria, proteinuria, crescent formation, tubulointerstitial injury and pulmonary haemorrhage. RNA sequencing of renal cortex and gene enrichment analysis were performed. The proteins of key identified pathways were analysed in neutrophils isolated from peripheral blood of patients with active AAV and normal controls. We assessed the effects of FTY720 on ANCA-induced neutrophil respiratory burst and neutrophil extracellular traps formation (NETosis).

Results

FTY720 treatment significantly attenuated renal injury and pulmonary haemorrhage in EAV. RNA sequencing analyses of renal cortex demonstrated enhanced fatty acid oxidation (FAO) and peroxisome proliferator-activated receptor (PPAR) signalling in FTY720-treated rats. Compared with normal controls, patients with active AAV showed decreased FAO in neutrophils. FTY720-treated differentiated HL-60 cells showed increased expression of carnitine palmitoyltransferase 1a (CPT1a) and PPARα. Blocking or knockdown of CPT1a or PPARα in isolated human neutrophils and HL-60 cells reversed the inhibitory effects of FTY720 on ANCA-induced neutrophil respiratory burst and NETosis.

Conclusion

FTY720 attenuated renal injury in EAV through upregulating FAO via the PPARα–CPT1a pathway in neutrophils, offering potential immunometabolic targets in AAV treatment.

Graphical Abstract

ANCA
glomerulonephritis
FTY720
immunometabolism
National Key Research and Development Program 10.13039/501100012166 2022YFC2502500/2022YFC2502502 Capital’s Funds for Health Improvement and Research 2020–2-4073 National Natural Science Funds No. 82270754 81870477 81900640 82000668 82090021 82300817
==== Body
pmcRheumatology key messages Compared with normal controls, neutrophils from peripheral blood of AAV patients showed decreased FAO-associated proteins.

FTY720 inhibited ANCA-induced neutrophil activation through upregulating FAO, and thus attenuated renal injury in EAV.

Introduction

Anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) comprises a group of autoimmune disorders characterized by necrotizing inflammation of small blood vessels. As the serological hallmark of AAV, ANCAs target constituents of neutrophil granules, mainly proteinase 3 (PR3) or myeloperoxidase (MPO) [1]. Most patients with AAV in China are positive for MPO-ANCA [2, 3].

Although the pathogenesis of AAV is not fully elucidated, the cross-talk among ANCA, neutrophils and the complement system play a central role [4]. Neutrophils are the major effector cells in AAV. ANCAs can induce neutrophil activation, including respiratory burst, degranulation and neutrophil extracellular trap (NET) formation, also termed NETosis [5–7]. ANCA, neutrophils and the complement system form a positive-feedback amplification loop, in which C5a plays a central role mainly by chemotacting and priming neutrophils [8].

As a biologically active sphingolipid metabolite, sphingosine-1-phosphate (S1P) is generated by phosphorylation of sphingosine. S1P interacts with five high-affinity G-protein-coupled receptors (GPCRs) named S1P receptors 1–5 (S1PR1–5) and further participates in distinctive cellular processes, including cell migration, adhesion, survival and proliferation [9]. Notably, fingolimod (FTY720, Gilenya, Novartis), a sphingosine analogue as well as a modulator of S1PR1 and S1PR3–5, has been approved for the treatment of multiple sclerosis [10, 11]. As reported in our previous study, S1P acts as a downstream effector molecule of C5a, and enhances C5a and ANCA-induced neutrophil activation [12].

Recent studies revealed the importance of immunometabolism in various physiological and pathophysiological functions of immune cells [13]. Specifically, neutrophils utilize fatty acid oxidation (FAO)-mediated oxidative phosphorylation (OXPHOS) in the process of neutrophil differentiation, and glycolysis and the pentose phosphate pathway (PPP) as well as NADPH oxidase (NOX) to generate reactive oxygen species (ROS) [14]. Furthermore, NETosis is inhibited by 2-deoxyglucose (a glycolysis inhibitor), indicating that NETosis depends on glycolysis [15]. However, the role of immunometabolism in modulating ANCA-induced neutrophil activation is not fully elucidated.

Based on the above evidence, we hypothesized that immunometabolic pathways are involved in neutrophil activation in AAV, and that FTY720 could attenuate ANCA-induced neutrophil activation by regulating immunometabolic pathways in neutrophils. The current study investigated the metabolic reprogramming of ANCA-activated neutrophils in AAV. We found that FTY720 ameliorated renal injury of experimental MPO-ANCA-associated vasculitis. Mechanistically, FTY720 upregulated FAO in neutrophils and thus inhibited ANCA-induced neutrophil activation via the peroxisome proliferator-activated receptor-α (PPARα)–carnitine palmitoyltransferase 1a (CPT1a) pathway in neutrophils.

Methods

Experimental autoimmune vasculitis model induction and treatment protocol

Six-week-old female WKY rats purchased from Vital River Laboratory Technology Co. Ltd (Beijing, China) were used in our study. All parts of animal experiments were performed in the laboratory animal facility of Peking University First Hospital and complied with the ARRIVE guidelines. Ethical approval for animal studies was granted by Laboratory Animal Ethics Committee of Peking University First Hospital (number: J201924). All procedures were in compliance with Laboratory Animal Care and Use Committee of Peking University First Hospital.

The experimental autoimmune vasculitis (EAV) model was induced by immunization with MPO according to the previous study by Little et al. [16]. Detailed methods are available in the Supplementary Methods, available at Rheumatology online. The treatment was started from week 4 post-immunization when the clinicopathological features of vasculitis were developed [16], and lasted 4 weeks until sacrifice. According to the product instruction, FTY720 (A8548, APExBIO, Houston, TX, USA) was dissolved in a mixture of 10% dimethyl sulfoxide, 40% PEG300 and 50% phosphate-buffered saline (PBS). In line with our previous study [17], the EAV rats were randomly treated with FTY720 at a dosage of 1 mg/kg or vehicle intraperitoneally five times per week (n = 5 per group).

Furthermore, to investigate the influence of FTY720 on EAV induction, another group of EAV rats were treated with FTY720 at a dosage of 1 mg/kg or vehicle intraperitoneally five times per week from the time of immunization (week 0) to sacrifice (week 8) (n = 5 for HSA group, n = 7 for both FTY720 group and vehicle group).

Assessment of clinicopathological characteristics of EAV

The kidney is one of the most frequently involved organs in AAV, and thereby haematuria, proteinuria, serum creatinine and blood urea nitrogen were assessed in our study. Haematuria was semi-quantitatively evaluated with a dipstick (URIT, Shenzhen, China) and was shown on a 0–4 scale. Proteinuria was detected with an ELISA kit (9040, Chondrex, Redmond, WA, USA) according to the manufacturer’s guidelines. Serum creatinine and blood urea nitrogen were analysed by automatic biochemical analyser (model AU5800; Beckman Coulter, Inc., Brea, CA, USA). Circulating anti-hMPO antibody was measured with ELISA. Detailed methods are available in the Supplementary Methods, available at Rheumatology online.

Periodic acid–Schiff (PAS) staining of renal sections was used to assess renal pathological characteristics, including the proportion of glomerular crescent formation and the tubulointerstitial nephritis (TIN) score (0 = no TIN; 1 = a single focus of TIN; 2 = <25% tubulointerstitium involved; 3 = ≥25% tubulointerstitium involved) [16].

In addition to renal injury, pulmonary haemorrhage in EAV was assessed based on the number of lung surface bleeding: 0 = no haemorrhage; 1 = a single haemorrhage; 2 = 2–5 haemorrhages; 3 = 6–12 haemorrhages; and 4 = >12 haemorrhages. Pulmonary haemorrhage was further verified with Perl’s Prussian blue stain (G1426, Solarbio, Beijing, China) according to the manufacturer’s instructions [16].

RNA sequencing and gene enrichment analysis

The renal cortex tissues of rats were collected to isolate total RNA followed by rinsing in PBS to remove blood. The following work was outsourced to OE Biotech Co., Ltd (Shanghai, China). The integrity of the extracted RNA was evaluated on an Agilent 2100 bioanalyser (Agilent Technologies, Santa Clara, CA, USA) and was presented as the RNA integrity number and the ratio of 28S/18S. The Illumina HiSeq X platform (Illumina, Inc., San Diego, CA, USA) was used to perform RNA sequencing. Analysis of transcriptomic data were performed through Gene Set Enrichment Analysis (GSEA) software [18]. The differentially expressed genes (DEGs) were set with a threshold as followed: P < 0.05 and fold change >2 or <0.5. The changes of specific genes were further verified with real-time quantitative PCR (qPCR) and western blot.

AAV patients and kidney and blood samples

Two patients with active AAV at initial onset and receiving renal biopsies in Peking University First Hospital were recruited in our study for double immunofluorescence staining, and another seven patients with active AAV at initial onset were recruited in our study for isolation of neutrophils from peripheral blood and serum. Another eight patients with active AAV at initial onset and receiving plasma exchange were recruited in our study for ANCA-positive IgG. All these patients met the criteria of the 2012 Chapel Hill Consensus Conference definition for AAV, and patients with other coexisting renal diseases and secondary vasculitis were excluded [1]. Each participant signed the informed consent. This research was performed in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Peking University First Hospital.

Double immunofluorescence staining of CPT1a with MPO

To investigate whether CPT1a was expressed by neutrophils in kidneys of AAV patients and normal controls, double immunofluorescence staining of CPT1a with MPO was performed according to methods previously reported [19]. Mouse anti-human CPT1a (1:50, ab128568; Abcam, Cambridge, UK) and rabbit anti-human MPO (1:50, ab9535; Abcam) were used as primary antibodies. Detailed methods are available in the Supplementary Methods, available at Rheumatology online.

ANCA-induced activation of neutrophils in vitro

Levels of neutrophil respiratory burst and NETosis, reflecting ANCA-induced neutrophil activation, were determined by generation of ROS and quantification of DNA released from isolated human neutrophils upon stimulation by patient-derived MPO-ANCA positive IgG [5, 20, 21]. ROS generation was measured by flow cytometry and was presented with the mean fluorescence intensity (MFI). NET formation was detected with primary antibody of mouse anti-human MPO (1:500, ab25989; Abcam) and rabbit anti-human histone H3 (1:500, ab5103; Abcam). The DNA released from isolated human neutrophils to the supernatant was quantified by PicoGreen. Detailed methods are available in the Supplementary Methods, available at Rheumatology online.

Cell lines

HL-60 cell line with authentication of short tandem repeat profiling was obtained from the Cell Resource Center of Peking Union Medical College [22]. The cell line was cultured in IMDM (CM-0110, Pricella, Wuhan, China) enriched with 20% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37°C with 5% CO2. Differentiated HL-60 cells could develop features of mature neutrophils, such as highly expressed CD11b [23, 24]. In the current study, in order to induce differentiation, HL-60 cell line was cultured in RPMI-1640 medium (Gibco 12633020, Thermo Fisher Scientific, Waltham, MA, USA) with 1.3% dimethyl sulfoxide (DMSO, D2650, Sigma-Aldrich, St Louis, MO, USA) and 0.5% FBS (Gibco 10099141) for 4 days [23, 24]. Differentiation of HL-60 cells was determined by the CD11b level (1:100, 301342; BioLegend, San Diego, CA, USA) measured by flow cytometry.

Cell treatment

The differentiated HL-60 cells or isolated human neutrophils were preincubated with 10 µM FTY720 on ice for 45 min before the stimulation of serum derived from MPO-AAV patients or MPO-ANCA positive IgG, the concentration of which was referenced to the previous study [17]. To explore the pathway in FTY720-induced inhibition of ANCA-medicated neutrophil activation, cells were preincubated with 10 µM PPARα antagonist GW6471 (S2798, Selleck Chemicals, Houston, TX, USA), or 100 nM PPARα agonist GW7647 (HY-13861, MedChemExpress, Monmouth Junction, NJ, USA) for 12 h and 3 µM CPT1 inhibitor etomoxir (HY-50202, MedChemExpress) for 30 min before treatment with FTY720 [25–28].

SiRNA transfection

To further explore the role of FAO in FTY720-induced inhibition of ANCA-mediated neutrophil activation, HL-60 cells were transfected with siRNA targeting human CPT1a (RiboBio, Guangzhou, China) using electrotransfection. In brief, HL-60 cells were transfected with 2 µg CPT1a siRNA or control sequence using the 4D-Nucleofector system and SF Cell Line 4D X Kit L (V4XC-2024, Lonza, Cologne, Germany) with program EN-138 following the manufacturer’s instructions. After a 48-h incubation with CPT1a siRNA, the medium was changed before the above-mentioned treatment of HL-60 cells.

Real-time quantitative PCR

Total RNA of differentiated HL-60 cells or renal cortical tissues was extracted using TRIzol reagent (15596018, Thermo Fisher Scientific) and reverse transcribed with High Capacity cDNA Reverse Transcription Kits (Applied Biosystems 4368814, Thermo Fisher Scientific). Then the mRNA levels of target genes were quantified using SYBR green Master Mix (Applied Biosystems A25742) on ViiATM7 Dx Real-Time PCR (Thermo Fisher Scientific) following the manufacturer’s instructions. Relative gene expression was calculated with the comparative ΔCt method and was normalized to reference gene ACTB (Sangon Biotech, Shanghai, China) or GAPDH (Tianyihuiyuan, Beijing, China). The primer sequences for target genes are listed in Table 1.

Table 1. The primer sequences for target genes

Name	Gene ID	Forward primer 5′–3′	Reverse primer 5′–3′	
Human				
 SESN2	83667	CCGCTACATGACCTGACTCC	CTGCACATCACACACAAGCC	
 SLC27A2	11001	TTTCCGCCATCTACACAGTCC	CGTAGGTGAGAGTCTCGTCG	
 HSD17b4	3295	TGAGGGATCGTTCCTTTGCTA	CGTGTCACTTGGAATGAACCC	
 ABCD3	5825	TACTTGACGGCGCGAAACTC	CACCACAGCTCGCTCCTTTT	
 ECHDC2	55268	CGACGACTGAGTGGAACTGAG	CCACAGCGTGATTCACCAG	
 CPT1a	1374	TCCAGTTGGCTTATCGTGGTG	TCCAGAGTCCGATTGATTTTTGC	
 PPARα	5465	CGGTGACTTATCCTGTGGTCC	CCGCAGATTCTACATTCGATGTT	
Rat				
 Cpt1a	25757	ATCGCAAAGATCAGTCGGAC	AGCAGCACCTTCAGCGAGTA	
 Pparα	25747	CGTTCGCAGCTGTTTTGTGG	TGGCTCGCCTCTAAGATCCC	
ABCD3: ATP binding cassette subfamily D member 3; CPT1a: carnitine palmitoyltransferase 1a; ECHDC2: enoyl-coA hydratase domain containing 2; HSD17b4: 17β-hydroxysteroid dehydrogenase 4; PPARα: peroxisome proliferator-activated receptor-α; SESN2: sestrin 2; SLC27A2: solute carrier family 27 member 2.

Western blot

Western blot was performed according to previous methods [25]. Total protein of HL-60 cells or renal cortical tissues was extracted using RIPA lysis with 1% proteinase inhibitor cocktail (539134, Merck KGaA, Darmstadt, Germany). The membranes with protein were incubated with primary antibodies against β-actin (1:1000, sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), CPT1a (1:1000, ab128568, Abcam) and PPARα (1:1000, ab227074, Abcam). The protein expression was normalized to reference β-actin expression.

Assessment of FAO in differentiated HL-60 cells

qPCR was applied to measure changes of the FAO pathway in differentiated HL-60 cells incubated with 10% serum of MPO-AAV patients or healthy controls at 37°C for 1 h. The mRNA levels of FAO-related genes significantly upregulated in FTY720-treatment rats were measured, including sestrin 2 (SESN2), solute carrier family 27 member 2 (SLC27A2), 17β-hydroxysteroid dehydrogenase 4 (HSD17b4), ATP binding cassette subfamily D member 3 (ABCD3), enoyl-CoA hydratase domain containing 2 (ECHDC2) and CPT1a. The genes of FAO pathway upregulated in HL-60 cells in mRNA levels were further determined by western blot.

Assessment of FAO in neutrophils isolated from peripheral blood of patients with active AAV and normal controls

Neutrophils of patients with active AAV were isolated from their anticoagulated peripheral blood before the initiation of immunosuppressive therapy according to the methods described above. Then hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit α (HADHA), a protein associated with FAO, was detected by flow cytometry using a commercial kit (ab118183, Abcam) according to the manufacturer’s instructions and was represented as the mean fluorescence intensity.

Expressions of CPT1a in neutrophils isolated from peripheral blood of patients with active AAV and normal controls were detected by immunofluorescence staining. MPO and CPT1a were detected with primary antibody of rabbit anti-human MPO (1:100, ab9535; Abcam) and mouse anti-human CPT1a (1:100, ab128568; Abcam). Western blot analyses of CPT1a in isolated neutrophils were performed as described above. Detailed methods are available in the Supplementary Methods, available at Rheumatology online.

Statistical analysis

Statistical analysis was performed with SPSS version 22.0 (IBM Corp., Armonk, NY, USA). Data are presented as median and interquartile range (IQR) for those with skewed distribution, or mean (s.d.) for those with normal distribution. Differences between groups were analysed by Student’s t-test or a non-parametric test as appropriate. P < 0.05 was considered to indicate statistical significance.

Results

FTY720 attenuated renal injury and pulmonary haemorrhage in EAV

In EAV, rats immunized with hMPO developed haematuria and proteinuria at 4 weeks post-immunization (Fig. 1E and F). After a 4-week treatment, FTY720 treatment significantly attenuated haematuria and proteinuria (Fig. 1E and F), compared with the vehicle controls. As for renal histopathology, administration of FTY720 significantly reduced the proportion of crescent formation and the TIN score (Fig. 1A, B, G and H). Furthermore, FTY720 treatment decreased neutrophil infiltration in both glomeruli and tubulointerstitium (Fig. 1C, D, I and J).

Figure 1. FTY720 alleviated renal injury in EAV rats. (A, B) Representative images of glomeruli (A) and tubulointerstitium (B) of PAS staining for kidneys of rats (scale bar: 100 µm). (C, D) Representative images of glomerular (C) and tubulointerstitial (D) neutrophil infiltration in EAV rats (scale bar: 50 µm). (E, F) Amelioration of haematuria (E) and proteinuria (F) of EAV rats following FTY720 treatment. (G, H) Assessment of crescent formation (G) and TIN score (H) in EAV rats following FTY720 treatment. (I, J) Quantification of infiltrating neutrophils in glomeruli (I) and tubulointerstitium (J). Data are presented as means (s.d.) from five rats per group. *P < 0.05, **P < 0.01, ***P < 0.001; ns: not significant. DAPI: 4′,6-diamidino-2-phenylindole; EAV: experimental autoimmune vasculitis; HSA: human serum albumin; MPO: myeloperoxidase; PAS: periodic acid–Schiff; TIN: tubulointerstitial nephritis

Furthermore, in order to investigate the influence of FTY720 on EAV induction, FTY720 treatment was started at the time of immunization. The results showed that compared with the vehicle controls, FTY720 treatment attenuated proteinuria (Supplementary Fig. S1A, available at Rheumatology online), haematuria (Supplementary Fig. S1B, available at Rheumatology online), crescent formation (Supplementary Fig. S2A, E, available at Rheumatology online), TIN score (Supplementary Fig. S2B, F, available at Rheumatology online) and pulmonary haemorrhage (Supplementary Fig. S2C, D, G, available at Rheumatology online) of EAV rats at week 8. However, no significant difference of anti-MPO antibody, serum creatinine or blood urea nitrogen was observed between FTY720 and vehicle treatment (Supplementary Fig. S1C–E, available at Rheumatology online). It was noteworthy that FTY720 reduced proteinuria of EAV rats at week 4, suggesting that FTY720 indeed attenuated EAV induction and was promising in AAV treatment.

RNA sequencing analysis illustrated the impact of FTY720 on FAO, PPAR signalling and respiratory burst pathway

To explore downstream pathways of FTY720 treatment, RNA sequencing analysis of renal cortex from EAV rats was performed. There was a total of 929 differentially expressed genes (DEG) identified, with 49 genes upregulated and 880 genes downregulated in the FTY720 treatment group (P < 0.05 and fold change >2 or <0.5) (Fig. 2A and B). GSEA analysis revealed that upregulated genes were enriched in the pathways related to cell metabolism in FTY720-treated EAV rats, especially fatty acid β-oxidation and the upstream PPAR signalling (Fig. 2C–E, Supplementary Figs S3 and S4, available at Rheumatology online) [29]. Transcriptomic results of critical genes were confirmed by qPCR, including Cpt1a and Pparα (Fig. 3A). The results of western blot also showed that the amount of CPT1a and PPARα protein were upregulated in the FTY720 treatment group (Fig. 3B and C). Furthermore, we found that downregulated genes in the FTY720 treatment group were also enriched in the respiratory burst pathway (Fig. 2F). The above results of RNA sequencing analysis and the influence of FTY720 on neutrophil infiltration in renal specimens of EAV suggested a link between FTY720 and FAO as well as neutrophil activation. The double immunofluorescence staining of CPT1a with the neutrophil marker MPO in renal tissues of active AAV patients showed that neutrophils of normal controls expressed CPT1a while neutrophils of active AAV patients expressed little CPT1a (Fig. 3D). In addition, we analysed two key proteins associated with FAO in neutrophils isolated from peripheral blood of patients with active AAV and normal controls. Compared with normal controls, active AAV patients showed lower expression of HADHA (Fig. 3F) and CPT1a in isolated human neutrophils (Fig. 3E and G). GSEA analysis of MPO-immunized rats and HSA-immunized rats was performed. The results showed impaired FAO pathway in EAV rats (Supplementary Fig. S5, available at Rheumatology online), which was consistent with that in neutrophils of patients with active AAV. Therefore, we further explored whether FTY720 influenced ANCA-induced neutrophil activation by regulating neutrophil FAO.

Figure 2. RNA sequencing analysis and gene enrichment analysis of renal cortex from rats. (A, B) Heat map (A) and scatter plot (B) presenting the distribution of DEGs between vehicle-treated and FTY720-treated groups. Fold change >2.0 or <0.5, P < 0.05. (C) A cluster profiler of the 10 most prominently enriched pathways identified in RNA sequencing and gene enrichment analysis between vehicle-treated and FTY720-treated groups. (D, F) Gene set enrichment analysis of FAO (D), PPAR signalling pathway (E) and respiratory burst pathway (F). FTY represents EAV rats treated with FTY720; AAV represents EAV rats treated with vehicle. AAV: ANCA-associated vasculitis; DEG: differentially expressed gene; FAO: fatty acid oxidation; FC: fold change; FDR: false discovery rate; NES: normalized enrichment score; PPAR: peroxisome proliferator activated receptor

Figure 3. Validation of key identified results of RNA sequencing analysis in EAV rats and AAV patients. (A) Confirmation of the mRNA levels of Cpt1a and Pparα in EAV rats. (B) Confirmation of the protein expression of CPT1a in EAV rats. (C) Confirmation of the protein expression of PPARα in EAV rats. (D) Double immunofluorescence staining of CPT1a with neutrophil marker MPO in renal tissues of patients with active AAV and normal controls (scale bar: 25 µm). (E) Double immunofluorescence staining of CPT1a and MPO in isolated human neutrophils (scale bar: 50 µm). (F) Expression of HADHA in isolated human neutrophils detected by flow cytometry. (G) Protein expression of CPT1a in isolated human neutrophils. Data are shown as means (s.d.). *P < 0.05, **P < 0.01, ***P < 0.001; ns: not significant. AAV: ANCA-associated vasculitis; ACTB: actin, beta; CPT1a: carnitine palmitoyltransferase 1A; DAPI: 4′,6-diamidino-2-phenylindole; DEG: differentially expressed gene; EAV: experimental autoimmune vasculitis; FAO: fatty acid oxidation; HADHA: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit α; MFI: mean fluorescent intensity; MPO: myeloperoxidase; NC: normal controls; PPARα: peroxisome proliferator activated receptor α

FTY720 inhibited ANCA-induced neutrophil activation while upregulated CPT1a expression

To investigate the role of FTY720 on ANCA-induced neutrophil activation, we studied respiratory burst in human neutrophils isolated from peripheral blood and in differentiated HL-60 cells. Following DMSO treatment, HL-60 cells showed significant upregulation of CD11b, suggesting successful differentiation (Fig. 4A). We found that FTY720 inhibited respiratory burst of neutrophils stimulated by serum of patients with active AAV or by MPO-ANCA positive IgG (Fig. 4B and C). Then the top six genes in the FAO pathway in RNA sequencing were further detected in differentiated HL-60 cells (Supplementary Fig. S3, available at Rheumatology online). Compared with the vehicle treatment, the transcription level of CPT1a was enhanced after FTY720 treatment, while the other five genes, including SESN2, SLC27A2, HSD17b4, ABCD3 and ECHDC2, did not change significantly (Fig. 4D). We also found upregulated protein level of CPT1a in FTY720-treated HL-60 cells (Fig. 4E), which was consistent with our in vivo results.

Figure 4. FTY720 inhibited ANCA-induced neutrophil activation while upregulating FAO. (A) Identification of increased neutrophil marker CD11b of differentiated HL-60 cells. (B) Inhibitory effect of FTY720 on respiratory burst of differentiated HL-60 cells stimulated with serum from AAV patients. (C) Inhibitory effect of FTY720 on respiratory burst of isolated human neutrophils activated by MPO-ANCA positive IgG. (D) Gene expression of the top six upregulated genes in FAO in RNA sequencing was measured in differentiated HL-60 cells treated with the 10% serum from AAV patients and FTY720 or vehicle. (E) mRNA level of PPARα and protein expression of CPT1a and PPARα in differentiated HL-60 cells treated with the 10% serum from AAV patients and FTY720 or vehicle. Data are shown as means (s.d.). *P < 0.05, **P < 0.01, ***P < 0.001; ns: not significant. AAV: ANCA-associated vasculitis; ABCD3: ATP binding cassette subfamily D member 3; CPT1a: carnitine palmitoyltransferase 1A; ECHDC2: enoyl-CoA hydratase domain containing 2; FAO: fatty acid oxidation; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; HSD17b4: 17β-hydroxysteroid dehydrogenase 4; MFI: mean fluorescence intensity; PPARα: peroxisome proliferator activated receptor α; ROS: reactive oxygen species; SESN2: sestrin 2; SLC27A2: solute carrier family 27 member 2

FTY720 inhibited ANCA-induced neutrophil activation through upregulating FAO via the PPARα–CPT1a pathway

Based on the above in vivo and in vitro findings that FTY720 inhibited ANCA-induced neutrophil activation and increased FAO in neutrophils, we further investigated whether FTY720 exerted its influence by upregulating FAO in neutrophils. In addition to isolated human neutrophils, we also used differentiated HL-60 cells in this part of the experiments due to their gene manipulation tractability. As shown above, the mRNA level and protein expression of CPT1a were elevated in FTY720-treated EAV rats and FTY720-treated HL-60 cells, as compared with vehicle-treated groups. We therefore proceeded to study the direct effect of manipulating CPT1a in HL-60 cells through knocking down the gene by nucleofection with CPT1a siRNA (Fig. 5A). The inhibitory effect of FTY720 on MPO-AAV serum induced respiratory burst of differentiated HL-60 cells was significantly attenuated both in the presence of etomoxir (a CPT1 inhibitor, Fig. 5B) and upon CPT1a knockdown (Fig. 5C). Consistently, etomoxir showed similar effects on the inhibition of FTY720 on MPO-ANCA positive IgG induced respiratory burst in isolated human neutrophils (Fig. 5D). Moreover, etomoxir reversed the inhibition of FTY720 on ANCA-induced NETosis, another important aspect of neutrophil activation (Fig. 5E and H). These results suggested that FTY720 exerted inhibitory effect on ANCA-induced neutrophil activation via regulating CPT1a.

Figure 5. FTY720 exerted an inhibitory effect on ANCA-induced neutrophil activation via the PPARα–CPT1a pathway. (A) Determination of CPT1a-knockdown efficiency by qPCR and western blot. (B, C) The inhibitory effect of FTY720 on respiratory burst in differentiated HL-60 cells upon stimulation with 10% serum from AAV patients was reversed by CPT1 antagonist etomoxir (B) and CPT1a knockdown (C). (D, E) The effect of GW6471 (a PPARα antagonist) on the inhibition of FTY720 on respiratory burst (D) and NET formation (E). (F, G) The effect of combination of GW7647 (a PPARα agonist) and etomoxir (a CPT1 inhibitor) on the inhibition of FTY720 on respiratory burst (F) and NET formation (G). (H) Representative images of NET formation with or without FTY720, etomoxir, GW6471 (scale bar: 50 µm). Data are shown as means (s.d.). *P < 0.05, **P < 0.01, ***P < 0.001; ns: not significant. AAV: ANCA-associated vasculitis; CPT1a: carnitine palmitoyltransferase 1A; Eto: etomoxir; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; MFI: mean fluorescence intensity; PPARα: peroxisome proliferator activated receptor α; ROS: reactive oxygen species

PPARα could act as a transcriptional factor by binding the promoter regions of genes involved in FAO, thus further upregulating expression of genes associated with this pathway, including CPT1a [30, 31]. We have demonstrated that PPAR signalling was upregulated in EAV rats treated with FTY720 (Fig. 2E and Supplementary Fig. S4, available at Rheumatology online). qPCR and western blot analysis revealed significantly increased expression of PPARα in FTY720-treated HL-60 cells compared with vehicle-treated ones (Fig. 4E). To investigate whether FTY720 influenced CPT1a expression by regulating upstream PPARα in neutrophils, we treated isolated human neutrophils with GW6471 (a PPARα antagonist) and GW7647 (a PPARα agonist), respectively. We found that GW6471 reversed the inhibitory effect of FTY720 on ANCA-induced neutrophil activation, including respiratory burst and NETosis, suggesting that the effect of FTY720 was mediated by PPARα (Fig. 5D, E and H). Furthermore, the reversing effect of etomoxir on the inhibition of FTY720 on neutrophil activation was not prevented by pretreating with GW7647 (Fig. 5F and G). Collectively, these data suggested that FTY720 inhibited ANCA-induced neutrophil activation via the PPARα–CPT1a pathway.

Discussion

The current study confirmed our previous results that the S1P receptor modulator FTY720 could ameliorate glomerulonephritis and pulmonary haemorrhage in EAV. We identified a novel protective mechanism of FTY720 in EAV in which promotion of FAO in neutrophils via the PPARα–CPT1a pathway results in attenuation of ANCA-induced neutrophil activation and consequent amelioration of renal injury in EAV.

Accumulating evidence highlights the importance of immunometabolism in the function of immune cells, especially macrophages and T cells. M1 macrophages exhibit a reliance on glycolysis and the PPP to support the production of inflammatory cytokines, while M2 macrophages tend to use the tricarboxylic acid (TCA) cycle and FAO to provoke the inhibition of the inflammatory pathway [32]. Some vital metabolic molecules, such as mammalian target of rapamycin, AMP-activated protein kinase, and hypoxia-inducible factor 1α, have been investigated in systemic lupus erythematosus and rheumatoid arthritis, and treatments targeting them are in preclinical or clinical trials [13]. Therefore, intervention on key metabolic pathways provides potential strategies for the treatment of autoimmune diseases including AAV. Previous studies revealed that resting neutrophils primarily use glycolysis to generate energy [14]. Both 2-deoxyglucose and 6-aminonicotinamide (a glucose-6-phosphate dehydrogenase inhibitor, as well as an inhibitor of the PPP) have an inhibitory effect on NETosis, suggesting that glycolysis and the PPP are involved in this process [15, 33]. Additionally, apart from the classic role of the PPP and NOX in ROS generation, supplementation of glutamine promoted ROS generation in human neutrophils [34]. Therefore, the PPP and NOX (bypassing mitochondrial glutaminolysis) comprise the major pathways for the generation of ROS in neutrophils [14]. Inhibition of mitochondrial complex I and III is also capable of inducing ROS generation, suggesting that mitochondria are involved in this process [35, 36]. Furthermore, mitochondrial ROS also play an important role in NETosis [37].

A recent study explored the metabolic changes of monocytes stimulated with ANCA. They found a significant increase in glucose uptake and a shift to glycolysis and OXPHOS in the presence of MPO-ANCA [38]. In the current study, we found that FTY720 inhibited ANCA-induced neutrophil activation and ameliorated glomerulonephritis in the EAV model through restoration of FAO in neutrophils. Immature neutrophils rely upon FAO during differentiation [39]. In mature neutrophils with reduced mitochondria, FAO was considered dispensable for glucose and glutamine metabolism in energy production [14]. However, in a recent study, neutrophil trafficking to the site of infection relied upon fatty acid β-oxidation in a CPT1a-dependent manner, indicating the vital role of FAO in neutrophil biology [40]. Our current study found that impaired FAO participated in ANCA-induced neutrophil activation in AAV, and that restoring FAO could inhibit neutrophil activation and thus ameliorate ANCA-induced inflammation. Grayson et al. analysed the microarray-derived differential gene expression of 88 critical enzymes in metabolic pathways and 25 genes of immune cell markers in glomerular and tubulointerstitial compartments of patients with AAV and healthy donors [41]. They found that in AAV, gene expression related to glycolysis and the PPP was significantly increased, while genes involved in FAO and the TCA cycle were largely decreased in AAV. Furthermore, upregulation of the PPP was associated with decreased kidney function and increased production of cytokines. In our study, we found that, compared with healthy controls, patients with active AAV showed impaired FAO in neutrophils isolated from peripheral blood, suggesting the metabolic reprogramming of neutrophils in this disease. Systematic analysis of metabolic reprogramming in neutrophils deserves further investigation and might provide potential strategies for AAV treatment.

The main immunomodulatory mechanism of FTY720 in multiple sclerosis involved circulating lymphocyte depletion mediated by S1PR1 [11]. As demonstrated in our recent studies, FTY720 attenuated EAV by reducing circulating T cells, inhibiting proliferation, adhesion and migration of T cells, and increasing apoptosis of T cells [17]. S1P mediated C5a-primed neutrophil activation, FTY720 blocking of which attenuated neutrophil activation induced by C5a and ANCA [12]. In the present study, we found that the inhibitory effect of FTY720 on neutrophil activation was abolished when PPARα or CPT1a was pharmacologically blocked or genetically knocked down, suggesting that FTY720 enhanced FAO through the PPARα–CPT1a pathway. Rousselle et al. found FTY720-treated dendritic cells (DCs) protected kidneys from ischaemia–reperfusion injury (IRI). Further investigation revealed that FTY720 treatment improved mitochondrial numbers in DCs, and induced DCs to transfer mitochondria to macrophages. Additionally, in FTY720-treated DCs, inhibition of mitochondrial function with rotenone (an inhibitor of mitochondrial electron transport) and antimycin A (an inhibitor of cellular respiration) abrogated its protective effect in kidney IRI. This study supported that FTY720 protected kidney in IRI by inducing mitochondrial biogenesis in DCs [42]. Based on our data, we propose that FTY720 inhibits ANCA-induced neutrophil activation, including respiratory burst and NETosis, by improving FAO and downstream mitochondrial function.

The kidney and lung are two organs most commonly involved in ANCA-associated vasculitis. Our previous study has demonstrated that pulmonary haemorrhage was alleviated in EAV rats treated with FTY720 compared with those treated with vehicle [17]. Consistently, in the current study, pulmonary haemorrhage was also substantially attenuated in EAV rats treated with FTY720 beginning at week 0. Furthermore, previous studies found neutrophil activation was related to lung involvement of AAV [43, 44]. As shown in our study, FTY720 inhibited ANCA-induced neutrophil activation including NET formation. Therefore, we speculate the PPARα–CPT1a pathway is also involved in the protection of FTY720 in lung injury in EAV, which deserves further exploration.

In conclusion, our study provided evidence that FTY720 alleviated kidney injury in the EAV model by upregulating FAO via the PPARα–CPT1a pathway in neutrophils, making an exploration of immunometabolism in ANCA-induced neutrophil activation and offering a potential novel immune-modulatory avenue in AAV treatment.

Supplementary Material

keae320_Supplementary_Data

Supplementary material

Supplementary material is available at Rheumatology online.

Data availability

The data underlying this article will be shared on reasonable request to the corresponding author.

Funding

The work was supported by National Key Research and Development Program (No. 2022YFC2502500/2022YFC2502502), Capital’s Funds for Health Improvement and Research (No. 2020–2-4073), and Grants from the six National Natural Science Funds (No. 82270754, 81870477, 81900640, 82000668, 82090021 and 82300817).

Disclosure statement: The authors have declared no conflicts of interest.
==== Refs
References

1 Jennette JC , FalkRJ, BaconPA et al 2012 revised International Chapel Hill Consensus Conference nomenclature of vasculitides. Arthritis Rheum 2013;65 :1–11.23045170
2 Chen M , YuF, ZhangY et al Characteristics of Chinese patients with Wegener’s granulomatosis with anti-myeloperoxidase autoantibodies. Kidney Int 2005;68 :2225–9.16221222
3 Li ZY , ChangDY, ZhaoMH, ChenM. Predictors of treatment resistance and relapse in antineutrophil cytoplasmic antibody-associated vasculitis: a study of 439 cases in a single Chinese center. Arthritis Rheumatol 2014;66 :1920–6.24623469
4 Chen M , JayneDRW, ZhaoMH. Complement in ANCA-associated vasculitis: mechanisms and implications for management. Nat Rev Nephrol 2017;13 :359–67.28316335
5 Falk RJ , TerrellRS, CharlesLA, JennetteJC. Anti-neutrophil cytoplasmic autoantibodies induce neutrophils to degranulate and produce oxygen radicals in vitro. Proc Natl Acad Sci USA 1990;87 :4115–9.2161532
6 Nakazawa D , ShidaH, TomaruU et al Enhanced formation and disordered regulation of NETs in myeloperoxidase-ANCA-associated microscopic polyangiitis. J Am Soc Nephrol 2014;25 :990–7.24385592
7 Xiao H , HeeringaP, LiuZ et al The role of neutrophils in the induction of glomerulonephritis by anti-myeloperoxidase antibodies. Am J Pathol 2005;167 :39–45.15972950
8 Schreiber A , XiaoH, JennetteJC et al C5a receptor mediates neutrophil activation and ANCA-induced glomerulonephritis. J Am Soc Nephrol 2009;20 :289–98.19073822
9 Proia RL , HlaT. Emerging biology of sphingosine-1-phosphate: its role in pathogenesis and therapy. J Clin Invest 2015;125 :1379–87.25831442
10 Pelletier D , HaflerDA. Fingolimod for multiple sclerosis. N Engl J Med 2012;366 :339–47.22276823
11 Huwiler A , Zangemeister-WittkeU. The sphingosine 1-phosphate receptor modulator fingolimod as a therapeutic agent: recent findings and new perspectives. Pharmacol Ther 2018;185 :34–49.29127024
12 Hao J , HuangYM, ZhaoMH, ChenM. The interaction between C5a and sphingosine-1-phosphate in neutrophils for antineutrophil cytoplasmic antibody mediated activation. Arthritis Res Ther 2014;16 :R142.25000985
13 Wang T , JiaoY, ZhangX. Immunometabolic pathways and its therapeutic implication in autoimmune diseases. Clin Rev Allergy Immunol 2021;60 :55–67.33179144
14 Jeon JH , HongCW, KimEY, LeeJM. Current understanding on the metabolism of neutrophils. Immune Netw 2020;20 :e46.33425431
15 Rodríguez-Espinosa O , Rojas-EspinosaO, Moreno-AltamiranoMM, López-VillegasEO, Sánchez-GarcíaFJ. Metabolic requirements for neutrophil extracellular traps formation. Immunology 2015;145 :213–24.25545227
16 Little MA , SmythL, SalamaAD et al Experimental autoimmune vasculitis: an animal model of anti-neutrophil cytoplasmic autoantibody-associated systemic vasculitis. Am J Pathol 2009;174 :1212–20.19264905
17 Wang L-Y , SunX-J, WangC et al Sphingosine-1-phosphate receptor modulator FTY720 attenuates experimental myeloperoxidase-ANCA vasculitis in a T cell-dependent manner. Clin Sci (Lond) 2020;134 :1475–89.32538435
18 Subramanian A , TamayoP, MoothaVK et al Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 2005;102 :15545–50.16199517
19 Wang RX , WuL, ChenSF et al Renal expression of annexin A1 is associated with the severity of renal injury in antineutrophil cytoplasmic autoantibody-associated vasculitis. Front Med (Lausanne) 2022;9 :769813.35783659
20 Ma Y-H , MaT-T, WangC et al High-mobility group box 1 potentiates antineutrophil cytoplasmic antibody-inducing neutrophil extracellular traps formation. Arthritis Res Ther 2016;18 :2.26739852
21 Chen SF , WangFM, LiZY et al Complement factor H inhibits anti-neutrophil cytoplasmic autoantibody-induced neutrophil activation by interacting with neutrophils. Front Immunol 2018;9 :559.29616045
22 Blanter M , GouwyM, StruyfS. Studying Neutrophil Function in vitro: cell Models and Environmental Factors. J Inflamm Res 2021;14 :141–62.33505167
23 Bernard Y , MelchiorC, TschirhartE, BuebJL. Co-cultures of human coronary smooth muscle cells and dimethyl sulfoxide-differentiated HL60 cells upregulate ProMMP9 activity and promote mobility-modulation by reactive oxygen species. Inflammation 2008;31 :287–98.18665441
24 Naegelen I , PlançonS, NicotN et al An essential role of syntaxin 3 protein for granule exocytosis and secretion of IL-1α, IL-1β, IL-12b, and CCL4 from differentiated HL-60 cells. J Leukoc Biol 2015;97 :557–71.25548252
25 Wang L-Y , WangR-X, WangC et al Inhibitor of apoptosis proteins antagonist SM164 ameliorates experimental MPO-ANCA-associated vasculitis via enhancing fatty acid oxidation in neutrophils. Rheumatology (Oxford) 2023;62 :2563–73.36308438
26 O’Connor RS , GuoL, GhassemiS et al The CPT1a inhibitor, etomoxir induces severe oxidative stress at commonly used concentrations. Sci Rep 2018;8 :6289.29674640
27 Sun N , ShenC, ZhangL et al Hepatic Krüppel-like factor 16 (KLF16) targets PPARα to improve steatohepatitis and insulin resistance. Gut 2021;70 :2183–95.33257471
28 Luo M , YeruvaS, LiuY et al IL-1β-induced downregulation of the multifunctional PDZ adaptor PDZK1 is attenuated by ERK Inhibition, RXRα, or PPARα stimulation in enterocytes. Front Physiol 2017;8 :61.28223944
29 Song S , AttiaRR, ConnaughtonS et al Peroxisome proliferator activated receptor alpha (PPARalpha) and PPAR gamma coactivator (PGC-1alpha) induce carnitine palmitoyltransferase IA (CPT-1A) via independent gene elements. Mol Cell Endocrinol 2010;325 :54–63.20638986
30 Napal L , MarreroPF, HaroD. An intronic peroxisome proliferator-activated receptor-binding sequence mediates fatty acid induction of the human carnitine palmitoyltransferase 1A. J Mol Biol 2005;354 :751–9.16271724
31 Finck BN , KellyDP. Peroxisome proliferator-activated receptor alpha (PPARalpha) signaling in the gene regulatory control of energy metabolism in the normal and diseased heart. J Mol Cell Cardiol 2002;34 :1249–57.12425323
32 O’Neill LA , KishtonRJ, RathmellJ. A guide to immunometabolism for immunologists. Nat Rev Immunol 2016;16 :553–65.27396447
33 Azevedo EP , RochaelNC, Guimarães-CostaAB et al A metabolic shift toward pentose phosphate pathway is necessary for amyloid fibril- and phorbol 12-myristate 13-acetate-induced Neutrophil Extracellular Trap (NET) formation. J Biol Chem 2015;290 :22174–83.26198639
34 Furukawa S , SaitoH, InoueT et al Supplemental glutamine augments phagocytosis and reactive oxygen intermediate production by neutrophils and monocytes from postoperative patients in vitro. Nutrition 2000;16 :323–9.10793298
35 Zmijewski JW , LorneE, ZhaoX et al Mitochondrial respiratory complex I regulates neutrophil activation and severity of lung injury. Am J Respir Crit Care Med 2008;178 :168–79.18436790
36 Zmijewski JW , LorneE, BanerjeeS, AbrahamE. Participation of mitochondrial respiratory complex III in neutrophil activation and lung injury. Am J Physiol Lung Cell Mol Physiol 2009;296 :L624–34.19168575
37 Lood C , BlancoLP, PurmalekMM et al Neutrophil extracellular traps enriched in oxidized mitochondrial DNA are interferogenic and contribute to lupus-like disease. Nat Med 2016;22 :146–53.26779811
38 O’Brien EC , WhiteCA, WyseJ et al Pro-inflammatory stimulation of monocytes by ANCA is linked to changes in cellular metabolism. Front Med (Lausanne) 2020;7 :553.33015103
39 Riffelmacher T , ClarkeA, RichterFC et al Autophagy-dependent generation of free fatty acids is critical for normal neutrophil differentiation. Immunity 2017;47 :466–80.e5.28916263
40 Pham L , KomalavilasP, EddieAM et al Neutrophil trafficking to the site of infection requires Cpt1a-dependent fatty acid β-oxidation. Commun Biol 2022;5 :1366.36513703
41 Grayson PC , EddyS, TaroniJN et al ; Vasculitis Clinical Research Consortium, the European Renal cDNA Bank cohort, and the Nephrotic Syndrome Study Network. Metabolic pathways and immunometabolism in rare kidney diseases. Ann Rheum Dis 2018;77 :1226–33.29724730
42 Rousselle TV , KuscuC, KuscuC et al FTY720 regulates mitochondria biogenesis in dendritic cells to prevent kidney ischemic reperfusion injury. Front Immunol 2020;11 :1278.32670281
43 Negreros M , Flores-SuárezLF. A proposed role of neutrophil extracellular traps and their interplay with fibroblasts in ANCA-associated vasculitis lung fibrosis. Autoimmun Rev 2021;20 :102781.33609801
44 d’Alessandro M , ConticiniE, BergantiniL et al Neutrophil extracellular traps in ANCA-associated vasculitis and interstitial lung disease: a scoping review. Life (Basel) 2022;12 :317.35207604
