
==== Front
Plant Cell
Plant Cell
plcell
The Plant Cell
1040-4651
1532-298X
Oxford University Press US

38943676
10.1093/plcell/koae195
koae195
Research Article
AcademicSubjects/SCI01270
AcademicSubjects/SCI01280
AcademicSubjects/SCI02286
AcademicSubjects/SCI02287
AcademicSubjects/SCI02288
CELLULOSE SYNTHASE-LIKE C proteins modulate cell wall establishment during ethylene-mediated root growth inhibition in rice
https://orcid.org/0000-0003-4619-6873
Zhou Yang Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0001-8845-2738
Gao Yi-Hong Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0002-3239-7263
Zhang Bao-Cai Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0003-1088-9424
Yang Han-Lei Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0009-0005-7016-0477
Tian Yan-Bao Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0003-2774-4547
Huang Yi-Hua Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0001-5691-6366
Yin Cui-Cui Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0002-2828-6835
Tao Jian-Jun Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0002-9471-9694
Wei Wei Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0003-3475-2852
Zhang Wan-Ke Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0002-3557-4245
Chen Shou-Yi Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China

https://orcid.org/0000-0001-6644-610X
Zhou Yi-Hua Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100049, China

https://orcid.org/0000-0003-2165-3468
Zhang Jin-Song Key Lab of Seed Innovation, State Key Lab of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing 100049, China

Author for correspondence: zhouyang@genetics.ac.cn (Y.Z.), yhzhou@genetics.ac.cn (Y.-H.Z.), and jszhang@genetics.ac.cn (J.-S.Z.)
Yang Zhou, Yi-Hong Gao and Bao-Cai Zhang contributed equally.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (https://academic.oup.com/plcell/pages/General-Instructions) is: Jin-Song Zhang (jszhang@genetics.ac.cn).

Conflict of interest statement. Authors declare no competing interests.

9 2024
29 6 2024
29 6 2024
36 9 37513769
23 1 2024
07 6 2024
11 7 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of American Society of Plant Biologists.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (https://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.

Abstract

The cell wall shapes plant cell morphogenesis and affects the plasticity of organ growth. However, the way in which cell wall establishment is regulated by ethylene remains largely elusive. Here, by analyzing cell wall patterns, cell wall composition and gene expression in rice (Oryza sativa, L.) roots, we found that ethylene induces cell wall thickening and the expression of cell wall synthesis-related genes, including CELLULOSE SYNTHASE-LIKE C1, 2, 7, 9, 10 (OsCSLC1, 2, 7, 9, 10) and CELLULOSE SYNTHASE A3, 4, 7, 9 (OsCESA3, 4, 7, 9). Overexpression and mutant analyses revealed that OsCSLC2 and its homologs function in ethylene-mediated induction of xyloglucan biosynthesis mainly in the cell wall of root epidermal cells. Moreover, OsCESA-catalyzed cellulose deposition in the cell wall was enhanced by ethylene. OsCSLC-mediated xyloglucan biosynthesis likely plays an important role in restricting cell wall extension and cell elongation during the ethylene response in rice roots. Genetically, OsCSLC2 acts downstream of ETHYLENE-INSENSITIVE3-LIKE1 (OsEIL1)-mediated ethylene signaling, and OsCSLC1, 2, 7, 9 are directly activated by OsEIL1. Furthermore, the auxin signaling pathway is synergistically involved in these regulatory processes. These findings link plant hormone signaling with cell wall establishment, broadening our understanding of root growth plasticity in rice and other crops.

Ethylene promotes CELLULOSE SYNTHASE-LIKE C protein-mediated xyloglucan synthesis in epidermal cell walls in an ETHYLENE-INSENSITIVE3-LIKE1-dependent manner for root growth inhibition in rice.

STI 2030-Major Project 2023ZD0406801 the National Natural Science Foundation of China 32000220 31530004 31670274 31600980 the State Key Lab of Plant Genomics
==== Body
pmcIntroduction

Ethylene inhibits the growth of hypocotyls and roots, and aggravates apical hooks in Arabidopsis (Arabidopsis thaliana), resulting in a “triple response” (Guzman and Ecker 1990). In rice (Oryza sativa, L.), ethylene also inhibits root growth but promotes the elongation of coleoptiles and mesocotyls, leading to a “double response” in etiolated seedlings (Zhou et al. 2020). In these two plant species, ethylene signaling pathways have been extensively studied, and similar signaling components have been discovered, while more regulators and different types of crosstalk with other plant hormones have been found in rice (Merchante et al. 2013; Binder 2020; Zhou et al. 2020; Zhao et al. 2021).

In Arabidopsis, ethylene is perceived by receptors in the endoplasmic reticulum (ER). The perception of ethylene likely suppresses these receptors and the CONSTITUTIVE TRIPLE RESPONSE1 (CTR1) kinase activity, thereby increasing the stability of the multifunctional protein ETHYLENE-INSENSITIVE2 (EIN2). The C-terminal end of EIN2 is cleaved and translocated into the nucleus to promote the activation of ETHYLENE-INSENSITIVE3 (EIN3) and EIN3-LIKE1 (EIL1) through the chromatin epigenetic modification (Zhang et al. 2016, 2017). The cleaved part can also move to the processing bodies (P-bodies) for the translational suppression of EIN3-BINDING F-BOX 1 (EBF1) and EBF2, thus blocking the EBF1 and EBF2-mediated degradation of EIN3 and EIL1, and triggering the downstream responses (Merchante et al. 2013, 2015; Li et al. 2015; Zhang et al. 2020). In rice, through the characterization of the mao hu zi (mhz) mutants with abnormal phenotypes of ethylene response, additional regulators, such as the histidine kinase MHZ1 (Zhao et al. 2020a), the membrane-localized OsEIN2 stabilizer MHZ3 (Ma et al. 2018), the GDSL lipase MHZ11 (Zhao et al. 2020b), and the translational regulator MHZ9 (Huang et al. 2023), in addition to the conserved components MHZ7 (OsEIN2, the homolog of Arabidopsis EIN2) (Ma et al. 2013) and MHZ6 (OsEIL1, the homolog of Arabidopsis EIN3 and EIL1) (Yang et al. 2015), have been identified in ethylene signaling. The crosstalk between ethylene and other plant hormones ABA, auxin and JA has also been shown to occur at previously unknown levels of interaction (Ma et al. 2014; Yin et al. 2015; Xiong et al. 2017; Chen et al. 2018; Zhou et al. 2022). These findings have laid the foundation for exploring how ethylene regulates downstream events in plants.

In contrast to what occurs in animal cells, plant cells are encased in a cell wall. The plant cell wall provides mechanical support, protects plants against various biotic and abiotic stresses, determines cell morphogenesis, and represents the most abundant natural renewable resource (Staehelin 2019). The cell wall, which usually consists of macromolecular polysaccharides, highly glycosylated proteins, and lignin, is a complex and dynamic polysaccharide network (Somerville et al. 2004). The primary cell wall is composed of cellulose microfibrils embedded in a matrix of hemicellulosic and pectic polysaccharides (McNeil et al. 1984; Sandhu et al. 2009), and usually exists in growing cells. Compared to the thickened secondary cell wall that is deposited on the inner side of the primary wall after the cessation of cell expansion (Sandhu et al. 2009), the primary wall is flexible and allows cell growth driven by turgor pressure (Ray et al. 1972).

Plant cells exhibit distinct growth patterns in different organs and organisms (Cosgrove 2014), including “tip growth” in which surface expansion is limited to the hemispherical dome at the tip of the cell, e.g. pollen tubes (Hepler et al. 2013), and root hairs (Sieberer et al. 2005), “diffuse growth” as a result of directional expansion of the side walls over their entire surface, e.g. stem and root (Cosgrove 2014). In the “diffuse growth” of cells, cellulose microfibrils deposit in the circumferential direction (Baskin and Jensen 2013), facilitating wall extension in the axial direction (Cosgrove 2014). According to the Lockhart (1965) equation, the cell elongation rate is a function of the osmotic pressure, “extensibility” of the cell wall, water permeability and cell size, and with positive turgor pressure. High tensile stress from cell turgor pressure drives the enlargement of the growing wall by a combination of stress relaxation (Cosgrove 1997). A pH-dependent mechanism, namely, the acid growth theory, is well known for explaining the role of the cell wall in auxin regulation. Auxin-induced efflux of hydrogen ions to the apoplast from the cytoplasm causes acidification of the cell wall, which likely activates the function of expansins (Cosgrove 1996). The expansins appear to disrupt the noncovalent bonding of matrix hemicelluloses to the cellulose microfibrils, thereby allowing wall loosening (Cosgrove 1997). After the spreading movement of wall cellulose microfibrils and associated matrix components, newly synthesized components are added into the wall to maintain wall integrity (Cosgrove 2016).

Due to the complexity of the plant cell wall, plants use hundreds of enzymes, most of which belong to the glycosyltransferase (GT) family, to make cell wall components. Cellulose, the linear polymer chain of β-1,4-linked glucose residues, is the major component of the plant cell wall (Saxena and Brown 2005). Cellulose in vascular plants is catalyzed by a plasma membrane-located cellulose synthase complex (CSC) that is composed of three kinds of cellulose synthase A (CESA) subunits (Taylor 2008; Jarvis 2013). Mutant and gene overexpression analyses in Arabidopsis revealed that the functions of the different CESAs in cell elongation, cell division, and plant biomass production are redundant and differentiated (Hu et al. 2018a,b). Hemicellulosic polymers, including xyloglucan (XyG), xylan, mannan, and glucomannan, and mixed-linkage glucan, have common β-(1→4)-linked backbones of glucose, xylose, or mannose.

XyG is a major hemicellulose in the primary cell walls of spermatophytes, except grasses, and its biosynthesis among cell wall polysaccharides is well understood. Its β-1,4 glucan backbone is synthesized by CELLULOSE SYNTHASE-LIKE C (CSLC) members through characterization of cslc mutants of Arabidopsis that have undetectable XyG (Cocuron et al. 2007; Kim et al. 2020). Multiple GT proteins have been shown to be involved in the formation of the side chains of XyG (Zhang et al. 2021), such as the XYLOGLUCAN XYLOSYLTRANSFERASE proteins, XXT1 and XXT2 (in Arabidopsis), which add xylosyl residues to the side chains of XyG (Faik et al. 2002; Cavalier and Keegstra 2006; Cavalier et al. 2008). The XyG side chains display specific profiles, which, together with the backbone, provide tethering sites for crosslinking with the cellulose microfibrils to form an XyG-cellulose network in a type I primary cell wall model (Fry 1989b; Cosgrove 2001, 2018). The XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE proteins (XTHs) are responsible for the XyG metabolism to modify the XyG-cellulose framework in the cell wall during cell growth and differentiation (Nishitani 1997; Rose et al. 2002; Hara et al. 2014). Although this model has been questioned based on recent findings, the primary cell wall network is believed to be a plastic structure whose properties are associated with softening, loosening, extending, flexing, and strengthening, consequently regulating the growth plasticity of plant cells (Cosgrove 1993, 2018).

Unlike animals, plants exhibit sessile growth, resulting in strong growth plasticity during environmental changes. External signals affect root growth through internal signals such as ethylene and other plant hormones. Although the ethylene signaling pathway has been extensively studied, the downstream events of cell growth are not well understood, especially in crops such as rice. Moreover, the way in which ethylene affects the cell wall growth plasticity of rice remains largely unknown. In this study, we investigated the ethylene-triggered cell wall changes that inhibit root growth in rice. These cell wall composition changes result from the induction of OsCSLC1, 2, 7, 9 and other cell wall synthesis-related genes by the OsEIL1-Auxin/INDOLE-3-ACETIC ACID (OsAux/IAA) module, which we previously identified. Ethylene upregulated these OsCSLC genes to promote the XyG accumulation in roots, likely strengthened the networks of cellulose microfibrils, and thereby restricted root cell expansion and elongation. A similar mechanism may exist for auxin-promoted root growth plasticity.

Results

Ethylene restricts cell elongation and increases the lateral expansion of roots

Compared with ambient air conditions, ethylene treatment inhibited root elongation in wild-type (WT) rice seedlings 0.51-fold. Slightly visible swelling of the roots was also noted. In contrast, the root length of the Oseil1 mutant (with a mutation in OsEIL1) did not respond to ethylene (Fig. 1A), consistent with the findings of our previous study (Yang et al. 2015).

Figure 1. Ethylene regulates cell elongation in rice roots. A) Root length of Oseil1 seedlings in response to ethylene. Etiolated seedlings were grown with ambient air (air) or 10 ppm ethylene (ET) for 1.5 days after germination (DAG). WT, wild type. n ≥ 26 seedlings. Scale bar, 10 mm. B) Paraffin-embedded longitudinal sections of roots. Etiolated seedlings were grown with ambient air or 10 ppm ethylene for 1 DAG. Scale bar, 250 μm. The dashed boxes in the root growth terminating zone mark the magnified view on the right. Scale bar, 100 μm. C) Cell length of the epidermis and cortex in response to ethylene. n ≥ 52 cells were collected from more than 3 roots in each treatment group. D) Paraffin-embedded cross-sections of roots. Scale bar, 100 μm. E) Lateral expansion of the roots in response to ethylene. n ≥ 23 images, taken from more than 4 roots in each treatment. F, G) Number of cell layers F) and cells G) in the cortex. n ≥ 7 roots. In C–G), the features of the root growth terminating zone are shown and were measured. H) The root meristem was analyzed by EdU staining. Scale bar, 250 μm. I) The distribution of active meristematic cells is indicated by the total area of Azide 488 fluorescence. n ≥ 22 roots. J) The number of meristematic cells estimated by total azide 488 fluorescence intensity. n ≥ 22 roots. K) Cell division activity of meristematic cells estimated by the mean azide 488 fluorescence intensity. n ≥ 22 roots. L) The effect of ethylene on the thickness of root cell wall. Cell walls in junction regions in the cortex and sclerenchyma layer were measured and are shown. Scale bar for the epidermis, 1 μm; scale bar for the sclerenchyma layer, 5 μm; scale bar for the cortex, 1 μm. n ≥ 130 positions, taken from more than 10 images of 3 roots in each treatment. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum value. Statistical significance was analyzed by one-way analysis of variance (ANOVA) followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant difference, and “ns” indicates no significant difference. The source data are provided in Supplementary Data Set 3.

The plant root tip is divided into four distinct zones: the meristematic zone, transition zone, fast elongation zone, and growth terminating zone (Verbelen et al. 2006). We performed paraffin-embedded sectioning and safranin O-fast green staining analysis on roots to determine how ethylene affects root growth in relation to cell size and cell division (Fig. 1, B to G). The lengths of the epidermal and cortical cells in the root growth termination zone were measured in longitudinal sections. In the WT, ethylene noticeably inhibited the cell length of the two kinds of cells (Fig. 1, B and C). However, in the Oseil1 mutant, cell length was not significantly affected. In the WT roots, the inhibition of cell length strongly corresponded to the inhibition of root length (Fig. 1, A and C), indicating that ethylene inhibits root growth by restricting cell elongation.

The radial growth status of the roots was analyzed via cross-sections (Fig. 1D). Ethylene treatment significantly increased the diameter of the WT roots but did not affect the diameter of the Oseil1 roots (Fig. 1E). Because the cortex is dominant in the primary root and occupies most of the root cross section, the number of cell layers and cells in the cortex were counted (Fig. 1, F and G). Neither parameter changed significantly in the WT or Oseil1 plants with or without ethylene treatment. These results indicate that ethylene-treated WT roots have laterally enlarged cells in the cortex.

The quiescent center (QC) of the root apical meristem (RAM) plays essential roles during root development (van den Berg et al. 1997). We examined whether the QC content changed after ethylene treatment. We found three QC cells in the RAM (Supplementary Fig. S1A), consistent with the findings of a previous report on rice (Kamiya et al. 2003). With ethylene treatment, the QC cells and cell arrangement in the RAM appeared to have no obvious difference (Supplementary Fig. S1A). Cell division in the root tip was monitored by using 5-ethynyl-2′-deoxyuridine (EdU) staining (Salic and Mitchison 2008; Kotogany et al. 2010). The results showed that ethylene promoted the intensity and increased the area of fluorescence in the proximal meristem of both the WT and Oseil1 roots, suggesting that ethylene promotes root cell division, likely independent of OsEIL1 function (Fig. 1, H to K).

The cell wall largely determines the shape of the plant cell. To explore how ethylene inhibits longitudinal elongation and increases the lateral expansion of root cells, ultrathin cross-sections of the root growth terminating zone were prepared and examined using transmission electron microscopy (TEM). The TEM analysis revealed that the cell walls in the epidermis, sclerenchyma layer, and cortex cells of the WT roots were thickened after the ethylene treatment, while these walls did not drastically change in the same cell types of the Oseil1 roots (Fig. 1L; Supplementary Fig. S1B). Taken together, these findings indicate that ethylene inhibits rice root elongation by restricting cell elongation and promoting lateral cell expansion but likely not by reducing cell division.

OsCSLC2 and its homologs are involved in the ethylene response of rice roots

Thickening of the cell wall during the root ethylene response implies dynamic changes in cell wall composition, and we therefore determined the monosaccharide composition of the ethylene-treated root samples. Notably, the content of xylose residues was greater than that of the other residues, and ethylene greatly increased the amount of xylose residues in the WT but not in Oseil1 (Supplementary Fig. S2A). The cellulose content was also significantly elevated by ethylene treatment in the WT but not in the Oseil1 (Supplementary Fig. S2A). These results demonstrate that ethylene leads to changes in the cell wall, including changes in the xylose residues and cellulose levels, in rice roots.

We next analyzed gene expression in the root tip via transcriptome deep sequencing (RNA-seq) analysis (NCBI databases: PRJNA639684; Supplementary Data Set 1) (Zhou et al. 2022). The OsEIL1-regulated ethylene-responsive genes (OsEIL1-RERG) were subjected to gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. The OsEIL1-RERGs were defined as genes whose expression was responsive to ethylene in the WT (2-fold change) but not in the Oseil1. Several cell wall-related terms were enriched, including “xyloglucan metabolic process”, “cell wall biogenesis”, and “plant-type secondary cell wall biogenesis” in the biological process category; “extracellular region”, “plant-type cell wall”, “cell wall”, and “apoplast” in the cellular component category; and “xyloglucan: xyloglucosyl transferase activity” and “UDP-glycosyltransferase activity” in the molecular function category (Fig. 2A, Supplementary Data Set 1). Moreover, the cell wall-related phenylpropanoid biosynthesis pathway was identified via KEGG pathway analysis (Supplementary Data Set 1). Thus, a strong correspondence between ethylene inhibition of root cell growth and cell wall metabolism was revealed at the transcriptional level. It should be noted that RNA-seq analysis also revealed that “plant hormone signal transduction”, “responses to auxin”, etc., were associated with the ethylene response in rice roots (Fig. 2A, Supplementary Data Set 1). There are eleven putative cellulose synthase genes, OsCESA1–11, in the rice genome (Wang et al. 2010). Based on the results of the RNA-seq analysis, the transcript levels of OsCESA3, 4, 7, 9 and four CESA-LIKE (CSL) genes, OsCSLC2, OsCSLD1, OsCSLF8, and OsCSLH1, in the root tips were upregulated by ethylene treatment (Supplementary Data Set 1). RT‒qPCR confirmed this transcriptional upregulation (Fig. 2B).

Figure 2. CSLC family members are involved in the ethylene response of rice and Arabidopsis. A) Gene Ontology enrichment of ethylene-responsive genes in root tips analyzed by RNA-Seq. The source data are provided in Supplementary Data Set 1. B) Expression of eight cell wall synthesis-related genes in response to ethylene, as determined by RT‒qPCR. The values represent the means ± SDs. The relative expression levels are based on transcript levels. C) Root length of OsCSLC2 overexpression seedlings (OsCSLC2-OE) in response to ethylene. Etiolated seedlings were grown with ambient air (air) or 1 ppm ethylene (ET) for 2 days after germination (DAG). OsCSLC2-OE#7 and OsCSLC2-OE#16 are independent transgenic lines. WT, wild type. Relative root growth was calculated as the percentage of the length in ethylene to the length with ambient air. Scale bar, 10 mm. n ≥ 28 seedlings. D) Root length of Oscslc2 mutants in response to ethylene. Etiolated seedlings were grown with ambient air or 5 ppm ethylene for 2.5 DAG. Oscslc2-1 and Oscslc2-2 are independent mutant lines. Scale bar, 10 mm. n ≥ 30 seedlings. E) Root length of the Oscslc1239 higher-order mutant in response to ethylene. Etiolated seedlings were grown with ambient air with 2 or 5 ppm ethylene for 2 DAG. Scale bar, 10 mm. n ≥ 21 seedlings. F) Root thickness of Oscslc1239 in response to ethylene. Scale bar, 1 mm. n ≥ 4 seedlings. G) Root ethylene response of segregating higher-order Oscslc seedlings. Etiolated seedlings were grown in 5 ppm ethylene for 3 DAG. Scale bar, 10 mm. The seedlings are numbered. +/+, WT genotype of OsCSLCs; +/−, heterozygous genotype; −/−, homozygous mutant genotype. H) Ethylene response of apical hooks in higher-order Atcslc mutants. Col-0, wild-type Arabidopsis of Columbia ecotype. Bending angles were measured with the hypocotyl toward the top at 0 degrees. Scale bar, 500 μm. n ≥ 26 seedlings. I) Hypocotyl length in higher-order Arabidopsis Atcslc mutants in response to ethylene. The relative hypocotyl growth is relative to the length with ambient air. Scale bar, 10 mm. n ≥ 28 seedlings. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum value. In B and I), ns, not significantly different; *P < 0.05; **P < 0.01; ***P < 0.001, as determined by a two-tailed Student's t test compared to the 0-time point or the Col-0 control. In C–F and H), statistical significance was analyzed by one-way ANOVA followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant difference.

To investigate the function of the above CESAs and CSLs, we generated transgenic plants overexpressing these genes. Among these plants, compared with the WT seedlings, OsCSLC2-overexpressing (OsCSLC2-OE) seedlings were the only seedlings that showed significant changes in root growth in response to ethylene (Fig. 2C; Supplementary Fig. S3A to O). The etiolated OsCSLC2-OE seedlings exhibited shorter roots with ambient air and mild hypersensitivity to ethylene, suggesting that OsCSLC2 may promote the root ethylene response (Fig. 2C). We next generated Oscslc2 mutants (Oscslc2-1 and Oscslc2-2) via clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9)-mediated genome editing. The two mutants harbored a 363C deletion and a 669G deletion (Supplementary Fig. S4A), causing frameshift mutations after the 120th and 223rd amino acids, respectively (Supplementary Fig. S4B). Both mutants had shorter roots with ambient air but relatively longer roots in the ethylene treatment group than in the WT group (Fig. 2D).

In the CSLC family, six members have been identified in rice, and five members have been identified in Arabidopsis (Dwivany et al. 2009; Wang et al. 2010; Kim et al. 2020). To verify the role of OsCSLCs in the ethylene response of rice roots, we generated higher-order Oscslc mutants based on the Oscslc2-2 mutant. Among them, the homozygous quadruple mutant Oscslc1239 showed more severe constitutive short roots, and its insensitivity to ethylene in terms of root length was greater than that of both the WT and Oscslc2 single mutants (Fig. 2, D and E; Supplementary Fig. S4C), indicating that these OsCSLCs are functionally redundant in the rice root ethylene response. In addition, in the absence and presence of ethylene, the roots were thinner than those of the WT (Fig. 2F). The lateral roots of this mutant were shorter than those of the WT (Supplementary Fig. S5D), suggesting that OsCSLCs also play important roles in the development of lateral roots in rice. In other segregating higher-order mutants, increased insensitivity to ethylene in terms of root length was also observed (Fig. 2G; Supplementary Table S1). These results indicate that OsCSLC2 and its homologs play a positive role in the root ethylene response and are also required for normal root growth.

Beyond the phenotype of the root ethylene response, Oscslc mutants displayed changes in field-grown plants. The seeds of the Oscslc1239 mutants were longer than those of the WT but had a reduced width and thickness; as a result, the seed weights of Oscslc2 and Oscslc1239 increased and decreased, respectively (Supplementary Fig. S5, A to C and E to G). In addition, compared with the WT plants, the Oscslc1239 mutant plants exhibited reduced plant height, smaller spikes, decreased setting rates and yields, and glume trichome deficiency (Supplementary Fig. S5, H to L). Therefore, OsCSLCs are indispensable for the growth of rice.

To investigate whether CSLCs have conserved functions in Arabidopsis, we tested the ethylene response of Atcslc mutants, which were generated in a previous study (Kim et al. 2020). In the Atcslc higher-order mutants, the hypocotyls exhibited a reduced response to ethylene according to their length and relative growth compared to those of the corresponding Col-0 controls, and the changes in the apical hooks of all four higher-order mutants and the changes in the root hairs of Atcslc45612 and Atcslc456812 mutants were also consistent with the reduced ethylene response (Fig. 2, H and I; Supplementary Fig. S6A). However, the roots of these mutants did not exhibit reduced sensitivity to ethylene (Supplementary Fig. S6B). These results suggest that CSLCs are general targets of ethylene signaling in plants, although their roles may differ in terms of cell wall biogenesis in different organs.

Ethylene-induced xyloglucan accumulation in the root cell wall depends on OsCSLCs and OsEIL1

CSLCs are glucan synthases that usually contain a D, D, D, QQHRW motif and catalyze the backbone (β-1,4-glucan) synthesis of XyG (Cocuron et al. 2007; Dwivany et al. 2009). OsCSLC2 contains six transmembrane domains and a glycosyltransferase domain (Supplementary Fig. S4B). Its localization highly overlapped with that of the known cis-Golgi apparatus protein Man49-mCherry (Saint-Jore-Dupas et al. 2006; Xiong et al. 2010) in rice protoplasts; therefore, it can be concluded that OsCSLC2 is a Golgi apparatus-localized protein (Fig. 3A).

Figure 3. XyG in the cell wall synthesized by OsCSLCs restricts cell elongation in the root ethylene response. A) Subcellular localization of OsCSLC2. GFP served as the control, and the Man49-mCherry protein indicates the Golgi apparatus. In randomly chosen regions, 14 protoplasts for OsCSLC2-GFP and Man49-mCherry localization were imaged, and 6 protoplasts for GFP and Man49-mCherry localization (the control) were imaged. The fluorescence signals of OsCSLC2-GFP and Man49-mCherry highly overlapped in all observed protoplasts. The representative protoplasts are exhibited. Scale bar, 10 μm. B, D, F, and I) Xyloglucan-derived oligosaccharides (XyG-oligo) in the root cell walls of OsCSLC2 overexpression (OsCSLC2-OE, B), Oscslc2 (D), Oscslc1239 (F), and Oseil1 (I) seedlings in response to ethylene (ET) analyzed by PACE. C, E, G, and J) Levels of XyG-oligo in the root cell walls of OsCSLC2-OE (C), Oscslc2 (E), Oscslc1239 (G), and Oseil1 (J) seedlings, as determined by UPLC-MS. The total XyG-oligo content reflects the XyG level. AIRs, alcohol insoluble residues. Three biological replicates were performed. The data are the means ± SDs. Statistical significance was analyzed by one-way ANOVA followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant. H, K) Immunodetection of ethylene-induced cell wall XyG in the roots of Oscslc1239 (H) and Oseil1 (K). One-DAG etiolated seedlings were treated with 10 ppm ethylene for 8 h, and the root tips were collected for resin-embedded sectioning. Green fluorescence shows the distribution of XyG. The upper pictures are longitudinal sections. Scale bar, 500 μm. The magnified view on the right is the region marked by the dashed box. Scale bar, 50 μm. The lower pictures are cross-sections. Scale bar, 500 μm. The images of more than 12 sections with similar green immunofluorescence of XyG prepared using 6 roots in each treatment group were taken, and the representative images are shown. L) Effect of xyloglucanase (XEGP) on the root growth of OsEIL1 overexpression seedlings (OsEIL1-OE). n ≥ 31 seedlings. Scale bar, 10 mm. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum value. ns, not significantly different; ***P < 0.001, as determined by a two-tailed Student's t test compared to the mock control.

To explore the function of OsCSLC2 in the rice root ethylene response, we examined the levels of xyloglucan-derived oligosaccharides (XyG-oligo) in the root cell wall through polysaccharide analysis by gel electrophoresis (PACE) and ultra-performance liquid chromatography‒mass spectrometry (UPLC-MS) (Plumb et al. 2006; Liu et al. 2015; Pidatala et al. 2017). Compared with the levels of XyG-oligo in the WT plants, the levels in the OsCSLC2-OE plants were greater in the presence of air and ethylene, and ethylene appeared to induce XyG accumulation reflected by the levels of XyG-oligo in both the WT and OsCSLC2-OE plants (Fig. 3B). UPLC-MS analysis also revealed increased XyG-oligo levels in the root cell walls of the OsCSLC2-OE plants (Fig. 3C). The increased level of xylose residues in the previous determination of monosaccharide composition is likely in concert with this ethylene-induced XyG accumulation (Supplementary Fig. S2A).

XXG (P2H3), GXXG/XLG (P2H4), XXXG (P3H4), XLXG/XXLG (P3H5), XXFG (P3H5Hde1), and XLLG (P3H6) are major components of XyG-oligo in the root cell wall of young seedlings (Supplementary Fig. S7, A and B). The levels of these oligosaccharides were constitutively increased in the OsCSLC2-OE seedlings, among which the levels of XXXG (P3H4), XLXG/XXLG (P3H5), XXFG (P3H5Hde1), and XLLG (P3H6) were strongly induced by ethylene treatment (Supplementary Fig. S7C). In the Oscslc2-2 mutant, ethylene-induced XyG accumulation was substantially lower than that in the WT (Fig. 3, D and E; Supplementary Fig. S7D). In the root cell wall of the quadruple mutant Oscslc1239, the XyG levels were lower than the WT in the absence and presence of ethylene treatment, as determined by the PACE and UPLC-MS assays (Fig. 3, F and G; Supplementary Fig. S7E).

To study XyG accumulation in the cell wall of roots, the XyG-specific antibody LM15 (Donaldson and Knox 2012) was used for immunodetection of the XyG distribution in root cells in resin-embedded sections prepared from seedlings subjected to short-term ethylene treatment. In the WT, ethylene-induced XyG mainly accumulated in the cell walls of the elongation and differentiation zone, as indicated by the strong signals in longitudinal sections (Fig. 3H, upper panel). Ethylene-induced XyG enrichment also occurred in the epidermal cells of this region according to cross-sections (Fig. 3H, lower panel). In contrast, the ethylene induction of XyG in the epidermal cell wall of the Oscslc1239 mutant decreased. This is consistent with the previous findings that ethylene and auxin inhibit root growth by reducing the elongation of epidermal cells (Alarcón et al. 2014). These results suggest that during the rice root ethylene response, multiple OsCSLCs are involved in the enhancement of XyG synthesis in the epidermal cell wall in the elongation and differentiation zone.

Oseil1 root growth did not respond to ethylene (Fig. 1A), and ethylene promoted XyG accumulation in the root cell wall of the WT plants (Fig. 3, B to G). We therefore examined whether the XyG-oligo levels were altered in the root cell wall of Oseil1 after ethylene treatment. Both the PACE and UPLC-MS analyses revealed lower ethylene-induced levels of XyG in the Oseil1 mutant than in the WT (Fig. 3, I and J; Supplementary Fig. S7F), suggesting that ethylene induction of XyG in the root cell wall is mostly dependent on OsEIL1. The immunodetection revealed no ethylene-induced XyG synthesis in the epidermal cell wall in Oseil1 (Fig. 3K). A similar XyG distribution pattern was observed in the long-term root ethylene response (Supplementary Fig. S8). These results indicate that ethylene mainly induces XyG accumulation in the epidermal cell wall in the root elongation and differentiation zone in a largely OsEIL1-dependent manner.

Considering that OsEIL1-overexpressing (OsEIL1-OE) seedlings exhibit a constitutively short-root ethylene-response phenotype (Yang et al. 2015; Zhou et al. 2022) and that ethylene-induced XyG accumulation occurs mainly in the epidermal cell wall, we confirmed the role of XyG in root growth by using xyloglucanase (XEGP) to treat the roots of the OsEIL1-OE seedlings. XEGP is an XyG-specific endo-β-1,4-glucanase. When XEGP was applied to the roots of the OsEIL1-OE plants, the short-root phenotype was alleviated (Fig. 3L), suggesting that XyG is crucial for this inhibition of root growth. Therefore, ethylene-mediated inhibition of root growth likely requires XyG accumulation mediated by the OsEIL1-OsCSLC pathway.

OsEIL1 directly upregulates OsCSLC2 in the root ethylene response

Since OsCSLC2 is involved in the root ethylene response, we investigated the genetic interaction between OsEIL1 and OsCSLC2. Oseil1 had slightly longer roots than did the WT, and its root length did not respond to ethylene. Although the root ethylene sensitivity of OsCSLC2-OE plants in the Oseil1 background was not restored due to the OsEIL1 mutation, OsCSLC2 overexpression partially inhibited the root growth of Oseil1 plants (Fig. 4A). Mutation of OsCSLC2 significantly suppressed the short-root phenotype of the OsEIL1-OE seedlings (Fig. 4B). These results indicate that OsCSLC2 likely acts downstream of the master transcription factor OsEIL1 in the ethylene signaling pathway to inhibit root growth in rice seedlings.

Figure 4. OsEIL1 regulates the expression of OsCSLCs and other XyG metabolism-related genes in the ethylene response of roots. A) Root length of the OsCSLC2 overexpression seedlings (OsCSLC2-OE) in the Oseil1 background in response to ethylene. Etiolated seedlings were grown with ambient air (Air) or 10 ppm ethylene (ET) for 2 DAG. n ≥ 29 seedlings. Scale bar, 10 mm. B) Root length of OsEIL1-OE seedlings in the Oscslc2 background. Etiolated seedlings were grown with ambient air for 2.5 DAG. n ≥ 24 seedlings. Scale bar, 10 mm. C) The expression of OsCSLC2 in the Oseil1 in response to ethylene. The relative expression levels are based on transcript levels. The values represent the means ± SDs, n = 3. D) Regulatory effect of OsEIL1 on the activity of OsCSLC2 promoter in rice protoplasts. nYFP-Flag served as the control. The relative LUC activity indicates OsCSLC2 promoter activity. The immunoblotting shows the Flag-tagged proteins, and Coomassie Brilliant Blue Staining (CBBS) indicates the equivalent loading. The values represent the means ± SDs, n = 3. E) EMSA and supershift-EMSA for OsEIL1 binding to OsCSLC2 promoter. OsEIL1N indicates 1-350 aa of OsEIL1. A GST antibody for supershifting demonstrated the binding. F) ChIP‒qPCR assay for OsEIL1 binding to OsCSLC2 promoter. The upper diagram shows the region of the OsEIL1 binding site (EBS) and two ChIP‒qPCR fragments (PF1 and PF2) in OsCSLC2 promoter. IgG served as the negative control. The values represent the means ± SDs, n = 3. G–I) The expression of OsCSLC1, 7, 9, 10 (G), OsXXT1, OsGT3–OsGT7 (H), and OsXTHs (I) in response to ethylene in roots. The values represent the means ± SDs, n = 3. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum valu. In A, B and G–I), statistical significance was analyzed by one-way ANOVA followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant difference. In C, D, and F), ns, not significantly different; *P < 0.05; **P < 0.01; ***P < 0.001, as determined by a two-tailed Student's t test compared to the corresponding control.

We analyzed ethylene-induced OsCSLC2 expression in Oseil1 root tips. OsCSLC2 was not transcriptionally induced in the Oseil1, unlike in the WT plants (Fig. 4C), suggesting that ethylene-induced OsCSLC2 expression is dependent on OsEIL1. We then examined whether OsEIL1 can directly regulate OsCSLC2 in rice protoplasts. In this assay, the effector plasmid OsEIL1-Flag and the reporter plasmid ProOsCSLC2:LUC were constructed and coexpressed, and a promoting effect of OsEIL1 on OsCSLC2 promoter activity was observed, as reflected by the luciferase (LUC) activity (Fig. 4D). EMSAs and ChIP‒qPCR were performed and revealed that OsEIL1 directly binds to the OsCSLC2 promoter (Fig. 4, E and F). These results indicate that OsCSLC2 is directly activated by OsEIL1 in the root ethylene response.

Considering the mild root ethylene insensitivity of the Oscslc2 mutants and the increased root ethylene insensitivity of Oscslc1239 and other segregating mutants (Fig. 2, D, E, and G), we examined the expression of the other five CSLC homologs in the root tip in response to ethylene. All the OsCSLC1, 7, 9, 10 genes, except for OsCSLC3 (Supplementary Fig. S9A), were upregulated by ethylene in an OsEIL1-dependent manner (Fig. 4G). The promoter-LUC activity analyses in rice protoplasts showed that OsEIL1 elevated the promoter activity of OsCSLC1, 7, 9 but does not affect that of OsCSLC10 (Supplementary Fig. S10A). Taken the EMSAs results together (Supplementary Fig. S10B), OsEIL1 directly activates the transcription of OsCSLC1, 7, 9. These results suggested that these CSLCs are functionally redundant, and among the five ethylene-responsive CSLCs in rice, in addition to the indirect promotion on OsCSLC10, OsEIL1 directly upregulates the transcription level of OsCSLC1, 2, 7, 9 in the root ethylene response of rice.

The levels of XyG-oligo with different side chain substitutions were significantly altered by ethylene in our analysis (Supplementary Fig. S7). We therefore examined the expression of these two kinds of XyG-related genes likely involved in the root ethylene response, including 7 XXT genes and 13 XTH genes reported in previous studies (Yokoyama et al. 2004; Wang et al. 2014). Except for OsGT2 and OsXTH3, 11, 23, 28, 29 (Supplementary Fig. S9, B and C), the expression of 6 XXT genes OsXXT1, OsGT3–OsGT7, and 6 XTH genes OsXTH10, 12, 20, 21, 22, 25, was promoted, while the expression of 2 XTH genes OsXTH2 and OsXTH9 was repressed by ethylene in an OsEIL1-dependent manner (Fig. 4, H and I). These results were assessed in concert with those of the GO enrichment analysis (Fig. 2A) and suggest that a major portion of the entire biosynthetic pathway and postsynthetic modifications of XyG are involved in the rice root ethylene response and are regulated by OsEIL1.

Auxin also inhibits root growth through xyloglucan accumulation

We previously identified another ethylene-insensitive mutant, mao hu zi 10 (mhz10) (Zhou et al. 2022). The corresponding gene, rice TRYPTOPHAN AMINOTRANSFERASE-RELATED2 (OsTAR2, also designated MHZ10), encodes a tryptophan aminotransferase that catalyzes the conversion of IPyA to IAA in the auxin biosynthesis pathway and is directly upregulated by OsEIL1, mediating the inhibition of root growth (Zhou et al. 2022). To investigate whether the ethylene insensitivity of Ostar2 roots is also associated with changes in cell wall composition, we also determined the monosaccharide composition of the root cell wall. The levels of xylose residues and cellulose were significantly induced by ethylene in the WT, while such induction was disrupted in the Ostar2 (Supplementary Fig. S2B). The PACE and UPLC-MS analyses indicated that both the control (ambient air) level and ethylene-induced level of XyG were lower in the root cell walls of the Ostar2 than in that of the WT (Fig. 5, A and B). Moreover, the levels of XyG-oligo in XLXG/XXLG (P3H5), XXFG (P3H5Hde1), and XLLG (P3H6) were not elevated in the Ostar2 (Supplementary Fig. S7G), suggesting that these oligosaccharide components play important roles in ethylene-induced and OsTAR2-mediated cell growth inhibition. These results indicate that auxin is essential for ethylene-induced XyG accumulation in the root cell wall.

Figure 5. Auxin inhibition of root growth is also dependent on XyG synthesis in the cell wall. A, B) Xyloglucan-derived oligosaccharides (XyG-oligo) in the root cell walls of the Ostar2 in the ethylene response, as analyzed by PACE (A) and UPLC-MS (B). Etiolated seedlings were grown with ambient air (air) or 10 ppm ethylene (ET) for 1.5 days after germination (DAG). WT, wild type. Three biological replicates were analyzed via UPLC‒MS, and the values are presented as the means ± SDs. C) Root length in response to auxin. Seedlings were grown in 0.1 μM NAA for 2 DAG. An equal amount of EtOH solvent served as the control. n ≥ 46 seedlings. Scale bar, 10 mm. D, E) XyG-oligo in the root cell wall in the auxin response was analyzed by PACE (D) and UPLC-MS (E). The entire roots of rice plants grown in 0.1 μM NAA or an equal amount of EtOH solvent for 1.5 DAG were used for the analyses. Three biological replicates were analyzed via UPLC‒MS, and the values are presented as the means ± SDs. F) Root length of the OsCSLC2 overexpression (OsCSLC2-OE) and Oscslc2 seedlings in response to auxin. Etiolated plants were grown in water supplemented with 0.05 μM NAA for 1.5 DAG, and an equal amount of EtOH served as the control. The relative root length refers to the length of the roots after treatment with 0.05 μM NAA relative to the length of the roots after treatment with EtOH. n ≥ 30 seedlings. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum value. In B and F), statistical significance was analyzed by one-way ANOVA followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant difference. In C and E), ns, not significantly different; *P < 0.05; **P < 0.01; ***P < 0.001, as determined by a two-tailed Student's t test compared to the EtOH control.

To investigate the effect of auxin on XyG synthesis, 1-naphthylacetic acid (NAA) treatment was applied to the WT, which drastically inhibited the root growth (Fig. 5C). We next determined the change in XyG-oligo in the root cell wall during this auxin response by PACE and UPLC-MS. The levels of total XyG and all the major XyG-oligos were elevated (Fig. 5, D and E; Supplementary Fig. S7H), suggesting that auxin-mediated inhibition of root growth may also be dependent on XyG accumulation. We applied NAA to OsCSLC2-OE and Oscslc2 plants and found that their roots had increased and reduced sensitivity to NAA, respectively (Fig. 5F). These results demonstrate that OsCSLC2 and its mediated XyG accumulation in the root cell wall also contribute to auxin-triggered inhibition of root growth in rice.

Ethylene and auxin coregulate OsCSLC2 expression in the rice root ethylene response

Since OsCSLC2 is also involved in the auxin response of roots, the genetic interaction between OsCSLC2 and OsTAR2 was analyzed. Compared with those of the WT plants, the roots of the Ostar2 plants were longer with ambient air and had no response to ethylene. Overexpression of OsCSLC2 drastically reduced the length of the roots of the Ostar2 plants; however, it did not or only slightly restore the ethylene response of the Ostar2 root growth (Fig. 6A, Supplementary Fig. S3P). This result suggested that OsCSLC2 acts downstream of OsTAR2 in the root ethylene response. The expression analysis revealed no ethylene induction of OsCSLC2 in the Ostar2 root tips (Fig. 6B), indicating that auxin biosynthesis is required for OsCSLC2 expression in the root ethylene response. In addition, other 4 OsCSLC homologs, the 6 XXT genes OsXXT1 and OsGT3–OsGT7 and the 8 XTH genes, were also not normally regulated by ethylene in the Ostar2 mutant (Supplementary Fig. S9, D to F). These results suggest that the XyG synthesis pathway and its postsynthetic modifications may also be controlled by auxin in the root ethylene response.

Figure 6. The ethylene pathway and auxin pathway synergistically regulate the expression of OsCSLC2. A) Root length of the OsCSLC2 overexpression seedlings (OsCSLC2-OE) in the Ostar2 background in response to ethylene. Etiolated seedlings were grown with ambient air (air) or 10 ppm ethylene (ET) for 1.5 DAG. WT, wild type. Scale bar, 10 mm. n ≥ 29 seedlings. B)OsCSLC2 expression in the Ostar2 root tips in response to ethylene. The relative expression levels are based on transcript levels. The values represent the means ± SDs, n = 3. C)OsCSLC2 expression in response to auxin. One-DAG etiolated seedlings were treated with 0.5 μM NAA, and the resulting root tips were used for the analyses. The data are the means ± SDs (n = 3). D) Effect of disrupting the auxin pathway on the ethylene induction of OsCSLC2 expression. One-DAG etiolated seedlings were treated with or without 10 ppm ethylene for 8 h, and the resulting root tips were used for the analyses. The data are the means ± SDs (n = 3). E) Effects of OsIAA1, 9, 21, 31 on OsEIL1-activated OsCSLC2 promoter activity. The data are the means ± SDs, n = 3. The immunoblotting shows the expression of Flag-tagged and Myc-tagged proteins. CBBS was used as the loading control. F) Auxin-induced OsCSLC2 expression in the Oseil1. One-DAG Oseil1 etiolated seedlings were treated with EtOH or NAA for 4 h, and the resulting root tips were used for the analysis of OsCSLC2 expression. The “Oseil1 to 1” indicate OsCSLC2 expression in the Oseil1 under the NAA treatment relative to that in the EtOH control. Three biological replicates were performed, and the values represent the means ± SDs. G) Regulatory effect of OsARFs on OsCSLC2 promoter activity. The values represent the means ± SDs, n = 3. H3 indicates the loading control. In the boxplots, the middle line is plotted at the median, the box extends from the 25th to 75th percentiles, and the whiskers represent down to the minimum and up to the maximum value. In A and E), statistical significance was analyzed by one-way ANOVA followed by a post hoc (LSD) analysis at a significance level of 0.05. Different lowercase letters above the bars indicate a significant difference. In B–D, F, and G), ns, not significantly different; *P < 0.05; **P < 0.01; ***P < 0.001, as determined by a two-tailed Student's t test compared to the corresponding control. H) A working model showing that the ethylene pathway and auxin pathway work together to promote the expression of OsCSLC2 and its homologs for xyloglucan (XyG) synthesis and accumulation in the cell wall to inhibit cell elongation and hence root growth during the root ethylene response of rice seedlings. The regions of the root tip including the growth terminating zone, elongation zone, and meristematic zone are shaded. In the cell wall, the thicker lines and thinner lines represent cellulose microfibrils and XyG, respectively. The dashed arrow represents a speculation.

NAA treatment of roots resulted in the upregulation of OsCSLC2 (Fig. 6C). We next explored whether other components of the auxin pathway participate in the ethylene regulation of OsCSLC2. OsmiR393a-OE and OsmiR393b-OE lines have lower expression of the auxin receptor OsTIR1 and AFB2 (Bian et al. 2012; Xia et al. 2012). Ospin2 is an auxin transporter mutant (Zhou et al. 2022). OsCSLC2 in OsmiR393a-OE, OsmiR393b-OE and Ospin2 roots had lower ethylene induction than that in the WT roots (Fig. 6D), revealing that the ethylene-induced upregulation of OsCSLC2 expression requires the assistance of the auxin pathway.

The above regulatory pattern of OsCSLC2 resembles the previously discovered ethylene regulation pattern of OsTAR2. OsTAR2 is directly upregulated by OsEIL1, and auxin promotes OsEIL1 activity in a feedback loop to enhance root auxin biosynthesis through OsEIL1-OsIAA1, 9, 21, 31 module-mediated histone acetylation (Zhou et al. 2022). Accordingly, we tested the effect of OsIAA1, 9, 21, 31 on OsEIL1-activated OsCSLC2 promoter activity. The results showed that OsIAA1 and OsIAA9 promoted, and OsIAA21 and OsIAA31 repressed OsEIL1 in the regulation of OsCSLC2, similar to OsTAR2 (Fig. 6E).

We investigated whether the auxin induction of OsCSLC2 is dependent on the ethylene pathway. The effect of NAA treatment on OsCSLC2 expression in the Oseil1 root tips was analyzed. Unlike OsTAR2, whose auxin induction is dependent on OsEIL1, especially at lower auxin levels (Zhou et al. 2022), OsCSLC2 was normally upregulated in the Oseil1 root tips by the NAA treatment (Fig. 6F), indicating that auxin can independently regulate the expression of OsCSLC2. Therefore, we tested the regulatory activity of 14 OsARFs on OsCSLC2 promoter (Wang et al. 2007) (Supplementary Fig. S11A). Among these genes, OsARF4, 7, 8, 23 promoted OsCSLC2 promoter activity (Fig. 6G). The expression of the 4 OsARFs was substantially induced by ethylene and auxin (Supplementary Fig. S11B).

Together, the ethylene pathway and the ethylene-promoted auxin pathway jointly regulate the expression of representative OsCSLC2 and other XyG metabolism-associated genes, promoting XyG accumulation and postsynthetic modifications in the cell wall to restrict cell elongation in the rice root ethylene response, and auxin also appears to independently regulate XyG metabolism through its signaling pathway.

Discussion

Ethylene inhibits the growth of rice seedling roots. The understanding of such inhibition at the downstream level is very limited. In this study, we found that the ethylene and auxin pathways synergistically induced the expression of OsCSLC2, which encodes a glucan synthase responsible for XyG synthesis and accumulation, leading to the suppression of root elongation in rice seedlings (Fig. 6H).

Ethylene appears to inhibit root growth through the inhibition of cell elongation (Fig. 1). The glucan synthase gene OsCSLC2 and its homologs play a major role in this process. The following evidence supports this conclusion. First, the expression of OsCSLC2 is induced by ethylene, and the OsCSLC2-OE plants and the Oscslc2 mutants showed mildly enhanced and reduced ethylene responses in terms of the relative root growth, respectively; moreover, the higher-order Oscslc mutants displayed increased insensitivity to ethylene (Fig. 2). Consistent with these findings, mutations in Arabidopsis homologs also led to reduced ethylene sensitivity. Second, the XyG-oligo levels were elevated by ethylene, and this elevation required the functions of OsCSLCs and OsEIL1 (Fig. 3). Third, immunodetection revealed that ethylene-induced accumulation of XyG in the root epidermal cell wall of the elongation and differentiation zone occurred in an OsCSLCs and OsEIL1-dependent manner (Fig. 3, H and K; Supplementary Fig. S8). Fourth, the XEGP treatment promoted root elongation, suggesting that XyG deposition in the cell wall inhibits root growth (Fig. 3L). Fifth, the genetic interaction analysis revealed that OsCSLC2 acts downstream of OsEIL1 to mediate the root growth inhibition (Fig. 4, A and B). Sixth, ethylene induction of OsCSLC1, 2, 7, 9, 10 and other XyG metabolic genes requires OsEIL1, and promoter-LUC assays, EMSAs and ChIP‒qPCR analyses support that OsEIL1 directly binds to the OsCSLC1, 2, 7, 9 promoter and activates their gene expression (Fig. 4, C to I; Supplementary Fig. S10). Taken together, these results demonstrate that OsCSLC2 and its homologs function downstream of OsEIL1 to promote XyG synthesis and accumulation in the cell wall to inhibit root elongation in rice seedlings during the ethylene response.

Considering that ethylene requires the auxin pathway to affect rice root growth (Qin et al. 2017; Zhou et al. 2022), we examined the roles of auxin in ethylene-regulated and OsCSLC2-mediated root inhibition. In fact, ethylene-induced xylose residue and XyG accumulation also require the function of OsTAR2 (Fig. 5, A and B; Supplementary Fig. S2B), the tryptophan aminotransferase in the auxin biosynthesis pathway. NAA treatment increased the XyG level and inhibited root growth through OsCSLC2 (Fig. 5, C to F). Genetically, OsCSLC2 also acts downstream of the auxin pathway to regulate the root ethylene response in rice (Fig. 6A). Ethylene induced OsCSLC2 expression through the auxin pathway, while the auxin induction of OsCSLC2 basically did not rely on OsEIL1 (Fig. 6F). On the basis of these findings, we propose that the ethylene and auxin pathways collaboratively upregulate OsCSLC2 expression to inhibit root growth. Moreover, both hormones also have their own regulatory effects on OsCSLC2 for root control. Notably, in our previous study, we found that the OsEIL1-OsAux/IAAs module controls OsTAR2 gene expression in the root ethylene response and that ARF proteins are not involved in this process (Zhou et al. 2022). Presently, both the OsEIL1-OsAux/IAAs module and the ARF proteins appear to regulate OsCSLC2 expression (Fig. 6). This difference may reflect the specificity and complexity of the regulation of genes at different positions in a pathway.

In the roots, in addition to OsCSLC2, several other OsCSLC homologs and XXT genes likely involved in XyG synthesis, and XTH genes likely involved in XyG modification are responsive to ethylene in rice (Fig. 4, G to I). The ethylene induction of these strains also depends on the auxin pathway (Supplementary Fig. S9, D to F). These data suggest that many genes involved in the XyG synthesis pathway and modification processes participate in cell wall reshaping to inhibit root cell elongation in the ethylene response.

Notably, the expression of cellulose synthase genes and cellulose content were also apparently induced by ethylene in roots, and these effects depend on the functions of OsEIL1 and OsTAR2 (Fig. 2B; Supplementary Figs. S2 and S9, G and H). Therefore, the synthesis of cellulose in the root cell wall is also under the control of ethylene and auxin pathways. However, overexpression of the 4 genes OsCESA3, 4, 7, 9 appeared to have no effect on root elongation in the ethylene response (Supplementary Fig. S3, A to H). These results suggest that cellulose deposition and accumulation may contribute to cell wall reshaping together with XyG function during the root ethylene and auxin response. It is possible that the molecular domains (units) and different side chain substitutions in XyG (Fry 1989a) may mediate the interactions of XyG with the cellulose microfibrils by forming crosslinks, which may be closely associated with or entrapped within or between the cellulose microfibrils (Hayashi et al. 1987; Fry and Miller 1989; Mccann et al. 1990; Pauly et al. 1999a; Hanus and Mazeau 2006; Zheng et al. 2018). Depending on these interactions, XyG may act as a linker to form an XyG-cellulose network in the cell wall (Pauly et al. 1999a). In Arabidopsis, with the treatments of α-expansin and fusicoccin, petiole cell walls of the XyG-deficient xxt1 xxt2 double mutant exhibited less extensibility in creep and stress relaxation processes than the WT (Park and Cosgrove 2012a), meaning that cell wall expansion requires the changes in XyG-related wall structures. In cucumber (Cucumis sativus) hypocotyl cell walls, neither the XyG-specific endoglucanase (XEG) nor the cellulose-specific endoglucanase induced cell wall creep, whereas the Cel12A, an endoglucanase that hydrolyzes both XyG and cellulose, elicited a high creep rate, because of the effect of Cel12A on these XyG in the limited regions of tight contact between cellulose microfibrils (Park and Cosgrove 2012b). According to these studies, the limited and inaccessible junctions between cellulose and XyG chains, known as biomechanical hotspots, which tightly adhere to each other, determine the extensibility of cell walls (Cosgrove 2016).

However, the issue of XyG-cellulose crosslinking remains a challenging aspect in the field of cell wall structure, especially in grasses such as rice. The occurrence of XyG is 20% to 25% in the dicot primary walls, and is 2% to 5% in the grass primary walls (Scheller and Ulvskov 2010). According to the UPLC-MS analyses in our study, the XyG accounts for 2% to 4% of the destarched alcohol insoluble residues (AIRs) in the cell walls of rice primary roots, and both ethylene and auxin significantly promote the synthesis of XyG in the roots (Figs. 3, C, E, G, and J and 5, B and E). Although the cell wall contains a lower proportion of XyG in rice, the deficiency of the XyG led to multiple growth phenotypes (Fig. 2, D to G; Supplementary Fig. S5), indicating the importance of XyG in rice. To investigate the effects of ethylene and auxin on the XyG-cellulose crosslinking, we digested the root AIRs with the xyloglucan-specific endo-β-1,4-glucanase to release the XyG having no crosslink with cellulose microfibrils and then used the Cel12A to digest and release the XyG having tight crosslink with cellulose microfibrils. The PACE assays exhibited that ethylene and auxin substantially induced the levels of both the noncellulose crosslinking and cellulose crosslinking XyG (Supplementary Fig. S12), suggesting that ethylene likely increases the crosslinks between the newly synthesized XyG and cellulose to facilitate the formation of a more compact network and restrict the expansion of the cell wall (Hayashi et al. 1994; Lopez et al. 2010; Cosgrove 2016). The increased cell wall thickness in the ethylene response may be due to the effect of OsCESA3, 4, 7, 9 on cellulose synthesis (Fig. 1L). Therefore, we propose that the accumulation of XyG, rather than cellulose, may play an essential role in restricting cell elongation. However, we cannot exclude the possibility that cellulose deposition affects cell wall expansion.

Many factors, such as hormones, the cytoskeleton, glycosylphosphatidylinositol-anchored proteins, phosphoinositides, and the sugar nucleotide supply, are involved in the regulation of cell wall biosynthesis or deposition (Zhong and Ye 2007). The NAC (NAM, ATAF1/2, and CUC2)-MYB (myeloblastosis) transcriptional cascade was shown to regulate the initiation and biosynthesis of the secondary wall [reviewed by Zhong and Ye (2007, 2014), Hussey et al. (2013), and Didi et al. (2015)]. Group IIId- and IIIe-type AP2/ERF transcription factors were found to regulate primary cell wall deposition (Sakamoto et al. 2018). In this study, we revealed that the transcription factor OsEIL1 in the ethylene signaling pathway and some OsARFs in the auxin signaling pathway promoted the expression of OsCSLC2 and other primary cell wall metabolism-related genes involved in root growth regulation.

Based on these findings, a working model for ethylene-mediated inhibition of root growth was proposed (Fig. 6H). During the root ethylene response of rice, the ethylene signaling pathway promotes the accumulation of OsEIL1 and auxin biosynthesis, after which OsEIL1 cooperates with the auxin pathway to upregulate the expression of OsCSLC1, 2, 7, 9 in the root tip. The expression of OsCSLC10, OsXXT1, OsGT3–OsGT7 and OsXTH2, 9, 10, 12, 20, 21, 22, 25 in the root tip is also coregulated. Thus, the XyG synthesis pathway and postsynthetic modifications of XyG are enhanced, leading to XyG accumulation and restriction of the loosening of cellulose microfibrils in the epidermal cell wall in the root elongation and differentiation zone. Our study revealed that the XyG synthase genes OsCSLCs are downstream of the ethylene pathway and auxin pathway for root growth inhibition. Manipulation of these genes and their associated regulatory pathways may improve the adaptation of rice roots during development and under abiotic stresses.

Materials and methods

Plant materials

All the rice (Oryza sativa L.). plants were of the japonica cultivar Nipponbare. The Oseil1 and the Ostar2 (mhz10) were previously created (Yang et al. 2015; Zhou et al. 2020). OsCESAs-OE and OsCSLs-OE transgenic plants in the WT or Ostar2 background were generated via Agrobacterium (Agrobacterium tumefaciens) (EHA105 strain)-mediated transformation. OsCSLC2-OE lines, #7 and #16; OsCESA3-OE lines, #3 and #5; OsCESA4-OE line #3; OsCESA7-OE lines, #2 and #4; OsCESA9-OE lines, #2 and #3; OsCSLD1-OE lines, #4 and #5; OsCSLF8-OE line #4; OsCSLH1-OE lines, #2 and #3, were independent transgenic events. The homozygosity and the expression level of transgene were identified via resistance screening and RT-qPCR in the self-fertilized T2 generation, respectively. Oscslc2-1 and Oscslc2-2 mutants were independently generated by CRISPR/Cas9-mediated genome editing, and the quadruple mutant Oscslc1239 and other higher-order Oscslc mutants were generated based on the Oscslc2-2 mutant. The target sequences are: OsCSLC2 (target 1 GGCTGATGTACGGGTTCATCAGG, target 2 GATTGAAGGGGACCCGTTCAGGG); OsCSLC1 (target GGAGTGGGCGATATCTGAGGTGG); OsCSLC3 and OsCSLC7 (target TCCTCTGCCTCGGCTGCTTCTGG); OsCSLC9 (target 1 CGGCCGTGTGCAATCTTGATTGG, target 2 TGTACCGGCATCGTGTCCTTAGG); OsCSLC10 (target CGCCGGCGACTACTACCCCATGG). The homozygosity of Oscslc2-1, Oscslc2-2, and Oscslc1239 mutants was verified by sequencing the PCR products in the self-fertilized T2 generation and T3 generation, respectively. The primers used for identifying the mutations are listed in Supplementary Data Set 2. OsCSLC2-OE#7 plants in the Oseil1 background and OsEIL1-Flag-OE#9-7 plants in the Oscslc2-2 background were generated by crossing. Arabidopsis (Arabidopsis thaliana) mutants (Columbia ecotype) were purchased from the Arabidopsis Biological Resource Center (ABRC, https://abrc.osu.edu/).

Plant growth conditions

Rice plants were propagated and crossed in the Experimental Farms of the Institute of Genetics and Developmental Biology in Beijing (116°23′E, 40°22′N) from May to October and in Hainan Province (110°04′E, 18°51′N) from November to April. Rice etiolated seedlings used for protoplast isolation were grown on 1/2 Murashige and Skoog (MS) media (pH 5.8), containing 1/2 MS salt, 1% sucrose (w/v), and 0.3% phytagel (w/v), in the dark at 28°C for 7–15 days. Arabidopsis plants were grown in a greenhouse at 22°C under a 15-h light and 9-h dark photoperiod (8000-Lux intensity generated by fluorescent lamps).

Statistical analyses

The statistical calculations were performed using IBM SPSS Statistics version R24.0.0.0 software. For mean comparisons between two groups, a two-tailed Student's t test was used for the calculations. For the multiple comparisons among groups, one-way analysis of variance (ANOVA) followed by Lsd post hoc analysis at a significance level of 0.05 was used for the calculations. The details of the calculations are provided in Supplementary Data Set 3.

Chemical treatments

For the ethylene treatments, rice seeds were sown on a stainless steel mesh, immersed in water at 37°C for germination and then transferred to an airtight plastic box at 28°C in the dark with various concentrations of ethylene for phenotypic or gene expression analysis (Zhou et al. 2020). In the auxin treatments, an aqueous NAA solution was added to just submerge the mesh. For the short-term treatments, 1-DAG (day after germination) rice seedlings were used in the analysis. To analyze the ethylene response of the higher-order Atcslc mutants in Arabidopsis, the seeds were sterilized by soaking in 70% (v/v) ethanol for 5 min and transferred to 5% (w/v) sodium hypochlorite for 10 min. After the washing step in sterilized water, the seeds were sown on plates of 1/2 MS media (pH5.8) containing 1/2 MS salt, 1% (w/v) sucrose, 0.8% (w/v) agar. After the 3-days cold treatment at 4°C, the plates were placed at an inclination of 60 degrees in an airtight box. After the injection of ethylene into the box, the seedlings were grown in the dark at 22°C for 5 days before the phenotypic analysis. ImageJ software (V1.52a, National Institutes of Health) (Schneider et al. 2012) was used to measure the length of hypocotyl and root, and the angle of apical hook.

Microscopy

To observe the rice root cells, paraffin-embedded sections were obtained. The roots were fixed with 4% (w/v) paraformaldehyde (dissolved in 0.01 M PBS, pH 7.3) at 4°C for 24 h. After dehydration with 30%, 40%, 50%, and 60% (v/v) alcohol for 30 min each, the roots were stained with 1% (w/v) safranin O solution (in 70% alcohol) overnight at room temperature. The roots were dehydrated with 80%, 95%, and 100% alcohol for 1 h each. The roots were then soaked in ethanol-xylene mixtures (3:1, 1:1, 1:3) for 1 h each, twice in xylene for 1 h, and then a small amount of xylene and crushed paraffin were added at 38°C overnight incubation. In the paraffining step, the roots were infiltrated with pure paraffin three times at 56°C for 1 h each. Finally, the roots were transferred to a mold for embedding. The blocks were cut into 7-μm cross-sections and 10-μm longitudinal sections by a Leica RM2135 rotary microtome. After safranin O-fast green staining, the sections were sealed with neutral gum. A Leica DM2500 LED/DFC 7000 T system was used for imaging. ImageJ software (V1.52a) was used for the measurements.

EdU staining

To investigate the change of the root apical meristem in the ethylene response, we performed EdU staining using a BeyoClick EdU Cell Proliferation Kit with Alexa Fluor 488 (Beyotime, C0075L). Rice seedlings were grown with ambient air for 1 DAG. The root tips were immersed in 20 μM EdU solution (Kotogany et al. 2010) for 4 h with or without 10 ppm ethylene treatment, and then the root tips were fixed with 4% (w/v) paraformaldehyde (pH 7.3) dissolved in 0.01 M PBS and containing 0.1% (v/v) Triton X-100, at 4°C for 24 h. Click reactions were performed according to the kit's manual. Root tips were observed using a ZEISS LSM 980 Laser Confocal Microscope with a 488-nm laser (1.2% intensity), a collection bandwidth of 491 to 657 nm and a detector gain of 743 V. All images were generated by overlapping 7 Z-stock scans at 20 μm intervals from the surface to the 120–130 μm interior. The fluorescence was analyzed using ZEISS ZEN version 3.3 software.

Transmission electron microscopy

To investigate the change in cell wall thickness in the root ethylene response, the ultrathin sectioning and the performed. Etiolated seedlings were grown with ambient air or 10 ppm ethylene for 1 DAG. The segments of the root growth termination zone were immersed in 0.1 M PBS (pH 7.6) solution containing 2.5% (v/v) glutaraldehyde under vacuum and fixed at 4°C overnight. The tissues were washed five times with precooled 0.1 M PBS solution before gradient dehydration. Starting from 10% (v/v) ethanol, gradient dehydration was performed by increasing the concentration of ethanol from 10% to 100%, and each step lasted for 1 h. The ethanol-acetone mixtures used for the gradient replacements were 3:1, 1:1, and 1:3 (v/v), and the tissues were infiltrated with acetone twice for 1 h each. The proportions of acetone-Spurr's resin mixtures used for the gradient replacements were 3:1, 1:1, and 1:3 (v/v), and the tissues were infiltrated with Spurr's resin twice for 2 h each. Standard Spurr's resin contained 4.10 g of ERL 4221, 1.43 g of D.E.R. 736, 5.90 g of NSA, and 0.10 g of DMAE (using an electronic weighing balance). After infiltration, the tissues were placed in Spurr's resin in the mold, and the resins were polymerized at 70°C for 8 h. The ultrathin sections were sliced at 70 nm with a Leica EM UC6 ultramicrotome, and the cell wall was observed with a Hitachi HT7700 transmission electron microscope. ImageJ software (V1.52a) was used to measure the thickness of the cell wall.

Cell wall composition analyses

To study the changes in cell wall components in the rice root ethylene response, the analyses of monosaccharide residues and cellulose were conducted as previously described (Wang et al. 2022). One biological replicate refers to an assay from an independent seedling sampling, and 3 to 5 biological replicates were performed. In brief, the roots from plants subjected to different treatments were lyophilized and ball-milled into fine powders. The destarched alcohol insoluble residues (AIRs) were prepared by washing with 70% (v/v) ethanol and a mixture of chloroform and methanol (1:1, v/v), followed by treatment with α-amylase (Megazyme, E-BLAAM) in 50 mm MES-Tris buffer (pH 8.2). AIRs (2 mg) were hydrolyzed by 2 M trifluoroacetic acid. The supernatant was used to generate alditol acetate derivatives, which were detected by an Agilent 7890 series GC instrument equipped with a 5975C MS detector. The pellet was treated with Updegraff reagent and then used to analyze the cellulose content.

The XyG-oligo content was determined via polysaccharide analysis via gel electrophoresis (PACE) and ultra-performance liquid chromatography‒mass spectrometry (UPLC-MS). To prepare the XyG-oligo, the hemicellulose-enriched NaOH-soluble fraction was prepared by treating 10 mg of destarched AIRs in 4 M NaOH solution, and after neutralization and dialysis, the fraction was finally lyophilized. Then, 0.5 mg of the NaOH-soluble fraction was incubated in 0.5 mL of 50 mm ammonium formate, pH 5.0, with 1 U of a xyloglucan-specific endo-β-1,4-glucanase (Pauly et al. 1999b) for 18 h at 37°C. The profile of XyG-oligo was analyzed on a Bruker Autoflex MALDI-TOF mass spectrometry (MS) instrument (Bruker) as described previously (Zhu et al. 2012).

The released XyG-oligo was derivatized with 0.1 M 8-aminonaphthalene-1,3,6-trisulfonic acid (Invitrogen, A350) in 0.5 M sodium cyanoborohydride at 37°C overnight. The derivatives were resuspended in urea (6 M) and loaded onto PACE gels. The samples were run and imaged using a transilluminator with ultraviolet (UV) light at 365 nm and analyzed using Image Lab software 3.0.

To quantify XyG-oligo, ultra-performance liquid chromatography (UPLC) was carried out using an ACQUITY UPLC H-Class plus system equipped with an SQ Detector 2 single quadrupole mass detector (Waters). Oligosaccharides were separated using an ACQUITY UPLC BEH Amide column (100 × 2.1 mm, 1.7 μm) with mobile phase A (acetonitrile:H2O, 80:20, with 0.1% ammonium hydroxide) and mobile phase B (acetonitrile:H2O, 80:20, with 0.1% ammonium hydroxide). The abundance of XyG-oligo was quantified using a peak analyzer in MassLynx software (UPLC, v.4.1).

To analyze the XyG-cellulose crosslinks in root cell walls, 5 mg AIRs was first digested in a 500 μL reaction system (containing 50 mm ammonium formate, 10 μg xyloglucan-specific endo-β-1,4-glucanase; pH, 5.0) at 37°C for 48 h. After heating the products at 100°C for 5 min to deactivate the enzymes, 20 μL supernatant was used for PACE. Next, the solid residues from the previous reaction were further digested in a 500 μL reaction system (containing 50 mm ammonium formate, 10 μg 10×His-Cel12A; pH, 5.0) at 37°C for 48 h. After the same deactivation step, 20 μL supernatant was used for PACE. The 10×His-Cel12A proteins were expressed in and purified from Escherichia coli (DE3 strain) (Park and Cosgrove 2012b).

Transcriptome analysis

To analyze the ethylene-responsive genes in roots, total RNA was isolated from the root tips of rice plants using TRIzol reagent (Ambion, 15596018) according to the manufacturer's instructions. Three biological replicates were performed. One biological replicate refers to an independent plant sampling. After sequencing, the data were analyzed as previously described (Zhou et al. 2022). Before GO enrichment and KEGG pathway analysis, the MSU IDs of the OsEIL1-RERGs were converted into ENTREZ IDs (Supplementary Data Set 1). Then, the ENTREZ ID list was analyzed with DIVID tools with the following threshold: count, 2; EASE, 0.1 (https://david.ncifcrf.gov/tools.jsp) (Huang et al. 2009a,b). The results were visualized by the R package “GOplot (Walter et al. 2015)” with a threshold = 2.2 (R version 4.0.4; RStudio version 1.2.5033).

RT-qPCR

To analyze the gene expression in response to ethylene or auxin, 1-DAG etiolated seedlings were treated with or without 10 ppm ethylene for 8 h, or treated with or without NAA for 4 h, and the root tips (5-mm apical segment) were collected for RNA extraction. To analyze the expression level of the transgene, the roots were used for RNA extraction. Total RNA was isolated using TRIzol reagent (Ambion, 15596018). cDNAs were synthesized using 5×FastKing-RT SuperMix (TIANGEN, KR118). RT‒qPCR assays were performed on a Roche LightCycler 480 System with two technical replicates using the relative quantification method (TransGen Biotech, 1). The expression of OsUBIQUITIN (OsUBQ, LOC_Os05g06770) served as the normalization control. One biological replicate refers to an independent plant sampling, and three biological replicates were performed for each analysis. The RT‒qPCR primers used are listed in Supplementary Data Set 2.

Plasmid construction

To generate transgenic plants, the coding sequences of the OsCESAs and OsCSLs were cloned and inserted into the XbaI-digested pCAMBIA2300-35S-OCS vector (modified from the pCAMBIA-2300 vector) using a seamless assembly cloning kit (Clone Smarter, C5891). All the restriction enzymes in this study were purchased from Thermo Fisher Scientific. The coding sequence of OsCSLC2 was introduced into a pre-modified pCAMBIA2300-GFP vector with the digestion of KpnI and SmaI to construct the pCAMBIA2300-OsCSLC2-GFP plasmid for subcellular localization analysis. To construct the plasmids containing ProOsCSLC1:LUC, ProOsCSLC2:LUC, ProOsCSLC7:LUC, or ProOsCSLC9:LUC, the promoter sequences (sequence of 5′ side of starting codon), 2500-bp of OsCSLC1, 2812-bp of OsCSLC2, 2670-bp of OsCSLC7, or 4081-bp of OsCSLC9, were cloned and inserted into a pre-modified pEASY-LUC vector (TransGen Biotech, CT111-01) with the KpnI and BamHI digestion. For the construction of the pGEX-6P-1-OsEIL1N plasmid, the 1050-bp coding sequence of OsEIL1 was introduced into the EcoRI and BamHI-digested pGEX-6p-1 vector (cytiva, 28954648). The primers used for plasmid construction are listed in Supplementary Data Set 2.

Protein subcellular localization

To investigate the localization of the OsCSLC2 protein, rice protoplasts were isolated from 7 to 15-DAG etiolated seedlings by enzymatic digestion. Five micrograms of pCAMBIA2300-OsCSLC2-GFP plasmid were transfected into the protoplasts in a 200-μL reaction per tube as previously described for polyethylene glycol (PEG)-mediated transfection (Bart et al. 2006), and the protoplasts were incubated in the dark at 28°C for 14 h. The known Golgi apparatus-located protein Man49-mCherry was used for the comparison. The fluorescence was observed by the Carl Zeiss LSM710 system with a 488-nm laser (8% intensity), a collection bandwidth of 493 to 549 nm and a detector gain of 858 V for GFP or OsCSLC2-GFP observation; with a 561-nm laser (8% intensity), a collection bandwidth of 578 to 670 nm and a detector gain of 799 V for Man49-mCherry observation.

Xyloglucanase treatment

To explore the role of XyG in ethylene-mediated inhibition of root growth, xyloglucanase (Megazyme, E-XEGP, 1,000 U/mL) was used to treat the roots of the OsEIL1-OE seedlings. Before treatment, the ammonium sulfate in the xyloglucanase stock solution was removed by ultrafiltration. For ultrafiltration, 1.5 mL of E-XEGP stock solution was washed 5 times with 5 mL of prechilled 50 mm Tris-HCl (pH 6.8) in an ultrafiltration tube (Sartorius, VS04T02, 30 kDa) by centrifugation at 7,000 × g for 30 min at 4°C. Then, the XEGP working solution was diluted with sterile water to a concentration of 7.5 U/mL. The working solution was sprayed on the roots of the seedlings every 6 h for 3 DAG, after which the root length was measured. Sterile water supplemented with an equal amount of 50 mm Tris-HCl served as the control.

Immunodetection

To investigate the accumulation of XyG in roots, 1-DAG etiolated seedlings were treated with or without 10 ppm ethylene for 8 h. In the long-term ethylene treatment, the seedlings were grown with ambient air or 10 ppm ethylene for 1 DAG. The root tips (5-mm apical part) were fixed with 4% (w/v) paraformaldehyde (dissolved in 0.1 M PBS, pH 7.3) at 4°C for 24 h. After performing the same dehydration and ethanol-acetone mixture replacement steps as those used for TEM, the root tips were embedded in LR white resin (Sigma‒Aldrich). Five-micron-thick sections were cut with a microtome (RM2255, Leica). The samples were then incubated with LM15 (PlantProbe, ELD013) antibody at a 1:50 (v/v) dilution. A fluorescein isothiocyanate (FITC)-conjugated antimouse IgG secondary antibody (Signalway Antibody, 28256) was applied at a 1:500 dilution. The fluorescent signals were collected and recorded using an Airyscan2 confocal microscope (Zeiss LSM 980) with a 488-nm laser (1% intensity), a collection bandwidth of 495 to 682 nm and a detector gain of 534 V.

Transcriptional regulatory activity assay in rice protoplasts

To analyze the ability of OsEIL1 to regulate the promoter activity of OsCSLC1, 2, 7, 9, 10, plasmid mixtures containing 1 μg of PTRL, 3 μg of pEASY-ProOsCSLC:LUC, and 5 μg of pCAMBIA2300-OsEIL1-Flag were cotransfected into rice protoplasts in a 200-μL reaction per tube via PEG-mediated transfection. The pCAMBIA2300-nYFP-Flag plasmid served as the negative control. To test the regulatory effects of OsIAA1, 9, 21, 31 on OsEIL1-activated OsCSLC2 promoter activity, plasmid mixtures containing 1 μg PTRL, 3 μg pEASY-ProOsCSLC2:LUC, 5 μg pCAMBIA2300-OsEIL1-Flag, and 5 μg pCAMBIA2300-OsIAA-cYFP-Myc were cotransfected into rice protoplasts in a 200-μL reaction per tube via PEG-mediated transfection. The group containing pCAMBIA2300-nYFP-Flag and pCAMBIA2300-cYFP-Myc served as the control. To test the ability of the OsARFs to regulate OsCSLC2 promoter activity, plasmid mixtures containing 1 μg of PTRL, 3 μg of pEASY-ProOsCSLC2:LUC, and 5 μg of pCAMBIA2300-OsARF-Flag were cotransfected into rice protoplasts in a 200-μL reaction per tube. pCAMBIA2300-nYFP-Flag served as the control. After the transfection, protoplasts were cultured in the dark at 28°C for 14 h, luciferase activity assays were performed using a Dual-Luciferase Reporter Assay System (Promega, E1960), and the luciferase activity was measured on a GLOMAX 20/20 Luminometer (Promega). Relative LUC activity was defined as the ratio of firefly luciferase activity to Renilla luciferase activity, and these values were normalized relative to those of the control group. One biological replicate refers to one independent transfection event in one tube. Three biological replicates were performed for each test.

Immunoblotting

Protein samples for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were prepared by adding a reducing loading buffer (CWBIO, CW0027) and denaturing at 65°C for 5 min. The gels were prepared using TGX Stain-Free FastCast Acrylamide Kit (BIO-RAD). After the electrophoresis, the separated proteins were blotted on a PVDF membrane (Merck, IPVH00010) using a trans-Blot Sd Semi-Dry Electrophoretic Transfer Cell (BIO-RAD). The PVDF membrane was blocked with 5% (w/v) skim milk dissolved in 0.1 M PBS. The primary antibody (anti-Flag: MBL, M185; anti-Myc: Abmart, M20019; anti-H3: Agrisera, AS10710) was diluted at 1:5,000 (v/v) in 3% (w/v) skim milk (dissolved in 0.1 M PBS), and incubated with the membrane for 2 h at room temperature or overnight at 4°C. After washing the membrane with PBS-T (0.1 M PBS containing 0.5‰ Tween 20, v/v) four times, the membrane was incubated with the secondary antibody (Abmart, M21001 or M21002) diluted at 1:5000 in 3% skim milk at room temperature for 1 h. The membrane was washed with PBS-T four times, and soaked in chemiluminescent substrate (Thermo Scientific, 34580) for 5 min, finally followed by the exposure.

EMSAs and supershift-EMSAs

To prepare the GST-OsEIL1N protein, the pGEX-OsEIL1N plasmid was expressed in E. coli BL21 (DE3), and the GST-OsEIL1N protein was isolated as previously described (Zhou et al. 2022). The unlabeled and 5′-biotinylated complementary oligonucleotide pairs (Supplementary Data Set 2) were annealed on a thermocycler to generate double-stranded unlabeled competitors and biotin-labeled probes. The EMSA samples were prepared in a 10-μL reaction per tube according to the manufacturer's protocol (Thermo Fisher Scientific, 20148). For the supershift-EMSA, the anti-GST antibody was added to the reaction mixture. After the reactions, the protein-probe mixture was separated on a 6% native polyacrylamide gel and transferred to a nylon membrane (Thermo Fisher Scientific, LC2003). The probes on the membrane were detected using a Chemiluminescent Nucleic Acid Detection Module (Thermo Fisher Scientific, 89880).

ChIP-qPCR assay

To investigate the binding of OsEIL1 to OsCSLC2 promoter, the root tips of 1-DAG etiolated seedlings were collected for the ChIP‒qPCR. The procedures were performed according to the manual of the Plant ChIP Kit (EPIGENTEK, P-2014). OsEIL1 binding site (EBS) is the region of −1,433 to −1,373 bp; ChIP‒qPCR fragments 1 and 2 (PF1 and PF2) are the regions of −1,520 to −1,339 bp and −1,497 to −1,301 bp, respectively. Three μg anti-Flag antibody (CST, 14793S) were used in each reaction. Mouse IgG served as the control. DNA enrichment was measured relative to the input (10% of chromatin relative to the ChIP sample). One biological replicate refers to an assay from an independent seedling sampling, and three biological replicates were performed. The primers used are listed in Supplementary Data Set 2.

Accession numbers

Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: OsCESA3 (LOC_Os07g24190); OsCESA4 (LOC_Os01g54620); OsCESA7 (LOC_Os10g32980); OsCESA9 (LOC_Os09g25490); OsCSLC2 (LOC_Os09g25900); OsCSLD1 (LOC_Os10g42750); OsCSLF8 (LOC_Os07g36630); OsCSLH1 (LOC_Os10g20090). OsCSLC1 (LOC_Os01g56130); OsCSLC3 (LOC_Os08g15420); OsCSLC7 (LOC_Os05g43530); OsCSLC9 (LOC_Os03g56060); OsCSLC10 (LOC_Os07g03260); OsARF2 (LOC_Os01g48060); OsARF4 (LOC_Os01g70270); OsARF7 (LOC_Os02g35140); OsARF8 (LOC_Os02g41800); OsARF9 (LOC_Os04g36054); OsARF10 (LOC_Os04g43910); OsARF14 (LOC_Os05g43920); OsARF15 (LOC_Os05g48870); OsARF16 (LOC_Os06g09660); OsARF18 (LOC_Os06g47150); OsARF22 (LOC_Os10g33940); OsARF23 (LOC_Os11g32110); OsARF24 (LOC_Os12g29520); OsARF75 (Rad9, Ddc1, LOC_Os03g22450); Atcslc456 (CS72435); Atcslc4568 (CS72436); Atcslc45612 (CS72437); Atcslc456812 (CS72438). The raw RNA-seq reads were deposited in the NCBI database under accession number PRJNA639684.

Supplementary Material

koae195_Supplementary_Data

Acknowledgments

We thank Prof. Mu-Yuan Zhu (Zhejiang University) and Prof. Ming-Yong Zhang (South China Botanical Garden, Chinese Academy of Sciences, CAS) for providing the seeds of OsmiR393a-OE and OsmiR393b-OE lines.

Author contributions

Y.Z., Y.H.Z., and J.S.Z. designed the research, analyzed the data, and wrote the manuscript. Y.Z., Y.H.G., and B.C.Z. performed the main experiments. H.L.Y., Y.B.T., Y.H.H., C.C.Y., J.J.T., W.W., W.K.Z., and S.Y.C. participated in the data analysis.

Supplementary data

The following materials are available in the online version of this article.

Supplementary Figure S1. Microscopy of root cell.

Supplementary Figure S2. Determination of the monosaccharide composition and cellulose in root cell wall.

Supplementary Figure S3. Root length of OsCESAs-OE and OsCSLs-OE seedlings in response to ethylene.

Supplementary Figure S4. Mutations in OsCSLC genes.

Supplementary Figure S5. Plant phenotypes of OsCSLC2 overexpression seedlings (OsCSLC2-OE), Oscslc2 and Oscslc1239 multiple mutants.

Supplementary Figure S6. Root phenotype of higher-order Atcslc mutants in ethylene response.

Supplementary Figure S7. Determination of xyloglucan oligosaccharides (XyG-oligo) in root cell wall in response to ethylene or auxin by UPLC-MS.

Supplementary Figure S8. Immunodetection of XyG in root cell wall in long-term ethylene response.

Supplementary Figure S9. XyG and cellulose synthesis-related gene expression.

Supplementary Figure S10. Analysis of the activation and binding activity of OsEIL1 on the OsCSLCs promoter.

Supplementary Figure S11. The regulation of OsARFs on the expression of OsCSLC2.

Supplementary Figure S12. Using XEG and Cel12A for the digestion of AIRs to analyze the XyG-cellulose crosslinks of cell wall in the root ethylene and auxin response.

Supplementary Table S1. Mutations in the segregating higher-order Oscslc mutant identified by sequencing.

Supplementary Data Set 1. Details of the transcriptome analysis and MALDI-TOF analysis.

Supplementary Data Set 2. A list of the primers and oligos used in this study.

Supplementary Data Set 3. Details of source data and statistical calculations in this study.

Funding

This work was supported by the STI 2030-Major Project (2023ZD0406801), the National Natural Science Foundation of China (32000220, 31530004, 31670274, and 31600980).

Data availability

The data underlying this article are available in the article and in its online supplementary material.

Dive Curated Terms

The following phenotypic, genotypic, and functional terms are of significance to the work described in this paper:

EIN3 Gramene: AT3G20770

EIN3 Araport: AT3G20770

EBF1 Gramene: AT2G25490

EBF1 Araport: AT2G25490

EBF2 Gramene: AT5G25350

EBF2 Araport: AT5G25350

ethylene CHEBI: CHEBI:29362

KEGG Gramene: Kyoto Encyclopedia of Genes and Genomes

KEGG Araport: Kyoto Encyclopedia of Genes and Genomes

OsEIL1 Gramene: LOC_Os03g20790

OsEIL1 Araport: LOC_Os03g20790

OsEIN2 Gramene: LOC_Os07g06130

OsEIN2 Araport: LOC_Os07g06130

OsAFB2 Gramene: LOC_Os04g32460

OsAFB2 Araport: LOC_Os04g32460

OsTIR1 Gramene: LOC_Os05g05800

OsTIR1 Araport: LOC_Os05g05800

xyloglucan CHEBI: CHEBI:18233

OsCESA3 Gramene: LOC_Os07g24190

OsCESA3 Araport: LOC_Os07g24190

OsCESA4 Gramene: LOC_Os01g54620

OsCESA4 Araport: LOC_Os01g54620

OsCESA7 Gramene: LOC_Os10g32980

OsCESA7 Araport: LOC_Os10g32980

OsCESA9 Gramene: LOC_Os09g25490

OsCESA9 Araport: LOC_Os09g25490

OsCSLC2 Gramene: LOC_Os09g25900

OsCSLC2 Araport: LOC_Os09g25900

OsCSLD1 Gramene: LOC_Os10g42750

OsCSLD1 Araport: LOC_Os10g42750

OsCSLF8 Gramene: LOC_Os07g36630

OsCSLF8 Araport: LOC_Os07g36630

OsCSLH1 Gramene: LOC_Os10g20090

OsCSLH1 Araport: LOC_Os10g20090

OsCSLC1 Gramene: LOC_Os01g56130

OsCSLC1 Araport: LOC_Os01g56130

OsCSLC3 Gramene: LOC_Os08g15420

OsCSLC3 Araport: LOC_Os08g15420

OsCSLC7 Gramene: LOC_Os05g43530

OsCSLC7 Araport: LOC_Os05g43530

OsCSLC9 Gramene: LOC_Os03g56060

OsCSLC9 Araport: LOC_Os03g56060

OsCSLC10 Gramene: LOC_Os07g03260

OsCSLC10 Araport: LOC_Os07g03260

OsARF23 Gramene: LOC_Os11g32110

OsARF23 Araport: LOC_Os11g32110

OsARF7 Gramene: LOC_Os02g35140

OsARF7 Araport: LOC_Os02g35140

OsARF8 Gramene: LOC_Os02g41800

OsARF8 Araport: LOC_Os02g41800

OsARF4 Gramene: LOC_Os01g70270

OsARF4 Araport: LOC_Os01g70270

OsTAR2 Gramene: LOC_Os01g07500

OsTAR2 Araport: LOC_Os01g07500
==== Refs
References

Alarcón MV , LloretPG, SalgueroJ. Synergistic action of auxin and ethylene on root elongation inhibition is caused by a reduction of epidermal cell length. Plant Signal Behav. 2014:9 (3 ):e28361. 10.4161/psb.28361 24598313
Bart R , ChernM, ParkC-J, BartleyL, RonaldPC. A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts. Plant Methods. 2006:2 (1 ):13. 10.1186/1746-4811-2-13 16808845
Baskin TI , JensenOE. On the role of stress anisotropy in the growth of stems. J Exp Bot. 2013:64 (15 ):4697–4707. 10.1093/jxb/ert176 23913952
Bian H , XieY, GuoF, HanN, MaS, ZengZ, WangJ, YangY, ZhuM. Distinctive expression patterns and roles of the miRNA393/TIR1 homolog module in regulating flag leaf inclination and primary and crown root growth in rice (Oryza sativa). New Phytol. 2012:196 (1 ):149–161. 10.1111/j.1469-8137.2012.04248.x 22846038
Binder BM . Ethylene signaling in plants. J Biol Chem. 2020:295 (22 ):7710–7725. 10.1074/jbc.REV120.010854 32332098
Cavalier DM , KeegstraK. Two xyloglucan xylosyltransferases catalyze the addition of multiple xylosyl residues to cellohexaose. J Biol Chem. 2006:281 (45 ):34197–34207. 10.1074/jbc.M606379200 16982611
Cavalier DM , LerouxelO, NeumetzlerL, YamauchiK, ReineckeA, FreshourG, ZabotinaOA, HahnMG, BurgertI, PaulyM, et al Disrupting two Arabidopsis thaliana xylosyltransferase genes results in plants deficient in xyloglucan, a major primary cell wall component. Plant Cell. 2008:20 (6 ):1519–1537. 10.1105/tpc.108.059873 18544630
Chen H , MaB, ZhouY, HeS-J, TangS-Y, LuX, XieQ, ChenS-Y, ZhangJ-S. E3 ubiquitin ligase SOR1 regulates ethylene response in rice root by modulating stability of aux/IAA protein. Proc Natl Acad Sci USA. 2018:115 (17 ):4513–4518. 10.1073/pnas.1719387115 29632179
Cocuron J-C , LerouxelO, DrakakakiG, AlonsoAP, LiepmanAH, KeegstraK, RaikhelN, WilkersonCG. A gene from the cellulose synthase-like C family encodes a beta-1,4 glucan synthase. Proc Natl Acad Sci USA. 2007:104 (20 ):8550–8555. 10.1073/pnas.0703133104 17488821
Cosgrove DJ . How do plant cell walls extend? Plant Physiol. 1993:102 (1 ):1–6. 10.1104/pp.102.1.1 11536544
Cosgrove DJ . Plant cell enlargement and the action of expansins. Bioessays. 1996:18 (7 ):533–540. 10.1002/bies.950180704 8757932
Cosgrove DJ . Assembly and enlargement of the primary cell wall in plants. Annu Rev Cell Dev Biol. 1997:13 (1 ):171–201. 10.1146/annurev.cellbio.13.1.171 9442872
Cosgrove DJ . Wall structure and wall loosening. A look backwards and forwards. Plant Physiol. 2001:125 (1 ):131–134. 10.1104/pp.125.1.131 11154315
Cosgrove DJ . Plant cell growth and elongation. eLS. Chichester: John Wiley & Sons, Ltd; 2014. p. 1–12.
Cosgrove DJ . Plant cell wall extensibility: connecting plant cell growth with cell wall structure, mechanics, and the action of wall-modifying enzymes. J Exp Bot. 2016:67 (2 ):463–476. 10.1093/jxb/erv511 26608646
Cosgrove DJ . Diffuse growth of plant cell walls. Plant Physiol. 2018:176 (1 ):16–27. 10.1104/pp.17.01541 29138349
Didi V , JacksonP, HejátkoJ. Hormonal regulation of secondary cell wall formation. J Exp Bot. 2015:66 (16 ):5015–5027. 10.1093/jxb/erv222 26002972
Donaldson LA , KnoxJP. Localization of cell wall polysaccharides in normal and compression wood of radiata pine: relationships with lignification and microfibril orientation. Plant Physiol. 2012:158 (2 ):642–653. 10.1104/pp.111.184036 22147521
Dwivany FM , YuliaD, BurtonRA, ShirleyNJ, WilsonSM, FincherGB, BacicA, NewbiginE, DoblinMS. The CELLULOSE-SYNTHASE LIKE C (CSLC) family of barley includes members that are integral membrane proteins targeted to the plasma membrane. Mol Plant. 2009:2 (5 ):1025–1039. 10.1093/mp/ssp064 19825677
Faik A , PriceNJ, RaikhelNV, KeegstraK. An Arabidopsis gene encoding an alpha-xylosyltransferase involved in xyloglucan biosynthesis. Proc Natl Acad Sci USA. 2002:99 (11 ):7797–7802. 10.1073/pnas.102644799 12032363
Fry SC . The structure and functions of xyloglucan. J Exp Bot. 1989a:40 (1 ):1–11. 10.1093/jxb/40.1.1
Fry SC . Cellulases, hemicelluloses and auxin-stimulated growth: a possible relationship. Physiol Plantarum. 1989b:75 (4 ):532–536. 10.1111/j.1399-3054.1989.tb05620.x
Fry SC , MillerJG. Toward a working model of the growing plant-cell wall-phenolic cross-linking reactions in the primary-cell walls of dicotyledons. In: LewisNG, PaiceMG, editors. Plant cell wall polymers. Washington (DC): ACS Publications; 1989. p. 33–46.
Guzman P , EckerJR. Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell. 1990:2 (6 ):513–523. 10.1105/tpc.2.6.513 2152173
Hanus J , MazeauK. The xyloglucan-cellulose assembly at the atomic scale. Biopolymers. 2006:82 (1 ):59–73. 10.1002/bip.20460 16453275
Hara Y , YokoyamaR, OsakabeK, TokiS, NishitaniK. Function of xyloglucan endotransglucosylase/hydrolases in rice. Ann Bot. 2014:114 (6 ):1309–1318. 10.1093/aob/mct292 24363334
Hayashi T , MarsdenMP, DelmerDP. Pea xyloglucan and cellulose: VI. Xyloglucan-cellulose interactions in vitro and in vivo. Plant Physiol. 1987:83 (2 ):384–389. 10.1104/pp.83.2.384 16665254
Hayashi T , TakedaT, OgawaK, MitsuishiY. Effects of the degree of polymerization on the binding of xyloglucans to cellulose. Plant Cell Physiol. 1994:35 :893–899. 10.1093/oxfordjournals.pcp.a078674 7981962
Hepler PK , RoundsCM, WinshipLJ. Control of cell wall extensibility during pollen tube growth. Mol Plant. 2013:6 (4 ):998–1017. 10.1093/mp/sst103 23770837
Hu H , ZhangR, FengS, WangY, WangY, FanC, LiY, LiuZ, SchneiderR, XiaT, et al Three AtCesA6-like members enhance biomass production by distinctively promoting cell growth in Arabidopsis. Plant Biotechnol J. 2018a:16 (5 ):976–988. 10.1111/pbi.12842 28944540
Hu H , ZhangR, TaoZ, LiX, LiY, HuangJ, LiX, HanX, FengS, ZhangG, et al Cellulose synthase mutants distinctively affect cell growth and cell wall integrity for plant biomass production in Arabidopsis. Plant Cell Physiol. 2018b:59 (6 ):1144–1157. 10.1093/pcp/pcy050 29514326
Huang Y-H , HanJ-Q, MaB, CaoW-Q, LiX-K, XiongQ, ZhaoH, ZhaoR, ZhangX, ZhouY, et al A translational regulator MHZ9 modulates ethylene signaling in rice. Nat Commun. 2023:14 (1 ):4674. 10.1038/s41467-023-40429-0 37542048
Huang DW , ShermanBT, LempickiRA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009a:4 (1 ):44–57. 10.1038/nprot.2008.211 19131956
Huang DW , ShermanBT, LempickiRA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009b:37 (1 ):1–13. 10.1093/nar/gkn923 19033363
Hussey SG , MizrachiE, CreuxNM, MyburgAA. Navigating the transcriptional roadmap regulating plant secondary cell wall deposition. Front Plant Sci. 2013:4 :325. 10.3389/fpls.2013.00325 24009617
Jarvis MC . Cellulose biosynthesis: counting the chains. Plant Physiol. 2013:163 (4 ):1485–1486. 10.1104/pp.113.231092 24296786
Kamiya N , NagasakiH, MorikamiA, SatoY, MatsuokaM. Isolation and characterization of a rice WUSCHEL-type homeobox gene that is specifically expressed in the central cells of a quiescent center in the root apical meristem. Plant J. 2003:35 (4 ):429–441. 10.1046/j.1365-313X.2003.01816.x 12904206
Kim S-J , ChandrasekarB, ReaAC, DanhofL, Zemelis-DurfeeS, ThrowerN, ShepardZS, PaulyM, BrandizziF, KeegstraK. The synthesis of xyloglucan, an abundant plant cell wall polysaccharide, requires CSLC function. Proc Natl Acad Sci USA. 2020:117 (33 ):20316–20324. 10.1073/pnas.2007245117 32737163
Kotogany E , DuditsD, HorvathGV, AyaydinF. A rapid and robust assay for detection of S-phase cell cycle progression in plant cells and tissues by using ethynyl deoxyuridine. Plant Methods. 2010:6 (1 ):5. 10.1186/1746-4811-6-5 20181034
Li W , MaM, FengY, LiH, WangY, MaY, LiM, AnF, GuoH. EIN2-directed translational regulation of ethylene signaling in Arabidopsis. Cell. 2015:163 (3 ):670–683. 10.1016/j.cell.2015.09.037 26496607
Liu L , PaulitzJ, PaulyM. The presence of fucogalactoxyloglucan and its synthesis in rice indicates conserved functional importance in plants. Plant Physiol. 2015:168 (2 ):549–560. 10.1104/pp.15.00441 25869654
Lockhart JA . An analysis of irreversible plant cell elongation. J Theor Biol. 1965:8 (2 ):264–275. 10.1016/0022-5193(65)90077-9 5876240
Lopez M , BizotH, ChambatG, MaraisM-F, ZykwinskaA, RaletM-C, DriguezH, BuleonA. Enthalpic studies of xyloglucan-cellulose interactions. Biomacromolecules. 2010:11 (6 ):1417–1428. 10.1021/bm1002762 20433133
Ma B , HeS-J, DuanK-X, YinC-C, ChenH, YangC, XiongQ, SongQ-X, LuX, ChenH-W, et al Identification of rice ethylene-response mutants and characterization of MHZ7/OsEIN2 in distinct ethylene response and yield trait regulation. Mol Plant. 2013:6 (6 ):1830–1848. 10.1093/mp/sst087 23718947
Ma B , YinC-C, HeS-J, LuX, ZhangW-K, LuT-G, ChenS-Y, ZhangJ-S. Ethylene-induced inhibition of root growth requires abscisic acid function in rice (Oryza sativa L.) seedlings. PLoS Genet. 2014:10 (10 ):e1004701. 10.1371/journal.pgen.1004701 25330236
Ma B , ZhouY, ChenH, HeS-J, HuangY-H, ZhaoH, LuX, ZhangW-K, PangJ-H, ChenS-Y, et al Membrane protein MHZ3 stabilizes OsEIN2 in rice by interacting with its Nramp-like domain. Proc Natl Acad Sci USA. 2018:115 (10 ):2520–2525. 10.1073/pnas.1718377115 29463697
Mccann MC , WellsB, RobertsK. Direct visualization of cross-links in the primary plant cell wall. J Cell Sci. 1990:96 (2 ):323–334. 10.1242/jcs.96.2.323
McNeil M , DarvillAG, FrySC, AlbersheimP. Structure and function of the primary cell walls of plants. Annu Rev Biochem. 1984:53 (1 ):625–663. 10.1146/annurev.bi.53.070184.003205 6383202
Merchante C , AlonsoJM, StepanovaAN. Ethylene signaling: simple ligand, complex regulation. Curr Opin Plant Biol. 2013:16 (5 ):554–560. 10.1016/j.pbi.2013.08.001 24012247
Merchante C , BrumosJ, YunJ, HuQ, SpencerKR, EnriquezP, BinderBM, HeberS, StepanovaAN, AlonsoJM. Gene-specific translation regulation mediated by the hormone-signaling molecule EIN2. Cell. 2015:163 (3 ):684–697. 10.1016/j.cell.2015.09.036 26496608
Nishitani K . The role of endoxyloglucan transferase in the organization of plant cell walls. Int Rev Cytol. 1997:173 :157–206. 10.1016/S0074-7696(08)62477-8 9127953
Park YB , CosgroveDJ. Changes in cell wall biomechanical properties in the xyloglucan-deficient xxt1/xxt2 mutant of Arabidopsis. Plant Physiol. 2012a:158 (1 ):465–475. 10.1104/pp.111.189779 22108526
Park YB , CosgroveDJ. A revised architecture of primary cell walls based on biomechanical changes induced by substrate-specific endoglucanases. Plant Physiol. 2012b:158 (4 ):1933–1943. 10.1104/pp.111.192880 22362871
Pauly M , AlbersheimP, DarvillA, YorkWS. Molecular domains of the cellulose/xyloglucan network in the cell walls of higher plants. Plant J. 1999a:20 (6 ):629–639. 10.1046/j.1365-313X.1999.00630.x 10652135
Pauly M , AndersenLN, KauppinenS, KofodLV, YorkWS, AlbersheimP, DarvillA. A xyloglucan-specific endo-beta-1,4-glucanase from Aspergillus aculeatus: expression cloning in yeast, purification and characterization of the recombinant enzyme. Glycobiology. 1999b:9 (1 ):93–100. 10.1093/glycob/9.1.93 9884411
Pidatala VR , MahboubiA, MortimerJC. Structural characterization of mannan cell wall polysaccharides in plants using PACE. J Vis Exp. 2017:128 :e56424. 10.3791/56424
Plumb RS , JohnsonKA, RainvilleP, SmithBW, WilsonID, Castro-PerezJM, NicholsonJK. UPLC/MSE; a new approach for generating molecular fragment information for biomarker structure elucidation. Rapid Commun Mass Spectrom. 2006:20 (13 ):1989–1994. 10.1002/rcm.2550 16755610
Qin H , ZhangZ, WangJ, ChenX, WeiP, HuangR. The activation of OsEIL1 on YUC8 transcription and auxin biosynthesis is required for ethylene-inhibited root elongation in rice early seedling development. PLoS Genet. 2017:13 (8 ):e1006955. 10.1371/journal.pgen.1006955 28829777
Ray PM , GreenPB, ClelandR. Role of turgor in plant cell growth. Nature. 1972:239 (5368 ):163–164. 10.1038/239163a0
Rose JKC , BraamJ, FrySC, NishitaniK. The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: current perspectives and a new unifying nomenclature. Plant Cell Physiol. 2002:43 (12 ):1421–1435. 10.1093/pcp/pcf171 12514239
Saint-Jore-Dupas C , NebenführA, BoulaflousA, Follet-GueyeM-L, PlassonC, HawesC, DriouichA, FayeL, GomordV. Plant N-glycan processing enzymes employ different targeting mechanisms for their spatial arrangement along the secretory pathway. Plant Cell. 2006:18 (11 ):3182–3200. 10.1105/tpc.105.036400 17138701
Sakamoto S , SomssichM, NakataMT, UndaF, AtsuzawaK, KanekoY, WangT, BågmanA-M, GaudinierA, YoshidaK, et al Complete substitution of a secondary cell wall with a primary cell wall in Arabidopsis. Nat Plants. 2018:4 (10 ):777–783. 10.1038/s41477-018-0260-4 30287954
Salic A , MitchisonTJ. A chemical method for fast and sensitive detection of DNA synthesis in vivo. Proc Natl Acad Sci USA. 2008:105 (7 ):2415–2420. 10.1073/pnas.0712168105 18272492
Sandhu APS , RandhawaGS, DhuggaKS. Plant cell wall matrix polysaccharide biosynthesis. Mol Plant. 2009:2 (5 ):840–850. 10.1093/mp/ssp056 19825661
Saxena IM , BrownRMJr. Cellulose biosynthesis: current views and evolving concepts. Ann Bot. 2005:96 (1 ):9–21. 10.1093/aob/mci155 15894551
Scheller HV , UlvskovP. Hemicelluloses. Annu Rev Plant Biol. 2010:61 (1 ):263–289. 10.1146/annurev-arplant-042809-112315 20192742
Schneider CA , RasbandWS, EliceiriKW. NIH image to ImageJ: 25 years of image analysis. Nat Methods. 2012:9 (7 ):671–675. 10.1038/nmeth.2089 22930834
Sieberer BJ , KetelaarT, EsselingJJ, EmonsAMC. Microtubules guide root hair tip growth. New Phytol. 2005:167 (3 ):711–719. 10.1111/j.1469-8137.2005.01506.x 16101908
Somerville C , BauerS, BrininstoolG, FacetteM, HamannT, MilneJ, OsborneE, ParedezA, PerssonS, RaabT, et al Toward a systems approach to understanding plant cell walls. Science. 2004:306 (5705 ):2206–2211. 10.1126/science.1102765 15618507
Staehelin LA . Cell wall. Chicago: Encyclopædia Britannica, Inc; 2019.
Taylor NG . Cellulose biosynthesis and deposition in higher plants. New Phytol. 2008:178 (2 ):239–252. 10.1111/j.1469-8137.2008.02385.x 18298430
van den Berg C , WillemsenV, HendriksG, WeisbeekP, ScheresB. Short-range control of cell differentiation in the Arabidopsis root meristem. Nature. 1997:390 (6657 ):287–289. 10.1038/36856 9384380
Verbelen J-P , De CnodderT, LeJ, VissenbergK, BaluskaF. The root apex of Arabidopsis thaliana consists of four distinct zones of growth activities: meristematic zone, transition zone, fast elongation zone and growth terminating zone. Plant Signal Behav. 2006:1 (6 ):296–304. 10.4161/psb.1.6.3511 19517000
Walter W , Sanchez-CaboF, RicoteM. GOplot: an R package for visually combining expression data with functional analysis. Bioinformatics. 2015:31 (17 ):2912–2914. 10.1093/bioinformatics/btv300 25964631
Wang L , GuoK, LiY, TuY, HuH, WangB, CuiX, PengL. Expression profiling and integrative analysis of the CESA/CSL superfamily in rice. Bmc Plant Biol. 2010:10 (1 ):282. 10.1186/1471-2229-10-282 21167079
Wang C , LiS, NgS, ZhangB, ZhouY, WhelanJ, WuP, ShouH. Mutation in xyloglucan 6-xylosytransferase results in abnormal root hair development in Oryza sativa. J Exp Bot. 2014:65 (15 ):4149–4157. 10.1093/jxb/eru189 24834920
Wang D , PeiK, FuY, SunZ, LiS, LiuH, TangK, HanB, TaoY. Genome-wide analysis of the auxin response factors (ARF) gene family in rice (Oryza sativa). Gene. 2007:394 (1-2 ):13–24. 10.1016/j.gene.2007.01.006 17408882
Wang H , YangH, WenZ, GaoC, GaoY, TianY, XuZ, LiuX, PerssonS, ZhangB, et al Xylan-based nanocompartments orchestrate plant vessel wall patterning. Nat Plants. 2022:8 (3 ):295–306. 10.1038/s41477-022-01113-1 35318447
Xia K , WangR, OuX, FangZ, TianC, DuanJ, WangY, ZhangM. OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One. 2012:7 :364–373. 10.1371/journal.pone.0030039
Xiong G , LiR, QianQ, SongX, LiuX, YuY, ZengD, WanJ, LiJ, ZhouY. The rice dynamin-related protein DRP2B mediates membrane trafficking, and thereby plays a critical role in secondary cell wall cellulose biosynthesis. Plant J. 2010:64 (1 ):56–70. 10.1111/j.1365-313X.2010.04308.x 20663087
Xiong Q , MaB, LuX, HuangY-H, HeS-J, YangC, YinC-C, ZhaoH, ZhouY, ZhangW-K, et al Ethylene-inhibited jasmonic acid biosynthesis promotes mesocotyl/coleoptile elongation of etiolated rice seedlings. Plant Cell. 2017:29 (5 ):1053–1072. 10.1105/tpc.16.00981 28465411
Yang C , MaB, HeS-J, XiongQ, DuanK-X, YinC-C, ChenH, LuX, ChenS-Y, ZhangJ-S. MAOHUZI6/ETHYLENE INSENSITIVE3-LIKE1 and ETHYLENE INSENSITIVE3-LIKE2 regulate ethylene response of roots and coleoptiles and negatively affect salt tolerance in rice. Plant Physiol. 2015:169 (1 ):148–165. 10.1104/pp.15.00353 25995326
Yin C-C , MaB, CollingeDP, PogsonBJ, HeS-J, XiongQ, DuanK-X, ChenH, YangC, LuX, et al Ethylene responses in rice roots and coleoptiles are differentially regulated by a carotenoid isomerase-mediated abscisic acid pathway. Plant Cell. 2015:27 (4 ):1061–1081. 10.1105/tpc.15.00080 25841037
Yokoyama R , RoseJKC, NishitaniK. A surprising diversity and abundance of xyloglucan endotransglucosylase/hydrolases in rice. Classification and expression analysis. Plant Physiol. 2004:134 (3 ):1088–1099. 10.1104/pp.103.035261 14988479
Zhang J , ChenY, LuJ, ZhangY, WenC-K. Uncertainty of EIN2Ser645/Ser924 inactivation by CTR1-mediated phosphorylation reveals the complexity of ethylene signaling. Plant Commun. 2020:1 (3 ):100046. 10.1016/j.xplc.2020.100046 33367241
Zhang B , GaoY, ZhangL, ZhouY. The plant cell wall: biosynthesis, construction, and functions. J Integr Plant Biol. 2021:63 (1 ):251–272. 10.1111/jipb.13055 33325153
Zhang F , QiB, WangL, ZhaoB, RodeS, RigganND, EckerJR, QiaoH. EIN2-dependent regulation of acetylation of histone H3K14 and non-canonical histone H3K23 in ethylene signalling. Nat Commun. 2016:7 (1 ):13018. 10.1038/ncomms13018 27694846
Zhang F , WangL, QiB, ZhaoB, KoEE, RigganND, ChinK, QiaoH. EIN2 mediates direct regulation of histone acetylation in the ethylene response. Proc Natl Acad Sci USA. 2017:114 (38 ):10274–10279. 10.1073/pnas.1707937114 28874528
Zhao H , DuanK-X, MaB, YinC-C, HuY, TaoJ-J, HuangY-H, CaoW-Q, ChenH, YangC, et al Histidine kinase MHZ1/OsHK1 interacts with ethylene receptors to regulate root growth in rice. Nat Commun. 2020a:11 (1 ):518. 10.1038/s41467-020-14313-0 31980616
Zhao H , MaB, DuanK-X, LiX-K, LuX, YinC-C, TaoJ-J, WW, ZhangW-K, XinP-Y, et al The GDSL lipase MHZ11 modulates ethylene signaling in rice roots. Plant Cell. 2020b:32 (5 ):1626–1643. 10.1105/tpc.19.00840 32184349
Zhao H , YinC-C, MaB, ChenS-Y, ZhangJ-S. Ethylene signaling in rice and Arabidopsis: new regulators and mechanisms. J Integr Plant Biol. 2021:63 (1 ):102–125. 10.1111/jipb.13028 33095478
Zheng Y , WangX, ChenY, WagnerE, CosgroveDJ. Xyloglucan in the primary cell wall: assessment by FESEM, selective enzyme digestions and nanogold affinity tags. Plant J. 2018:93 (2 ):211–226. 10.1111/tpj.13778 29160933
Zhong R , YeZ-H. Regulation of cell wall biosynthesis. Curr Opin Plant Biol. 2007:10 (6 ):564–572. 10.1016/j.pbi.2007.09.001 17950657
Zhong R , YeZ-H. Complexity of the transcriptional network controlling secondary wall biosynthesis. Plant Sci. 2014:229 :193–207. 10.1016/j.plantsci.2014.09.009 25443846
Zhou Y , MaB, TaoJ-J, YinC-C, HuY, HuangY-H, WeiW, XinP-Y, ChuJ-F, ZhangW-K, et al Rice EIL1 interacts with OsIAAs to regulate auxin biosynthesis mediated by the tryptophan aminotransferase MHZ10/OsTAR2 during root ethylene responses. Plant Cell. 2022:34 (11 ):4366–4387. 10.1093/plcell/koac250 35972379
Zhou Y , XiongQ, YinC-C, MaB, ChenS-Y, ZhangJ-S. Ethylene biosynthesis, signaling, and crosstalk with other hormones in rice. Small Methods. 2020:4 (8 ):1900278. 10.1002/smtd.201900278
Zhu XF , ShiYZ, LeiGJ, FrySC, ZhangBC, ZhouYH, BraamJ, JiangT, XuXY, MaoCZ, et al XTH31, encoding an in vitro XEH/XET-active enzyme, regulates aluminum sensitivity by modulating in vivo XET action, cell wall xyloglucan content, and aluminum binding capacity in Arabidopsis. Plant Cell. 2012:24 (11 ):4731–4747. 10.1105/tpc.112.106039 23204407
