
==== Front
Channels (Austin)
Channels (Austin)
Channels
1933-6950
1933-6969
Taylor & Francis

39212541
10.1080/19336950.2024.2396339
2396339
Version of Record
Research Article
Research Article
Novel benzoylurea derivative decreases TRPM7 channel function and inhibits cancer cells migration
X. ZHANG ET AL.
CHANNELS
https://orcid.org/0009-0000-4872-222X
Zhang Xiaoding a
Zong Rui a
Han Yu b
Li Xiaoming c
Liu Shuangyu a
Cao Yixue a
Jiang Nan a
Chen Pingping d
Gao Haixia a *
a Department of Pharmacology, Center for Innovative Drug Research and Evaluation, Institute of Medical Science and Health, The Hebei Collaboration Innovation Center for Mechanism, Diagnosis and Treatment of Neurological and Psychiatric Disease, The Key Laboratory of Neural and Vascular Biology, Ministry of Education, Hebei Medical University , Shijiazhuang, Hebei, China
b Department of Pharmacy, Hebei Children’s Hospital , Shijiazhuang, Hebei, China
c Department of Pharmacy, Hebei General Hospital , Shijiazhuang, Hebei, China
d The Department of Pharmacology, Hebei University of Chinese Medicine , Shijiazhuang, Hebei, China
CONTACT Pingping Chen chenpp@hebcm.edu.cn
Haixia Gao gaohx686@hebmu.edu.cn
* Haixia Gao will handle correspondence at all stages of refereeing, publication, and post-publication.

30 8 2024
2024
30 8 2024
18 1 2396339Integra30 8 2024
Integra30 8 2024
18 3 2024
16 8 2024
20 8 2024
© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
2024
The Author(s)
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent.

ABSTRACT

The transient receptor potential melastatin 7 channel (TRPM7) is a nonselective cation channel highly expressed in some human cancer tissues. TRPM7 is involved in the proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) of cancer cells. Modulation of TRPM7 could be a promising therapeutic strategy for treating cancer; however, efficient and selective pharmacological TRPM7 modulators are lacking. In this study we investigated N- [4- (4, 6-dimethyl- 2-pyrimidinyloxy) − 3- methylphenyl] -N’ - [2 -(dimethylamino)] benzoylurea (SUD), a newly synthesized benzoylurea derivative, for its effects on cancer cell migration and EMT and on functional expression of TRPM7. Our previous studies showed that SUD induces cell cycle arrest and apoptosis of MCF-7 and BGC-823 cells (human breast cancer and gastric cancer cell lines, respectively). Here, we show that SUD significantly decreased the migration of both types of cancer cells. Moreover, SUD decreased vimentin expression and increased E-cadherin expression in both cell types, indicating that EMT is also decreased by SUD. Importantly, SUD potentially reduced the TRPM7-like current in a concentration-dependent manner and decreased TRPM7 expression through the PI3K/Akt signaling pathway. Finally, molecular docking simulations were used to investigate potential SUD binding sites on TRPM7. In summary, our research demonstrated that SUD is an effective TRPM7 inhibitor and a potential agent to suppress the metastasis of breast and gastric cancer by inhibiting TRPM7 expression and function.

KEYWORDS

SUD
TRPM7
EMT
migration
cancer
Central Guiding Local Science and Technology Development Fund Project 236Z7723G Hebei Natural Science Foundation H2022206515 Hebei Natural Science Foundation H2022423364 National Youth Science Foundation 10.13039/100007515 81201642 National Natural Science Foundation of China 10.13039/501100001809 81871027 This work was supported by grants from the Central Guiding Local Science and Technology Development Fund Project [236Z7723G] to Haixia Gao, Hebei Natural Science Foundation [H2022206515] to Haixia Gao, Hebei Natural Science Foundation [H2022423364] to Pingping Chen, National Youth Science Foundation Project of China [81201642] to Haixia Gao, and National Natural Science Foundation of China [81871027] to Haixia Gao.
==== Body
pmcIntroduction

Metastasis, a fundamental characteristic of malignant neoplasms, is responsible for most cancer-related fatalities [1], and the invasion and migration capabilities of cancer cells are crucial determinants of this process. Prior investigations have established the significance of the ubiquitous second messenger Ca2+ in facilitating migration, invasion, angiogenesis, and proliferation of cancer cells [2–4]. TRPM7 is a nonselective cation channel permeable to divalent cations, such as Ca2+ and Mg2+; in addition, TRPM7 also contains an intracellular alpha-kinase domain [5,6]. TRPM7 has been found to be highly expressed in various types of cancer tissues and cell lines; it regulates proliferation, migration, and invasion of lung [3], gastric [7] and breast cancer [8] cells. Previous studies demonstrated that the up-regulation of TRPM7 promotes [3,9], whereas the down-regulation inhibits cancer cells migration [10–12]. The overexpression of epidermal growth factor receptor (EGFR) in certain cancer cells is thought to play a crucial role in invasion and metastasis [13]. Our previous findings demonstrated that epidermal growth factor (EGF) greatly enhanced the migration of A549 cells by increasing TRPM7 expression [3].

The cytoskeleton fulfills different changing needs through self-assembly to different shapes [14]. Actin filaments support filopodial protrusions, which are involved in chemotaxis (directed movement along a chemical gradient) and cell–cell communication [14]. EMT plays an important role in tumor metastasis. During EMT, there is a decrease in cell adhesion, an alteration in cytoskeleton expression, and a shift of cells from an epithelial to a mesenchymal phenotype [15]. Mesenchymal cells are distinguished from epithelial cells by their irregular morphology, with an elongated, spindle-shaped form and less rigid topography [16]. Monitoring the expression of EMT-related proteins and changes in the cytoskeleton is crucial for determining whether cells are undergoing the EMT process.

The PI3K/Akt pathway, which is frequently activated in human cancers [17], alters cellular metabolism by enhancing the functions of nutrient transporters and metabolic enzymes, thereby facilitating the anabolic requirements of abnormally proliferating cells. Several studies have established that modulation of TRPM7 by the PI3K/AKT signaling pathway is an important mechanism for controlling the proliferation and migration of cancer cells [2,4,18].

N- [4- (4, 6-dimethyl- 2-pyrimidinyloxy) − 3-methylphenyl] -N’ - [2 -(dimethylamino)] benzoylurea (SUD) is a novel synthetic benzoylurea derivative, which has been shown to possess anticancer properties in vivo and in vitro [19,20]. We recently found that SUD significantly inhibited the proliferation of human cancer cells, including the breast cancer cell line MCF-7 and gastric cancer cell line BGC-823, in a time- and concentration-dependent manner [20]. However, the underlying mechanism or potential effects of SUD on other cancer cell properties, such as migration, remain unclear. This study employed wound healing and transwell assays, electrophysiology, confocal microscopy, western blotting, and quantitative polymerase chain reaction (Q-PCR) to examine the impact of SUD on the migration of breast and gastric cancer cells and to elucidate the underlying mechanisms involved. These results indicate that SUD is a potential TRPM7 inhibitor that reduces cancer cell migration by decreasing TRPM7 function.

Materials and methods

Reagents and chemicals

Antibodies for E-cadherin (Cat No.: 3195) and Vimentin (Cat No.: 5741) were from Cell Signaling Technology (USA); TRPM7 (Cat No.: DF7513) and β-actin (Cat No.: AF7018) were from Affinity Biosciences Ltd. (USA). Primers for TRPM7, AKT1, PI3K and β-actin were from Sangon Biotech (Shanghai) Co., Ltd. (PR. China). Fetal bovine serum (FBS), Roswell Park Memorial Institute (RPMI) 1640 medium, penicillin, streptomycin, and other necessary substances were from Thermo Fisher Scientific Inc. (USA). SUD was synthesized in-house by the Department of Pharmaceutical Chemistry, Hebei Medical University; 2-Amino- 6-chloro- α- cyano-3- (ethoxycarbonyl)- 4 H–1- benzopyran-4-acetic Acid Ethyl Ester (SC79) was acquired from Tocris Biosciences (USA) and used at a final concentration of 4 μg/mL. All chemicals were dissolved in DMSO, and the final concentration of DMSO was maintained below 0.1%.

Cell culture

The human breast cancer cell line MCF-7 and human gastric cancer cell line BGC-823 (both provided by the Institute of Cell Biology, Chinese Academy of Sciences) were cultured in RPMI1640 medium with 10% (v/v) FBS, penicillin (100 U/mL), and streptomycin (100 mg/mL) at 37°C in a moisture-saturated atmosphere containing 5% CO2.

Wound healing assay

MCF-7 and BGC-823 cells (1.0 × 105) were seeded in 24-well cell culture plates and cultured overnight to form a monolayer. A pipette tip (10 μL) was used to scratch the midline of the culture well, and the cells were washed twice with phosphate-buffered saline (PBS). All cells were cultured in a medium containing 2% fetal bovine serum, and the experimental groups were treated with SUD, EGF (100 ng/ml), or both. A phase-contrast microscope (Olympus 1X71, Japan; ×20 objective) was used to image the same visual field of the cell culture at 0 and 48 h. The edges of the cell culture removed by the scratching were manually demarcated. Change in the wound area was measured manually over time using ImageJ, and the cell migration rate was calculated as (48 h-0 h)/0 h.

Transwell chamber migration assay

MCF-7 and BGC-823 cells were randomly divided into four groups, each of which was cultured for 48 hours in medium containing different stimuli. Then, 200 μL of serum-free medium containing 1.0 × 104 cells was added to the transwell chamber (Corning, USA). Complete medium (500 μl) was added to the bottom of the chambers to induce cell migration. After 48 hours, the cells that traversed the membrane were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet ammonium oxalate solution. A phase contrast microscope (Olympus 1X71, Japan; × 20 objective) was used to image the upper, middle, lower, left, and right regions of the Transwell chamber (starting from the bottom). ImageJ was used to count the number of cells in each region and calculate the average for statistical analysis.

F-actin staining

Cells were seeded onto glass slides in a 24-well plate at 1.0 × 104 per well and treated with control medium or medium containing SUD, EGF (100 ng/ml), or both for 48 hours. Cells were then fixed with 4% paraformaldehyde for 10 minutes, washed twice with PBS and incubated in 0.1% Triton X-100 for 30 minutes. Cells were then washed with PBS again and incubate with phalloidin (Cat No.: BMD0082. Abbkine Scientific Co.,Ltd. PR. China) for 30 minutes to promote F-actin staining. After further wash (PBS; twice) cells were incubated with Dapi (in PBS, 5 ug/mL, D9542, Sigma, USA) for 10 minutes. Zeiss LSM 900 (Germany) confocal microscop was used for imaging. Cellpose ImageJ plugin was used to automatically segment the boundaries of cells; length-to-width ratio of each cell was measured using ImajeJ; an automatic analysis ImageJ plagin was used to measure the average grayscale value of the area occupied by cells (as defined by the Cellpose plugin).

Quantitative real-time PCR (qRT-pcr)

Following different treatments for 48 h, total RNA was extracted from the cell culture using ISOGEN reagent (Nippon Gene Co. Ltd., Tokyo, Japan). The concentration and purity of RNA were assessed by spectrophotometry at 260 nm. Subsequently, 1 µg of total RNA was converted into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., USA). Real-time fluorescence quantitative PCR was conducted using a Real-Time PCR system (Bioer Co. Ltd., Tokyo, Japan). Relative quantification of the target gene expression for each sample was performed using the 2−ΔΔCt method. Primer pairs are shown in the Table 1.Table 1. PCR primer sequences.

Gene	Primer sequence	
β-actin	Primer F: TGACGTGGACATCCGCAAAG	
Primer R: CTGGAAGGTGGACAGCGAGG	
AKT1	Primer F: GTGACCATGAACGAGTTTGAGT	
Primer R: CGTACTCCATGACAAAGCAGAG	
PI3K	Primer F: GGCAATGGAAAAGCTCATTAAC	
Primer R: GTTCTCCCAATTCAACCACAGT	
TRPM7	Primer F: CCTCCCTACCTCACACAAGAAG	
Primer R: AGACCTGATTGGCACTTTCACT	

Western blot

Following exposure to varying concentrations of SUD for 48 h, the cells were washed twice with PBS (Thermo Fisher Scientific Inc., USA) and lysed on ice for 30 minutes, and then centrifugation at 13,400 g for 10 minutes at 4°C. An ND-1000 Spectrophotometer (NanoDrop, Wilmington, Delaware, USA) was used to measure protein concentrations in cell lysates. Proteins that were denatured by equal amounts of heat were separated by SDS polyacrylamide gel electrophoresis and then transferred onto PVDF membranes (Millipore, Bedford, Massachusetts, USA). The membranes were blocked in 5% milk at ambient temperature for 2 h, followed by overnight incubation with primary antibodies at 4°C, and a 2-hour incubation with secondary antibodies at 37°C. After washing with TBST (T1086, Solarbio, China), place the PVDF membranes in Western LightningTM Chemiluminescence Reagent (NEL10300EA, PerkinElmer, USA) for 30 seconds and then immediately place it in an exposure box. Cover the photosensitive film on the PVDF membranes and expose for 1 minute. Use the Epson Perfection V39 (EPSON, Japen) scanner to scan and image the target bands. Next, Soak the PVDF membrane in a Stripping buffer (SW3020, Solarbio, China) for 30 minutes to clean the antibodies on the PVDF, and then repeat the above steps to obtain the bands of β-actin.

Electrophysiology

The whole-cell currents from MCF-7 and BGC-823 cells were recorded using a Multiclamp 200 B amplifier (Molecular Devices, USA), with the following protocol: cell membrane was held at 0 mV and stimulated with voltage ramps from −120 to +120 mV for 250 ms, repeatedly at 1 s intervals, and sampled at 1 kHz (5 kHz digitized). The recordings were conducted at room temperature. The pipette resistance was 2–3 MΩ when filled with internal solutions. The internal pipette solution contained (mM): 145 cesium methanesulfonate (CsSO3CH3), 8 NaCl, 10 EGTA, and 10 HEPES, with the pH adjusted to 7.2 with CsOH. The extracellular solution for the whole-cell recording contained (mM): 145 NaCl, 5 KCl, 1 CaCl,10 HEPES and 10 glucose, with pH adjusted to 7.4 with NaOH. Only recordings with a pipette-membrane seal resistance of >1 GΩ were included. pClamp 9.2 and Clampfit 9.2 were used for data acquisition and analysis.

The data analysis of the cancer genome atlas (TCGA)

Data were downloaded from the TCGA public database. Cox regression and Kaplan–Meier survival rate analysis were used to analyze the relationship between TRPM7 expression and the overall survival rate of breast cancer and gastric cancer patients. Spearman analysis method was used to analyze the correlation between TRPM7 and AKT1 expression.

Molecular docking analysis

Molecular docking of SUD and TRPM7 was carried out using the CDKCKER module in Discovery Studio 2019. Imported the 3D structure of SUD and used the Small Molecules module to process its structure and minimize energy. Next, we imported the 3D structures of human TRPM7 (Retrieval number: Q96QT4) downloaded from UniProt database and mouse TRPM7 (PDB code: 8SI7) from Protein Data Bank. 8SI7 is the cryo-EM structure in closed state with inhibitor ver155008. In the macromolecular module, Q96QT4 is overlapped with 8SI7, and after modification, it serves as a template to form a complete tetrameric channel. The structure is further optimized by adding hydrogen, repairing missing residues, localizing and hydrating, as well as optimizing the energy. The Receptor–Ligand Interactions module was used to define the active sites with six amino acids, namely T923, L977, A981, M991, T1111, and P1118. The docking mode of CDKCKER was selected to dock SUD with the active pocket under the CHARMm force field. From these results, the model with highest comprehensive score was selected as the most likely binding conformation.

Statistical analysis

The data are reported as mean ± standard error (S.E). Unpaired t-test was used to compare the two groups; one-way ANOVA (with subsequent Bonferroni test) was used for multiple group comparisons; p < 0.05 was considered to be statistically significant. Statistical analyses were conducted using GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA).

Results

SUD inhibits the migration of MCF-7 and BGC-823 cells

We used wound-healing assay (see Methods) to test the effect of SUD on the migration of MCF-7 and BGC-823 cells. For MCF-7 cells, SUD at 0.2 μM and 1 μM significantly decreased the migration area to 27.50 ± 1.95% and 15.16 ± 1.25% from the control value of 51.50 ± 2.32% (vehicle-treated cells). In addition, EGF increased the migration area from 51.50 ± 2.32% to 71.24 ± 2.93%, while SUD decreased the EGF-induced migration to 45.05 ± 2.71% (at 0.2 μM) and to 39.46 ± 2.49%, (at 1 μM) respectively (Figure 1a). Similar results were obtained for BGC-823 cells (Figure 1d). Figure 1. SUD inhibits the migration of MCF-7 and BGC-823 cells. (a) Effects of SUD on migration and egf-stimulated migration of MCF-7 cells examined by wound healing. (b) the migration area% (48 h/0 h) of MCF-7 cells. (c) transwell tests the effect of SUD on migration and egf-stimulated migration in MCF-7 cells. (d) effects of SUD on migration and egf-stimulated migration of BGC-823 cells examined by wound healing. (e) the migration area% (48 h/0 h) of BGC-823 cells. (f) transwell tests the effect of SUD on migration and egf-stimulated migration in BGC-823 cells. *, **, ***, **** and #, ##, ### #### denote significant difference with control group or EGF group, respectively. p<0.05, p<0.01, p<0.001 and p<0.0001, ordinary one-way ANOVA test.

Figure 1 shows the inhibitory effect of SUD on tumor cell migration. A: Typical graphs of wound healing experiment results on MCF-7 cells under different treatments. B: Statistical results of wound healing experiments in MCF-7 cells. Among the six groups, 1μM SUD group has the smallest cell migration area after 48 hours, followed by the 0.2μM SUD group. The EGF group has the largest cell migration area, the cell migration area of the EGF + 0.2μM SUD group and EGF + 1μM SUD group is significantly smaller than that of the EGF group. All results show significant statistical differences. C: Typical graphs of transwell experiment results on MCF-7 cells under different treatments and statistical analysis results. Among the four groups, the 1μM SUD group has the fewest migrating cells after 48 hours, while the EGF group has the highest number of migrating cells. The EGF + 1μM SUD group has fewer migrating cells compared to the EGF group. All results show significant statistical differences. D, E, and F show the effects of SUD on wound healing and transwell experiments in BGC-823 cells. The results were consistent with those in A, B, and C.

Transwell assay was used to further investigate the role of SUD in cell migration. Compared with the control group, EGF significantly increased the number of MCF-7 (Figure 1c) and BGC-823 (Figure 1f) cells that migrated to the other side of the chamber, while SUD reduced the number of migrating cells in both the absence and presence of EGF.

The above findings indicate that SUD exerts a notable inhibitory effect on the migration of MCF-7 and BGC-823 cells while also impeding the stimulatory effect of EGF.

SUD inhibits the EMT of MCF-7 and BGC-823 cells

To determine whether SUD can reduce the migration of cancer cells by affecting EMT we assessed the expression and morphological changes of the cytoskeleton using phalloidin staining to observe F-actin, (see Methods). In MCF-7 cells, compared to the control group, SUD decreased the fluorescence intensity of F-actin and reduced the ratio of cell length to width, and we can see that the connections between cells are tighter. EGF increases the aspect ratio of cells, transforms them into spindle-shaped structures that facilitate migration [14], and generates new membrane protrusions, all of which are consistent with the characteristics of EMT process. In contrast, SUD weakened the effect of EGF, reduced the F-actin abundance, and restored the cells to a tightly connected state (Figure 2a). Figure 2. SUD inhibits the EMT of MCF-7 and BGC-823 cells. (a) Fluorescence microscopy was used to measure the expression levels of F-actin in these cells. Scale bar is 20 μM. (b) Western blot analysis of the relative levels of E-cadherin and vimentin in MCF-7 cells. (c) Western blot analysis of the relative levels of E-cadherin and vimentin in BGC-823 cells. *, **, ***, **** and #, ##, ### #### denote significant difference with control group or EGF group, respectively. p<0.05, p<0.01, p<0.001 and p<0.0001, ordinary one-way ANOVA test.

shows the inhibitory effect of SUD on EMT of tumor cells. A: Typical graph of F-actin expression level and shape changes in MCF-7 cells and statistical analysis results. Among the four groups, the 1 μM SUD group exhibited the lowest F-actin fluorescence intensity and aspect ratio, showing significant statistical differences. B: Three Western blot bands show the expression of E-cadherin, vimentin, and β-actin proteins in MCF-7 cells following 48 hours of different treatments. C:Three Western blot bands show the expression of E-cadherin, vimentin, and β-actin proteins in BGC-823 cells following 48 hours of different treatments.

Next, we assessed the expression of the EMT marker proteins, E-cadherin and vimentin. Compared with the control group, exposure of MCF-7 (Figure 2b) and BGC-823 (Figure 2c) cells to EGF resulted in a decrease in E-cadherin expression but an increase in vimentin expression. Conversely, SUD exhibited contrasting effects by inhibiting vimentin expression while augmenting E-cadherin expression, counteracting the changes induced by EGF.

Collectively, these results suggest that SUD impedes the transition of cells from an epithelial to a mesenchymal state.

SUD inhibits the expression and function of TRPM7

Our previous study showed that EGF markedly up-regulated the membrane protein expression of TRPM7, which is involved in the cell migration induced by EGF [3]. Moreover, dysregulation and increased expression of TRPM7 protein are involved in EMT in human bladder cancer tissues, and knockdown of TRPM7 reversed the EMT status of these cells [21]. Therefore, we investigated whether SUD could inhibit cell migration and EMT by acting on TRPM7.

We performed a correlation analysis between the expression of TRPM7 and the survival rates of patients with breast and gastric cancer using the TCGA database [22]. The results showed that patients with higher TRPM7 expression have a significantly shorter survival rate as compared to those with lower TRPM7 expression (Figure 3a), which suggests a close association between TRPM7 and cancer progression. Figure 3. SUD inhibits the expression and function of TRPM7 in MCF-7 and BGC-823 cells. (a) TRPM7 expression and overall survival in breast cancer and gastric cancer patients. (b) effects of different concentrations SUD on the TRPM7 mRNA expression in MCF-7(left) and BGC-823(right) cells examined by qPCR. (c) Patch clamp analysis of the effects of 2-APB and SUD on TRPM7-like currents in MCF-7 cells. (d) Patch clamp analysis of the effects of 2-APB and SUD on TRPM7-like currents in BGC-823 cells. **** denotes significant difference with control group, p<0.0001, ordinary one-way ANOVA test.

shows the inhibitory effect of SUD on expression and function of TRPM7 in tumor cells. A: The survival curve of breast cancer and gastric cancer patients with different levels of TRPM7 expression. Patients with high TRPM7 expression exhibit a notably lower survival rate compared to those with low TRPM7 expression. B: The mRNA expression results of TRPM7 in MCF-7 and BGC-823 cells treated with four different treatments for 48 hours. Among the four groups, the 5μM SUD group shows the lowest mRNA expression of TRPM7, and showing significant statistical differences. C: The TRPM7-like current was elicited by a voltage ramp protocol in MCF-7 cells. After administering 100 μM 2-APB, the magnitude of the current was reduced by about 50% compared to the previous level. After following the administration of varying concentrations of SUD to MCF-7 cells, the 5μM SUD group showed the highest decrease in TRPM7-like current, followed by 1μM SUD group and 0.2μM SUD group. These results showed significant differences. Part D illustrates the effect of SUD on the amplitude of TRPM7-like currents in BGC-823 cells, which is consistent with the experimental results presented in Part C.

We evaluated the effect of SUD on TRPM7 mRNA expression in MCF-7 and BGC-823 cells using qPCR. Compared with the control group, SUD showed a concentration-dependent inhibitory effect on the expression of TRPM7 mRNA in MCF-7 and BGC-823 cells (Figure 3b).

Next, we used the whole-cell patch-clamp technique to measure TRPM7-like currents in MCF-7 and BGC-823 cells. The representative TRPM7-like whole-cell currents were elicited by a voltage-ramp protocol ranging from −120 to +120 mV, which can be inhibited by 2-APB (Figure 3c,), a potent nonspecific inhibitor of TRPM7 channel [23], is similar to the TRPM7-like current we have recorded in another study [3]. Then, we tested the effect of SUD on TRPM7-like current in MCF-7 and BGC-823 cells. The results showed that different concentrations of SUD (0.2, 1, and 5 μM) led to a significant reduction in TRPM7-like currents at +100 mV by 42.27 ± 1.03%, 55.47 ± 1.10%, and 71.65 ± 1.03% in MCF-7 cells, and by 31.28 ± 1.13%, 54.22 ± 0.85%, and 68.98 ± 1.12% in BGC-823 cells, respectively (Figure 3c,).

The results presented above demonstrate that SUD exhibited a dose-dependent inhibition of TRPM7 mRNA expression and TRPM7-like current amplitude.

SUD inhibits TRPM7 expression through PI3K/Akt signaling pathway

The activation of the PI3K/Akt signaling pathway has been proven to promote the proliferation and migration of breast cancer and gastric cancer cells [24,25] and is related to the regulation of TRPM7 [2,4]. Therefore, We hypothesized that SUD may affect TRPM7 expression through the PI3K/Akt signaling pathway. The qPCR results show that SUD treatment led to a significant decrease in the expression of PI3K and AKT1 mRNA in MCF-7 (Figure 4a) and BGC-823 (Figure 4b) cells. Figure 4. SUD inhibits TRPM7 expression through PI3K/Akt signaling pathway. (a) Effects of different concentrations SUD on the AKT1 and PI3K mRNA expression in MCF-7 cells examined by qPCR. (b) effects of different concentrations SUD on the AKT1 and PI3K mRNA expression in BGC-823 cells examined by qPCR. ***, **** denote significant difference with control group, p<0.001 and p<0.0001, ordinary one-way ANOVA test. (c) Western blot analysis of the relative levels of TRPM7 in MCF-7 cells. (d) Western blot analysis of the relative levels of TRPM7 in BGC-823 cells. *, ***, **** denote significant difference with control group. p<0.05, p<0.001 and p<0.0001, ordinary one-way ANOVA test. ##, and ### denote significant differences with SC79 group. p<0.01 and p<0.001, unpaired t-test. (e, f) correlation between the expression of AKT1 and TRPM7 in breast cancer patients(e) and gastric cancer patients(f). The units in the x, y axis is FPKM (fragments per kilobase of exon model per million mapped fragments).

shows the inhibitory effect of SUD on expression of PI3K and AKT in tumor cells. A and B: The mRNA expression results of AKT1 and PI3K in MCF-7 and BGC-823 cells treated with different treatments for 48 hours. Among the four groups, the 5μM SUD group shows the lowest mRNA expression of AKT1 and PI3K in both cell types and demonstrates significant statistical differences. C and D: Western blot experiment results show the expression of TRPM7 and β-actin proteins in MCF-7 and BGC-823 cells following 48 hours of various treatments. In both cell types, the TRPM7 protein level was the lowest in the 1 μM SUD group, the highest in the SC79 group, and the expression level in the SC79 + 1 μM SUD group was lower than that in the SC79 group. The results showed statistical differences. E and F: Correlation between TRPM7 and AKT1 expression in cancer patients. The expressions of TRPM7 and AKT1 in breast cancer patients and gastric cancer were positively correlated, indicating a strong relationship between the two.

SC79 is an activator of Akt protein kinase [26]. Treatment of MCF-7 and BGC-823 cells with SC79 for 48 hours resulted in a significant increase in TRPM7 protein expression. SUD inhibited TRPM7 protein expression, while SC79 caused SUD to lose its inhibitory effect on TRPM7 expression both in MCF-7 (Figure 4c) and BGC-823 cells (Figure 4d), indicating that SUD may inhibit TRPM7 through the PI3K/Akt signaling pathway.

To further understand the relationship between PI3K/Akt pathway and TRPM7, we used TCGA data to analyze the relationship between the expression of TRPM7 and AKT1 in breast cancer and gastric cancer metastasis. Spearman analysis showed that the expressions of AKT1 and TRPM7 were positively correlated in breast cancer (Figure 4e) and gastric cancer patients (Figure 4f).

These findings provide evidence supporting the notion that SUD may exert its suppressive effects on TRPM7 expression via the PI3K/Akt signaling pathway.

Molecular docking studies predicting interactions of SUD with TRPM7

To understand the role of SUD on functional activity of TRPM7 from another perspective, we conducted simulated molecular docking between SUD and TRPM7 to obtain their possible binding conformations. We compared the protein structure of human TRPM7 (Uniprot: Q96QT4) with mouse TRPM7 (PDB: 8SI7), the homology of Q96QT4 and 8SI7 structural sequences is as high as 94.36%, and the RMSD of comparison is 2.932 in protein structural superposition, which shows good overlap (Figure 5a). Highly overlapping regions are mainly distributed in the N-terminal domain, S1-S4, S6 terminal, and the front end of the C-terminal domain. The structure of 8SI7 is bound to a small molecule inhibitor, VER155008 [27], for which the site within TRPM7 has been identified [28]. VER155008 and SUD have similar chemical structures, with aromatic structures, such as pyrimidine and benzene rings, at either end (Figure 5b). The continuous amide bond in the SUD molecule also provides the possibility of additional hydrogen bonding. The high homology of the proteins and structural similarity of the ligands indicate similar binding sites. From the docking results we can see that SUD and TRPM7 channels have considerable binding effects (Figure 5c). In the optimal structure, the continuous amide structure of SUD has hydrogen bonding with GLN-1114 and LYS995, and the pyrimidine ring and benzene ring of TYR-923 have Pi-Pi stacked interactions (Figure 5d). These results may suggest a direct inhibitory effect of SUD on TRPM7. Figure 5. Molecular docking studies predicting interactions of SUD with TRPM7. (a) The A-chain structure overlap between human TRPM7 (Uniprot: Q96QT4) and mouse TRPM7 (PDB: 8SI7) and the interaction between VER155008 and 8SI7. (b) comparison of molecular structures between SUD and VER155008. (c) global diagram and top view of interaction between SUD and human TRPM7 channel. (d) interaction between SUD and key amino acids at TRPM7 binding site.

shows the predicted docking study between the SUD and TRPM7 molecules. A: Two single chains of TRPM7 from mice and humans show obvious structural overlap. The transmembrane region of mouse TRPM7 binds to a small molecule compound called VER155008. B: Comparison of the chemical structures of VER155008 and SUD. The two compounds have similar chemical groups at both ends. C: The four-dimensional structure of human TRPM7 protein and its binding to SUD in plan and top views. D: The localized magnified image of the interaction between SUD and the human TRPM7 structure showcases the binding mode and binding site of SUD with the human TRPM7 channels, which shows that GLN1114 maybe is a critical binding site.

Discussion

In this study, we used various experimental methods to validate the inhibitory role of SUD on the cancer cell migration and to reveal its possible mechanisms.

The majority of cancer-related fatalities (approximately 90%) do not stem from the primary tumor itself, but from the development of secondary tumors at distant anatomical sites, facilitated by the dissemination of cancer cells. Metastasis enables the infiltration of cancer cells into various organs and tissues via the circulatory or lymphatic systems, thereby fostering their proliferation and the formation of novel neoplasms [1]. Therefore, inhibition of the metastasis of tumor cells is important for cancer treatment. Our previous findings showed that SUD suppressed cancer cells growth [20], hence, here we investigated the effects of SUD on cancer cells migration, and functional expression of TRPM7. The results of wound healing and transwell experiments suggested that SUD inhibited the migration of MCF-7 and BGC-823 cells, as well as the stimulatory effect of EGF. But while being widely accepted cell migration assays, the wound healing and transwell migration data may be affected by cell death and, hence, need to be treated with caution.

EMT plays an important role in cancer progression as it can confer metastatic properties to tumor cells [18]. We observed the effect of SUD on EMT through F-actin staining and the detection of EMT-related proteins. Our findings revealed that EGF facilitated the onset of EMT and upregulated the expression of the EMT-associated protein vimentin. Conversely, SUD hindered the progression of EMT and downregulated vimentin expression in MCF-7 and BGC-823 cells. These results collectively indicate that SUD inhibits the EMT process in tumor cells and has a reversal effect on EGF-induced EMT.

It was observed in human bladder cancer tissues that the elevation and dysregulation of TRPM7 protein expression were involved in EMT; knocking down TRPM7 reversed the EMT status in these tissues [21]. We found that acute application of SUD significantly inhibited TRPM7-like currents in the MCF-7 and BGC-823 cell lines. Furthermore, a 48 hours incubation with SUD significantly decreased the mRNA and protein expression levels of TRPM7. These findings suggest that SUD hinders the functional expression of TRPM7 by directly suppressing TRPM7-like current and by diminishing its expression level. The decline in TRPM7 expression may be attributed to various mechanisms, such as alterations in gene transcription and translation, as well as protein trafficking and degradation [29]. Regardless of the mechanism, these results indicate that SUD may suppresses cancer cell migration by reducing functional expression of TRPM7.

We examined the relationship between TRPM7 and the AKT/PI3K signaling pathway in an attempt to discover the mechanism of action of SUD on TRPM7, the results showed that the expressions of TRPM7 and AKT1 were positively correlated in breast cancer and gastric cancer patients. SUD inhibited the mRNA expression of PI3K, AKT1, and the TRPM7 protein abundance. Moreover, the Akt activator SC97 [23] reversed the inhibitory effect of SUD on TRPM7 protein expression. Based on these observations, we speculated that SUD inhibits the expression of TRPM7 through the PI3K/Akt signaling pathway. On the other hand, the acute inhibition of TRPM7-like current amplitudes may suggest also a direct inhibition of TRPM7 ion channel activity by SUD.

To obtain a more comprehensive understanding of the effect of SUD on TRPM7, we employed a molecular docking simulation to model possible interactions between SUD and TRPM7. This approach enabled us to predict potential binding conformations between the two entities. These simulations revealed that SUD may share its binding site with a known small molecule inhibitor of TRPM7, ver155008. Hence, we hypothesize, that SUD is also a TRPM7 channel inhibitor. Figure 6 details our current understanding of the potential mechanism of SUD effects on TRPM7 inhibition and migration based on the present work in conjunction with our previous studies. Figure 6. Schematic of sud-mediated TRPM7 inhibition. TRPM7 participates in the process of EMT by regulating cation influx, while the expression of TRPM7 is influenced by EGF through the AKT signaling pathway. Cancer cell functional outcomes can be modulated via changes in gene transcription and translation or via alternative cytosolic signaling. SUD inhibits the expression and function of TRPM7 via PI3K-AKT signaling pathway, then inhibits the EMT process of cancer cells, ultimately leading to a reduction of cancer cell proliferation, viability and migration.

Diagram illustrating the mechanism of SUD affecting the function of TRPM7. EGF enhances the expression of TRPM7 by binding to the EGF receptor, promoting the expression of AKT1 and PI3K, and enhancing the flow of calcium, magnesium, zinc, and other ions. This promotes the transition of cells from an epithelial state to a mesenchymal state and ultimately promotes cell migration. However, SUD inhibits the expression of AKT1 and PI3K, resulting in the suppression of TRPM7 expression and reduced ion flow. This ultimately leads to the inhibition of cell migration.

Conclusions

This study demonstrates that SUD inhibits the migration of breast and gastric cancer cells through a dual effect on TRPM7: direct inhibition TRPM7 activity and PI3K/AKT-mediated suppression of channel expression.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author statement

Haixia Gao: Conceptualization, Methodology, Supervision, Funding acquisition, and project administration. Pingping Chen: Conceptualization, Funding acquisition, and validation. Xiaoding Zhang: Investigation, Validation, Writing. Rui Zong, Yu Han and Xiaoming Li: Investigation, Validation. Shuangyu Liu and Yixue Cao: Software, Formal analysis. Nan Jiang: Validation. All authors have read and approved the final version.

Data availability statement

The data that support the findings of this study are available from the corresponding author, Haixia Gao, upon reasonable request.
==== Refs
References

[1] Bourzac K. Biology: three known unknowns. Nature. 2014;509 (7502 ):S69–14. Epub 2014/05/30. doi: 10.1038/509S69a 24870828
[2] Alessandro R, Masiero L, Liotta LA, et al. The role of calcium in the regulation of invasion and angiogenesis. Vivo. 1996;10 (2 ):153–160. Epub 1996/03/01.
[3] Gao H, Chen X, Du X, et al. Egf enhances the migration of cancer cells by up-regulation of Trpm7. Cell Calcium. 2011;50 (6 ):559–568. Epub 2011/10/08. doi: 10.1016/j.ceca.2011.09.003 21978419
[4] Wang X, Song X, Cheng G, et al. The regulatory mechanism and biological significance of mitochondrial calcium uniporter in the migration, invasion, angiogenesis and growth of gastric cancer. Onco Targets Ther (2020) 13 :11781–11794. Epub 2020/11/26. doi: 10.2147/ott.S262049 33235465
[5] Nadler MJ, Hermosura MC, Inabe K, et al. Ltrpc7 is a Mg.Atp-regulated divalent cation channel required for cell viability. Nature. 2001;411 (6837 ):590–595. Epub 2001/06/01. doi: 10.1038/35079092 11385574
[6] Mederos Y, Schnitzler M, Wäring J, et al. Evolutionary determinants of divergent calcium selectivity of trpm channels. Faseb J. 2008;22 (5 ):1540–1551. Epub 2007/12/13. doi: 10.1096/fj.07-9694com 18073331
[7] Lee HJ, Kim MC, Lim B, et al. Buxus Microphylla var. Koreana Nakai extract for the treatment of gastric cancer. J Pharmacopuncture. 2013;16 (3 ):39–45. Epub 2013/09/01. doi: 10.3831/kpi.2013.16.016 25780674
[8] Middelbeek J, Kuipers AJ, Henneman L, et al. Trpm7 is required for breast tumor cell metastasis. Cancer Res. 2012;72 (16 ):4250–4261. Epub 2012/08/09. doi: 10.1158/0008-5472.Can-11-3863 22871386
[9] Chen JP, Wang J, Luan Y, et al. Trpm7 promotes the metastatic process in human nasopharyngeal carcinoma. Cancer Lett. 2015;356 (2 Pt B ):483–490. Epub 2014/10/12. doi: 10.1016/j.canlet.2014.09.032 25304381
[10] Chen WL, Turlova E, Sun CL, et al. Xyloketal B suppresses glioblastoma cell proliferation and migration in vitro through inhibiting Trpm7-regulated Pi3k/Akt and Mek/Erk signaling pathways. Mar Drugs. 2015;13 (4 ):2505–2525. Epub 2015/04/29. doi: 10.3390/md13042505 25913706
[11] Luo Y, Wu JY, Lu MH, et al. Carvacrol alleviates prostate cancer cell proliferation, migration, and invasion through regulation of Pi3k/Akt and mapk signaling pathways. Oxid Med Cell Longev. 2016) 2016 2016 (1 ):1469693. Epub 2016/11/03. doi: 10.1155/2016/1469693 27803760
[12] Song C, Bae Y, Jun J, et al. Identification of Tg100-115 as a new and potent Trpm7 kinase inhibitor, which suppresses breast cancer cell migration and invasion. Biochim Biophys Acta Gen Subj. 2017;1861 (4 ):947–957. Epub 2017/02/06. doi: 10.1016/j.bbagen.2017.01.034 28161478
[13] Normanno N, Bianco C, De Luca A, et al. Target-based agents against erbb receptors and their ligands: a novel approach to cancer treatment. Endocr Relat Cancer. 2003;10 (1 ):1–21. Epub 2003/03/26. doi: 10.1677/erc.0.0100001 12653668
[14] Fletcher DA, Mullins RD. Cell mechanics and the cytoskeleton. Nature. [2010 Jan 28];463 (7280 ):485–492. doi: 10.1038/nature08908 20110992
[15] Nieto MA, Huang RY, Jackson RA, et al. EMT: 2016. Cell. 2016;2016 (166 ):21–45. doi: 10.1016/j.cell.2016.06.028
[16] Voulgari A, Pintzas A. Epithelial–mesenchymal transition in cancer metastasis: mechanisms, markers and strategies to overcome drug resistance in the clinic. Biochim Biophys Acta. 2009;1796 (2 ):75–90. doi: 10.1016/j.bbcan.2009.03.002 19306912
[17] Lawrence MS, Stojanov P, Mermel CH, et al. Discovery and saturation analysis of cancer genes across 21 tumour types. Nature. 2014;505 (7484 ):495–501. Epub 2014/01/07. doi: 10.1038/nature12912 24390350
[18] Zhenhua P, Huanlong L. Preparation of cyclodextrin inclusion complexes and preliminary study on their pharmacodynamics in mice Chinese pharmacy. Ying Yong Sheng Tai Xue Bao. 2011;22 (8 ):1982–1984.22097357
[19] Chen PP, Li CY, Han Y, et al. N-[4-(4,6-Dimethyl-2-Pyrimidinyloxy)-3-Methylphenyl]-N’-2-(dimethylamino)] benzoylurea induces cell-cycle arrest and apoptosis in human cancer cells. Anticancer Drugs. 2015;26 (6 ):620–631. Epub 2015/03/11. doi: 10.1097/cad.0000000000000226 25756738
[20] Pasquier J, Abu-Kaoud N, Al Thani H, et al. Epithelial to mesenchymal transition in a clinical perspective. J Oncol. 2015) 2015 2015 :1–10. Epub 2015/10/02. doi: 10.1155/2015/792182
[21] Cao R, Meng Z, Liu T, et al. Decreased Trpm7 inhibits activities and induces apoptosis of bladder cancer cells via Erk1/2 pathway. Oncotarget. 2016;7 (45 ):72941–72960. Epub 2016/09/24. doi: 10.18632/oncotarget.12146 27662662
[22] Weinstein JN, Collisson EA, Mills GB, et al. The cancer genome atlas pan-cancer analysis project. Nat Genet. 2013;45 (10 ):1113–1120. Epub 2013/09/28. doi: 10.1038/ng.2764 24071849
[23] Chokshi R, Fruasaha P, Kozak JA. 2-aminoethyl diphenyl borinate (2-apb) inhibits Trpm7 channels through an intracellular acidification mechanism. Channels. 2012;6 (5 ):362–369. Epub 2012/08/28. doi: 10.4161/chan.21628 Channels (Austin).22922232
[24] Liu L, Meng T, Zheng X, et al. Transgelin 2 promotes paclitaxel resistance, migration, and invasion of breast cancer by directly interacting with Pten and activating Pi3k/Akt/Gsk-3β pathway. Mol Cancer Ther. 2019;18 (12 ):2457–2468. Epub 2019/09/07. doi: 10.1158/1535-7163.Mct-19-0261 31488699
[25] Zhao Y, He J, Li Y, et al. Phf14 promotes cell proliferation and migration through the akt and Erk1/2 pathways in gastric cancer cells. Biomed Res Int. 2020) 2020 2020 :1–10. Epub 2020/07/01. doi: 10.1155/2020/6507510
[26] Jo H, Mondal S, Tan D, et al. Small molecule-induced Cytosolic activation of protein kinase Akt rescues ischemia-elicited neuronal Death. Proc Natl Acad Sci U S A. 2012;109 (26 ):10581–10586. Epub 2012/06/13. doi: 10.1073/pnas.1202810109 22689977
[27] Rössig A, Hill K, Nörenberg W, et al. Pharmacological agents selectively acting on the channel moieties of Trpm6 and Trpm7. Cell Calcium. 2022;106 :102640. Epub 2022/08/29. doi: 10.1016/j.ceca.2022.102640 36030694
[28] Nadezhdin KD, Correia L, Narangoda C, et al. Structural mechanisms of Trpm7 activation and inhibition. Nat Commun. 2023;14 (1 ):2639. Epub 2023/05/09. doi: 10.1038/s41467-023-38362-3 37156763
[29] Zou ZG, Rios FJ, Montezano AC, et al. Trpm7, Magnesium, and Signaling. Int J Mol Sci. 2019;20 (8 ). Epub 2019/04/19. doi: 10.3390/ijms20081877
