
==== Front
J Neuroinflammation
J Neuroinflammation
Journal of Neuroinflammation
1742-2094
BioMed Central London

3204
10.1186/s12974-024-03204-6
Research
Tyrosine phosphorylation and palmitoylation of TRPV2 ion channel tune microglial beta-amyloid peptide phagocytosis
Yang Shaobin yangshaobin@nwnu.edu.cn

Du Yaqin
Li Yanhong
Tang Qi
Zhang Yimeng
Zhao Xiaoqian
https://ror.org/00gx3j908 grid.412260.3 0000 0004 1760 1427 College of Life Sciences, Northwest Normal University, Lanzhou, Gansu 730070 China
3 9 2024
3 9 2024
2024
21 21811 4 2024
13 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Alzheimer’s disease (AD) is the leading form of dementia, characterized by the accumulation and aggregation of amyloid in brain. Transient receptor potential vanilloid 2 (TRPV2) is an ion channel involved in diverse physiopathological processes, including microglial phagocytosis. Previous studies suggested that cannabidiol (CBD), an activator of TRPV2, improves microglial amyloid-β (Aβ) phagocytosis by TRPV2 modulation. However, the molecular mechanism of TRPV2 in microglial Aβ phagocytosis remains unknown. In this study, we aimed to investigate the involvement of TRPV2 channel in microglial Aβ phagocytosis and the underlying mechanisms. Utilizing human datasets, mouse primary neuron and microglia cultures, and AD model mice, to evaluate TRPV2 expression and microglial Aβ phagocytosis in both in vivo and in vitro. TRPV2 was expressed in cortex, hippocampus, and microglia.Cannabidiol (CBD) could activate and sensitize TRPV2 channel. Short-term CBD (1 week) injection intraperitoneally (i.p.) reduced the expression of neuroinflammation and microglial phagocytic receptors, but long-term CBD (3 week) administration (i.p.) induced neuroinflammation and suppressed the expression of microglial phagocytic receptors in APP/PS1 mice. Furthermore, the hyper-sensitivity of TRPV2 channel was mediated by tyrosine phosphorylation at the molecular sites Tyr(338), Tyr(466), and Tyr(520) by protein tyrosine kinase JAK1, and these sites mutation reduced the microglial Aβ phagocytosis partially dependence on its localization. While TRPV2 was palmitoylated at Cys 277 site and blocking TRPV2 palmitoylation improved microglial Aβ phagocytosis. Moreover, it was demonstrated that TRPV2 palmitoylation was dynamically regulated by ZDHHC21. Overall, our findings elucidated the intricate interplay between TRPV2 channel regulated by tyrosine phosphorylation/dephosphorylation and cysteine palmitoylation/depalmitoylation, which had divergent effects on microglial Aβ phagocytosis. These findings provide valuable insights into the underlying mechanisms linking microglial phagocytosis and TRPV2 sensitivity, and offer potential therapeutic strategies for managing AD.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12974-024-03204-6.

Keywords

Alzheimer’s disease
Transient receptor potential vanilloid family type 2
Phagocytosis
Microglia
Phosphorylation
National Nature Science Foundation of China32360219 Natural Science Foundation of Gansu Province21JR7RA137 Youth Talents Lifting Project Foundation of Northwest Normal UniversityNWNU-LKQN2021-01 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Alzheimer’s disease (AD) is the most common form of dementia, it is characterized by a progressive deterioration of memory and cognitive function [1, 2]. Currently, AD affects more than 50 million individuals worldwide, and the number is reaching to triple within the next four decades [3]. AD is primarily associated with the formation of amyloid plaques, which is caused by the accumulation and aggregation of amyloid-β (Aβ) in the brain [4]. Amyloid plaques lead to neuronal damage, neuroinflammation, and disruption of synaptic function [5, 6]. Microglia play a pivotal role in preventing Aβ accumulation through phagocytosis-mediated clearance in central nervous system (CNS), triggering receptor expressed on myeloid cells 2 (Trem2) and TAM receptors (Axl and Mer) facilitating microglial recognition and engulfment of amyloid plaques [7, 8]. Therefore, it is crucial to inhibit the synthesis, accumulation, and aggregation of Aβ for the prevention of AD. The transient receptor potential vanilloid family type 2 (TRPV2) is associated with the risk of AD and mild cognitive impairment [9]. TRPV2, a Ca2+-permeable non-selective cation channel, is widely expressed in most organs, and plays significant roles in axon outgrowth, osmotic- or mechanosensation, pro-inflammatory processes, and oncogenesis [10–12]. Furthermore, TRPV2 plays a crucial for phagocytosis in macrophages and microglia [13]. However, due to the absence of specific modulators, endogenous modulation of TRPV2 remains largely unexplored, making it difficult to pinpoint its exact TRPV2 molecular function [14]. Cannabidiol (CBD), a non-psychotropic compound, exhibits neuroprotective and anti-inflammatory properties in neurons via cannabinoid receptors. CBD reverses object recognition deficits and enhances the hippocampal immune response and autophagy in AD model mice [15, 16]. Similarly, CBD induces autophagy and improves neuronal health associated with SIRT1 mediated longevity in C. elegans [17]. CBD acts as a non-specific exogenous activator for TRPV2, showing much higher apparent affinity than other agonists [18, 19]. Recently, our study found that CBD improves microglial Aβ phagocytosis by modulation by TRPV2 [20]. Nevertheless, TRPV2 demonstrates varied effects on microglial phagocytosis. Under oxygen-glucose deprivation (OGD), CBD boosts TRPV2 expression but diminishes microglial phagocytosis [21]. Thus, it is essential to study the impact of CBD mediated TRPV2 modulation on microglial Aβ phagocytosis in AD mice. TRPV2 is primarily located on the endoplasmic reticulum membrane [22]. However, when microglia are activated by nitric oxide, TRPV2’s regulation and migration from the endoplasmic reticulum to the plasma membrane along with the enhancement of its phagocytic function, depend on phosphoinositide 3-kinase signaling pathways (PI3Ks) [23, 24]. Recently, the oxidation of TRPV2 on methionine residues was discovered to activate and sensitize the channel [25]. Moreover, protein tyrosine phosphatase non-receptor type 1 (PTPN1) mediates TRPV2 dephosphorylation, and inhibiting JAK1 reduces TRPV2 channel activity and diminishes macrophage phagocytic ability [26]. Dynamic protein S-palmitoylation also contributes to protein transport and functional localization by increasing protein hydrophobicity [27, 28]. Palmitoylation regulates cellular distribution of and transmembrane Ca2+ flux through TrpM7 [29]. TRPML1 is palmitoylated following histamine stimulation of acid secretion [30]. TRPC5 channel instability induced by depalmitoylation protects striatal neurons against oxidative stress in Huntington’s disease [31]. Intriguingly, palmproteomics suggests that TRPV2 may undergo palmitoylation. Meanwhile, the physiological and pathological roles of TRPV2 in microglial phagocytic ability is required to comprehensively understand. In this study, the function of TRPV2 channel in microglial Aβ phagocytosis and the underlying mechanisms were examined. It was found that microglial TRPV2 channel is regulated by tyrosine phosphorylation/dephosphorylation and cysteine palmitoylation/depalmitoylation, exhibits divergent effects on microglial Aβ phagocytosis.

Results

Short-term CBD injection (i.p.) reduced the expression of neuroinflammation and microglial phagocytic receptors via TRPV2 channel

First, the TRPV2 expression in the brain zone of wild-type (WT) mice was determined, the TRPV2 protein expression was shown in the cortex, telencephalon, and hippocampus (Fig. S1A). When characterizing the expression pattern of TRPV2 in the brain, the TRPV2 protein expression in microglia was significantly higher than the neuronal or astrocytic expression (Fig. S1B). To further understand the impact of AD on TRPV2 expression in brain, we analyzed cell-type specific data from human brain cortical tissue based on the τ enrichment score [32]. Results highlighted microglia exhibiting the highest TRPV2 levels among the TRPV family (Fig. S1C-D). Bioinformatics analysis unveiled the conservation of the amino acid sequence of the TRPV2 channel across humans, mice, and rats (Fig. S1E). Using AlphaFold2, it was determined that full-length mouse TRPV2 forms a tetrameric protein, and CBD could bind to mTRPV2 through a hydrophobic pocket located between the S5 and S6 helices (Fig. 1A). We then asked whether CBD exerts beneficial effects on TRPV2/Akt pathway in APP/PS1 mice. We observed a significant increase in the TRPV2 protein levels in the cortex of both WT and APP/PS1 mice after CBD was injected (i.p.) for 1 week (Fig. 1B and C). The phosphorylation level of Akt at Ser473 was significantly increased in the cortex of APP/PS1 mice by CBD treatment (Fig. 1B and C). Notably, the protein level of Tau was weakly reduced by CBD treatment, and ionized calcium binding adaptor molecule 1 (Iba1) was a slight reduction in the cortex of APP/PS1 mice, but there was no statistical difference (Fig. 1B and C). To investigate the effects of CBD on neuroinflammation and microglial phagocytic receptors in AD, we performed qRT-PCR to measure the mRNA expression levels of various cellular cytokines and phagocytic receptors, including G protein-coupled receptor 34 (GPR34), complement receptor 3 (CR3), purinergic receptor P2Y6 (P2Y6), interleukin-1β (IL-1β), IL-6, and IL-4. CBD treatment significantly decreased the cortical mRNA expression levels of Cr3, GPR34, P2Y6, IL-4, IL-6, and IL-1β compared with saline group in APP/PS1 mice (Fig. 1D). These data demonstrate that short-term CBD treatment significantly decreases chronic neuroinflammation and microglial phagocytic receptors in AD mice.

Fig. 1 Short-term CBD treatment modulated mRNA and protein expression in the cortex of APP/PS1 mice. (A) A schematic diagram depicting the binding of CBD to TRPV2 in mice is shown, the binding site represented in white. (B) WT and APP/PS1 mice were treated with or without CBD (10 mg/kg/d for 1 week), protein expression was determined by immunoblot analysis with the depicted antibodies. (C) Band densitometry quantification normalized to GAPDH levels or Akt phosphorylated and Akt total protein levels are shown. (D) mRNA levels were determined by RT-qPCR. The data are presented as the mean ± SEM (n = 5 per group) independent experiments conducted in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001 are compared to WT treated by saline, #p < 0.05, ##p < 0.01, and ###p < 0.001 compared to APP/PS1 mice treated by saline, $p < 0.05, $$p < 0.01, and $$$p < 0.001 are compared to WT treated by CBD, as obtained by one-way analysis of variance (ANOVA). Vehicle: saline. WT: wild type + saline, APP/PS1: APP/PS1 + saline

Long-term CBD injection (i.p.) aggravated amyloid plaques without altering neuronal death in APP/PS1 mice

We then explored whether long-term CBD treatment offers beneficial effects in mitigating neuronal apoptosis and Aβ pathology, two significant features of AD. To examine CBD’s on neuronal activity, we assessed neuronal viability by quantifying NeuN-positive neurons in mice. Following prolonged CBD injection (i.p.) in APP/PS1 mice, as illustrated in Fig. 2A, no apparent differences in NeuN staining were observed among the four groups (WT + saline vs. APP/PS1 + saline vs. WT + CBD vs. APP/PS1 + CBD) in the medial prefrontal cortex (mPFC) and the hippocampal dentate gyrus (DG) region (Fig. 2C-D). Furthermore, primary cortical neurons were employed to measure the percentage of apoptotic cells. As expected, exposure to Aβ oligomers led to a notable increase in apoptotic cell percentage. Nonetheless, CBD treatment effectively rescued the neuronal death induced by Aβ oligomers (Fig. S2).

Fig. 2 Long-term CBD treatment did not affect the expression of NeuN but exacerbated amyloid plaques in APP/PS1 mice. (A) Schematic illustrations of the experiment and timeline. Immunohistochemical staining of brain sections obtained from WT and APP/PS1 mice after the last injection of saline or CBD (10 mg/kg/d for 21 days). (B-D) The numbers of cells in the medial prefrontal cortex (mPFC) and hippocampal dentate gyrus (DG) NeuN were quantified and are expressed as a percentage of WT controls with saline. (E) The amyloid plaques in the mPFC and DG were stained, and the numbers in the cortex (F) and (G) hippocampus were quantified and are expressed as a percentage of those in the WT controls treated with saline. The data are presented as the mean ± SEM at least of five different mice per group (n = 10) independent experiments conducted in triplicate. One-way ANOVA, followed by Post hoc Tukey’s test for multiple comparisons, was used to analyze the data. ***p < 0.001 versus WT group. The scale bars = 100 μm–75 μm. WT: wild type + saline, APP/PS1: APP/PS1 + saline

To confirm CBD’s potential in addressing Aβ pathology in the AD brain, we utilized APP as a marker for protein expression in APP/PS1 mice. Our results indicated the absence of APP expression in WT mice, while the cortex and hippocampus of APP/PS1 mice exhibited APP presence (Fig. 3A and S3A). Interestingly, CBD administration led to an increase in APP protein expression in both the cortex and hippocampus of APP/PS1 mice (Fig. 3A and S3A). Aβ accumulation and aggregation result from an imbalance in Aβ production [33]. To further explore the effect of long-term CBD on amyloid burden in mice, brain sections were immunostained with an anti-Aβ antibody, and the number of Aβ plaques was quantified. Immunopositivity was completely absent in the cortex and hippocampus of WT mice (Fig. 2E). CBD significantly increased the number of Aβ- immunostained plaques in the cortex and hippocampus of APP/PS1 mice (Fig. 2F and G). These findings collectively suggest that long-term CBD injection activates TRPV2 channel and aggravates amyloid plaques, without altering neuronal apoptosis in APP/PS1 mice.

Fig. 3 Long-term CBD injection (i.p.) modulated mRNA and protein expression in the hippocampus of six-month-old APP/PS1 mice. WT and APP/PS1 mice were treated with or without CBD (10 mg/kg/d for 21 days), and (A) protein and (B) mRNA levels were determined by RT-qPCR and immunoblot. Protein extracts were obtained from the hippocampus and immunoblotted with the depicted antibodies, and GAPDH was used as a loading control. The data are presented as the mean ± SEM (n = 5 per group) independent experiments conducted in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001 are compared to WT treated with saline, #p < 0.05, ##p < 0.01, and ###p < 0.001 compared to APP/PS1 mice treated with saline, $p < 0.05, $$p < 0.01, and $$$p < 0.001 are compared to WT treated with CBD, as obtained by one-way analysis of variance (ANOVA). WT: wild type; Vehicle: saline. APP/PS1: APP/PS1 + saline

Overactivation of TRPV2 by CBD led to neuroinflammation and phagocytic dysfunction in APP/PS1 mice

Our previous study has demonstrated that CBD enhances Aβ phagocytosis in microglia via Akt signaling pathway mediated by TRPV2 [20]. However, we observed a notable increase in TRPV2 protein levels in the hippocampus and cortex following prolonged CBD treatment in APP/PS1 mice (Fig. 3A and S3A). The Akt phosphorylation at Ser473 significantly decreased in both WT and APP/PS1 mice after CBD administration. Surprisingly, the protein levels of Tau and Iba1 showed a marked increase in the hippocampus and cortex post-CBD treatment in WT and APP/PS1 mice, but Beta-site-APP Cleaving Enzyme (BACE) slightly increased in APP/PS1 + CBD compared to APP/PS1 + saline (Fig. 3A and S3A). These findings are intriguing given the prior evidence of CBD’s promotion of microglial Aβ phagocytosis and clearance via TRPV2 activation [20]. We speculate that CBD-induced TRPV2 channel activation might contribute to microglial polarization and the release of inflammatory factors, potentially leading to impaired Aβ phagocytosis [20]. To further explore CBD’s effects on microglial phagocytic capacity and inflammation in AD brain tissues, we conducted qRT-PCR to evaluate cytokine and phagocytic receptor levels in APP/PS1 mice. Our results revealed that CBD administration upregulated mRNA levels of Iba1, TRPV2, Triggering receptor expressed on myeloid cells 2 (Trem2), Cr3, as well as inflammatory factors IL-6, TNFα, and IL-1β in the hippocampus of APP/PS1 mice, CBD improved the mRNA expression of Iba1, Trem2, and P2Y6 in the hippocampus of WT mice (Fig. 3B). Furthermore, CBD treatment resulted in increased cortical mRNA levels of Iba1, P2Y6, and TNFα in APP/PS1 mice, CBD administration upregulated mRNA levels of Iba1, TRPV2, Trem2, Cr3, P2Y6 and IL-6 in the cortex of WT mice (Fig. S3B). Together, these findings suggest that CBD-induced overactivation of TRPV2 channel may contribute to neuroinflammation and impaired phagocytic function in APP/PS1 mice.

Hypersensitivity of TRPV2 channel by tyrosine dephosphorylation reduced microglial Aβ phagocytosis

To investigate the effects of TRPV2 overexpression on microglial phagocytosis, we introduced TRPV2 plasmids into microglia and treated them with FITC- conjugated Aβ. Our results indicated that while CBD treatment slightly enhanced microglial Aβ phagocytosis, there was a reduction in the uptake of FITC-Aβ42 and the internalized amount of FITC-Aβ42 following TRPV2 plasmid transfection, despite CBD increasing TRPV2 expression on the membrane (Fig. 4A, B, and E). Previous study has shown that JAK1 can enhance TRPV2 phosphorylation [26]. To investigate this, we employed ruxolitinib, a selective kinase inhibitor that blocks JAK signaling and transcriptional activation factor pathways [26]. The optimal time and dose of ruxolitinib were determined using the MTT assay (Fig. S4A). Microglia were then treated with ruxolitinib to assess their phagocytic ability. The results demonstrated that cotreatment with ruxolitinib and Aβ modestly reduced the capacity of microglia to uptake FITC-Aβ compared to the Aβ group (Fig. 4C). Moreover, immunocytochemistry analysis revealed a significant decrease in the engulfment of FITC-Aβ42 peptides following cotreatment with ruxolitinib and Aβ (Fig. 4E).

Fig. 4 Hyper-sensitivity of TRPV2 channels by tyrosine dephosphorylation reduced microglial Aβ phagocytosis. (A) Primary microglia were transfected with the TRPV2 pCMV-TRPV2-3FLAG-Neo plasmid for 48 h, and then treated with CBD for 24 h, FITC-Aβ42 (1 µg/ml) was added to the medium for another 24 h, and the FITC-Aβ42 uptake index was calculated based on the phagocytosis assay. (B) BV2 cells were transfected with the TRPV2 pCMV-TRPV2-3FLAG-Neo plasmid, cell cytosolic and membrane fractions were obtained and immunoblotted with the indicated antibodies, with GAPDH and ACE2 used as cytosolic and membrane markers, respectively. (C-D) Primary microglia were pre-added with Ruxo (ruxolitinib, 10 µM) 4 h, PTP IN 1 (protein tyrosine phosphatase (PTP) inhibitor 1, 0.5 µM), PTP IN 2 (protein tyrosine phosphatase (PTP) inhibitor 2, 0.5 µM) for 5 min, and treated with or without CBD for 24 h, FITC-Aβ42 (1 µg/ml) was added to the medium for another 24 h, FITC-Aβ42 uptake index was analyzed using the phagocytosis assay. (E) Primary microglia were plated at a density of 5 × 104 in poly-D-lysine-coated wells of 24-well plates containing DMEM supplemented with 10% FBS. Cells were transfected with TRPV2 pCMV-TRPV2-3FLAG-Neo plasmid for 48 h, or pretreated with Ruxo (ruxolitinib, 10 µM) 4 h, PTP IN 1 (0.5 µM), PTP IN 2 0.5 µM) for 5 min, FITC-Aβ42 (1 µg/ml) was added to the medium. Immunofluorescence analysis of microglial phagocytosis of FITC-Aβ42 was performed after allowing uptake for 24 h. *p < 0.05, **p < 0.01, and ***p < 0.001 are compared to control, ##p < 0.01 and ###p < 0.001 are compared to Aβ, $p < 0.05 and $$$p < 0.001 are compared to CBD + Aβ, &p < 0.05 is compared to CBD + PTP IN 1, as obtained by one-way analysis of variance (ANOVA). Con: DMSO

Protein phosphorylation, a reversible post-translational modification is regulated by both kinases and phosphatases [26]. Protein tyrosine phosphatase (PTP) inhibitors were used to search for the phosphatases that mediated the dephosphorylation of TRPV2 [26]. PTP inhibitor 1 (2-bromo-4’-hydroxyacetophenone) and PTP inhibitor 2 (4-(bromoacetyl)anisole) are inhibitors for TRPV2 dephosphorylation, they could enhance the tyrosine phosphorylation level of TRPV2 [26]. The optimal time and dose of PTP inhibitors 1 and 2 were determined via MTT assay (Fig. S4B and C). We subsequently examined the impact of PTP-mediated dephosphorylation of TRPV2 on the microglial phagocytic ability. Treatment with PTP inhibitor 1 and PTP inhibitor 2 modestly increased the efficiency of FITC-Aβ uptake, while microglial phagocytic ability decreased upon co-treatment with CBD and PTP inhibitor 2 (Fig. 4D). Accordingly, compared to the Aβ42 group, the amount of internalized FITC-Aβ42 in the CBD and PTP inhibitor 2 or PTP inhibitor 1 co-treatment group was also higher (Fig. 4E). These findings indicate that tyrosine phosphorylation enhances TRPV2 sensitivity and improves microglial Aβ phagocytosis, which is regulated by phosphatase-mediated dephosphorylation.

JAK1 phosphorylated TRPV2 at the Y338, Y466, and Y520 molecular sites

We then investigated the molecular mechanism of TRPV2 channel regulated by tyrosine phosphorylation. We firstly determined the tyrosine phosphorylation level of TRPV2 in the AD brain through immunoprecipitation. Our findings indicated a decrease in TRPV2 tyrosine phosphorylation in the cortex of APP/PS1 mice, which was reversed by CBD treatment, while CBD treatment slightly enhanced total TRPV2 expression compared to control (Fig. 5A). Interestingly, ruxolitinib also reduced TRPV2 tyrosine phosphorylation in macroglia (Fig. 5B). JAK1 phosphorylates rat TRPV2 at sites Y335, Y471, and Y525 [26]. Using the conservation of TRPV2 sequence across species and the prediction of tyrosine phosphorylation sites in mouse TRPV2, we identified potential sites in mouse TRPV2. Transfecting TRPV2 plasmids containing TRPV2 Y338F, Y466F, Y520F, as well as a triple mutant TRPV2 plasmid (Y338/466/520F) into HEK293T cells, TRPV2 levels were downregulated at the Y520F, and tri-mutant sites, but not at the Y466F and Y338F sites upon CBD treatment (Fig. S5A). The tyrosine phosphorylation levels of immunoprecipitated TRPV2 protein decreased in cells expressing TRPV2 Y520F and TRPV2 (Y338/466/520F) plasmids. Interestingly, CBD treatment augmented TRPV2 channel sensitivity at the Y466F and Y520F sites, but not at the Y338F or the tri-mutant site (Fig. 5C).

Fig. 5 JAK1 phosphorylated TRPV2 at the Y338, Y466, and Y520 molecular sites. (A) 6-months-APP/PS1 mice were treated with or without CBD (10 mg/kg/d for 21 days), (B) microglia cells were treatment with Ruxo (ruxolitinib, 10 µM) 4 h, and tyrosine phosphorylation of immunoprecipitated TRPV2 in cortical tissues or cells was determined by immunoblotting with an anti-phosphotyrosine antibody. Microglia or HEK293T cells were transfected with the TRPV2 pCMV-TRPV2-3FLAG-Neo, pCMV-TRPV2-Y338F-3FLAG-Neo, pCMV-TRPV2-Y466F-3FLAG-Neo, pCMV-TRPV2-Y520F-3FLAG-Neo, pCMV-TRPV2-Y338/466/520F-3FLAG-Neo plasmids for 48 h, and then after treatment with CBD for 24 h, FITC-Aβ42 (1 µg/ml) was added to the medium for 24 h. (C) Tyrosine phosphorylation of immunoprecipitated TRPV2 transiently transfected into HEK293T cells were determined by immunoblotting with an anti-phosphotyrosine antibody after treated with Ruxo (ruxolitinib, 10 µM) 4 h. (D) The FITC-Aβ42 uptake index was analyzed using the phagocytosis assay. (E) and (F) Primary microglia were plated at a density of 5 × 104 in poly-D-lysine-coated wells of 24-well plates containing DMEM supplemented with 10% FBS. Immunofluorescence analysis of microglial TRPV2 expression was determined. **p < 0.01 and ***p < 0.001 compared to control or TRPV2+/+, #p < 0.05, ##p < 0.01 and ###p < 0.001 compared to Aβ, $$p < 0.01 and $$$p < 0.001 compared to CBD + Aβ, as obtained by one-way analysis of variance (ANOVA). Con: DMSO. tri-mutant or tri-mut: Y338/466/520F

To explore how mutations at these sites affect microglial Aβ phagocytosis, we transfected TRPV2 Y338F, Y466F, Y520F, and TRPV2 (Y338/466/520F) plasmids into microglia. This led to a modest reduction in microglial Aβ phagocytosis compared to Aβ + plasmid group, especial in TRPV2 Y338F, Y466F, and TRPV2 (Y338/466/520F) plasmids. CBD only improved microglial Aβ phagocytosis in the Y466F and TRPV2 (Y338/466/520F) plasmids, although the effect is not drastic (Fig. 5D). Moreover, fluorescence intensity surrounding microglia decreased after transfection with TRPV2 Y338F, Y466F, Y520F, and TRPV2 (Y338/466/520F) plasmids following 24 h FITC-Aβ treatment (Fig. S5B). TRPV2 typically relocates from the endoplasmic reticulum to the cell membrane upon activation, facilitating Aβ phagocytosis by microglia [24]. We examined whether mutations at these sites affect TRPV2 localization. Our findings revealed that transfection with the TRPV2 plasmid exhibited the highest fluorescence intensity and TRPV2 expression on the cell membrane (Fig. 5E-F). Conversely, transfection with TRPV2 Y338F, Y466F, Y520F, and TRPV2 (Y338/466/520F) plasmids not only decreased TRPV2 fluorescence intensity in microglia, but also reduced the levels of TRPV2 expression on the cell membrane (Fig. 5E-F and S6). These findings suggest that tyrosine phosphorylation sites, especially Y338 and Y520 of TRPV2 regulate microglial Aβ phagocytosis partially depend on its localization.

TRPV2 was palmitoylated at cysteine 277 site and reduced microglial Aβ phagocytosis

TRPV2 was identified as a potential palmitoylated protein based on palm-proteomics analysis. Employing an ABE assay on TRPV2 expressed in HEK293T cells, we found that TRPV2 is palmitoylated (Fig. 6A). We then assessed palmitoylation levels in the brain of AD mice. Results revealed elevated cortical levels in APP/PS1 mice following HAM treatment compared to WT mice, with CBD enhancing the palmitoylation levels in AD mice (Fig. S7A and B). Further investigation identified cysteine 277 as the specific site of palmitoylation on TRPV2 (Fig. 6B). To ascertain the impact of TRPV2 palmitoylation on microglial phagocytic ability, we evaluated the phagocytosis of FITC-Aβ and fluorescence intensity surrounding microglia after transfection with TRPV2 and TRPV2 C277A plasmids. The TRPV2 C277A group exhibited slightly higher fluorescence intensity of internalized Aβ surrounding microglia compared to the Aβ group (Fig. 6C). While transfection with the TRPV2 C277A plasmid did not alter microglial Aβ phagocytosis induced by CBD (Fig. 6D). Examining TRPV2 localization, upon transfection of TRPV2 and TRPV2 C277A plasmids into HEK293T cells revealed reduced the membrane expression with the C277A plasmid (Fig. 6E). Interestingly, no significant difference in TRPV2 fluorescence intensity on the cell membrane was observed between the mutation and overexpression groups (Fig. 6F). Palmitoylation is catalyzed by a family of ZDHHC domain-containing S-acyltransferases [34]. Substrate specificity analysis viapalm-proteomics, suggested ZDHHC21 as a potential enzyme involved in TRPV2 palmitoylation. To validate this, we expressed a hemagglutinin (HA)-tagged ZDHHC21 enzyme in HEK293T cells, followed by analysis of TRPV2 palmitoylation by ABE assay. Results indicated an increase in TRPV2 palmitoylation level upon ZDHHC21expression (Fig. S7C).

Fig. 6 TRPV2 was palmitoylated at cysteine 277 site and reduced microglial Aβ phagocytosis. Microglia or HEK293T cells were transfected with the TRPV2 pCMV-TRPV2-3FLAG-Neo and pCMV-TRPV2-C277A-3FLAG-Neo plasmids for 48 h, and then treated with CBD for 24 h, FITC-Aβ42 (1 µg/ml) was added to the medium for another 24 h. (A) and (B) Palmitoylation of TRPV2 and TRPV2-C277A detected by ABE assay in HEK293T cells. Cells transiently expressing FLAG-TRPV2 and TRPV2-C277A were immunoprecipitated with anti-TRPV2 antibody. (C) Primary microglia were plated at a density of 5 × 104 in poly-D-lysine-coated wells of 24-well plates containing DMEM supplemented with 10% FBS, immunofluorescence analysis of FITC-Aβ42 was performed after allowing uptake of FITC-Aβ42 for 24 h. (D) FITC-Aβ42 uptake index was analyzed using the phagocytosis assay. (E) Cytosolic and membrane fractions of BV2 cells were obtained and immunoblotted with the indicated antibodies, and GAPDH and ACE2 were used as cytosolic and membrane markers, respectively. (F) Immunofluorescence analysis of microglial TRPV2 were determined. ***p < 0.001 compared to the control, ##p < 0.01 and ###p < 0.001 compared to the Aβ group, $$$p < 0.001 are compared to the C227A group, as obtained by one-way analysis of variance (ANOVA). Con: DMSO

In this study, we explored the effects of 2-Bromopalmitate (2-BP), a compound inhibiting palmitoylation by targeting palmitoyltransferase on microglia and their ability to phagocytose FITC-Aβ [35]. Initially, we determined the optimal time and concentration of 2-BP (Fig. S7D). Microglia were treated with 2-BP and subsequently exposed to FITC-Aβ for 24 h. Interestingly, we found that 2-BP treatment enhanced microglial phagocytosis of Aβ, and this phagocytic ability was further boosted when CBD and Aβ were co-administered (Fig. S7E). To explore the role of TRPV2 palmitoylation in microglia response to Aβ, we examined TRPV2 expression in microglia treated with 2-BP and Aβ. Our results indicated that co-treatment with 2-BP and Aβ led to time-dependent decrease in TRPV2 expression. Importantly, this treatment did not affect the phosphorylation of CaMKIIα/δ at Thr286 (Fig. S7F). Together, these findings suggest that TRPV2 palmitoylation negatively regulates microglial phagocytosis of Aβ.

Discussion

TRPV2 is identified as a promising therapeutic target in AD for its role in regulating microglial Aβ phagocytosis. Our study utilized cellular and animal models to investigate the role of TRPV2 channel in microglial Aβ phagocytosis, we found that TRPV2 channel was modulated by tyrosine phosphorylation/dephosphorylation and cysteine palmitoylation/depalmitoylation, exhibited opposing impacts on microglial Aβ phagocytosis. These findings illuminate the underlying connections between microglial phagocytosis and TRPV2 sensitivity.

Our data demonstrated that TRPV2 protein expression was expressed in the hippocampus and cortex. Among TRPV family members, TRPV2 was expressed at the highest level in microglia. Notably, our previous study showed that the protein level of TRPV2 is greater in microglia than in neurons [20]. Considering the pivotal role of microglia in AD pathophysiology through Aβ phagocytosis and inflammatory cytokine secretion, these results strongly indicate that microglial TRPV2 could hold significant implications for AD development [9]. TRPV2 has been proposed as a potential target for various stimuli, including redox processes, temperature changes, and membrane depolarization, all known to activate TRPV2 channels in rodents [36]. CBD, a natural compound with neuroprotective, anti-inflammatory, and antioxidant properties, has emerged as a promising therapeutic candidate for AD [37–39]. CBD exhibits neuroprotective and anti-inflammatory properties in neurons via cannabinoid receptors [15]. CBD reverses object recognition deficits and enhances the hippocampal immune response and autophagy in AD model mice [16]. Similarly, CBD induces autophagy and improves neuronal health associated with SIRT1 mediated longevity in C. elegans [17]. Our findings also found that CBD could effectively rescue neuronal death caused by Aβ both in APP/PS1 mice and primary cortical neurons, suggesting CBD exhibits neuroprotective in neurons via cannabinoid receptors. CBD demonstrates notably higher apparent affinity for TRPV2 compared to other agonists [18, 19]. CBD interacts with TRPV2 via a hydrophobic pocket situated between the S5 and S6 helices in the PH domain, this direct interaction between CBD and TRPV2 is believed to underlie the modulation of TRPV2 activity [40, 41].

CBD significantly enhances microglial phagocytic capacity by activating TRPV2 channel, thereby facilitating the clearance of Aβ within microglia [20]. When co-administered with Aβ42, treatment with 2-APB (a TRPV2 agonist) or capsaicin (a TRPV1 agonist) markedly enhances the phagocytic capacity of microglia [20]. However, the most pronounced increase in FITC-Aβ42 fluorescence intensity is observed in cells treated with CBD, this effect is inhibited by TRPV2 siRNA or the TRPV2 antagonist tranilast [20]. Moreover, CBD effectively penetrates the blood-brain barrier in human brain endothelial cells through TRPV2 activation [42]. Our findings demonstrated that short-term CBD treatment reduced the expression levels of Tau and Iba1 in the cortex of APP/PS1 mice, but the protein levels of BACE, Tau, and Iba1 were significantly increased upon long-term CBD treatment in the hippocampus and cortex of APP/PS1 mice through TRPV2/Akt signaling pathway. Interestingly, long-term CBD administration upregulated APP protein expression and increased Aβ plaques formation in the cortex and hippocampus of APP/PS1 mice. Phagocytosis pivotal for clearing cellular debris, is regulated by phagocytic receptors. [43, 44]. TRPV2 plays a crucial role in microglial phagocytosis through the PKG/PI3K- and iNOS/NO- dependent signaling pathways,. essential for clearing aggregated proteins, and delaying neuropathology while reducing neurodegeneration [23, 45]. Inflammatory cytokines are implicated in AD development and progression [46, 47]. Microglia activation and pro-inflammatory cytokine production are contribute to Aβ accumulation [46]. Short-term CBD treatment reduced the mRNA levels of Cr3, GPR34, P2Y6, IL-4, IL-6, IL-1β in the cortex of APP/PS1 mice, long-term CBD treatment upregulated the mRNA levels of Iba1, Trem2, P2Y6, IL-6, TNFα, and IL-1β in the cortex and hippocampus of APP/PS1 mice through the TRPV2 channel. However, the mRNA expression showed little variation with protein, this was believed to be due to the fact that the mRNA do not necessarily reflect protein expression levels, this phenomenon was also evident in other study [48]. TRPV2 activation by NO or oxidative stress may sensitize it through methionine oxidation [24, 25]. This activation promotes the influx of sodium and calcium from the extracellular media and/or endoplasmic reticulum, leading to cell depolarization and subsequent microglial phagocytosis or cytokine production [49].

Post-translational protein modification is vital for regulating ion channel and immune signaling, affecting channel expression on the plasma membrane and their biophysical characteristics [26, 50]. TRPV2 channel sensitivity is finely regulated by dynamic phosphorylation and dephosphorylation processes, with the JAK1-TRPV2 axis contributing to immune regulation [26]. Our study revealed that CBD enhanced TRPV2 responses by the PTPN1 phosphatase at specific molecular sites, namely Y338, Y466, and Y520. Tyrosine phosphorylation not only influences TRPV2’s sensitivity to stimuli but also modulates macrophage phagocytosis [26]. Increased tyrosine phosphorylation levels heighten TRPV2 sensitivity, boosting microglial Aβ phagocytosis, controlled by phosphatase dephosphorylation. In macrophages, tyrosine phosphorylation directly affects TRPV2’s biophysical properties without altering its membrane expression [26]. Our findings indicated that phosphorylation at Y338 and Y520 reduced TRPV2 expression on the plasma membrane. Previous studies have shown that PKC-related or Src-related pathways phosphorylate TRPV1 channel, influencing their surface expression [51, 52]. Additionally, methionine oxidation or endogenous modulators may influence TRPV2 channel sensitivity independently or synergistically [25]. We also have identified palmitoylation at cysteine 277 in TRPV2, which reduced microglial Aβ phagocytosis. Moreover, it was demonstrated that TRPV2 palmitoylation was dynamically regulated by ZDHHC21. Palmitoylation play a crucial role in regulating protein transport, cellular localization, and stability [27]. Interestingly, our findings indicated that palmitoylation directly affected TRPV2’s phagocytic ability without altering its membrane expression. Thus, TRPV2 channel is finely maintained through dynamic phosphorylation/dephosphorylation and palmitoylation/depalmitoylation processes.

The study highlights the contribution of TRPV2 ion channel in microglial Aβ phagocytosis and the underlying mechanisms. We observed predominant expression of TRPV2 in microglia, and noted that CBD activation sensitized TRPV2 channel. Short-term CBD injection (i.p.) significantly decreased chronic neuroinflammation and microglial phagocytic receptors in AD mice, and exhibited neuroprotective effect in neurons. Prolonged CBD treatment induced neuroinflammation and disrupted the expression of microglial phagocytic receptors in APP/PS1 mice. Additionally, we identified tyrosine phosphorylation at Tyr(338), Tyr(466), and Tyr(520) sites, which increased microglial Aβ phagocytosis by enhancing TRPV2 channel sensitivity and its localization. Conversely, TRPV2 was palmitoylated at Cys 277 site and blocking TRPV2 palmitoylation improved microglial Aβ phagocytosis, and TRPV2 palmitoylation was dynamically regulated by ZDHHC21. These findings underscore the opposing effects of tyrosine phosphorylation/dephosphorylation and cysteine palmitoylation/depalmitoylation on microglial Aβ phagocytosis mediated by TRPV2 channel (Fig. 7).

Fig. 7 Tyrosine phosphorylation and palmitoylation of TRPV2 ion channel tuned microglial beta-amyloid peptide phagocytosis. TRPV2 was predominantly expressed in microglia, and CBD could activate and sensitize TRPV2 channel. Short-term CBD injection (i.p.) significantly decreased chronic neuroinflammation and microglial phagocytic receptors in AD mice, and exhibited neuroprotective in neurons. Long-term CBD treatment led to neuroinflammation and impaired the expression of microglial phagocytic receptors in APP/PS1 mice. Furthermore, the hyper-sensitivity of TRPV2 channels was mediated by tyrosine phosphorylation at the Tyr(338), Tyr(466), and Tyr(520) sites, which enhanced microglial Aβ phagocytosis partially dependence on its localization. TRPV2 was palmitoylated at cysteine 277 site and blocking TRPV2 palmitoylation improved microglial Aβ phagocytosis. Moreover, it was demonstrated that TRPV2 palmitoylation was dynamically regulated by ZDHHC21. Microglial TRPV2 channels had contrasting effects on microglial Aβ phagocytosis, and were regulated by tyrosine phosphorylation/dephosphorylation and cysteine palmitoylation/depalmitoylation

Materials and methods

Key resources were shown in Table 1.

Table 1 Key resources were shown

Reagent type (species) or resource	Source	Identifiers	
Antibodies			
TRPV2	Alomone Labs (Jerusalem, Israel)	ALO-ACC-032-50	
AKT	Proteintech	BS4006	
IBA1	Proteintech	10904-1-AP	
GAPDH	Proteintech	10494-1-AP	
Alexa Flour 594-conjugated Goat Anti-Rabbit IgG (H + L)	Proteintech	SA00013-4	
NeuN	Proteintech	26975-1-AP	
DYDDDDK tag Recombinant antibody (Binds to FLAG® tag epitope)	Proteintech	80010-1-RR	
HRP-conjugated Streptavidin	Proteintech	SA00001-0	
phospho-Akt Ser473	Bioworld	9271	
CaMKIIα/δ	Bioworld	BS3433	
CaMKIIα/δ (phospho-T268)	Bioworld	BS4773	
ACE2	Bioss	bs-1004R	
Goat Anti-rabbit IgG/HRP	Bioss	bs-0295G	
APP/β-Amyloid (NAB228) Mouse mAb	Cell Signaling TECHNOLOGY	2450	
BACE	Cell Signaling TECHNOLOGY	5606	
Tau	Cell Signaling TECHNOLOGY	4019	
Anti-mouse IgG, HRP-linked Antibody	Cell Signaling TECHNOLOGY	7076	
β-Amyloid(D54D2)XP®Rabbit mAb	Cell Signaling TECHNOLOGY	8243	
Chemical compound, drug			
cannabidiol	Refines Biotechnology	13956-29-1	
PTP Inhibitor I	AbMole BioScience	M20414	
PTP Inhibitor II	AbMole BioScience	M20410	
INCB18424 (Ruxo)	AbMole BioScience	M1787	
BMCC-Biotin	Thermo scientific	XF344410	
2-Bromohexadecanoic acid	Merck	18263-25-7	
Aβ (1–42)	GL Biochem	052487	
Fitc-Aβ (1–42)	GL Biochem	250,857	
Other reagents/kits			
Glycine	BioFROxx	1275GR500	
SDS	BioFROxx	3250KG001	
Cryo Embedding Medium	Biosharp	B2557A	
Membrance and cytoplasmic Extraction kit	Biosharp	BL671A	
Anti-FLAG Nanobody Magarose beads	AlpaLifeBio	KTSM1338	
BeyoMay™ protein Atg Magnetic Beads	Beyotime	P2108	
Protein A/G Magnetic Beads	MCE	HY-K0202	
Protease inhibitor cocktail	MCE	HY-K0010	
MTT	MCE	298-93-1	
Serum-free cell Cryopreservation Medium	Cellor Lab	BY002P	
Lipofectamine 2000	Invitrogen	2,536,760	
Revertflid First strand cDNA synthesis kit	Thermo scientific	91,279,588	
GeneJET RNA Purification kit	Thermo scientific	K0731	
Taq SYBR® Green qPCR Premix	Labead	R0202-02	
E.Z.N.A.®Endo-Free plasmid Midi kit	Omega	D6915030000L02v038	
Ammonium persulfate	Tianjin Damao chemical reagent factory	7727-54-0	
paraformaldehyde	Tianjin Damao chemical reagent factory	30525-89-4	
sugar	Beichen Founder reagent factory	/	
Sodium chloride	Beichen Founder reagent factory	/	
Anhydrous sodium dihydrogen phosphate	Sinopharm Group Chemical reagent Co., LTD	7558-80-7	
Anhydrous disodium hydrogen phosphate	Sinopharm Group Chemical reagent Co., LTD	7558-79-4	
Tricolor Prestained Protein Marker	epizyme	WJ103	
carbinol	Yantai Shuangshuang Chemical Co., LTD	/	
Isopropyl alcohol	Yantai Shuangshuang Chemical Co., LTD	/	
Ethyl alcohol	Yantai Shuangshuang Chemical Co., LTD	/	
xylene	Yantai Shuangshuang Chemical Co., LTD	/	
N.N.N.n-tetramethylenediamine	Yantai Shuangshuang Chemical Co., LTD	/	
chloroform	Yantai Shuangshuang Chemical Co., LTD	/	
Tween-20	Solarbio	T8220	
Triton x-100	Solarbio	T8200	
Hydroxylamme solution	Solarbio	7803-49-8	
BCA Protein Assay Kit	Solarbio	PC0020	
β-Mercaptoethanol	Solarbio	M8210	
Normal Goat Serum	Solarbio	SL038	
Glycero	Solarbio	G8190	
Antigen Retrieval Solution, 1x	Solarbio	C1035	
Bromphenol Blue	Solarbio	115-39-9	
PMSF (100mM)	Solarbio	P0100-01	
DNase/RNase-Free water	Solarbio	R1600	
0.01 M PBS (powder, pH7.2-7.4)	Solarbio	P1010	
LB broth, powder	Solarbio	L1010	
LB agar, powder	Solarbio	L1015	
Ampicillin	Solarbio	A6920	
Kanamycin Sulfate	Solarbio	K8020	
Mounting Medium, antifading	Solarbio	S2100	
M5 Total RNA Extraction Reagent	Solarbio	MF034-01	
DMSO	Solarbio	D8371	
Polylysine, 10x	Solarbio	P2100	
RNA extract	Solarbio	P1025	
NP-40 lysisi buffer	Solarbio	N8032	
Hypersensitive ECL kit	Proandy	10,144	
WB and IP cell lysate	Beyotime	P0013J	
Hydroxylamine solution	Sigma Aldrich Trading Co., LTD	7803-49-8	
2-Bromohexadecanoic acid	Sigma Aldrich Trading Co., LTD	18263-25-7	
Sodium chloride injection	Sichuan Kelun Pharmaceutical Co., Ltd.	N23040605	
Pentobarbital sodium	Shanghai Zhongqin Chemical Reagent Co., LTD	/	
High protein skim high calcium milk powder	Erie	/	
Rabbit IgG - Immunohistochemical kit	Bosyer Bio	SA1022	

Mice and drug treatment

Male mice of 6-months overexpressing APP and PS1, as well as non-transgenic WT littermates, were obtained from Aniphe Biolaboratory (Nanjing, China). All mice were housed in pathogen-free facilities at the Experiment Animal Center of Northwest Normal University with 5–6 mice per cage. Animals were maintained with food and water ad libitum. All experimental procedures were conducted according to the Directive 2010/63/EU of the European Parliament and the Ethical Committee for Human and Animal Experimentation Guidelines at Northwest Normal University. In vivo CBD treatment, 6-month-old APP/PS1 mice or WT mice were administrated intraperitoneally (i.p.) with CBD according to the previous study [20]. The injections continued until mice were euthanized (10 mg/kg per day continued for 1 week (short-term) or 3 weeks (long-term)).

Cell culture

Primary microglia culture was prepared as previously described [23]. Newborn pups were used to isolate primary microglia, which were grown in T-25 flasks in complete DMEM supplemented with 10% FBS, 1% penicillin (70 mg/l), and streptomycin (100 mg/l). The medium was completely replaced every 3 days and achieved after 12 days. The cells were placed on a shaker at 200 rpm for 18 h, the supernatants were collected and centrifuged at 900 g for 4 min. The isolated microglia were resuspended and plated at 5 × 104 cells/cm2 in different plates. The BV-2 cell line was generously provided by Prof. Shengxiang Zhang from Lanzhou University, while human embryonic kidney (HEK) 293T cells were obtained from ATCC. Both cell lines were cultured in DMEM complete medium and maintained in a 37 °C incubator with 5% CO2 and 95% humidity. To prepare the CBD solution, it was first dissolved in anhydrous ethyl alcohol and then diluted with serum-free medium.

Western blot and immunoprecipitation assays

Immunoblotting was performed according to previously study [33]. Brain tissues were homogenized, and cells were scraped in ice-cold RIPA protein lysis buffer supplemented with 1% Protease inhibitor cocktail and PMSF. The BCA assay method was used to quantify the concentration. Samples (20 µg) were prepared, subjected to SDS-PAGE, then transferred onto nitrocellulose membranes. The membranes were blocked with 10% nonfat skim milk at room temperature (RT) for 1 h, and incubated overnight at 4 °C with the corresponding primary antibodies. After washing with TBST, the membranes were incubated with the appropriate HRP-conjugated secondary antibodies. Protein bands were visualized using a chemiluminescent HRP substrate and quantified using ImageJ software.

For immunoprecipitation, 1 µg of anti-TRPV2 antibody was conjugated with 25 µl of nanobody manarose beads or protein A/G magnetic beads at 4 °C for 1 h on a shaking platform. The conjugated beads were washed three times with lysis buffer. They were incubated with 0.2 mg of precleared tissues or cell lysates and left overnight at 4 °C. Following another set of washes, the resulting precipitants were resuspended in 2 × SDS sample buffer, boiled, and subjected to SDS-PAGE. Finally, immunoblot analysis was conducted using the appropriate antibodies.

Immunohistochemistry

Following CBD or saline injection, both the APP/PS1 and WT mice were perfused with ice-cold heparinized saline and 4% paraformaldehyde in 0.1 M PBS at pH 7.4. Brains were collected and fixed for 72 h at 4 °C. To facilitate dehydration, brains were treated with sucrose solution (10%, 20%, and 30%) and then embedded in O.C.T. compound. Coronal Sect. (10 μm) were prepared using a freezing microtome. Endogenous peroxidases were inhibited with 3% H2O2, and sections were blocked for 1.5 h with 5% goat serum containing 0.3% Triton X-100 before overnight incubation with primary antibodies at 4 °C. Detection was performed using SABC-POD and DAB kits and images were captured using a light microscope (Leica, Germany). Quantitative analysis was performed using ImageJ, and determined the number of Aβ plaques and NeuN levels in the prefrontal cortex (PFC) and hippocampal DG region. Three slices per mouse and five mice per group were sampled, average data were used to represent the data for each mouse.

Preparation of amyloid-beta

The preparation of amyloid-beta was adapted from a previous study [33]. Amyloid peptides (1–42) were dissolved in 20 µl of DMSO and vigorously mixed for 5 min on a shaker. Next, 424 µl of PBS was added to the solution to achieve a final concentration of 500 µM. The solution was then incubated at 37 °C for 24 h, it was centrifuged at 14,000 g for 10 min at 4 °C. The resulting supernatant, containing soluble Aβ1–42 oligomers, was collected for further use.

Immunocytochemistry

Cells were cultured on poly-D-lysine coated coverslips in 24-well plates. Following treatment, cells were fixed with 2% paraformaldehyde for 20 min, followed by triple washes with PBS for 5 min each. After permeabilized with 1% Triton X-100 for 7 min and blocked using 10% normal goat serum for 1 h, Subsequently, cells were subjected to overnight incubation at 4 °C with antibodies (1:200). After three washes with PBS at RT. A fluorescent goat anti-rabbit secondary antibody labeled with Alexa Fluor 594 (1:400) were incubated for 90 min. The cells were stained with Hoechst 33,258 and coverslips were mounted onto microscope slides using Fluoromount-G. Immunofluorescence sections were captured using fluorescence microscope (Leica, Germany) at 20 × and 40 × magnifications. Image processing and analysis were performed using ImageJ, and immunofluorescence density was quantified across at least five selected images.

Quantitative reverse transcription (qRT) PCR

RNA was extracted from brain tissues using either the RNeasy Mini Kit or TRIzol, following the manufacturer’s instructions. The quantity and quality of the purified RNAs were assessed using NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific). Subsequently, cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit. The synthesized cDNA was then amplified in a 20 µl PCR reaction using SYBR green PCR master mix (TIANGEN, # FP205). Primer pairs listed in Table 2 were used for amplification. Gene expression was analyzed using a real-time detection system (Thermo Scientific) using 96-well plates in a total reaction volume of 20 µl. The expression levels of the target genes were normalized to GAPDH expression in the same sample, and quantified using the 2−ΔΔCt method.

Table 2 Primers and their sequences for fluorescence quantitative PCR

Primer	sequence	
TRPV2 Forward

TRPV2 Reverse

TREM2 Forward

TREM2 Reverse

Gpr34 Forward

Gpr34 Reverse

P2Y6 Forward

P2Y6 Reverse

IL-4 Forward

IL-4 Reverse

Iba1 Forward

Iba1 Reverse

Cr3 Forward

Cr3 Reverse

TNFα Forward

TNFα Reverse

IL-1β Forward

IL-1β Reverse

IL-6 Forward

IL-6 Reverse

GAPDH Forward

GAPDH Reverse

	GGTATGGGTGAGCTGGCTTTT

AGGACGTAGGTGAGGAGGAC

CTGATCACAGCCCTGTCCCAA

CGTCTCCCCCAGTGCTTCAA

CTTCAGGAAAGCTTCAACTC

GTAACTATCAGGAGGAGAGC

GTGAGGATTTCAAGCGACTGC

TCCCCTCTGGCGTAGTTATAGA

GGTCTCAACCCCCAGCTAGT

GCCGATGATCTCTCTCAAGTGAT

ATCAACAAGCAATTCCTCGATGA

CAGCATTCGCTTCAAGGACATA

AATTGAGGGCACGCAGACA

GCCCAGCAAGGGACCATTAG

ACTCCAGGCGGTGCCTATGT

GTGAGGGTCTGGGCCATAGAA

TCCAGGATGAGGACATGAGCAC

GAACGTCACACACCAGCAGGTTA

CCACTTCACAAGTCGGAGGCTTA

CCAGTTTGGTAGCATCCATCATTTC

TGTGTCCGTCGTGGATCTGA

TTGCTGTTGAAGTCGCAGGAG

	

Phagocytosis assays

The phagocytosis of aggregated Aβ1–42 was analyzed according to previously study [20]. In brief, FITC-Aβ1–42 was allowed to aggregate for 24 h at 37 °C. Microglia were seeded at a density of 2 × 104 cells per well in 96-well plates and incubated overnight. After treatment, the culture media was removed, and the cells were washed twice with fresh complete DMEM remove any extracellular Aβ. Finally, the plate was protected from light, and the fluorescence intensity was measured at 485-nm excitation/538-nm emission using a multifunctional microplate reader. Results are expressed as the percentage of fold-change in fluorescence intensity compared to control samples.

Cell survival and apoptosis assay

Cell viability was evaluated using the 3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide salt (MTT) reduction assay. Cells were treated with MTT and incubated for 4 h. After removing the culture medium, DMSO was added to dissolve the formazan crystals. The absorbance at 490 nm was measured using a multifunctional microplate reader. To quantify apoptosis, primary neurons were fixed in 2% paraformaldehyde and stained with 1 µg/ml of the DNA dye Hoechst 33,342. Apoptotic cells, characterized by fragmented or condensed nuclei, were observed under a fluorescence microscope, while cells showing uniformly stained nuclei were scored as viable. At least 300 neurons from 6 randomly selected fields per well were counted for quantification.

Plasmid construction, and transfection

For plasmid construction and transfection, mouse TRPV2 cDNA sequences were mutated into the pCMV-3×FLAG-Neo vector (MIAOLING BIOLOGY, Wuhan, China). Various plasmids, including pCMV-TRPV2-Y338F-3FLAG-Neo (# G20943), pCMV-TRPV2-Y466F-3FLAG-Neo (# G20944), pCMV-TRPV2-Y520F-3FLAG-Neo (# G20945), pCMV-TRPV2-Y338/466/520F-3FLAG-Neo (# G20946), pCMV-TRPV2-C277A-3FLAG-Neo, pCMV-TRPV2-3FLAG-Neo and pCMV-HA-ZDHHC21-Neo employed. Briefly, BV2 or HEK293T cells were seeded at densities of 2.0 × 105 cells per well in a 6-well plate, 5.0 × 104 cells per well in a 24-well plate, and 1.0 × 104 cells per well in a 96-well plate. Transfection was conducted with 2 µg of DNA, diluted in 1800 µl–450 µl of fresh DEME, and incubated for 5 min, and followed by the addition of 4 µl Lipofectamine 2000. After a 20-min incubation, the mixture was added to the cells and incubated 4 h, subsequently, the medium was replaced, and the cells were cultured for 48 h. Tyrosine phosphorylation analysis of TRPV2 was performed using immunoblotting, immunocytochemistry, or phagocytosis assays following established protocols.

Acyl-biotin exchange (ABE) assay

The ABE assay was conducted following the previous study [34]. Briefly, cells transfected with pCMV-TRPV2-3FLAG-Neo plasmid and pCMV-TRPV2-C277A-3FLAG-Neo were harvested 48 h post-transfection and rinsed with cold PBS. Prior to lysing cells or brain tissue, a solution of 50 mM N-ethylmaleimide (NEM; Sangon Biotech, A600450) in ethanol was freshly added to lysis buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1 mM MgCl2; 1% NP-40; and 10% glycerol) with inhibitor cocktail. The cell and brain tissue lysates were then suspended in the lysis buffer containing NEM and incubated at 4 °C for 1.5 h, followed by centrifugation at 15,000 rpm for 30 min at 4 °C. The supernatants were incubated overnight with both anti-Flag antibody (GenScript, 80010-1-RR) or HA-tag (Santa Cruz Biotechnology, sc-7392) and protein A/G magnetic beads (MedChemExpress, HY-K0202). After incubation, the beads underwent five washes with lysis buffer (pH 7.5) followed by three washes with lysis buffer (pH 7.2). For hydroxylamine (HAM; MACKLIN, H828371) treatment, the beads were divided into two equal tubes (+ HAM and -HAM). The + HAM tube received freshly prepared lysis buffer (50 mM Tris-HCl, pH 7.2; 150 mM NaCl; 1 mM MgCl2; 1% NP-40; 10% glycerol; 0.75 M HAM; and inhibitor cocktail) and was incubated at RT for 1 h. The HAM tube served as a control and received lysis buffer at pH 7.2. The beads were washed four times with lysis buffer (pH 7.2) and then three washes with lysis buffer (pH 6.2). Subsequently, the beads were treated with 5 µM biotin-BMCC (Sangon Biotech, C1002225) in freshly prepared lysis buffer (pH 6.2) and incubated for 1 h at 4 °C. The immunoprecipitated samples were detected using western blotting with HRP-conjugated streptavidin (Beyotime, SA00001-0) and anti-Flag or -HA antibody.

Membrane and cytosol preparation

Membrane and cytosol preparation was assessed using a slightly modified membrane assay. Plasmids were transfected into BV2 cells for 48 h. Approximately 1 × 107 cells were harvested and washed twice with cold PBS (1, 000 g each time, 5 min). Then cells were treated with 1 ml of lysis buffer (1 ml lysis buffer + 1 µl DTT + 1 µl protease inhibitor) to each sample, followed by freezing in liquid nitrogen and thawing at 37 °C. The cells were vortexed for 30 s and placed on ice for five cycles of 1 min each. The samples were centrifuged at 14,000 g for 10 min at 4 °C, and the supernatant was the cytoplasm. The membrane fraction was isolated by centrifugation at 15,000 rpm for 20 min at 4 °C.

Model building and bioinformatics analysis

The conformance of TRPV2 sequences in mice was predicted using the website https://www.ebi.ac.uk/Tools/msa/clustalo/. IBS software was used to map different regions of TRPV2. AlphaFold2 was used to mark the binding sites of TRPV2 (TRPV2-MOUSE, # Q9WTR1) to CBD and analyzed by VMD software. For TRPV2 gene expression analysis, the Z-score of cell-type specific data from healthy human brain cortical tissue for each gene across samples was utilized, as shown in previous study, the score of τ is ≥ 0.8, the gene was selected for further analysis [32].

Statistical analysis

The data are presented as means ± standard errors and analyzed using GraphPad software (GraphPad Software Inc., La Jolla, CA, USA) and SPSS software (SPSS Inc., Chicago, IL, USA). The statistical significance of the difference between two groups was determined using the unpaired, two-tailed Student’s t-test analysis. For comparison involving multiple groups, one-way ANOVA followed by Post hoc Tukey’s test was applied. Data points that deviated more than two standard deviations from the mean were identified as significant outliers and were excluded from further analysis. Statistical significance levels of p < 0.05, p < 0.01, and p < 0.001 are indicated in the figures.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Acknowledgements

This work was funded by the National Nature Science Foundation of China (Grant no. 32360219 and no. 32160210.); Natural Science Foundation of Gansu Province (Grant no.21JR7RA137); Youth Talents Lifting Project Foundation of Northwest Normal University (NWNU-LKQN2021-01).

Author contributions

The conception and design of the work were prepared by Yang S. The experiment was performed by Du Y, Zhao XQ, Tang Q, and Li Y, while the analysis and interpretation of data were done by Du Y and Zhang Y. Drafting of the manuscript was done by Yang S. All the authors revised the manuscript and approved the submission.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Approved by Ethical Committee for Human and Animal Experimentation Guidelines at Northwest Normal University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

ABE Acyl-biotin exchange

AD Alzheime’s disease

Aβ Amyloid –β

Akt Protein kinase B

2-BP 2-Bromopalmitate

CBD Cannabidiol

CNS Central nervous system

CR3 Complement receptor 3

DG Dentate gyrus

DMEM Dulbecco’s modified Eagle’s medium

ECL Chemiluminescence

FBS Fetal bovine serum

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GPR34 G protein–coupled receptor 34

HEK Human embryonic kidney

IGF-1 Insulin-like growth factor-1

i.p Intraperitoneally

IL-6 Interleukin-6

IL-1β Interleukin-1β

MCI Mild cognitive impairment

MTT 3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide salt

NEM N-ethylmaleimide

NORT Novel object recognition task

OGD Oxygen-glucose deprivation

P2Y6 Pyrimidinergic receptor

PBS Phosphate-buffered saline

PFC Prefrontal cortex

PI3K Phosphoinositide 3-kinase

PTPN1 Protein tyrosine phosphatase non-receptor type 1

qRT-PCR Quantitative realtime polymerase chain reaction

TBST Tris-buffered saline-Tween

TNFα Tumor necrosis factor α

Trem2 Triggering receptor expressed on myeloid cells

T2DM Type 2 diabetes mellitus

TRPV2 Transient receptor potential vanilloid family type 2

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Jucker M Walker LC Alzheimer’s disease: from immunotherapy to immunoprevention Cell 2023 186 4260 70 10.1016/j.cell.2023.08.021 37729908
Jucker M, Walker LC. Alzheimer’s disease: from immunotherapy to immunoprevention. Cell. 2023;186:4260–70.37729908 10.1016/j.cell.2023.08.021
2. Verkhratsky A Zorec R Rodríguez JJ Astroglia dynamics in ageing and Alzheimer’s disease Curr Opin Pharmacol 2016 26 74 9 10.1016/j.coph.2015.09.011 26515274
Verkhratsky A, Zorec R, Rodríguez JJ, et al. Astroglia dynamics in ageing and Alzheimer’s disease. Curr Opin Pharmacol. 2016;26:74–9.26515274 10.1016/j.coph.2015.09.011
3. GBD 2019 Dementia Forecasting Collaborators Estimation of the global prevalence of dementia in 2019 and forecasted prevalence in 2050: an analysis for the global burden of Disease Study 2019 Lancet Public Health 2022 7 e105 25 10.1016/S2468-2667(21)00249-8 34998485
GBD 2019 Dementia Forecasting Collaborators. Estimation of the global prevalence of dementia in 2019 and forecasted prevalence in 2050: an analysis for the global burden of Disease Study 2019. Lancet Public Health. 2022;7:e105–25.34998485 10.1016/S2468-2667(21)00249-8
4. Querfurth HW LaFerla FM Alzheimer’s disease N Engl J Med 2010 362 329 44 10.1056/NEJMra0909142 20107219
Querfurth HW, LaFerla FM. Alzheimer’s disease. N Engl J Med. 2010;362:329–44.20107219 10.1056/NEJMra0909142
5. Scheltens P Blennow K Breteler MM Alzheimer’s disease Lancet 2016 388 505 17 10.1016/S0140-6736(15)01124-1 26921134
Scheltens P, Blennow K, Breteler MM, et al. Alzheimer’s disease. Lancet. 2016;388:505–17.26921134 10.1016/S0140-6736(15)01124-1
6. Wang J Gu BJ Masters CL A systemic view of Alzheimer disease - insights from amyloid-β metabolism beyond the brain Nat Rev Neurol 2017 13 612 23 10.1038/nrneurol.2017.111 28960209
Wang J, Gu BJ, Masters CL, et al. A systemic view of Alzheimer disease - insights from amyloid-β metabolism beyond the brain. Nat Rev Neurol. 2017;13:612–23.28960209 10.1038/nrneurol.2017.111
7. Huang Y Happonen KE Burrola PG Microglia use TAM receptors to detect and engulf amyloid β plaques Nat Immunol 2021 22 586 94 10.1038/s41590-021-00913-5 33859405
Huang Y, Happonen KE, Burrola PG, et al. Microglia use TAM receptors to detect and engulf amyloid β plaques. Nat Immunol. 2021;22:586–94.33859405 10.1038/s41590-021-00913-5
8. Zhou Y Song WM Andhey PS Human and mouse single-nucleus transcriptomics reveal TREM2-dependent and TREM2-independent cellular responses in Alzheimer’s disease Nat Med 2020 26 131 42 10.1038/s41591-019-0695-9 31932797
Zhou Y, Song WM, Andhey PS, et al. Human and mouse single-nucleus transcriptomics reveal TREM2-dependent and TREM2-independent cellular responses in Alzheimer’s disease. Nat Med. 2020;26:131–42.31932797 10.1038/s41591-019-0695-9
9. Tang R Liu H Identification of temporal characteristic networks of peripheral blood changes in Alzheimer’s Disease based on weighted gene co-expression network analysis Front Aging Neurosci 2019 11 83 10.3389/fnagi.2019.00083 31178714
Tang R, Liu H. Identification of temporal characteristic networks of peripheral blood changes in Alzheimer’s Disease based on weighted gene co-expression network analysis. Front Aging Neurosci. 2019;11:83.31178714 10.3389/fnagi.2019.00083
10. Entin-Meer M Cohen L Hertzberg-Bigelman E TRPV2 knockout mice demonstrate an improved cardiac performance following myocardial infarction due to attenuated activity of peri-infarct macrophages PLoS ONE 2017 12 e0177132 10.1371/journal.pone.0177132 28481959
Entin-Meer M, Cohen L, Hertzberg-Bigelman E, et al. TRPV2 knockout mice demonstrate an improved cardiac performance following myocardial infarction due to attenuated activity of peri-infarct macrophages. PLoS ONE. 2017;12:e0177132.28481959 10.1371/journal.pone.0177132
11. Lévêque M Penna A Le Trionnaire S Phagocytosis depends on TRPV2-mediated calcium influx and requires TRPV2 in lipids rafts: alteration in macrophages from patients with cystic fibrosis Sci Rep 2018 8 4310 10.1038/s41598-018-22558-5 29523858
Lévêque M, Penna A, Le Trionnaire S, et al. Phagocytosis depends on TRPV2-mediated calcium influx and requires TRPV2 in lipids rafts: alteration in macrophages from patients with cystic fibrosis. Sci Rep. 2018;8:4310.29523858 10.1038/s41598-018-22558-5
12. Shibasaki K Murayama N Ono K TRPV2 enhances axon outgrowth through its activation by membrane stretch in developing sensory and motor neurons J Neurosci 2010 30 4601 12 10.1523/JNEUROSCI.5830-09.2010 20357111
Shibasaki K, Murayama N, Ono K, et al. TRPV2 enhances axon outgrowth through its activation by membrane stretch in developing sensory and motor neurons. J Neurosci. 2010;30:4601–12.20357111 10.1523/JNEUROSCI.5830-09.2010
13. Santoni G Farfariello V Liberati S The role of transient receptor potential vanilloid type-2 ion channels in innate and adaptive immune responses Front Immunol 2013 4 34 10.3389/fimmu.2013.00034 23420671
Santoni G, Farfariello V, Liberati S, et al. The role of transient receptor potential vanilloid type-2 ion channels in innate and adaptive immune responses. Front Immunol. 2013;4:34.23420671 10.3389/fimmu.2013.00034
14. Su N Zhen W Zhang H Structural mechanisms of TRPV2 modulation by endogenous and exogenous ligands Nat Chem Biol 2023 19 72 80 10.1038/s41589-022-01139-8 36163384
Su N, Zhen W, Zhang H, et al. Structural mechanisms of TRPV2 modulation by endogenous and exogenous ligands. Nat Chem Biol. 2023;19:72–80.36163384 10.1038/s41589-022-01139-8
15. Coles M Watt G Kreilaus F Medium-dose chronic cannabidiol treatment reverses object recognition memory deficits of APP swe /PS1∆E9 transgenic female mice Front Pharmacol 2020 11 587604 10.3389/fphar.2020.587604 33424597
Coles M, Watt G, Kreilaus F, et al. Medium-dose chronic cannabidiol treatment reverses object recognition memory deficits of APP swe /PS1∆E9 transgenic female mice. Front Pharmacol. 2020;11:587604.33424597 10.3389/fphar.2020.587604
16. Hao FJ Feng YQ Cannabidiol (CBD) enhanced the hippocampal immune response and autophagy of APP/PS1 Alzheimer’s mice uncovered by RNA-seq Life Sci 2021 264 118624 10.1016/j.lfs.2020.118624 33096116
Hao FJ, Feng YQ. Cannabidiol (CBD) enhanced the hippocampal immune response and autophagy of APP/PS1 Alzheimer’s mice uncovered by RNA-seq. Life Sci. 2021;264:118624.33096116 10.1016/j.lfs.2020.118624
17. Wang ZZ, Zheng P, Chen X et al. Cannabidiol induces autophagy and improves neuronal health associated with SIRT1 mediated longevity.Geroscience. 2022;44:1505–24.
18. Gochman A Tan XF Bae C Cannabidiol sensitizes TRPV2 channels to activation by 2-APB Elife 2023 12 e86166 10.7554/eLife.86166 37199723
Gochman A, Tan XF, Bae C, et al. Cannabidiol sensitizes TRPV2 channels to activation by 2-APB. Elife. 2023;12:e86166.37199723 10.7554/eLife.86166
19. Pumroy RA Samanta A Liu Y Molecular mechanism of TRPV2 channel modulation by cannabidiol Elife 2019 8 e48792 10.7554/eLife.48792 31566564
Pumroy RA, Samanta A, Liu Y, et al. Molecular mechanism of TRPV2 channel modulation by cannabidiol. Elife. 2019;8:e48792.31566564 10.7554/eLife.48792
20. Yang S Du Y Zhao X Cannabidiol enhances microglial Beta-amyloid peptide phagocytosis and clearance via Vanilloid Family Type 2 Channel activation Int J Mol Sci 2022 23 5367 10.3390/ijms23105367 35628181
Yang S, Du Y, Zhao X, et al. Cannabidiol enhances microglial Beta-amyloid peptide phagocytosis and clearance via Vanilloid Family Type 2 Channel activation. Int J Mol Sci. 2022;23:5367.35628181 10.3390/ijms23105367
21. Lana D Landucci E Mazzantini C The Protective Effect of CBD in a model of in Vitro Ischemia May be mediated by Agonism on TRPV2 Channel and Microglia activation Int J Mol Sci 2022 23 12144 10.3390/ijms232012144 36292998
Lana D, Landucci E, Mazzantini C, et al. The Protective Effect of CBD in a model of in Vitro Ischemia May be mediated by Agonism on TRPV2 Channel and Microglia activation. Int J Mol Sci. 2022;23:12144.36292998 10.3390/ijms232012144
22. Hu J Gao Y Huang Q Flotillin-1 interacts with and sustains the surface levels of TRPV2 Channel Front Cell Dev Biol 2021 9 634160 10.3389/fcell.2021.634160 33634132
Hu J, Gao Y, Huang Q, et al. Flotillin-1 interacts with and sustains the surface levels of TRPV2 Channel. Front Cell Dev Biol. 2021;9:634160.33634132 10.3389/fcell.2021.634160
23. Maksoud MJE Tellios V An D Nitric oxide upregulates microglia phagocytosis and increases transient receptor potential vanilloid type 2 channel expression on the plasma membrane Glia 2019 67 2294 311 10.1002/glia.23685 31453646
Maksoud MJE, Tellios V, An D, et al. Nitric oxide upregulates microglia phagocytosis and increases transient receptor potential vanilloid type 2 channel expression on the plasma membrane. Glia. 2019;67:2294–311.31453646 10.1002/glia.23685
24. Maksoud MJE Tellios V Lu WY Nitric oxide attenuates microglia proliferation by sequentially facilitating calcium influx through TRPV2 channels, activating NFATC2, and increasing p21 transcription Cell Cycle 2021 20 417 33 10.1080/15384101.2021.1877936 33530820
Maksoud MJE, Tellios V, Lu WY. Nitric oxide attenuates microglia proliferation by sequentially facilitating calcium influx through TRPV2 channels, activating NFATC2, and increasing p21 transcription. Cell Cycle. 2021;20:417–33.33530820 10.1080/15384101.2021.1877936
25. Fricke TC Echtermeyer F Zielke J Oxidation of methionine residues activates the high-threshold heat-sensitive ion channel TRPV2 Proc Natl Acad Sci U S A 2019 116 24359 65 10.1073/pnas.1904332116 31719194
Fricke TC, Echtermeyer F, Zielke J, et al. Oxidation of methionine residues activates the high-threshold heat-sensitive ion channel TRPV2. Proc Natl Acad Sci U S A. 2019;116:24359–65.31719194 10.1073/pnas.1904332116
26. Mo X Pang P Wang Y Tyrosine phosphorylation tunes chemical and thermal sensitivity of TRPV2 ion channel Elife 2022 11 e78301 10.7554/eLife.78301 35686730
Mo X, Pang P, Wang Y, et al. Tyrosine phosphorylation tunes chemical and thermal sensitivity of TRPV2 ion channel. Elife. 2022;11:e78301.35686730 10.7554/eLife.78301
27. Ernst AM Syed SA Zaki O S-Palmitoylation Sorts Membrane Cargo for Anterograde Transport in the Golgi Dev Cell 2018 47 479 e493477 10.1016/j.devcel.2018.10.024 30458139
Ernst AM, Syed SA, Zaki O, et al. S-Palmitoylation Sorts Membrane Cargo for Anterograde Transport in the Golgi. Dev Cell. 2018;47:479–e493477.30458139 10.1016/j.devcel.2018.10.024
28. Yuan W Lu L Rao M GFAP hyperpalmitoylation exacerbates astrogliosis and neurodegenerative pathology in PPT1-deficient mice Proc Natl Acad Sci U S A 2021 118 e2022261118 10.1073/pnas.2022261118 33753498
Yuan W, Lu L, Rao M, et al. GFAP hyperpalmitoylation exacerbates astrogliosis and neurodegenerative pathology in PPT1-deficient mice. Proc Natl Acad Sci U S A. 2021;118:e2022261118.33753498 10.1073/pnas.2022261118
29. Gao X Kuo CW Main A Palmitoylation regulates cellular distribution of and transmembrane ca flux through TrpM7 Cell Calcium 2022 106 102639 10.1016/j.ceca.2022.102639 36027648
Gao X, Kuo CW, Main A, et al. Palmitoylation regulates cellular distribution of and transmembrane ca flux through TrpM7. Cell Calcium. 2022;106:102639.36027648 10.1016/j.ceca.2022.102639
30. Chandra M Zhou H Li Q A role for the Ca2 + channel TRPML1 in gastric acid secretion, based on analysis of knockout mice Gastroenterol Gastroenterol 2011 140 857 67 10.1053/j.gastro.2010.11.040
Chandra M, Zhou H, Li Q, et al. A role for the Ca2 + channel TRPML1 in gastric acid secretion, based on analysis of knockout mice. Gastroenterol Gastroenterol. 2011;140:857–67.10.1053/j.gastro.2010.11.040
31. Hong C Choi SH Kwak M TRPC5 channel instability induced by depalmitoylation protects striatal neurons against oxidative stress in Huntington’s disease Biochim Biophys Acta Mol Cell Res 2020 1867 118620 10.1016/j.bbamcr.2019.118620 31812495
Hong C, Choi SH, Kwak M, et al. TRPC5 channel instability induced by depalmitoylation protects striatal neurons against oxidative stress in Huntington’s disease. Biochim Biophys Acta Mol Cell Res. 2020;1867:118620.31812495 10.1016/j.bbamcr.2019.118620
32. Galea E Weinstock LD Larramona-Arcas R Multi-transcriptomic analysis points to early organelle dysfunction in human astrocytes in Alzheimer’s disease Neurobiol Dis 2022 166 105655 10.1016/j.nbd.2022.105655 35143967
Galea E, Weinstock LD, Larramona-Arcas R, et al. Multi-transcriptomic analysis points to early organelle dysfunction in human astrocytes in Alzheimer’s disease. Neurobiol Dis. 2022;166:105655.35143967 10.1016/j.nbd.2022.105655
33. Yang S Pascual-Guiral S Ponce R Reducing the levels of akt activation by PDK1 knock-in mutation protects neuronal cultures against Synthetic amyloid-Beta peptides Front Aging Neurosci 2018 9 435 10.3389/fnagi.2017.00435 29358916
Yang S, Pascual-Guiral S, Ponce R, et al. Reducing the levels of akt activation by PDK1 knock-in mutation protects neuronal cultures against Synthetic amyloid-Beta peptides. Front Aging Neurosci. 2018;9:435.29358916 10.3389/fnagi.2017.00435
34. Huang X Yao J Liu L S-acylation of p62 promotes p62 droplet recruitment into autophagosomes in mammalian autophagy Mol Cell 2023 83 3485 e35013411 10.1016/j.molcel.2023.09.004 37802024
Huang X, Yao J, Liu L, et al. S-acylation of p62 promotes p62 droplet recruitment into autophagosomes in mammalian autophagy. Mol Cell. 2023;83:3485–e35013411.37802024 10.1016/j.molcel.2023.09.004
35. Mukai K Konno H Akiba T Activation of STING requires palmitoylation at the Golgi Nat Commun 2016 7 11932 10.1038/ncomms11932 27324217
Mukai K, Konno H, Akiba T, et al. Activation of STING requires palmitoylation at the Golgi. Nat Commun. 2016;7:11932.27324217 10.1038/ncomms11932
36. Bluhm Y Raudszus R Wagner A Valdecoxib blocks rat TRPV2 channels Eur J Pharmacol 2022 915 174702 10.1016/j.ejphar.2021.174702 34919887
Bluhm Y, Raudszus R, Wagner A, et al. Valdecoxib blocks rat TRPV2 channels. Eur J Pharmacol. 2022;915:174702.34919887 10.1016/j.ejphar.2021.174702
37. Aso E Palomer E Juvés S CB1 agonist ACEA protects neurons and reduces the cognitive impairment of AβPP/PS1 mice J Alzheimers Dis 2012 30 439 59 10.3233/JAD-2012-111862 22451318
Aso E, Palomer E, Juvés S, et al. CB1 agonist ACEA protects neurons and reduces the cognitive impairment of AβPP/PS1 mice. J Alzheimers Dis. 2012;30:439–59.22451318 10.3233/JAD-2012-111862
38. Martín-Moreno AM Brera B Spuch C Prolonged oral cannabinoid administration prevents neuroinflammation, lowers β-amyloid levels and improves cognitive performance in tg APP 2576 mice J Neuroinflammation 2012 9 8 10.1186/1742-2094-9-8 22248049
Martín-Moreno AM, Brera B, Spuch C, et al. Prolonged oral cannabinoid administration prevents neuroinflammation, lowers β-amyloid levels and improves cognitive performance in tg APP 2576 mice. J Neuroinflammation. 2012;9:8.22248049 10.1186/1742-2094-9-8
39. Karl T Garner B Cheng D The therapeutic potential of the phytocannabinoid cannabidiol for Alzheimer’s disease Behav Pharmacol 2017 28 142 60 10.1097/FBP.0000000000000247 27471947
Karl T, Garner B, Cheng D. The therapeutic potential of the phytocannabinoid cannabidiol for Alzheimer’s disease. Behav Pharmacol. 2017;28:142–60.27471947 10.1097/FBP.0000000000000247
40. Pumroy RA Protopopova AD Fricke TC Structural insights into TRPV2 activation by small molecules Nat Commun 2022 13 2334 10.1038/s41467-022-30083-3 35484159
Pumroy RA, Protopopova AD, Fricke TC, et al. Structural insights into TRPV2 activation by small molecules. Nat Commun. 2022;13:2334.35484159 10.1038/s41467-022-30083-3
41. Zhang L Simonsen C Zimova L Cannabinoid non-cannabidiol site modulation of TRPV2 structure and function Nat Commun 2022 13 7483 10.1038/s41467-022-35163-y 36470868
Zhang L, Simonsen C, Zimova L, et al. Cannabinoid non-cannabidiol site modulation of TRPV2 structure and function. Nat Commun. 2022;13:7483.36470868 10.1038/s41467-022-35163-y
42. Luo H Rossi E Saubamea B Cannabidiol increases Proliferation, Migration, Tubulogenesis, and Integrity of Human Brain endothelial cells through TRPV2 activation Mol Pharm 2019 16 1312 26 10.1021/acs.molpharmaceut.8b01252 30721081
Luo H, Rossi E, Saubamea B, et al. Cannabidiol increases Proliferation, Migration, Tubulogenesis, and Integrity of Human Brain endothelial cells through TRPV2 activation. Mol Pharm. 2019;16:1312–26.30721081 10.1021/acs.molpharmaceut.8b01252
43. Jiang T Tan L Zhu XC Upregulation of TREM2 ameliorates neuropathology and rescues spatial cognitive impairment in a transgenic mouse model of Alzheimer’s disease Neuropsychopharmacology 2014 39 2949 62 10.1038/npp.2014.164 25047746
Jiang T, Tan L, Zhu XC, et al. Upregulation of TREM2 ameliorates neuropathology and rescues spatial cognitive impairment in a transgenic mouse model of Alzheimer’s disease. Neuropsychopharmacology. 2014;39:2949–62.25047746 10.1038/npp.2014.164
44. Lee CYD Daggett A Gu X Elevated TREM2 gene dosage reprograms Microglia Responsivity and ameliorates pathological phenotypes in Alzheimer’s Disease models Neuron 2018 97 1032 e10481035 10.1016/j.neuron.2018.02.002 29518357
Lee CYD, Daggett A, Gu X, et al. Elevated TREM2 gene dosage reprograms Microglia Responsivity and ameliorates pathological phenotypes in Alzheimer’s Disease models. Neuron. 2018;97:1032–e10481035.29518357 10.1016/j.neuron.2018.02.002
45. Lucin KM O’Brien CE Bieri G Microglial beclin 1 regulates retromer trafficking and phagocytosis and is impaired in Alzheimer’s disease Neuron 2013 79 873 86 10.1016/j.neuron.2013.06.046 24012002
Lucin KM, O’Brien CE, Bieri G, et al. Microglial beclin 1 regulates retromer trafficking and phagocytosis and is impaired in Alzheimer’s disease. Neuron. 2013;79:873–86.24012002 10.1016/j.neuron.2013.06.046
46. Wang WY Tan MS Yu JT Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease Ann Transl Med 2015 3 136 26207229
Wang WY, Tan MS, Yu JT, et al. Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann Transl Med. 2015;3:136.26207229
47. Sipe GO Lowery RL Tremblay M Microglial P2Y12 is necessary for synaptic plasticity in mouse visual cortex Nat Commun 2016 7 10905 10.1038/ncomms10905 26948129
Sipe GO, Lowery RL, Tremblay M, et al. Microglial P2Y12 is necessary for synaptic plasticity in mouse visual cortex. Nat Commun. 2016;7:10905.26948129 10.1038/ncomms10905
48. Kleinridders A, Ferris HA, Reyzer ML et al. Regional differences in brain glucose metabolism determined by imaging mass spectrometry.Mol Metab. 2018;12:113–21.
49. Enrich-Bengoa J Manich G Valente T TRPV2: a Key Player in Myelination disorders of the Central Nervous System Int J Mol Sci 2022 23 3617 10.3390/ijms23073617 35408977
Enrich-Bengoa J, Manich G, Valente T, et al. TRPV2: a Key Player in Myelination disorders of the Central Nervous System. Int J Mol Sci. 2022;23:3617.35408977 10.3390/ijms23073617
50. Agarwal N Taberner FJ Rangel Rojas D SUMOylation of enzymes and Ion channels in sensory neurons protects against metabolic dysfunction, Neuropathy, and sensory loss in diabetes Neuron 2020 107 1141 e11591147 10.1016/j.neuron.2020.06.037 32735781
Agarwal N, Taberner FJ, Rangel Rojas D, et al. SUMOylation of enzymes and Ion channels in sensory neurons protects against metabolic dysfunction, Neuropathy, and sensory loss in diabetes. Neuron. 2020;107:1141–e11591147.32735781 10.1016/j.neuron.2020.06.037
51. Studer M McNaughton PA Modulation of single-channel properties of TRPV1 by phosphorylation J Physiol 2010 588 3743 56 10.1113/jphysiol.2010.190611 20693293
Studer M, McNaughton PA. Modulation of single-channel properties of TRPV1 by phosphorylation. J Physiol. 2010;588:3743–56.20693293 10.1113/jphysiol.2010.190611
52. Zhang X Huang J McNaughton PA NGF rapidly increases membrane expression of TRPV1 heat-gated ion channels Embo j 2005 24 4211 23 10.1038/sj.emboj.7600893 16319926
Zhang X, Huang J, McNaughton PA. NGF rapidly increases membrane expression of TRPV1 heat-gated ion channels. Embo j. 2005;24:4211–23.16319926 10.1038/sj.emboj.7600893
