
==== Front
Eur J Med Res
Eur J Med Res
European Journal of Medical Research
0949-2321
2047-783X
BioMed Central London

39223620
2025
10.1186/s40001-024-02025-w
Research
Ginsenoside Rh2 suppresses ferroptosis in ulcerative colitis by targeting specific protein 1 by upregulating microRNA-125a-5p
Zhao Xun
Yuan WenQiang
Yang LiuChan
Yan Fang
Cui DeJun cuidejungz5055@outlook.com

grid.459540.9 0000 0004 1791 4503 Department of Gastroenterology, Guizhou Provincial People’s Hospital, Medical College of Guizhou University, No. 83, East Zhongshan Road, Guiyang, 550002 Guizhou China
2 9 2024
2 9 2024
2024
29 4506 12 2023
13 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Worldwide, ulcerative colitis (UC) is becoming increasingly fast growing. Ginsenoside Rh2 has been reported to alleviate UC. However, the latent biological mechanism of Rh2 in the treatment of UC remains uncertain. In this study, the goal was to determine the therapeutic effect of Rh2 on dextran sulfate sodium (DSS)-induced UC.

Methods

A DSS-induced UC mouse model was established and divided into 7 groups for Rh2 gavage and/or miR-125a-5p lentivirus injection (n = 10 per group). Colonic specimens were collected for phenotypic and pathological analysis. miR-125a-5p and specific protein 1 (SP1) expression, inflammation-related factors IL-6 and IL-10, and apoptosis were detected in mice. Human normal colon epithelial cell line NCM460 was treated with H2O2 and ferric chloride hexahydrate to construct an in vitro cell model of colitis and induce ferroptosis. Independent sample t-test was used to compare cell proliferation, cell entry, apoptosis, and oxidative stress between the two groups. One way analysis of variance combined with the least significant difference t test was used for comparison between groups. Multiple time points were compared by repeated measurement analysis of variance.

Results

DSS-induced UC mice had significantly decreased body weight, increased disease activity index, decreased colon length, and decreased miR-125a-5p expression (all P < 0.05). In the DSS-induced mouse model, the expression of miR-125a-5p rebounded and ferroptosis was inhibited after Rh2 treatment (all P < 0.05). Inhibition of miR-125a-5p or upregulation of SP1 expression counteracted the protective effects of Rh2 on UC mice and ferroptosis cell models (all P < 0.05).

Conclusions

Rh2 mitigated DSS-induced colitis in mice and restrained ferroptosis by targeting miR-125a-5p. Downregulating miR-125a-5p or elevating SP1 could counteract the protective impacts of Rh2 on ferroptotic cells. The findings convey that Rh2 has a latent application value in the treatment of UC.

Graphical Abstract

Highlights

Rh2 mitigates DSS-induced ferroptosis in mice;

MiR-125a-5p represses DSS-induced ferroptosis in mice.

Rh2 has protective impacts on ferroptotic cells.

MiR-125a-5p targets SP1;

Repression of miR-125a-5p or elevation of SP1 can counteract the protective effects of Rh2 on ferroptotic cells.

Keywords

Ginsenoside Rh2
MicroRNA-125a-5p
Specific protein 1
Ulcerative colitis
Ferroptosis
Cultivation Fund of National Natural Science FoundationGrant No. qiankehe2018-5764-11 Cui DeJun issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

As a multifactorial inflammatory disorder, ulcerative colitis (UC) presents with abdominal pain, diarrhea, and bloody stool [1]. Its pathogenesis is complex, involving genetics, dysregulated immune response, environmental factors, and epithelial barrier defects, and it usually occurs in the rectal and colonic mucosa [2]. Traditional treatment methods, such as oral 5-Aminosalicylic acid (5-ASA) drugs, mainly include Mesalazine, Olsalazine, Balsalazide and Sul-fasalazine, are commonly used to treat mild to moderate active UC [3], but these regimens also have potential serious adverse reactions, including pancreatitis, cardiotoxicity, hepatorenal toxicity and sexual dysfunction [4]. In addition, most patients have a course of chronic remission and recurrence, with a 10-year cumulative recurrence risk of 70–80%. Patients who fail to respond to medical treatment still need to undergo reconstructive colorectal resection [5]. Despite recent advances in medicine, the pathogenesis of UC remains to be elucidated, which is crucial for the development of new drugs for the treatment of UC. It remains an urgent task in current research to identify and search for new biomarkers that can be used to develop more effective UC treatments. Besides, with the wide application of small molecule drugs and new biological agents in recent years, the therapeutic goal of UC has gradually changed from clinical remission to mucosal remission, transmural healing and histological healing. How to develop drugs with fewer side effects, clearer targeting and higher selectivity has become the development requirement of the clinical treatment of UC in the future [6].

Ferroptosis is a non-apoptotic form of iron-dependent cell death which was originally discovered in tumor cells with oncogenic RAS [7]. Since then, the presence of ferroptosis in many tumors has been noted, leading to its identification as a natural tumor suppressor [8]. Ferroptosis has been shown to be associated with the development and progression of autoimmune and inflammatory diseases. Recently, ferroptosis has been observed in colon tissue of UC patients and UC animal models, and inhibition of ferroptosis is expected to become a new therapeutic strategy for UC [9]. A study clarifies that iron supplementation exacerbates UC and ferroptosis may participate in the progression of UC [10, 11]. Meanwhile, the pathogenesis of UC is linked with excessive apoptosis and reactive oxygen species (ROS) production [12], and ferroptosis has been clarified to be associated with excessive accumulation of ROS, which may serve as a latent therapeutic target for UC [13].

In recent years, drugs based on natural products have gained great attention for their unique advantages of high efficiency and low side effects. In plasma metabonomics and pharmacology studies, 6-Gingerol (6-G) was found to be able to regulate linoleic acid metabolism and arachidonic acid metabolism, which are closely related to ferroptosis [14]. However, its potential mechanism needs further exploration. Ginsenoside Rh2 (Rh2) is the main active ingredient of ginseng, which has been extensively studied for its pharmacological activities such as anti-obesity, anti-cancer, anti-inflammation, and anti-diabetes [15]. It can effectively restrain cancer cell growth and survival in animal models and cell lines [16]. For example, Rh2 restrains lung cancer cell proliferation by inducing ROS-mediated endoplasmic reticulum stress-dependent apoptosis [17]. Rh2 impedes proliferation and migration and stimulates apoptosis of osteosarcoma cells [18]. A recent study clarifies that Rh2 has a therapeutic role in UC, and its function may be associated with miRNA regulation [19].

MicroRNAs (miRNAs) are a class of highly conserved small non-coding RNAs that can control post-transcriptional gene expression by repressing mRNA translation or facilitating mRNA degradation, and participate in diversified physiological and pathological processes [20]. MiR-125a-5p, a extensively studied miRNA, has been clarified to be aberrantly expressed in the blood of Crohn's disease patients [21], but its expression in UC and its interaction with GRh2 have not been elucidated.

Therefore, the research aimed to figure out the latent molecular mechanisms of GRh2 and discover its effect on ferroptosis in UC. It is hypothesized that GRh2 inhibits ferroptosis in UC by targeting specific protein 1 (Sp1) by upregulating miR-125a-5p. This finding provides a new direction for understanding the pathogenesis and treatment of UC.

Materials and methods

Animal experiment

All animal procedures were approved by Guizhou Provincial People’s Hospital and performed in the light of the Guide for the Care and Use of Laboratory Animals. Male C57BL/6 J mice (8 weeks) were raised under control conditions (25 °C, 45–55% humidity, and 12 h light/dark cycle). All the mice were divided into 7 groups: Normal group, sodium dextran sulfate (DSS), Rh2, DSS + agomir negative control (NC) group, DSS + agomir miR-125a-5p group, DSS + Rh2 + anta-NC, and DSS + Rh2 + anta-miR-125a-5p (total n = 10 per group) [22]. A mouse UC model was induced by 3% DSS (D122347, Aladdin, Shanghai, China) mixed with drinking water, the induction lasted for 7 d. Mice in the DSS + Rh2 group were given Rh2 (Jilin, China) at 50 mg/kg by gavage, once a day, for 7 d during DSS administration [23]. From the day 5, an intraperitoneal injection of miR-125a-5p agomir, miR-125a-5p antagomir (GenePharma) or the corresponding NC (GenePharma) at 80 mg/kg was done for 3 d, and the DSS group and the normal group were given equal amounts of phosphate buffer saline (PBS) [23]. The experimental mice only drank water. Weight loss was recorded daily and disease activity index was scored as previously described. Mice were euthanized on day 8 and colon tissue was collected. After measuring the length of the colon, the remaining colon tissue was collected for further examination [23]. No dose-dependent toxic and side effects were found during subsequent experiments.

Histological analysis

After measuring the length of colons, histopathological analysis was performed. The colon tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Sections with 4 μm thickness were stained with hematoxylin and eosin. The severity of colonic tissue damage was quantitatively graded according to the defined criteria (Table 1). Briefly, the score is based on epithelial cell infiltration (E) and inflammatory cell infiltration (I) and calculated as (E + I) [24]. Table 1 Primer sequence

Genes		Primer sequence (5'-3')	
miR-125a-5p	Human	ACACTCCAGCTGGGTCCCTGAGACCCTTTAAC	
TGGTGTCGTGGAGTCG	
Mouce	ACACTCCAGCTGGGTCCCTGAGACCCTTTAAC	
TGGTGTCGTGGAGTCG	
SP1	Human	TGGCAGCAGTACCAATGGC	
CCAGGTAGTCCTGTCAGAACTT	
Mouce	AGGGTCCGAGTCAGTCAGG	
CTCGCTGCCATTGGTACTGTT	
U6	Human	CTCGCTTCGGCAGCACA	
AACGCTTCACGAATTTGCGT	
Mouce	CTCGCTTCGGCAGCACA	
AACGCTTCACGAATTTGCGT	
GAPDH	Human	CTCGCTTCGGCAGCACA	
AACGCTTCACGAATTTGCGT	
Mouce	CTCGCTTCGGCAGCACA	
AACGCTTCACGAATTTGCGT	
F forward, R reverse

Immunohistochemistry

The colon tissues were fixed with 4% paraformaldehyde, blocked with paraffin, and cut into 4 μm sections. After dewaxing and rehydration, the sections were immersed in 3% hydrogen peroxide to quench endogenous peroxidase activity, boiled in citrate buffer and then incubated with primary antibodies interleukin (IL)-6 (Abcam, ab6672, 1: 250), IL-10 (Abcam, ab34843, 1: 100) and the secondary antibody (Abcam, ab181602, 1: 2000). After diaminobenzidine treatment (Beyotime, Shanghai, China), images were acquired under a light microscope (× 200) (Leica, Wetzlar, Germany) [25].

Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining

The colon tissue sections were dewaxed and stained with Hoechst solution. The stained sections were examined with a light microscope and analyzed by Image J software to calculate the apoptosis rate (immunofluorescence positive rate) [26].

Cell culture

The human normal colonic epithelial cell line NCM460 was purchased from Beinan Chuanglian Institute of Biotechnology (Beijing, China). Cells were placed in 10% (w/v) fetal bovine serum (Gibco, California, USA), 100 mg/ml penicillin and 100 mg/ml streptomycin (Beyotime Biotechnology, Shanghai, China).

An in vitro model of colitis was induced by DSS. Briefly, 2% DSS (MP Biomedicals, Southern California, USA) was added to the cell culture medium when the cell confluence reached about 70%. Then, NCM460 cells were treated with Rh2 at different concentrations (5 μM, 10 μM) for 24 h. The concentration refers to the study of Wang et al., [26] and Chen et al. [19], and shows a good therapeutic effect on the cell model of NCM460.

Cell culture and treatment

H2O2 (50 μM; H112515, Aladdin) and ferric chloride hexahydrate (10 mg/ml; F102739, Aladdin) were cultured with NCM460 cells for 12 h to induce ferroptosis. NCM460 cells were treated with Rh2 at different concentrations (5 μM, 10 μM) for 30 min before H2O2 and ferric chloride hexahydrate treatment. Then, NC or SP1 siRNA was transfected into NCM460 cells for 24 h [27, 28].

Cell Counting Kit 8 (CCK-8) assay

Cell viability was tested by CCK-8 method. Briefly, NCM460 cells were seeded in 96-well plates, and 100 μL/mL CCK-8 reagent (Sigma, St Louis, MO) was added to each well and incubated for 2 h. Absorbance was then gained at 450 nm on a BioTek PowerWave Microplate Spectrophotometer (Thermo Fisher, USA) [29].

Cell cycle analysis

Cells were cultivated in 6-well plates (1.5 × 106 cells), trypsinized (Sigma-Aldrich), resuspended in 1 × PBS and fixed in pre-chilled absolute ethanol. Then, cells were reacted with 20 μL of RNase (Sigma Aldrich), stained with 20 μL propidium iodide (Sigma Aldrich) and tested on a flow cytometer (Thermo Fisher Scientific) [30].

Flow cytometry detection of apoptosis level

Cells were stained with Annexin V-fluorescein isothiocyanate Apoptosis Detection Kit (Beyotime) [31].

Determination of iron content

Proteins were extracted from colon tissues using an iron detection kit (TC1015, Leagene, Beijing, China), and iron concentrations were tested in the light of the manufacturer's protocol.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissues or cells using TRIzol reagent (Invitrogen), and then reverse-transcribed into cDNA using SuperScript IV reverse transcriptase (Thermo Fisher Scientific). RT-qPCR was implemented using TaqMan Universal PCR Master mix II (Thermo Fisher Scientific). Analysis of the relative expression was conducted by the 2−ΔΔCq method and gene expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6. The sequences were clarified in Table 1 [32].

Western blot

The tissues or cells were lysed in a protein lysis buffer (Sigma-Aldrich). Total protein was electro-blotted onto a polyvinylidene fluoride membrane (Millipore) by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, blocked with 5% nonfat milk, and incubated with the primary antibodies against phosphorylated SP1 (1: 1000; sc-420; Santa Cruz Biotechnology) and GAPDH (1: 1000; 2118; Cell Signaling Technology), and then the secondary antibody. Enhanced chemiluminescence (Sigma-Aldrich, USA) was applied to visualize protein bands and Image Lab software (Bio-Rad) was used to analyze the data [33].

RNA immunoprecipitation reaction (RIP)

Cells were lysed using Radio-Immunoprecipitation assay lysis buffer (Beyotime, Shanghai, China). The beads were washed with 500 μl of RIP washing solution and then incubated with human Argonaute2 (Ago2) antibody or mouse immunoglobulin G (IgG). After incubation, antibody-coated beads were incubated with cell lysates, followed by RT-qPCR [34].

The luciferase activity assay

The 3'UTR sequences of SP1 were chemically synthesized and introduced into luciferase reporter plasmids for constructing wild-type luciferase reporter plasmids. A mutant (mut) luciferase reporter plasmid was constructed by mutating the seed region. After NCM460 cells reached 80% confluence, cells were co-transfected with the luciferase reporter plasmids and miRNA mimic or inhibitor using Lipofectamine 3000 (Life Technologies, CA, USA). Then, dual luciferase activity was measured using dual luciferase reporter gene kit (Promega, Shanghai, China) [35].

Statistical analysis

Data analysis was done by SPSS20.0 and graphs were obtained by GraphPadPrism6. Measurement data were represented as mean ± standard deviation. Two-group comparison of measurement data obeying the normal distribution was done by independent sample t test. One-way analysis of variance combined with least significant difference-t test was applied for comparisons among groups. Comparison of multiple time points was performed by repeated measurement analysis of variance. P < 0.05 emphasized the statistical significance.

Results

In the present study, we explored the potential role and mechanism of ginsenoside Rh2 in DSS-induced colitis in mice. In vivo and in vitro experiments revealed that GR2h mediates ferroptosis in UC by regulating miR-125a-5p targeting Sp1. This finding provides new insights into the pathogenesis of UC and provides new directions for UC treatment.

Rh2 mitigates DSS-induced colitis and retrains ferroptosis

The UC mouse model was induced by 3% DSS for 7 d. It was found that mice induced with DSS showed a clear reduction in body weight and an increase in the disease activity index, which could be improved by Rh2 treatment (Fig. 1A, B). Meanwhile, DSS induction reduced the length of colon of mice, whereas Rh2 treatment could increase the length of colon of DSS-treated mice (Fig. 1C). Histological analyses showed that DSS-stimulated mice developed inflammation or tissue damage characterized by crypt loss, the presence of inflammatory cell infiltration in the mucosa and submucosa, and higher histological scores, and Rh2 treatment reversed these phenomena (Fig. 1D). Inflammatory factor IL-6 and and anti-inflammatory factor IL-10 were tested, and it was found that Rh2 repressed the elevation of IL-6 and the downregulation of IL-10 in DSS-treated mice (Fig. 1E, F). Meanwhile, it was examined that DSS-treated mice had increased apoptotic cells in the colon tissue, and Rh2 attenuated the apoptotic state of DSS-treated mice (Fig. 1G). Ferroptosis is iron-dependent cell death induced by accumulation of lipid peroxidation. As expected, iron content was elevated in UC mice which could be suppressed after Rh2 treatment (Fig. 1H). DSS induced a reduction in GSH content and malondialdehyde (MDA) production (Fig. 1I, J). Taken together, Rh2 ameliorated DSS-induced colitis and repressed ferroptosis.Fig. 1 Rh2 mitigates DSS-induced colitis and retrains ferroptosis. A Changes in body weight. B Calculation of the DAI score on the 8th d. C Image and quantification of colon length. D HE staining detection of the pathological condition of colon tissue. E Immunohistochemical detection of inflammatory factor IL-10. F Immunohistochemical detection of IL-10. G TUNEL staining to detect apoptosis. H–J Iron, glutathione and malondialdehyde in mouse colon tissues. * P < 0.05, vs the Normal; #P < 0.05, vs the DSS

MiR-125a-5p represses DSS-induced ferroptosis in mice

Interestingly, low expression levels of miR-125a-5p were detected in the DSS-induced mouse model, and miR-125a-5p expression rebounded after Rh2 treatment (Fig. 2A). DSS mice were intraperitoneally injected with miR-125a-5p agomir or agomir NC, and miR-125a-5p expression in colon tissue was tested (Fig. 2B). It was observed that after upregulation of miR-125a-5p, the weight loss in DSS-induced mice was suppressed (Fig. 2C), the disease activity index was reduced (Fig. 2D), the length of colon was increased (Fig. 2E), colonic tissue inflammation or tissue damage was improved, and histological scores were reduced (Fig. 2F), IL-6, apoptosis, iron content and MDA content in mice were inhibited, but IL-10 and GSH levels were elevated (Fig. 2G–L). The above experiments demonstrated that miR-125a-5p refrained DSS-induced ferroptosis in mice.Fig. 2 MiR-125a-5p represses DSS-induced ferroptosis in mice. A, B qPCR to detect miR-125a-5p in mouse colon tissue. C Observation of the changes in the body weight of mice. D Calculation of the DAI score on the 8th d. E Image and quantification of colon length. F HE staining to detect the pathological condition of colon tissue. G Immunohistochemical detection of inflammatory factor IL-6. H Immunohistochemical detection of IL-10. I TUNEL staining to detect apoptosis. I–K Detection of iron, glutathione and malondialdehyde in mouse colon tissue. + vs. the D + agomir NC, P < 0.05

Repression of miR-125a-5p counteracts the protective effect of Rh2 in UC mice

To further figure out the link between miR-125a-5p and Rh2, miR-125a-5p expression was retrained in Rh2-administered UC mice (Fig. 3A). Experiments found that repression of miR-125a-5p counteracted the protective effect of Rh2 on UC mice, resulting in weight loss, elevated DAI score, shortened colon, aggravated inflammatory infiltration, elevated histological score, and increased IL-6, apoptosis, iron content and MDA content, and reduced IL-10 and GSH contents (Fig. 3B-J).Fig. 3 Repressing miR-125a-5p counteracts the protective effect of Rh2 in UC mice. A qPCR to detect miR-125a-5p in mouse colon tissue. B Observation of the changes in the body weight of mice. C Calculation of the DAI score on the 8th d. D Image and quantification of colon length. E HE staining to detect the pathological condition of colon tissue. G Immunohistochemical detection of inflammatory factor IL-6. H Immunohistochemical detection of IL-10. I TUNEL staining to detect apoptosis. I–K Detection of iron, glutathione and malondialdehyde in mouse colon tissues. ^ vs. the D + R + anta-NC, P < 0.05

Rh2 has protective impacts on ferroptotic cells

To further study the impact of Rh2 on colitis, an in vitro cell model of colitis was constructed using H2O2 and ferric chloride hexahydrate and ferroptosis was induced. Cytotoxicity was first evaluated in NCM460 Rh2 cells, and Rh2 concentrations less than 20 μM did not show any toxicity (Fig. 4A). It was found that Rh2 elevated cell viability (Fig. 4B) and reduced cells in G0/G1 phase and apoptosis (Fig. 4C, D), as well as elevated GSH content and reduced MDA level and LDH activity, suggesting that Rh2 attenuated oxidative stress in ferroptotic cells (Fig. 4E-G). Meanwhile, decreased levels of miR-125a-5p were detected in the cellular model, similar to the results of in vivo experiments (Fig. 4H).Fig. 4 In vitro cell model of colitis, Rh2 has protective impacts on ferroptotic cells. A CCK-8 assay for the cytotoxicity of Rh2 (0 ~ 20 μM) on NCM460 cells. B CCK-8 assay to determine cell viability. C, D Measurement of cell cycle and apoptosis via flow cytometry. E–G Detection of glutathione, malondialdehyde content and LDH activity. H qPCR to detect miR-125a-5p in cells. a P < 0.05, vs the control; b P < 0.05, vs the H2O2 + ICH

MiR-125a-5p targets SP1

Notably, an elevation in SP1 expression was detected in both in vivo and in vitro models of colitis, which was opposite to the trend of miR-125a-5p (Fig. 5A–D). MiRNAs typically combine with the 3'UTR of mRNAs to post-transcriptionally regulate miRNA expression. Therefore, latent mRNAs targeted by miR-125a-5p were predicted, and the starBase showed a binding site between miR-125a-5p and SP1 3'UTR (Fig. 5E). Dual luciferase reporter gene assay found that the restoration of miR-125a-5p reduced the luciferase activity of NCM460 cells transfected with SP1 3'UTR-wt (Fig. 5F). Meanwhile, both miR-125a-5p and SP1 were enriched in the anti-Ago2 (Fig. 5G). Furthermore, SP1 expression was tested to be suppressed in the colon tissue of DSS-treated mice after overexpressing miR-125a-5p (Fig. 5HI). The above experiments clarified that miR-125a-5p targeted SP1.Fig. 5 MiR-125a-5p targets SP1. A–D qPCR and WB detection of SP1 in in vivo and in vitro models of colitis. E Binding site of miR-125a-5p with SP1. F, G The interaction between miR-125a-5p and SP1 was verified by the luciferase activity assay, and RIP experiments. H, I. qPCR and WB to detect SP1 in UC mice. P < 0.05, vs the Normal; #P < 0.05, vs the DSS. a P < 0.05, vs the control; b P < 0.05, vs the H2O2 + ICH

Repression of miR-125a-5p or elevation of SP1 can counteract the protective impacts of Rh2 on ferroptotic cells

Subsequently, the downstream molecular mechanisms of Rh2 were figured out in the cell model. After Rh2 treatment, cells were transfected with in-miR-125a-5p, in-NC, oe-SP1, and oe-NC, respectively, and the transfection efficiency was verified (Fig. 6A, B). Experiments found that after repressing miR-125a-5p or elevating SP1, cell viability was reduced (Fig. 6C), cells were arrested in G0/G1 phase, apoptosis was induced (Fig. 6D, E), GSH content was suppressed, and MDA content and LDH activity were elevated (Fig. 6F–H). The above results clarified that repression of miR-125a-5p or elevation of SP1 could counteract the protective impacts of Rh2 on ferroptotic cells.Fig. 6 Repressing miR-125a-5p or elevating SP1 can counteract Rh2's protective impacts on ferroptotic cells. A, B qPCR to verify transfection efficiency. C CCK-8 assay to determine cell viability. D, E Measurement of cell cycle and apoptosis via flow cytometry. F–H Detection of glutathione, malondialdehyde content and LDH activity. a P < 0.05, vs the control; c vs. the H2O2 + ICH + RH2 + in-NC, P < 0.05; d vs. the H2O2 + ICH + RH2 + oe-NC, P < 0.05

Discussion

Ferroptosis is a recently recognized form of cell death driven by lipid-based accumulation of ROS [36]. The core molecular mechanism of ferroptosis is the imbalance between oxidative damage and antioxidant defense, which further leads to the loss of the integrity of mitochondrial membrane and cell membrane. In recent years, more and more studies have reported that the activation of inflammation related signaling pathways is closely related to ferroptosis [37, 38]. Studies have shown that abnormal inflammatory response is essential for iron metabolism disorder and redox system imbalance. Proinflammatory cytokines such as IL-1β, IL-6, TNF-α, and IFN-γ can regulate the synthesis of ferritin, thereby affecting the storage of iron in cells and tissues, which in turn leads to ferroptosis [39]. In this study, we used the classic DSS-induced UC mouse model from previous studies and verified that it was accompanied by ferroptosis. Rh2 could reverse the effect of DSS, improve the inflammation and injury of colon tissue, restrain inflammatory response, elevate the content of GSH, and reduce apoptosis and the production of MDA. The results of in vitro experiments illustrated that Rh2 elevated cell viability, restrained cell apoptosis, and alleviated oxidative stress in ferroptotic cells. Meanwhile, Rh2 was observed to elevate miR-125a-5p expression, and down-regulation of miR-125a-5p turned around the therapeutic effect of Rh2 on UC. These results suggest that Rh2 attenuates UC-induced ferroptosis by regulating miR-125a-5p.

UC is a lifelong inflammatory bowel disease, usually characterized by a recurrent and remitting course. Rectal bleeding usually occurs in more than 90% of patients with UC [40]. The related symptoms usually reflect the severity of mucosal disease and can vary according to the degree of disease. The initial stage of the disease is based on the breakdown of the intestinal barrier and the loss of mucosal homeostasis [41]. Experimental UC models induced by DSS are clinically and histologically similar to human UC [42]. As mentioned previously [43], it was found that DSS-induced mice had decreased body weight, increased disease activity index, shorter colon length than controls, significant inflammation or tissue damage at the colon site, elevated inflammatory factor IL-10, apoptosis, and MDA production, and decreased GSH levels. These results demonstrate the successful establishment of the UC animal model, as described in previous studies [44–46]. As the main active ingredient of ginseng, ginsenoside Rh2 has been proven to have anti-tumor and anti-inflammatory effects in cancers and diseases. For example, ginsenoside Rh2 ameliorates lipopolysaccharide-induced acute lung injury by controlling TLR4/PI3K/Akt/mTOR, Raf-1/MEK/ERK and Keap1/Nrf2/HO-1 pathways in mice [44]. Ginsenoside Rh2 restrains prostate cancer angiogenesis by targeting CNNM1 [45]. Ginsenoside Rh2 alleviates DSS-induced colitis by enhancing TGFβ signaling [46]. In the present study, it was found that Rh2 effectively ameliorated DSS-induced UC. It has been reported that ferroptosis is mainly linked with three metabolic pathways, including lipid peroxidation, iron accumulation, and malfunction of the glutathione (GSH)-glutathione peroxidase 4 (GPX4) reduction system [47]. Among them, GSH is a core player in ferroptosis, and its depletion results in the inactivation of GPX4 and the increase of intracellular lipid peroxides, resulting in ferroptosis [48]. Ferroptosis is typically characterized by increased levels of the lipid membrane peroxidation product MDA [49]. Previous studies have shown that Ginsenoside Rh2 can significantly reduce the expression of SLC7A11, a negative regulator of ferroptosis, thereby alleviating liver fibrosis [50]. In this study, it was found that Rh2 elevated the content of GSH and reduced the production of MDA, indicating that Rh2 can effectively restrain ferroptosis. As far as we know, this is the first report finding that Rh2 restrains ferroptosis in UC. In addition, it has been shown that ginsenoside Rh2 alleviates DSS-induced colitis by blocking the STAT3/miR-214 signaling pathway [19, 51]. Studies have revealed that miR-214 and miR-125a-5p are involved in the regulation of inflammatory response [51], the connection between the two remains to be further explored. In the future, we will further explore the connection between this pathway and miRNAs when conditions permit.

Numerous studies have clarified miRNAs are regulators of gene expression and are involved in ferroptosis [52]. miR-125a-5p has been reported to be involved in regulating the inflammatory responses, such as LPS-induced inflammatory response. A recent study has noted that dioscin can ameliorate inflammatory bowel disease [53] by upregulating miR-125a-5p to regulate macrophage polarization. miR-125a-5p can inactivate the NF-κB pathway by targeting TRAF6, thereby reducing downstream TNF-α, IL-1β and IL-6 and thus depressing LPS-induced acute kidney inflammation [54]. In the present study, it was found for the first time that miR-125a-5p was reduced in a DSS-induced mouse model, and up-regulation of miR-125a-5p mitigated colonic injury and inflammation in UC and suppressed DSS-induced ferroptosis in mice; repressing miR-125a-5p counteracted the protective effect of Rh2 in UC mice. Furthermore, it was also confirmed that the downstream target of miR-125a-5p was SP1.

SP1 is a transcriptional activator that functions in ferroptosis through transcription-dependent or transcription-independent mechanisms [55]. For example, SP1 regulates ferroptosis by controlling acyl-CoA synthase long-chain family member 4 in the GSH-GPX4 reduction system [56]. The SP1/ACSL4 pathway has been shown to be associated with ferroptosis and may serve as a potential therapeutic target in mouse models of intestinal ischemia necrosis and Alzheimer's disease [57, 58]. In the DSS mouse model of colitis, administration of SP1 increases epithelial permeability, dysregulates intestinal microbiota diversity, and aggravates intestinal inflammation [59]. SP1-mediated upregulation of Prdx6 abrogates high glucose-induced ferroptosis by alleviating oxidative stress [60]. Similar conclusions have been drawn that Rh2 significantly inhibits the increase of ROS levels in senescent epithelial cells. These results also indicate that Ginsenoside Rh2 is a potential candidate drug for the treatment of aging related oxidative stress activation [61]. The results in the present study were similar to those in previous studies. We found that SP1 was upregulated in both in vivo and in vitro models of colitis, and elevation of SP1 counteracted the protective effect of Rh2 on ferroptotic cells, resulting in reduced cell viability, cell arrest in G0/G1 phase, and GSH content and elevated apoptosis, MDA content, and LDH activity.

The above results clarified ginsenoside Rh2 suppresses ferroptosis in UC by targeting Sp1 by upregulating miR-125a-5p. However, there are still great challenges in the application of Ginsenoside rh2 in the clinical treatment of UC. DSS-induced colitis is the most widely used experimental mouse colitis model at present. Although DSS can provide a mode of alleviating and recurrent inflammation in human IBD, but considering the impact of gut microbiome on disease, it may be necessary to further optimize the dosage of DSS in the subsequent experiments [62]. Moreover, in the in vivo experiment, the IC50 range and effective dose range of Ginsenoside Rh2 differed by dozens of times under different intervention time and different cell conditions [63]. Due to poor absorption, the bioavailability of oral Rh2 is extremely low, and increasing the dose of alternative therapy will also lead to increased toxicity. Therapeutic doses of Rh2 may exhibit high toxicity to cells in normal non target organs [64]. Although the oral bioavailability of Rh2 can be improved by esterification modification of the structure of Rh2 at present, because most of the current preparation tests are only carried out in the laboratory, how to improve the conversion rate and reduce the production cost is still the main problem of Rh2 industrial scale production. It is hoped to further explore the downstream targets of SP1 and other latent mechanisms of Rh2 in UC in future studies to improve the therapeutic effect of Rh2. More in vivo and in vitro experiments are needed in the future to confirm the efficacy of long-term administration of Ginsenoside Rh2 in chronic diseases such as UC, and further validate the data obtained in this study.

Conclusion

All in all, the study shows Rh2 restrains the progression of UC by depressing ferroptosis, which is mediated by the miR-125a-5p/Sp1 axis. The study suggests repression of ferroptosis as a potential therapeutic target for UC, and further confirms Rh2 is a promising drug for UC treatment.

Acknowledgements

Not applicable.

Author contributions

Xun Zhao designed the research study. WenQiang Yuan performed the research. LiuChan Yang provided help and advice on the experiments. Fang Yan and DeJun Cui analyzed the data. Xun Zhao wrote the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Funding

This work was financially supported by Cultivation Fund of National Natural Science Foundation (Grant No. qiankehe2018-5764-11).

Availability of data and materials

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The experiment research protocol was approved by the Ethics Committee of Guizhou Provincial People’s Hospital all experimental procedures conformed with institutional guidelines, All procedures and animal care were approved by Guizhou Provincial People’s Hospital Animal Care Committee and performed according to NIH guidelines (Ethics approval number: 201710-ZX6602).

Consent for publication

Informed consent was obtained from all individual participants included in the study.

Competing interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Feagan B Danese S Loftus E Vermeire S Schreiber S Ritter T Fogel R Mehta R Nijhawan S Kempiński R Filgotinib as induction and maintenance therapy for ulcerative colitis (SELECTION): a phase 2b/3 double-blind, randomised, placebo-controlled trial Lancet (London, England) 2021 397 10292 2372 2384 10.1016/S0140-6736(21)00666-8 34090625
Feagan B, Danese S, Loftus E, Vermeire S, Schreiber S, Ritter T, Fogel R, Mehta R, Nijhawan S, Kempiński R, et al. Filgotinib as induction and maintenance therapy for ulcerative colitis (SELECTION): a phase 2b/3 double-blind, randomised, placebo-controlled trial. Lancet (London, England). 2021;397(10292):2372–84.34090625 10.1016/S0140-6736(21)00666-8
2. Ungaro R Mehandru S Allen P Peyrin-Biroulet L Colombel J Ulcerative colitis Lancet (London, England) 2017 389 10080 1756 1770 10.1016/S0140-6736(16)32126-2 27914657
Ungaro R, Mehandru S, Allen P, Peyrin-Biroulet L, Colombel J. Ulcerative colitis. Lancet (London, England). 2017;389(10080):1756–70.27914657 10.1016/S0140-6736(16)32126-2
3. Liu J Di B Xu LL Recent advances in the treatment of IBD: targets, mechanisms and related therapies Cytokine Growth Factor Rev 2023 71–72 1 12 10.1016/j.cytogfr.2023.07.001 37455149
Liu J, Di B, Xu LL. Recent advances in the treatment of IBD: targets, mechanisms and related therapies. Cytokine Growth Factor Rev. 2023;71–72:1–12.37455149 10.1016/j.cytogfr.2023.07.001
4. Murray A Nguyen TM Parker CE Feagan BG MacDonald JK Oral 5-aminosalicylic acid for induction of remission in ulcerative colitis Cochrane Database Syst Rev 2020 8 8 CD000543 32786164
Murray A, Nguyen TM, Parker CE, Feagan BG, MacDonald JK. Oral 5-aminosalicylic acid for induction of remission in ulcerative colitis. Cochrane Database Syst Rev. 2020;8(8):CD000543.32786164
5. Hindryckx P Jairath V D'Haens G Acute severe ulcerative colitis: from pathophysiology to clinical management Nat Rev Gastroenterol Hepatol 2016 13 11 654 664 10.1038/nrgastro.2016.116 27580687
Hindryckx P, Jairath V, D’Haens G. Acute severe ulcerative colitis: from pathophysiology to clinical management. Nat Rev Gastroenterol Hepatol. 2016;13(11):654–64.27580687 10.1038/nrgastro.2016.116
6. Baumgart DC Le Berre C Newer biologic and small-molecule therapies for inflammatory bowel disease N Engl J Med 2021 385 14 1302 1315 10.1056/NEJMra1907607 34587387
Baumgart DC, Le Berre C. Newer biologic and small-molecule therapies for inflammatory bowel disease. N Engl J Med. 2021;385(14):1302–15.34587387 10.1056/NEJMra1907607
7. Jiang X Stockwell B Conrad M Ferroptosis: mechanisms, biology and role in disease Nat Rev Mol Cell Biol 2021 22 4 266 282 10.1038/s41580-020-00324-8 33495651
Jiang X, Stockwell B, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol. 2021;22(4):266–82.33495651 10.1038/s41580-020-00324-8
8. Lei G Zhang Y Koppula P Liu X Zhang J Lin S Ajani J Xiao Q Liao Z Wang H The role of ferroptosis in ionizing radiation-induced cell death and tumor suppression Cell Res 2020 30 2 146 162 10.1038/s41422-019-0263-3 31949285
Lei G, Zhang Y, Koppula P, Liu X, Zhang J, Lin S, Ajani J, Xiao Q, Liao Z, Wang H, et al. The role of ferroptosis in ionizing radiation-induced cell death and tumor suppression. Cell Res. 2020;30(2):146–62.31949285 10.1038/s41422-019-0263-3
9. Long D Mao C Huang Y Xu Y Zhu Y Ferroptosis in ulcerative colitis: potential mechanisms and promising therapeutic targets Biomed Pharmacother 2024 175 116722 10.1016/j.biopha.2024.116722 38729051
Long D, Mao C, Huang Y, Xu Y, Zhu Y. Ferroptosis in ulcerative colitis: potential mechanisms and promising therapeutic targets. Biomed Pharmacother. 2024;175: 116722.38729051 10.1016/j.biopha.2024.116722
10. Bertani L Tricò D Zanzi F Baiano Svizzero G Coppini F de Bortoli N Bellini M Antonioli L Blandizzi C Marchi S Oral sucrosomial iron is as effective as intravenous ferric carboxy-maltose in treating anemia in patients with ulcerative colitis Nutrients 2021 13 2 608 10.3390/nu13020608 33673371
Bertani L, Tricò D, Zanzi F, Baiano Svizzero G, Coppini F, de Bortoli N, Bellini M, Antonioli L, Blandizzi C, Marchi S. Oral sucrosomial iron is as effective as intravenous ferric carboxy-maltose in treating anemia in patients with ulcerative colitis. Nutrients. 2021;13(2):608.33673371 10.3390/nu13020608
11. Xu M Tao J Yang Y Tan S Liu H Jiang J Zheng F Wu B Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis Cell Death Dis 2020 11 2 86 10.1038/s41419-020-2299-1 32015337
Xu M, Tao J, Yang Y, Tan S, Liu H, Jiang J, Zheng F, Wu B. Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis. Cell Death Dis. 2020;11(2):86.32015337 10.1038/s41419-020-2299-1
12. Luo Y Yu M Yan Y Zhou Y Qin S Huang Y Qin J Zhong M Rab27A promotes cellular apoptosis and ROS production by regulating the miRNA-124-3p/STAT3/RelA signalling pathway in ulcerative colitis J Cell Mol Med 2020 24 19 11330 11342 10.1111/jcmm.15726 32815642
Luo Y, Yu M, Yan Y, Zhou Y, Qin S, Huang Y, Qin J, Zhong M. Rab27A promotes cellular apoptosis and ROS production by regulating the miRNA-124-3p/STAT3/RelA signalling pathway in ulcerative colitis. J Cell Mol Med. 2020;24(19):11330–42.32815642 10.1111/jcmm.15726
13. Chen Y Zhang P Chen W Chen G Ferroptosis mediated DSS-induced ulcerative colitis associated with Nrf2/HO-1 signaling pathway Immunol Lett 2020 225 9 15 10.1016/j.imlet.2020.06.005 32540488
Chen Y, Zhang P, Chen W, Chen G. Ferroptosis mediated DSS-induced ulcerative colitis associated with Nrf2/HO-1 signaling pathway. Immunol Lett. 2020;225:9–15.32540488 10.1016/j.imlet.2020.06.005
14. Li W Zhang Y Wang Q Wang Y Fan Y Shang E Jiang S Duan J 6-Gingerol ameliorates ulcerative colitis by inhibiting ferroptosis based on the integrative analysis of plasma metabolomics and network pharmacology Food Funct 2024 15 11 6054 6067 10.1039/D4FO00952E 38753306
Li W, Zhang Y, Wang Q, Wang Y, Fan Y, Shang E, Jiang S, Duan J. 6-Gingerol ameliorates ulcerative colitis by inhibiting ferroptosis based on the integrative analysis of plasma metabolomics and network pharmacology. Food Funct. 2024;15(11):6054–67.38753306 10.1039/D4FO00952E
15. Wang Z Kim U Jiao Y Li C Guo Y Ma X Jiang M Jiang Z Hou Y Bai G Quantitative proteomics combined with affinity MS revealed the molecular mechanism of ginsenoside antitumor effects J Proteome Res 2019 18 5 2100 2108 10.1021/acs.jproteome.8b00972 30860844
Wang Z, Kim U, Jiao Y, Li C, Guo Y, Ma X, Jiang M, Jiang Z, Hou Y, Bai G. Quantitative proteomics combined with affinity MS revealed the molecular mechanism of ginsenoside antitumor effects. J Proteome Res. 2019;18(5):2100–8.30860844 10.1021/acs.jproteome.8b00972
16. Wang D Kim Y Baek N Mathiyalagan R Wang C Jin Y Xu X Yang D Lactobacillus rhamnosus Glycosyltransformation of ginsenoside Rh2 into two novel ginsenosides using recombinant glycosyltransferase from and its applications J Ginseng Res 2021 45 1 48 57 10.1016/j.jgr.2019.11.004 33437156
Wang D, Kim Y, Baek N, Mathiyalagan R, Wang C, Jin Y, Xu X, Yang D. Lactobacillus rhamnosus Glycosyltransformation of ginsenoside Rh2 into two novel ginsenosides using recombinant glycosyltransferase from and its applications. J Ginseng Res. 2021;45(1):48–57.33437156 10.1016/j.jgr.2019.11.004
17. Ge G Yan Y Cai H Ginsenoside Rh2 inhibited proliferation by inducing ROS mediated ER stress dependent apoptosis in lung cancer cells Biol Pharm Bull 2017 40 12 2117 2124 10.1248/bpb.b17-00463 28966297
Ge G, Yan Y, Cai H. Ginsenoside Rh2 inhibited proliferation by inducing ROS mediated ER stress dependent apoptosis in lung cancer cells. Biol Pharm Bull. 2017;40(12):2117–24.28966297 10.1248/bpb.b17-00463
18. Li C Gao H Feng X Bi C Zhang J Yin J Ginsenoside Rh2 impedes proliferation and migration and induces apoptosis by regulating NF-κB, MAPK, and PI3K/Akt/mTOR signaling pathways in osteosarcoma cells J Biochem Mol Toxicol 2020 34 12 e22597 10.1002/jbt.22597 32762018
Li C, Gao H, Feng X, Bi C, Zhang J, Yin J. Ginsenoside Rh2 impedes proliferation and migration and induces apoptosis by regulating NF-κB, MAPK, and PI3K/Akt/mTOR signaling pathways in osteosarcoma cells. J Biochem Mol Toxicol. 2020;34(12): e22597.32762018 10.1002/jbt.22597
19. Chen X Xu T Lv X Zhang J Liu S Ginsenoside Rh2 alleviates ulcerative colitis by regulating the STAT3/miR-214 signaling pathway J Ethnopharmacol 2021 274 113997 10.1016/j.jep.2021.113997 33705918
Chen X, Xu T, Lv X, Zhang J, Liu S. Ginsenoside Rh2 alleviates ulcerative colitis by regulating the STAT3/miR-214 signaling pathway. J Ethnopharmacol. 2021;274: 113997.33705918 10.1016/j.jep.2021.113997
20. Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M: Deciphering miRNAs' Action through miRNA Editing. IJMS 2019, 20(24):6249
21. Jensen M Andersen R Christensen H Nathan T Kjeldsen J Madsen J Circulating microRNAs as biomarkers of adult Crohn's disease Eur J Gastroenterol Hepatol 2015 27 9 1038 1044 10.1097/MEG.0000000000000430 26230660
Jensen M, Andersen R, Christensen H, Nathan T, Kjeldsen J, Madsen J. Circulating microRNAs as biomarkers of adult Crohn’s disease. Eur J Gastroenterol Hepatol. 2015;27(9):1038–44.26230660 10.1097/MEG.0000000000000430
22. Chen L Li X Gu Q Chimonanthus salicifolius extract alleviates DSS-induced colitis and regulates gut microbiota in mice Food Sci Nutr 2023 11 6 3019 3030 10.1002/fsn3.3282 37324926
Chen L, Li X, Gu Q. Chimonanthus salicifolius extract alleviates DSS-induced colitis and regulates gut microbiota in mice. Food Sci Nutr. 2023;11(6):3019–30.37324926 10.1002/fsn3.3282
23. Zhu F Li H Liu Y Tan C Liu X Fan H Wu H Dong Y Yu T Chu S miR-155 antagomir protect against DSS-induced colitis in mice through regulating Th17/Treg cell balance by Jarid2/Wnt/β-catenin Biomed Pharmacother 2020 126 109909 10.1016/j.biopha.2020.109909 32135463
Zhu F, Li H, Liu Y, Tan C, Liu X, Fan H, Wu H, Dong Y, Yu T, Chu S, et al. miR-155 antagomir protect against DSS-induced colitis in mice through regulating Th17/Treg cell balance by Jarid2/Wnt/β-catenin. Biomed Pharmacother. 2020;126:109909.32135463 10.1016/j.biopha.2020.109909
24. Wang S Liu W Wang J Bai X Curculigoside inhibits ferroptosis in ulcerative colitis through the induction of GPX4 Life Sci 2020 259 118356 10.1016/j.lfs.2020.118356 32861798
Wang S, Liu W, Wang J, Bai X. Curculigoside inhibits ferroptosis in ulcerative colitis through the induction of GPX4. Life Sci. 2020;259: 118356.32861798 10.1016/j.lfs.2020.118356
25. Zeng J Zhang D Wan X Bai Y Yuan C Wang T Yuan D Zhang C Liu C Chlorogenic acid suppresses miR-155 and ameliorates ulcerative colitis through the NF-κB/NLRP3 inflammasome pathway Mol Nutr Food Res 2020 64 e2000452 10.1002/mnfr.202000452 33078870
Zeng J, Zhang D, Wan X, Bai Y, Yuan C, Wang T, Yuan D, Zhang C, Liu C. Chlorogenic acid suppresses miR-155 and ameliorates ulcerative colitis through the NF-κB/NLRP3 inflammasome pathway. Mol Nutr Food Res. 2020;64:e2000452.33078870 10.1002/mnfr.202000452
26. Wang Y Wang N Cui L Li Y Cao Z Wu X Wang Q Zhang B Ma C Cheng Y Long non-coding RNA MEG3 alleviated ulcerative colitis through upregulating miR-98-5p-sponged IL-10 Inflammation 2021 44 3 1049 1059 10.1007/s10753-020-01400-z 33394187
Wang Y, Wang N, Cui L, Li Y, Cao Z, Wu X, Wang Q, Zhang B, Ma C, Cheng Y. Long non-coding RNA MEG3 alleviated ulcerative colitis through upregulating miR-98-5p-sponged IL-10. Inflammation. 2021;44(3):1049–59.33394187 10.1007/s10753-020-01400-z
27. Tong L Tang C Cai C Guan X Upregulation of the microRNA rno-miR-146b-5p may be involved in the development of intestinal injury through inhibition of Kruppel-like factor 4 in intestinal sepsis Bioengineered 2020 11 1 1334 1349 10.1080/21655979.2020.1851476 33200654
Tong L, Tang C, Cai C, Guan X. Upregulation of the microRNA rno-miR-146b-5p may be involved in the development of intestinal injury through inhibition of Kruppel-like factor 4 in intestinal sepsis. Bioengineered. 2020;11(1):1334–49.33200654 10.1080/21655979.2020.1851476
28. Wang W Guo ZH Downregulation of lncRNA NEAT1 ameliorates LPS-induced inflammatory responses by promoting macrophage M2 polarization via miR-125a-5p/TRAF6/TAK1 axis Inflammation 2020 43 1548 1560 10.1007/s10753-020-01231-y 32388658
Wang W, Guo ZH. Downregulation of lncRNA NEAT1 ameliorates LPS-induced inflammatory responses by promoting macrophage M2 polarization via miR-125a-5p/TRAF6/TAK1 axis. Inflammation. 2020;43:1548–60.32388658 10.1007/s10753-020-01231-y
29. Han J Li Y Zhang B Liu H Wu M Zhang X lncRNA TUG1 regulates ulcerative colitis through miR-142-5p/SOCS1 axis Microb Pathog 2020 143 104139 10.1016/j.micpath.2020.104139 32173492
Han J, Li Y, Zhang B, Liu H, Wu M, Zhang X. lncRNA TUG1 regulates ulcerative colitis through miR-142-5p/SOCS1 axis. Microb Pathog. 2020;143: 104139.32173492 10.1016/j.micpath.2020.104139
30. Li C Wang Y Wang H Wang B Wang Y Li N Qin Y Wang Y miR-486 promotes the invasion and cell cycle progression of ovarian cancer cells by targeting CADM1 Anal Cell Pathol (Amst) 2021 2021 7407086 34395181
Li C, Wang Y, Wang H, Wang B, Wang Y, Li N, Qin Y, Wang Y. miR-486 promotes the invasion and cell cycle progression of ovarian cancer cells by targeting CADM1. Anal Cell Pathol (Amst). 2021;2021:7407086.34395181
31. Han D Zhu S Li X Li Z Huang H Gao W Liu Y Zhu H Yu X The NF-κB/miR-488/ERBB2 axis modulates pancreatic cancer cell malignancy and tumor growth through cell cycle signaling Cancer Biol Ther 2022 23 294 309 10.1080/15384047.2022.2054257 35343383
Han D, Zhu S, Li X, Li Z, Huang H, Gao W, Liu Y, Zhu H, Yu X. The NF-κB/miR-488/ERBB2 axis modulates pancreatic cancer cell malignancy and tumor growth through cell cycle signaling. Cancer Biol Ther. 2022;23:294–309.35343383 10.1080/15384047.2022.2054257
32. Zhou Z Tan F Pei Q Li C Zhou Y Li Y Pei H lncRNA SNHG4 modulates colorectal cancer cell cycle and cell proliferation through regulating miR-590-3p/CDK1 axis Aging (Albany NY) 2021 13 9838 9858 10.18632/aging.202737 33744866
Zhou Z, Tan F, Pei Q, Li C, Zhou Y, Li Y, Pei H. lncRNA SNHG4 modulates colorectal cancer cell cycle and cell proliferation through regulating miR-590-3p/CDK1 axis. Aging (Albany NY). 2021;13:9838–58.33744866 10.18632/aging.202737
33. Rao J Shao L Lin M Huang J Fan L LncRNA UCA1 accelerates the progression of ulcerative colitis via mediating the miR-331-3p/BRD4 axis IJGM 2021 14 2427 2435 10.2147/IJGM.S304837
Rao J, Shao L, Lin M, Huang J, Fan L. LncRNA UCA1 accelerates the progression of ulcerative colitis via mediating the miR-331-3p/BRD4 axis. IJGM. 2021;14:2427–35.10.2147/IJGM.S304837
34. Yu T Meng F Xie M Liu H Zhang L Chen X LncRNA PMS2L2 downregulates miR-24 through methylation to suppress cell apoptosis in ulcerative colitis Dig Dis 2020 10.1159/000513330 33238281
Yu T, Meng F, Xie M, Liu H, Zhang L, Chen X. LncRNA PMS2L2 downregulates miR-24 through methylation to suppress cell apoptosis in ulcerative colitis. Dig Dis. 2020. 10.1159/000513330.33238281 10.1159/000513330
35. Ding C Ding X Zheng J Wang B Li Y Xiang H Dou M Qiao Y Tian P Xue W miR-182-5p and miR-378a-3p regulate ferroptosis in I/R-induced renal injury Cell Death Dis 2020 11 10 929 10.1038/s41419-020-03135-z 33116120
Ding C, Ding X, Zheng J, Wang B, Li Y, Xiang H, Dou M, Qiao Y, Tian P, Xue W. miR-182-5p and miR-378a-3p regulate ferroptosis in I/R-induced renal injury. Cell Death Dis. 2020;11(10):929.33116120 10.1038/s41419-020-03135-z
36. Luo M Wu L Zhang K Wang H Zhang T Gutierrez L O'Connell D Zhang P Li Y Gao T miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma Cell Death Differ 2018 25 8 1457 1472 10.1038/s41418-017-0053-8 29348676
Luo M, Wu L, Zhang K, Wang H, Zhang T, Gutierrez L, O’Connell D, Zhang P, Li Y, Gao T, et al. miR-137 regulates ferroptosis by targeting glutamine transporter SLC1A5 in melanoma. Cell Death Differ. 2018;25(8):1457–72.29348676 10.1038/s41418-017-0053-8
37. Salvatori S Neri B Marafini I Brigida M Monteleone G Emerging oral drug options for ulcerative colitis Expert Opin Emerg Drugs 2023 28 3 191 201 10.1080/14728214.2023.2254686 37668153
Salvatori S, Neri B, Marafini I, Brigida M, Monteleone G. Emerging oral drug options for ulcerative colitis. Expert Opin Emerg Drugs. 2023;28(3):191–201.37668153 10.1080/14728214.2023.2254686
38. Kang Y Park H Choe BH Kang B The role and function of mucins and its relationship to inflammatory bowel disease Front Med (Lausanne) 2022 9 848344 10.3389/fmed.2022.848344 35602503
Kang Y, Park H, Choe BH, Kang B. The role and function of mucins and its relationship to inflammatory bowel disease. Front Med (Lausanne). 2022;9: 848344.35602503 10.3389/fmed.2022.848344
39. Chen Y Fang ZM Yi X Wei X Jiang DS The interaction between ferroptosis and inflammatory signaling pathways Cell Death Dis 2023 14 3 205 10.1038/s41419-023-05716-0 36944609
Chen Y, Fang ZM, Yi X, Wei X, Jiang DS. The interaction between ferroptosis and inflammatory signaling pathways. Cell Death Dis. 2023;14(3):205.36944609 10.1038/s41419-023-05716-0
40. Lv J Hou B Song J Xu Y Xie S The relationship between ferroptosis and diseases J Multidiscip Healthc 2022 15 2261 2275 10.2147/JMDH.S382643 36225859
Lv J, Hou B, Song J, Xu Y, Xie S. The relationship between ferroptosis and diseases. J Multidiscip Healthc. 2022;15:2261–75.36225859 10.2147/JMDH.S382643
41. Gong T Liu L Jiang W Zhou R DAMP-sensing receptors in sterile inflammation and inflammatory diseases Nat Rev Immunol 2020 20 95 112 10.1038/s41577-019-0215-7 31558839
Gong T, Liu L, Jiang W, Zhou R. DAMP-sensing receptors in sterile inflammation and inflammatory diseases. Nat Rev Immunol. 2020;20:95–112. 10.1038/s41577-019-0215-7.31558839 10.1038/s41577-019-0215-7
42. Wang J Zhang C Guo C Li X Chitosan ameliorates DSS-induced ulcerative colitis mice by enhancing intestinal barrier function and improving microflora Int J Mol Sci 2019 20 22 5751 10.3390/ijms20225751 31731793
Wang J, Zhang C, Guo C, Li X. Chitosan ameliorates DSS-induced ulcerative colitis mice by enhancing intestinal barrier function and improving microflora. Int J Mol Sci. 2019;20(22):5751.31731793 10.3390/ijms20225751
43. Sheng Y Wu T Dai Y Ji K Zhong Y Xue Y The effect of 6-gingerol on inflammatory response and Th17/Treg balance in DSS-induced ulcerative colitis mice Annals of translational medicine 2020 8 7 442 10.21037/atm.2020.03.141 32395486
Sheng Y, Wu T, Dai Y, Ji K, Zhong Y, Xue Y. The effect of 6-gingerol on inflammatory response and Th17/Treg balance in DSS-induced ulcerative colitis mice. Annals of translational medicine. 2020;8(7):442.32395486 10.21037/atm.2020.03.141
44. Hsieh Y Deng J Chang Y Huang G Ginsenoside Rh2 ameliorates lipopolysaccharide-induced acute lung injury by regulating the TLR4/PI3K/Akt/mTOR, Raf-1/MEK/ERK, and Keap1/Nrf2/HO-1 signaling pathways in mice Nutrients 2018 10 9 1208 10.3390/nu10091208 30200495
Hsieh Y, Deng J, Chang Y, Huang G. Ginsenoside Rh2 ameliorates lipopolysaccharide-induced acute lung injury by regulating the TLR4/PI3K/Akt/mTOR, Raf-1/MEK/ERK, and Keap1/Nrf2/HO-1 signaling pathways in mice. Nutrients. 2018;10(9):1208.30200495 10.3390/nu10091208
45. Huang Y Huang H Han Z Li W Mai Z Yuan R Ginsenoside Rh2 inhibits angiogenesis in prostate cancer by targeting CNNM1 J Nanosci Nanotechnol 2019 19 4 1942 1950 10.1166/jnn.2019.16404 30486934
Huang Y, Huang H, Han Z, Li W, Mai Z, Yuan R. Ginsenoside Rh2 inhibits angiogenesis in prostate cancer by targeting CNNM1. J Nanosci Nanotechnol. 2019;19(4):1942–50.30486934 10.1166/jnn.2019.16404
46. Ye H Wu Q Zhu Y Guo C Zheng X Ginsenoside Rh2 alleviates dextran sulfate sodium-induced colitis via augmenting TGFβ signaling Mol Biol Rep 2014 41 8 5485 5490 10.1007/s11033-014-3422-0 24893598
Ye H, Wu Q, Zhu Y, Guo C, Zheng X. Ginsenoside Rh2 alleviates dextran sulfate sodium-induced colitis via augmenting TGFβ signaling. Mol Biol Rep. 2014;41(8):5485–90.24893598 10.1007/s11033-014-3422-0
47. Dar H Anthonymuthu T Ponomareva L Souryavong A Shurin G Kapralov A Tyurin V Lee J Mallampalli R Wenzel S A new thiol-independent mechanism of epithelial host defense against Pseudomonas aeruginosa: iNOS/NO sabotage of theft-ferroptosis Redox Biol 2021 45 102045 10.1016/j.redox.2021.102045 34167028
Dar H, Anthonymuthu T, Ponomareva L, Souryavong A, Shurin G, Kapralov A, Tyurin V, Lee J, Mallampalli R, Wenzel S, et al. A new thiol-independent mechanism of epithelial host defense against Pseudomonas aeruginosa: iNOS/NO sabotage of theft-ferroptosis. Redox Biol. 2021;45: 102045.34167028 10.1016/j.redox.2021.102045
48. Vučković A Venerando R Tibaldi E Bosello Travain V Roveri A Bordin L Miotto G Cozza G Toppo S Maiorino M Aerobic pyruvate metabolism sensitizes cells to ferroptosis primed by GSH depletion Free Radical Biol Med 2021 167 45 53 10.1016/j.freeradbiomed.2021.02.045 33711415
Vučković A, Venerando R, Tibaldi E, Bosello Travain V, Roveri A, Bordin L, Miotto G, Cozza G, Toppo S, Maiorino M, et al. Aerobic pyruvate metabolism sensitizes cells to ferroptosis primed by GSH depletion. Free Radical Biol Med. 2021;167:45–53.33711415 10.1016/j.freeradbiomed.2021.02.045
49. Zhao X Liu Z Gao J Li H Wang X Li Y Sun F Inhibition of ferroptosis attenuates busulfan-induced oligospermia in mice Toxicology 2020 440 152489 10.1016/j.tox.2020.152489 32416107
Zhao X, Liu Z, Gao J, Li H, Wang X, Li Y, Sun F. Inhibition of ferroptosis attenuates busulfan-induced oligospermia in mice. Toxicology. 2020;440: 152489.32416107 10.1016/j.tox.2020.152489
50. Lang Z Yu S Hu Y Ginsenoside Rh2 promotes hepatic stellate cell ferroptosis and inactivation via regulation of IRF1-inhibited SLC7A11 Phytomedicine 2023 118 154950 10.1016/j.phymed.2023.154950 37441987
Lang Z, Yu S, Hu Y, et al. Ginsenoside Rh2 promotes hepatic stellate cell ferroptosis and inactivation via regulation of IRF1-inhibited SLC7A11. Phytomedicine. 2023;118: 154950.37441987 10.1016/j.phymed.2023.154950
51. Xu Y Zhu BW Li X Li YF Ye XM Hu JN Glycogen-based pH and redox sensitive nanoparticles with ginsenoside Rh2 for effective treatment of ulcerative colitis Biomaterials 2022 280 121077 10.1016/j.biomaterials.2021.121077 34890974
Xu Y, Zhu BW, Li X, Li YF, Ye XM, Hu JN. Glycogen-based pH and redox sensitive nanoparticles with ginsenoside Rh2 for effective treatment of ulcerative colitis. Biomaterials. 2022;280: 121077.34890974 10.1016/j.biomaterials.2021.121077
52. Cao L Jiang H Yang J Mao J Wei G Meng X Zang H LncRNA MIR31HG is induced by tocilizumab and ameliorates rheumatoid arthritis fibroblast-like synoviocyte-mediated inflammation via miR-214-PTEN-AKT signaling pathway Aging (Albany NY) 2021 13 24071 24085 10.18632/aging.203644 34753831
Cao L, Jiang H, Yang J, Mao J, Wei G, Meng X, Zang H. LncRNA MIR31HG is induced by tocilizumab and ameliorates rheumatoid arthritis fibroblast-like synoviocyte-mediated inflammation via miR-214-PTEN-AKT signaling pathway. Aging (Albany NY). 2021;13:24071–85.34753831 10.18632/aging.203644
53. Xiao F Zhang D Wu Y Jia Q Zhang L Li Y Yang Y Wang H Wu C Wang L miRNA-17-92 protects endothelial cells from erastin-induced ferroptosis through targeting the A20-ACSL4 axis Biochem Biophys Res Commun 2019 515 3 448 454 10.1016/j.bbrc.2019.05.147 31160087
Xiao F, Zhang D, Wu Y, Jia Q, Zhang L, Li Y, Yang Y, Wang H, Wu C, Wang L. miRNA-17-92 protects endothelial cells from erastin-induced ferroptosis through targeting the A20-ACSL4 axis. Biochem Biophys Res Commun. 2019;515(3):448–54.31160087 10.1016/j.bbrc.2019.05.147
54. Shi L Zhang P Jin R Chen X Dong L Chen W Dioscin ameliorates inflammatory bowel disease by up-regulating miR-125a-5p to regulate macrophage polarization J Clin Lab Anal 2022 36 e24455 10.1002/jcla.24455 35524480
Shi L, Zhang P, Jin R, Chen X, Dong L, Chen W. Dioscin ameliorates inflammatory bowel disease by up-regulating miR-125a-5p to regulate macrophage polarization. J Clin Lab Anal. 2022;36: e24455.35524480 10.1002/jcla.24455
55. Yang C, Yang C, Huang Z, Zhang J, Chen N, Guo Y, Zahoor A, Deng G: Reduced expression of MiR-125a-5p aggravates LPS-induced experimental acute kidney injury pathology by targeting TRAF6. Life Sci 2021:119657.
56. Dai C Chen X Li J Comish P Kang R Tang D Transcription factors in ferroptotic cell death Cancer Gene Ther 2020 27 9 645 656 10.1038/s41417-020-0170-2 32123318
Dai C, Chen X, Li J, Comish P, Kang R, Tang D. Transcription factors in ferroptotic cell death. Cancer Gene Ther. 2020;27(9):645–56.32123318 10.1038/s41417-020-0170-2
57. Li Y Feng D Wang Z Zhao Y Sun R Tian D Liu D Zhang F Ning S Yao J Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion Cell Death Differ 2019 26 11 2284 2299 10.1038/s41418-019-0299-4 30737476
Li Y, Feng D, Wang Z, Zhao Y, Sun R, Tian D, Liu D, Zhang F, Ning S, Yao J, et al. Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion. Cell Death Differ. 2019;26(11):2284–99.30737476 10.1038/s41418-019-0299-4
58. Zhu ZY Liu YD Gong Y Mitochondrial aldehyde dehydrogenase (ALDH2) rescues cardiac contractile dysfunction in an APP/PS1 murine model of Alzheimer's disease via inhibition of ACSL4-dependent ferroptosis Acta Pharmacol Sin 2022 43 1 39 49 10.1038/s41401-021-00635-2 33767380
Zhu ZY, Liu YD, Gong Y, et al. Mitochondrial aldehyde dehydrogenase (ALDH2) rescues cardiac contractile dysfunction in an APP/PS1 murine model of Alzheimer’s disease via inhibition of ACSL4-dependent ferroptosis. Acta Pharmacol Sin. 2022;43(1):39–49.33767380 10.1038/s41401-021-00635-2
59. Li Y Feng D Wang Z Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion Cell Death Differ 2019 26 11 2284 2299 10.1038/s41418-019-0299-4 30737476
Li Y, Feng D, Wang Z, et al. Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion. Cell Death Differ. 2019;26(11):2284–99.30737476 10.1038/s41418-019-0299-4
60. Kriaa A Jablaoui A Rhimi S SP-1, a serine protease from the gut microbiota, influences colitis and drives intestinal dysbiosis in mice Cells 2021 10 10 2658 10.3390/cells10102658 34685638
Kriaa A, Jablaoui A, Rhimi S, et al. SP-1, a serine protease from the gut microbiota, influences colitis and drives intestinal dysbiosis in mice. Cells. 2021;10(10):2658.34685638 10.3390/cells10102658
61. Gao C Zhou Y Chen Z Turmeric-derived nanovesicles as novel nanobiologics for targeted therapy of ulcerative colitis Theranostics 2022 12 12 5596 5614 10.7150/thno.73650 35910802
Gao C, Zhou Y, Chen Z, et al. Turmeric-derived nanovesicles as novel nanobiologics for targeted therapy of ulcerative colitis. Theranostics. 2022;12(12):5596–614.35910802 10.7150/thno.73650
62. Hou J Yun Y Xue J Jeon B Kim S Doxorubicin-induced normal breast epithelial cellular aging and its related breast cancer growth through mitochondrial autophagy and oxidative stress mitigated by ginsenoside Rh2 Phytother Res 2020 34 7 1659 1669 10.1002/ptr.6636 32100342
Hou J, Yun Y, Xue J, Jeon B, Kim S. Doxorubicin-induced normal breast epithelial cellular aging and its related breast cancer growth through mitochondrial autophagy and oxidative stress mitigated by ginsenoside Rh2. Phytother Res. 2020;34(7):1659–69.32100342 10.1002/ptr.6636
63. Zhang Q Hu Y Hu J Ding Y Shen Y Xu H Chen H Wu N Sp1-mediated upregulation of Prdx6 expression prevents podocyte injury in diabetic nephropathy via mitigation of oxidative stress and ferroptosis Life Sci 2021 278 119529 10.1016/j.lfs.2021.119529 33894270
Zhang Q, Hu Y, Hu J, Ding Y, Shen Y, Xu H, Chen H, Wu N. Sp1-mediated upregulation of Prdx6 expression prevents podocyte injury in diabetic nephropathy via mitigation of oxidative stress and ferroptosis. Life Sci. 2021;278: 119529.33894270 10.1016/j.lfs.2021.119529
64. Chen F Deng ZY Zhang B Esterification of Ginsenoside Rh2 enhanced its cellular uptake and antitumor activity in human HepG2 cells J Agric Food Chem 2016 64 1 253 261 10.1021/acs.jafc.5b05450 26672619
Chen F, Deng ZY, Zhang B, et al. Esterification of Ginsenoside Rh2 enhanced its cellular uptake and antitumor activity in human HepG2 cells. J Agric Food Chem. 2016;64(1):253–61.26672619 10.1021/acs.jafc.5b05450
