
==== Front
Oncol Lett
Oncol Lett
OL
Oncology Letters
1792-1074
1792-1082
D.A. Spandidos

10.3892/ol.2024.14636
OL-28-5-14636
Articles
Identification of feature genes and molecular mechanisms involved in cell communication in uveal melanoma through analysis of single‑cell sequencing data
Lyu Ning 123*
Wu Jiawen 123*
Dai Yiqin 123*
Fan Yidan 123
Lyu Zhaoyuan 4
Gu Jiayu 123
Cheng Jingyi 123
Xu Jianjiang 123
1 Eye Institute and Department of Ophthalmology, Eye & ENT Hospital, Fudan University, Shanghai 200031, P.R. China
2 NHC Key Laboratory of Myopia and Related Eye Diseases, Key Laboratory of Myopia and Related Eye Diseases, Chinese Academy of Medical Sciences, Shanghai 200031, P.R. China
3 Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai 200031, P.R. China
4 Graduate School of Transdisciplinary Arts, Akita University, Akita 010-0195, Japan
Correspondence to: Professor Jianjiang Xu or Dr Jingyi Cheng, Eye Institute and Department of Ophthalmology, Eye & ENT Hospital, Fudan University, 83 Fenyang Road, Shanghai 200031, P.R. China, E-mail: jianjiangxu@126.com tippicjy@126.com
* Contributed equally

11 2024
20 8 2024
20 8 2024
28 5 50308 2 2024
05 7 2024
Copyright: © 2024 Lyu et al.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
Uveal melanoma (UM) is a highly metastatic cancer with resistance to immunotherapy. The present study aimed to identify novel feature genes and molecular mechanisms in UM through analysis of single-cell sequencing data. For this purpose, data were downloaded from The Cancer Genome Atlas and National Center for Biotechnology Information Gene Expression Omnibus public databases. The statistical analysis function of the CellPhoneDB software package was used to analyze the ligand-receptor relationships of the feature genes. The Metascape database was used to perform the functional annotation of notable gene sets. The randomForestSRC package and random survival forest algorithm were applied to screen feature genes. The CIBERSORT algorithm was used to analyze the RNA-sequencing data and infer the relative proportions of the 22 immune-infiltrating cell types. In vitro, small interfering RNAs were used to knockdown the expression of target genes in C918 cells. The migration capability and viability of these cells were then assessed by gap closure and Cell Counting Kit-8 assays. In total, 13 single-cell sample subtypes were clustered by t-distributed Stochastic Neighbor Embedding and annotated by the R package, SingleR, into 7 cell categories: Tissue stem cells, epithelial cells, fibroblasts, macrophages, natural killer cells, neurons and endothelial cells. The interactions in NK cells|Endothelial cells, Neurons|Endothelial cells, CD74_APP, and SPP1_PTGER4 were more significant than those in the other subsets. T-Box transcription factor 2, tropomyosin 4, plexin D1 (PLXND1), G protein subunit α I2 (GNAI2) and SEC14-like lipid binding 1 were identified as the feature genes in UM. These marker genes were found to be significantly enriched in pathways such as vasculature development, focal adhesion and cell adhesion molecule binding. Significant correlations were observed between key genes and immune cells as well as immune factors. Relationships were also observed between the expression levels of the key genes and multiple disease-related genes. Knockdown of PLXND1 and GNAI2 expression led to significantly lower viability and gap closure rates of C918 cells. Therefore, the results of the present study uncovered cell communication between endothelial cells and other cell types, identified innovative key genes and provided potential targets of gene therapy in UM.

uveal melanoma
single-cell sequencing
cell communication
PLXND1
GNAI2
National Natural Science Foundation of China82201147 82171020 The present study was sponsored by the National Natural Science Foundation of China (grant nos. 82201147 and 82171020).
==== Body
pmcIntroduction

Uveal melanoma (UM) is the most common primary intraocular malignancy in adults (1). UM typically arises from choroidal melanocytes (90%) and melanocytes in the ciliary body (6%) or iris (4%) (2). UM is a highly malignant and lethal tumor, with ~50% of patients dying within a decade of diagnosis owing to its high risk of metastasis (3,4). Patients with metastasis have a poor prognosis, and the treatment of metastatic UM remains challenging owing to a lack of understanding of the biological characteristics of this disease (5). To address this issue, metastasis doubling times have been calculated, and it has been hypothesized that primary UM cells start to spread several years before diagnosis and initial treatment (6). Genetic characteristics linked to UM include mutations in the G protein subunit α (GNA)Q, GNA11 or eukaryotic translation initiation factor 1A X-linked genes (7). Alterations in gene expression associated with the occurrence of UM have also been demonstrated. For instance, loss of chromosome 3 and mutations in the BRCA1 associated protein 1 (BAP1) and splicing factor 3b subunit 1 genes frequently increase the risk of metastasis, and BAP1 is a tumor suppressor gene (8). In general, 1–2% of patients with UM carry germline alterations in the BAP1 gene (9). UM tissue comprises not only tumor cells but also an array of diverse immune cells (10). There is a notable increase in the presence of a distinct type (M2-type macrophages) of immune cells in UM, which accelerate tumor growth through angiogenesis and immunosuppression as a significant role of immune responses in the process of UM metastasis (10,11).

One area of significance in cancer research is single-cell sequencing, an innovative technique that provides high-resolution insights into the cellular composition of tumor tissues, thus enabling the exploration of the rich landscape of cell-to-cell communication within the tumor microenvironment (12). Some UM studies based on single-cell sequencing have shown tumor heterogeneity and varying gene expression patterns. For instance, Pandiani et al (13) found that hes family bHLH transcription factor 6 was an effective target for inhibiting UM progression. In addition, Durante et al (14) reported that lymphocyte activating 3 was a potential candidate for immune checkpoint blockade in patients with high-risk UM. Cell communication plays an essential role in the progression of cellular malignancies, as the ability of invasive cells to communicate and influence their surroundings determines the metastatic potential and subsequent impact of the disease (15). However, the cell-cell communication nexus within UM remains largely unexplored. This research requires a concerted effort to unravel the complex connections among mRNAs, micro (mi)RNAs and long non-coding (lnc)RNAs in a cancer type that is rare yet impactful, and which affects the uvea of the eye.

At present, UM is typically treated with radiation therapy, laser therapy, local resection and enucleation, chemotherapy and immunotherapy; however, none of these methods have shown satisfactory results (16,17). Furthermore, while immunotherapy with checkpoint inhibition (such as anti-cytotoxic T-lymphocyte associated protein 4 and programmed cell death protein 1/programmed death-ligand 1 inhibitors) showed promising results in treating cutaneous melanoma, it did not appear to be as effective for UM (17,18). Thus, an improved insight into the molecular and genetic profiles of UM is essential to facilitate the detection of new prognostic biomarkers and to develop new treatment modalities specific for patients with UM.

The present study aimed to identify new feature genes involved in the occurrence of UM and provide deeper insights into the mechanism of UM, including subtype clusters, ligand-receptor interactions, immune infiltration, co-expressed UM genes and competing endogenous (ce)RNA networks, through analysis of single-cell sequencing data. In vitro assays were also performed to verify the biofunctions of the identified key genes.

Materials and methods

Data acquisition

A total of 80 samples with processed raw mRNA expression data from UM were downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/projects/TCGA-UVM) (19). TCGA database is currently the largest cancer genomics database and stores various types of cancer-related data, including gene expression, miRNA expression, copy number and DNA methylation data (20). The GSE138433 dataset was downloaded from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/info/datasets.html) public database, which contained melanoma-related data for single-cell analysis (13). This dataset consisted of 6 samples. Briefly, the GEO database is a gene expression database created and maintained by the NCBI in the United States (21).

Single-cell analysis processing

First, the ‘Seurat’ package (v4; http://satijalab.org/seurat) (22) was employed to load the expression profile, followed by filtering out low-expressed genes using the criteria: nFeature_RNA >100 and percent.mt <5. Data were standardized, normalized and subjected to a principal component analysis (PCA). The ElbowPlot method identified the optimal number of principal components (PCs) as 13. Subsequently, data integration was performed among the samples using the ‘harmony’ package. Further analysis involved FindNeighbors, FindClusters and the t-distributed Stochastic Neighbor Embedding (t-SNE) method to visualize the spatial relationships between clusters with a specified resolution of 0.8.

The clusters were annotated using the ‘celldex’ (v1.0.0) and ‘SingleR’ packages (v1.4.1) (https://bioconductor.org/books/release/SingleRBook/sc-mode.html), revealing associations with crucial cells in disease occurrence. Finally, the FindAllMarkers function, with the logfc.threshold set to 1 and min.pct set to 0.25, was used to extract the marker genes for each cell subtype from the single-cell expression profile. Gene filtering criteria, including p_val_adj <0.01 and |avg_log2FoldChange|>1, was applied to identify significantly differentially expressed genes, serving as unique markers for each cell subtype.

Analysis of the interactions between ligands and receptors

CellPhoneDB (v4.0.0; https://github.com/ventolab/CellphoneDB) (23) is an openly available, curated repository of receptors, ligands and their interactions (24). Ligands and receptors consist of subunits that accurately represent heteromeric complexes. The ligand-receptor database, CellPhoneDB, is integrated with UniProt, Ensembl, PDB, IUPHAR and other resources. CellPhoneDB collectively stores 978 proteins, enabling a comprehensive and systematic analysis of communication molecules in cells and facilitating the study of intercellular communication and signaling networks in different cell types. A significance analysis of ligand-receptor relationships for features in the single-cell expression profiles was performed using the statistical_analysis function of the CellPhoneDB software package. The cluster labels of all cells were randomly permuted 1,000 times, and the average expression level of receptors within clusters and the average expression level of ligands within interacting clusters were determined. This generated a null distribution (also known as the Bernoulli distribution or binomial distribution) for each receptor-ligand pair in every pairwise comparison between two cell types. Finally, notable ligand-receptor pairs were selected for visualization.

Gene functional enrichment and protein-protein interaction (PPI) analyses

Functional annotation was performed on notable gene sets using the Metascape database (www.metascape.org) and the ‘clusterProfiler’ package (v3.18.1; http://bioconductor.org/packages/release/bioc/html/clusterProfiler.html) (25) to comprehensively explore the functional relevance of these gene sets. Gene Ontology (GO; http://metascape.org/gp/index.html) and Kyoto Encyclopedia of Genes and Genomes (KEGG; http://metascape.org/gp/index.html) analyses were performed for specific genes. A minimum overlap of ≥3 and P≤0.01 were considered to indicate statistical significance. PPIs were analyzed using Cytoscape software (3.9.1; http://cytoscape.org/) (26).

Random survival forest of selected key genes

Feature selection was performed using the ‘randomForestSRC’ package (v3.2.1; http://cran.r-project.org/web/packages/randomForestSRC/index.html) (27). Additionally, the random survival forest algorithm (v3.6.4) was used to rank the importance of prognosis-related genes (nrep=1,000, indicating 1,000 iterations in the Monte Carlo simulation). Genes with relative importance >0.5 were identified as the final marker genes.

Immune infiltration analysis

The CIBERSORT algorithm (‘CIBERSORT’ R package; v1.03; http://cibersortx.stanford.edu/) (28) was utilized to analyze RNA-sequencing data from different patient subgroups. This algorithm was used to infer the relative proportions of 22 immune-infiltrating cell types. A Pearson correlation analysis between gene expression levels and immune cell abundance was further performed. P<0.05 was considered to indicate a statistically significant difference.

Drug sensitivity analysis

Using the Genomics of Drug Sensitivity in Cancer (GDSC) database (https://www.cancerrxgene.org/), the R package ‘pRRophetic (v0.5) was employed to predict the chemosensitivity of each tumor sample. Regression analysis was employed to obtain half-maximal inhibitory concentration estimates for specific chemotherapy drugs, and 10-fold cross-validation was performed using the GDSC training set to assess the accuracy of the regression and prediction. Default values were selected for all parameters, including using ‘combat’ to remove batch effects and averaging duplicate gene expression values.

Gene Set Enrichment Analysis (GSEA)

GSEA of the expression profiles of patients with UM was performed using the GSEA tool (http://www.broadinstitute.org/gsea). This analysis was performed to identify the pathways enriched by differentially expressed genes between the high- and low-expression groups, distinguished by the median expression value of each key gene. Gene sets were filtered based on maximum and minimum gene set sizes of 500 and 15 genes, respectively. After 100 permutations, enriched gene sets were obtained based on P<0.05 and a false discovery rate of 0.25.

Construction of the nomogram and calibration curve

Overall survival (OS) curves were generated using the Kaplan-Meier (KM) method. Risk scores for each sample were calculated using the Cox proportional hazards model. Samples were divided into high-risk and low-risk groups based on the median risk score. A two-stage weighted test using the R package, ‘TSHRC’ (29), was then performed to validate the significance between the high-risk and low-risk groups.

Correlations between UM-related genes and feature genes

UM-related genes were obtained from the GeneCards database (https://www.genecards.org/) and then the expression levels of the top 20 genes with relevance score were compared with the expression levels of key genes. Analysis of the expression level of key genes and UM-related genes at the single cell level was also applied for comparison.

Construction of a lncRNA-miRNA-mRNA related ceRNA network

A potential lncRNA-miRNA-mRNA network was predicted using the miRWalk (http://mirwalk.umm.uni-heidelberg.de/) and ENCORI databases (https://rnasysu.com/encori/) and further validated using both the TargetScan (https://www.targetscan.org/vert_80/) and miRDB databases (https://mirdb.org/). Finally, ceRNA networks based on differentially expressed genes were constructed and visualized using Cytoscape software (version 3.9.1; http://cytoscape.org/) (26).

Cell culture and treatment

All experiments were performed in compliance with the Association for Research in Vision and Ophthalmology (https://www.arvo.org/About/policies/). The human UM C918 cell line (originated from choroid) was purchased from American Type Culture Collection (also termed MP41; cat. no. CRL-3297). C918 cells were cultured in fresh Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (cat. no. 11320033; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (cat. no. 10099141C; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin solution (cat. no. 15140122; Thermo Fisher Scientific, Inc.) at 37°C and 5% CO2 in a suitable incubator. For gene knockdown, small interfering (si)RNA duplexes targeting human genes [SEC14-like lipid binding 1 (SEC14L1), plexin D1 (PLXND1), tropomyosin 4 (TPM4) or GNAI2] and a control siRNA were designed and synthesized by Guangzhou RiboBio Co., Ltd. The C918 cells were seeded in 12-well plates at a density of 1×105 cells/ml. When the cells reached a 50–60% confluency, the SEC14L1, PLXND1, TPM4, GNAI2 or control siRNA (100 nmol/l) were transfected by riboFECT CP Transfection Kit (cat. no. C10511-05; Guangzhou RiboBio Co., Ltd.) according to the manufacturer's instructions. At 24 h post transfection, the cells were harvested and the knockdown efficiencies of SEC14L1, PLXND1, TPM4 and GNAI2 were evaluated using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The siRNA sequences of the target genes and the negative control are shown in Table I.

RNA extraction and RT-qPCR

Briefly, total RNA was extracted from different siRNA-treated C918 cells using TRIzol reagent (cat. no. 15596026; Thermo Fisher Scientific, Inc.). The RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). gDNA was erased at 42°C for 3 min and the first-strand cDNA was reverse transcribed from 1 µg total RNA at 42°C for 15 min followed by 95°C for 3 min using the KR106 FastQuant RT Kit with gDNA Eraser (cat. no. KR106-03; Tiangen Biotech Co., Ltd.). Subsequently, qPCR was performed using a QuantiNova SYBR Green PCR kit (cat. no. 208054; Qiagen GmbH) according to the manufacturer's instructions. The qPCR primer sequences are shown in Table II. The housekeeping gene, GAPDH, was used per sample for normalization of the data using 2−ΔΔCq (30).

Cell Counting Kit-8 (CCK-8) assay

C918 cells were treated as aforementioned then incubated with the CCK-8 reagent (cat. no. CK04-100T; Dojindo Laboratories, Inc.) at 37°C for 2 h. The absorbance at 450 nm was measured using a spectrophotometer (Synergy H1 Hybrid Reader; BioTek; Agilent Technologies, Inc.). The cell viability of each group was calculated according to the manufacturer's instructions.

Gap closure assay

C918 cells were seeded at a density of 1×105/ml cells on each side of the double-well culture inserts (cat. no. 80209; Ibidi GmbH) in a 24-well plate. After attachment, cells were respectively treated with control, PLXND1 and GNAI2 siRNA (100 nmol/l); 48 h post-transfection, the culture inserts were removed, and the cells were washed with PBS. The cells (in medium containing 1% FBS) were then allowed to migrate for a further 20 h. Cell migration was observed using an Olympus IX-73 microscope equipped with a color camera for light microscopy (Olympus Corporation). The gap closure rate of each group was evaluated by ImageJ software (v1.52a; National Institutes of Health).

Statistical analysis

All statistical analyses were performed using R language (https://cran.r-project.org/; v 4.1.3). Unpaired student's t-test was used for comparisons between two groups. For multiple comparisons, ANOVA followed by the Dunnett's test was applied. All data are presented as the mean ± SD. P<0.05 was considered to indicate a statistically significant difference.

Results

Single-cell sample subtype clustering and annotation analysis

A total of 19,441 cells with nFeature_RNA >100 and percent.mt <5 were included in the analysis (Fig. S1A and B). nfeatures=3,000 was set to merge batches of samples for subsequent analysis and to display the expression of genes in the samples (Fig. S1C). The top 10 genes with the highest standardized variance were then labeled (Fig. S1C). Through PCA (dimensionality reduction analysis) of the 10 genes, different scores were observed across different dimensions (Fig. S1D and E). However, when performing the PCA among samples, the overall differences were not significant (Fig. S1F). Based on ElbowPlot, the optimal number of PCs was determined to be 13 (Fig. S1G). Multi-sample integration of the single-cell samples using Seurat showed a small batch effect (Fig. 1A). A total of 13 subtypes were identified using t-SNE (Fig. 1B). Significant differences in the expression levels of numerous genes were observed among the subtypes. The dot plot visualization of the cell types were annotated manually to complement the results obtained from SingleR and showed that machine learning-based annotation significantly outperformed manual annotation in distinguishing various cell types (Fig. 1C). Using the R package SingleR to annotate each subtype, the 13 clusters were annotated into the following cell categories: ‘Tissue_stem_cells’, ‘Epithelial_cells’, ‘Fibroblasts’, ‘Macrophage’, ‘NK_cell’, ‘Neurons’ and ‘Endothelial_cells’ (Fig. 1D and E). Finally, using the FindAllMarkers function, 678 cell subtype marker genes were extracted from the single-cell expression profile (Table SI).

Analysis of receptor-ligand relationships and enriched pathways

Significant ligand-receptor pairs were selected for display, and the interactions in ‘NK_cell|Endothelial_cells’, ‘Neurons|Endothelial_cells’, ‘CD74_APP’ and ‘SPP1_PTGER4’ were the most significant (Fig. 2A). In addition, there were large numbers of potential ligand-receptor pairs among ‘Macrophages’, ‘NK_cell’, ‘Endothelial_cells’ and other cell types (Fig. 2B). With respect to cell-cell communication, the cellular senescence pathway was positively correlated with ‘Endothelial.cells-neurons’ (P<0.01; Fig. 2C). As observed in the heatmap shown in Fig. S2, the neurons mainly originated from progenitor cells and cones, while endothelial cells had diverse sources including capillary, lymphatic, vascular and venous origins. The count of ligand-receptor gene pairs corresponding to each cell group indicated that the Endothelial_cells subtype had the highest number of interaction relationships among all cell subtypes (Fig. 2D). Using the Metascape database, pathway analysis of 299 marker genes from the Endothelial_cell subtype showed significant enrichment in several pathways. These included ‘vasculature development’, ‘focal adhesion’ and ‘cell adhesion molecule binding’ (Fig. 2E and F). Additionally, PPI network analysis of the genes within this marker gene set (Fig. 2G) showed that complex protein interactions existed in patients with UM.

Random survival forest analysis of key genes

To further identify the key genes in the marker gene set that influenced UM, a random survival forest analysis was conducted using the TCGA-UM cohort. Based on a relative importance of >0.5, 5 genes that met the selection threshold were identified as the final markers (Fig. 3A). Excepting T-Box transcription factor 2 (TBX2), the key genes had high expression levels in NK cells (Fig. 3B). Furthermore, neither NK cells nor macrophages showed high expression of TBX2 (Fig. 3B). In the KM survival analysis, all 5 genes showed significant results in the TCGA-UM cohort, with the following order of significance: TBX2, TPM4, PLXND1, GNAI2 and SEC14L1. Specifically, high expression levels of TBX2, GNAI2, TPM4, PLXND1 and SEC14L1 were associated with a longer OS time in UM (all P<0.05; Fig. 3C-G).

Immune microenvironment analysis of key genes

The tumor immune microenvironment is typically composed of tumor-associated fibroblasts, immune cells, extracellular matrix, various growth factors, inflammatory factors and specific physical and chemical characteristics, as well as cancer cells themselves (31). The immune microenvironment significantly affects the diagnosis, survival outcome and clinical treatment sensitivity of tumors. The relative percentage of different immune cell types in each sample was shown in Fig. 4A. There were multiple significant correlations among these immune cells, indicating complex biological interactions among inflammatory cells (Fig. 4B). PLXND1 expression was most significantly positively correlated with monocytes and negatively correlated with plasma cells (both P<0.01; Fig. 4C). TPM4 expression was most significantly positively correlated with follicular helper T cells and negatively correlated with M2 macrophages (both P<0.01; Fig. 4C). GNAI2 expression was most significantly positively correlated with monocytes (P<0.01; Fig. 4C). TBX2 expression was most significantly positively correlated with resting CD4 memory T cells and negatively correlated with M0 macrophages (both P<0.01; Fig. 4C). Correlations were also observed between these key genes and different immune factors, including immune modulators, chemokines, major histocompatibility complex and cell receptors based on the TISIDB database (Fig. 4D). Notably, the expression level of TPM4 was significantly positively correlated with almost all immune factors. By contrast, the expression level of PLXND1 was negatively correlated with most immune factors.

Analysis of tumor immune dysfunction and exclusion showed differences between the high and low expression groups (with the median value as the cut-off for grouping). A significant difference in the dysfunction level between the high and low expression groups was only found for GNAI2 (P<0.001; Fig. 5A). In the exclusion and dysfunction analyses, the H-score group referred to samples with scores higher than the median score and the L-score group referred to samples with scores lower than the median score.

With respect to the relationship between key genes and the sensitivity to common chemotherapy drugs, the expression levels of the key genes were significantly correlated with sensitivity to bexarotene, bicalutamide, docetaxel, bryostatin.1, JNK inhibitor VIII, lenalidomide, mitomycin C and sunitinib (Fig. S3).

Specific signaling pathways associated with key genes

Certain highly significant pathways enriched in the key genes are shown in Fig. 6. The GNAI2 gene was enriched in pathways such as ‘chromosome organization involved in meiotic cell cycle’ and ‘high density lipoprotein particle assembly’ in the GO analysis and in pathways such as ‘acute myeloid leukemia’ and ‘basal cell carcinoma’ in the KEGG analysis (Fig. 6A and B). The PLXND1 gene was enriched in pathways such as ‘growth plate cartilage chondrocyte differentiation’ and ‘positive regulation of oxidative stress induced cell death’ in the GO analysis and in pathways such as ‘basal cell carcinoma’ and ‘cell cycle’ in the KEGG analysis (Fig. 6C and D). The SEC14L1 gene was enriched in pathways such as ‘aerobic electron transport chain’ and ‘ATP synthesis coupled electron transport’ in the GO analysis and in pathways such as ‘acute myeloid leukemia’ and ‘glycosaminoglycan biosynthesis chondroitin sulfate’ in the KEGG analysis (Fig. 6E and F). The TBX2 gene was enriched in pathways such as ‘establishment of protein localization to chromosome’ and ‘formation of extrachromosomal circular DNA’ in the GO analysis and in pathways such as ‘glyoxylate and dicarboxylate metabolism’ and ‘histidine metabolism’ in the KEGG analysis (Fig. 6G and H). The TPM4 gene was enriched in pathways such as ‘cell redox homeostasis’ and ‘cellular response to ionizing radiation’ in the GO analysis and in pathways such as ‘cytosolic DNA sensing pathway’ and ‘drug metabolism cytochrome P450’ in the KEGG analysis (Fig. 6I and J). These signaling pathways influenced the progression of UM.

Performance of the nomogram and calibration curve

The expression levels of key genes were visualized in the form of column charts based on the results of the regression analysis. Regression analysis showed that the values of different clinical indicators of UM and the expression distribution of key genes contributed to the scoring process to varying degrees in all samples (Fig. 7A). Furthermore, predictive analysis was performed for 1-year and 2-year survival periods, and the predicted OS rate aligned well with the observed OS (Fig. 7B). However, the predicted OS rate for the 3-year and 5-year period was not constructed due to the poor curve fitting (Fig. S4).

Correlations between the expression levels of the key genes and UM-related genes

A total of 2,312 disease-related genes associated with UM were obtained from the GeneCards database. Analysis of the expression levels of the 5 key genes in different clusters (Fig. 8A) and the expression levels of the top 20 disease-related genes, based on their relevance scores from the GeneCards database, (Fig. 8B and C) showed a significant correlation between the expression levels of the key genes and multiple UM-related genes (Fig. 8D). Notably, the expression level of TPM4 had a significant positive correlation with that of melanocortin 1 receptor (r=0.613, P<0.001; Fig. 8D), and the expression level of GNAI2 had a significant negative correlation with that of protection of telomeres protein 1 (r=−0.601, P<0.001; Fig. 8D). The correlations of TPM4 and UM-related genes were mostly opposite to that of GNAI2 and UM-related genes (Fig. 8D). However, the correlations of PLXND1 and GNAI2 with UM-related genes were more consistent (Fig. 8D). Additionally, when the expression of key and UM-related genes were analyzed at the single-cell level, these key genes were co-expressed with a number of UM-related genes (Fig. S5).

ceRNA network analysis of the key genes

First, extracting mRNA-miRNA interaction pairs related to the 5 key mRNAs from the miRWalk database resulted in 1,414 miRNAs. Only 41 mRNA-miRNA interaction pairs that were detectable in both the TargetScan and miRDB databases (including 4 mRNAs and 11 miRNAs) were then retained. Based on these miRNAs, the interacting lncRNAs were further predicted, resulting in 2,936 predicted interaction pairs (including 11 miRNAs and 1,071 lncRNAs). Finally, a ceRNA network, which involved 4 mRNAs and 11 miRNAs (Fig. 9) with 1,071 lncRNAs (Fig. S6), was constructed using Cytoscape.

In vitro biofunction of PLXND1 and GNAI2 in C918 cells

Firstly, the endogenous transcription level of feature genes in C918 cells were tested. The mean quantification cycle values of PLXND1, TBX2, SEC14L1, GNAI2 and TPM4 were 25.3, 32.3, 25.1, 22.2, and 23.2, respectively (Fig. S7A). TBX2 was excluded from the subsequent siRNA knockdown experiments owing to its low native expression, with a CT >30 compared with GAPDH (P<0.0001; Fig. S7A). SEC14L1 and TPM4 were also not tested in the further experiments due to the low knockdown efficiency (<50%) of the respective siRNAs compared with the negative control (P<0.01 and P<0.001, respectively; Fig. S7D and E). The PLXND1 and GNAI2 siRNAs were selected for CCK-8 and gap closure assays due to their high silencing efficiencies (>50%; Fig. S7B and C). The cell viabilities of the PLXND1 and GNAI2 knockdown groups were 59.8% and 62.1%, respectively, which were significantly lower than those of the siRNA control group (both P<0.0001; Fig. 10A and B). In the gap closure assay, the closure rate was significantly lower in the PLX1 (70.3%; P<0.001; Fig. 10D) and GNAI2 (68.7%; P<0.01; Fig. 10C) knockdown groups compared with the control group (92.9%). Representative images of the gap closure assay are shown in Fig. 10E.

Discussion

The present study, by analyzing single-cell data and annotating endothelial cells, showed that endothelial cells exhibited the most extensive cellular communication. Notably, these cells had significant roles in various biological processes in UM, particularly in vascular development. The findings of the present study will not only enhance the understanding of the pathobiology of UM at the cellular level but will also aid in the discovery of novel pathways and therapeutic targets for this malignancy.

Endothelial cells play a crucial role in the development of UM. García-Mulero et al (32) used the ESTIMATE algorithm to analyze TCGA data and found a close association among endothelial cells, fibroblasts (stromal cells), immune cells (especially cytotoxic cells) and adverse prognoses from UM recurrence. Although endothelial cells only account for 4–18% of ocular cells (depending on the tissue) (33), they play a pivotal role in UM progression and metastasis by orchestrating intricate interactions within the tumor microenvironment (34). UM arises in highly vascularized tissue, indicating a significant involvement of endothelial cells in its pathogenesis (35). Endothelial cells are key factors of angiogenesis, a process crucial for tumor growth and dissemination. Furthermore, through the secretion of angiocrine factors, endothelial cells not only regulate angiogenesis but also modulate tumor cell behavior, immune response and stromal remodeling (36). The aforementioned findings show that endothelial cells engage in extensive crosstalk with other cell types, including tumor cells, immune cells and fibroblasts, to promote tumor growth, invasion and metastasis. Additionally, endothelial cells may facilitate tumor cell intravasation into the bloodstream by participating in vascular mimicry and interacting with tumor cells during this process (37). The high number of cell communications identified in endothelial cells underscores their essential role in driving UM progression through angiogenesis, microenvironmental interactions and response to pro-angiogenic signals secreted by tumor cells (38). In normal conditions, endothelial cells are situated on the vascular wall and act as barriers preventing cell entry or exit from the bloodstream (38). Epithelial-to-mesenchymal transition (EMT) is a process in which epithelial cells lose cell adhesion and polarity and transform into mesenchymal-like cells (39,40). Vascular endothelial cells also participate in regulating cancer cells, thereby enhancing their invasive and migratory capabilities. A study has indicated that vascular endothelial cells induce EMT in human pancreatic, lung and murine mammary gland cancer cell lines by continuously secreting TGFβ1 and TGFβ2 (41). Cancer cells overcome the endothelial barrier by altering their vascular system. During the migration of mesenchymal cancer cells towards blood vessels, they may undergo passive transendothelial migration through endothelial cells owing to the highly leaky nature of tumor vessels (42).

To the best of our knowledge, this is the first study to identify that the SEC14L1, TPM4, TBX2, PLXND1 and GNAI2 genes are associated with UM prognosis. The KM survival analysis demonstrated significant differences in the expression levels of these 5 genes between the high and low expression groups in the TCGA-UM cohort. SEC14L1 has been reported as a prognostic factor in both breast cancer and prostate cancer (43,44). TPM4 has been reported as a prospective marker for diagnosis, treatment outcome, and a small molecular drugs target for pan-cancer treatment, including in gastric cancer treatment (45). Consistent results were obtained in the present study. TPM4 expression was positively correlated with almost all immune factors in contrast to that of other genes. This indicated the essential role of TPM4 in immune infiltration and the progression of UM.

TBX2 and TBX3, members of the T-box transcription factor family, are upregulated in various cancer types, including melanoma, breast, liver, lung, pancreatic, ovarian and cervical cancer (46). As the master regulator of the type 1 immune response, TBX21 is also upregulated in the leukocytes of peripheral blood in patients with late-onset Alzheimer's disease (47). PLXND1 knockdown significantly reduces cell migration and invasion and inhibits EMT in colorectal cancer (48). The activation of PLXND1 in dorsal root ganglion cells increases the migratory and invasive activities of pancreatic cancer cells and a loss of neural PLXND1 reduces the innervation of orthotopic pancreatic ductal adenocarcinoma and metastasis in mice (49). In addition, PLXND1 can impair endocardial endothelial autophagy via mediating calcium dyshomeostasis in atrial fibrillation and is a mechanosensor in endothelial cells (50,51). It is well known that the GNAQ and GNA11 genes are mutated in 80–90% of UM in a mutually exclusive pattern (52). These genes encode the α subunits of the heterotrimeric G proteins, Gq and G11, commonly termed the Gq/11 (Gq/G11) family (52). The typical function of Gq/G11 is to activate intracellular signaling pathways in response to activation of the cell surface G protein-coupled receptors (53,54). However, GNAI2 encodes the α-2 subunit of guanine nucleotide-binding protein G(i) involved in the regulation of adenylate cyclase and transcriptome in ovarian cancer (55), and is a critical regulator of oncogenesis and an upstream driver of cancer progression in ovarian cancer (56). In addition, a protein biomarker study using liquid biopsy revealed a negative correlation between GNAI2 and the survival of patients with cholangiocarcinoma (57). The aforementioned findings showed notable differences in the biofunction and encoding proteins between the Gq/G11 family and GNAI2. Thus, we consider that the mutation of GNAI2 is a new variant. Consistently, in the present study, the results of the in vitro experiments demonstrated a significant reduction in cell viability and gap closure rate after PLXND1 and GNAI2 knockdown. This indicated that PLXND1 and GNAI2 may serve as potential diagnostic markers and therapeutic targets for UM. Furthermore, these genes and their co-expressions were significantly correlated with disease-related genes, validating the reliability of the study findings and demonstrating complex genetic interactions in UM.

A crucial aspect addressed in the present study was the strong relationship between the tumor microenvironment and notable aspects of disease understanding, such as diagnosis, survival outcome and treatment sensitivity. Previous studies have shown the abundance of several tumor-infiltrating immune cells, T cells and dendritic cells in UM (58,59). A previous study reported a positive correlation between the risk score of UM and the levels of immune cell infiltration, including CD4+ T cells, B cells, NK cells, dendritic cells and macrophages (60). Notably, the findings of the present study further revealed that certain genes were significantly correlated with specific immune cells; for instance, PLXND1 was associated with monocytes and TPM4 was associated with follicular helper T cells. Combined with the significant role of GNAI2 in immune dysfunction, these findings implied the potential value of key genes in UM immunotherapy. Examining the molecular landscape of a disease can significantly contribute to refining current methods and strengthening individualized medicine (61). This underscores that personalized medicine is the future of disease treatment in a world where generalized treatments are becoming less desirable and effective. Furthermore, the accurate prediction of the 1 and 2-year OS rate using key genes and clinical information in the present study illustrated the clinical value of these key genes in predicting the prognosis of patients with UM.

Recent experimental evidence suggests that lncRNAs serve as ceRNAs, bind to miRNAs to modulate miRNA-induced gene silencing, act as natural miRNA sponges, regulate gene expression and play crucial roles in human diseases including UM (62–64). In the present study, a ceRNA network specific for UM was constructed. The findings highlighted the complex nature of UM, combining with the functional roles of various mRNAs, miRNAs and lncRNAs. The intricate network of these molecules along with the heterogeneous nature of the disease presents a challenging scenario for the design of therapeutic strategies. Thus, in the present study, the cell communication mechanisms among UM were initially elucidated using single-cell and TCGA data and key genes associated with prognosis were identified. Although the present study has reported notable findings, it also has limitations, particularly the lack of in vivo verification and examination of detailed molecular mechanisms. Further research is needed to elucidate the molecular mechanisms of UM.

In summary, the results of the present study revealed the communication between endothelial cells and other cell types, elucidating the molecular mechanisms underlying UM. The identification of key genes (SEC14L1, PLXND1, TPM4, GNAI2 and TBX2) in UM prompted further analyses. In vitro assays confirmed the functional significance of PLXND1 and GNAI2, with the knockdown of these genes decreasing cell viability and delaying cell migration. We consider that these findings will not only enhance the understanding of the pathobiology of UM at the cellular level but will also serve to reveal novel pathways and therapeutic targets in the treatment of this mucosal cancer.

Supplementary Material

Supporting Data

Supporting Data

Acknowledgements

Not applicable.

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

NL contributed to investigation (bioinformatics analysis), writing (original draft) and validation (bioinformatics database). JW contributed to investigation (bioinformatics database), writing (original draft) and formal analysis. YD contributed to investigation (in vitro experiments) and writing (original draft). YF, ZL and JG contributed to formal analysis and validation (bioinformatics analysis). JC contributed to conceptualization and supervision. JX contributed to conceptualization, writing (review and editing), supervision and funding acquirement. All authors read and approved to the final version of the manuscript. NL, JW and JC confirm the authenticity of all the raw data.

Ethics approval and consent to participate

All experiments were performed in compliance with the Association for Research in Vision and Ophthalmology, and the experimental protocols were evaluated and approved by the Ethical Committee of Eye and ENT Hospital, Fudan University (Shanghai, China; approval no. ky2012-037).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Figure 1. Single-cell sample subtype clustering analysis (GSE138433 dataset). (A) Multi-sample integration. (B) Subtypes identified by t-SNE. (C) The dot plot visualization of cell types. (D) Cell categories of clustered subtypes. (E) Proportion of samples in each category. NK, natural killer; t-SNE, t-distributed Stochastic Neighbor Embedding.

Figure 2. Analysis of receptor-ligand relationships, enriched pathways and protein-protein interaction of key genes (GSE138433 dataset). (A) Representative ligand-receptor pairs. (B) Interactions of ligand-receptor pairs in different cell category. (C) Pathways related to cell-cell communication. (D) Number of ligand-receptor gene pairs corresponding to each cell group. (F and E) Enriched pathway analysis of the identified marker genes. (G) Protein-protein interaction network. CC, cellular component; GO, Gene Ontology; NES, normalized enrichment score; NK, natural killer.

Figure 3. Random survival forest analysis of marker genes (TCGA-UVM dataset). (A) Random survival forest analysis and 5 genes with a relative importance of >0.5. (B) The expression levels of key genes in different cell clusters. Survival curves for (C) TBX2, (D) GNAI2, (E) TPM4, (F) PXLND1 and (G) SEC14L1 in The Cancer Genome Atlas-uveal melanoma cohort. The P-value of the two-stage weighted test of each gene is shown. GNAI2, G protein subunit α I2; NK, natural killer; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 4. Immune infiltration in uveal melanoma (TCGA-UVM dataset). (A) Immune cell content of each sample. (B) Immune cell correlation map. (C) Relationship between key genes and immune cells. (D) Correlations between key genes and immune-factor (chemokines, immunoinhibitors, immunostimulators, MHC and receptors) related genes. GNAI2, G protein subunit α I2; MHC, major histocompatibility complex; NK, natural killer; PLXND1, plexin D1; pv, P-value; SEC14L1, SEC14-like lipid binding 1; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 5. Analysis of tumor immune dysfunction and exclusion of key genes (TCGA-UVM dataset). Dysfunction and Exclusion of (A) GNAI2, (B) PLXND1, (C) SEC14L1, (D) TBX2 and (E) TPM4. GNAI2, G protein subunit α I2; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 6. Specific signaling pathways enriched by key genes. GO and KEGG analysis of (A and B) GNAI2, (C and D) PLXND1, (E and F) SEC14L1, (G and H) TBX2 and (I and J) of TPM4. GNAI2, G protein subunit α I2; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 7. Construction of a nomogram and calibration curve. (A) Regression analysis of different clinical indicators and the expression distribution of key genes. (B) Predictive analysis of the 1 and 2-year OS periods. GNAI2, G protein subunit α I2; M, metastasis stage; OS, overall survival; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; T, tumor stage; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 8. Expression levels of key genes and UM-related genes. (A) The expression levels of 5 key genes in different clusters. (B and C) The expression levels of the top 20 genes based on their relevance scores. (D) The correlations between the expression levels of the key genes and multiple UM-related genes. GNAI2, G protein subunit α I2; NK, natural killer; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; t-SNE, t-distributed Stochastic Neighbor Embedding; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4; UV, uveal melanoma.

Figure 9. Competing endogenous RNA network of the key genes involved 4 mRNAs and 11 miRNAs. GNAI2, G protein subunit α I2; miR/miRNA, microRNA; PLXND1, plexin D1; SEC14L1, SEC14-like lipid binding 1; TBX2, T-Box transcription factor 2; TPM4, tropomyosin 4.

Figure 10. In vitro biofunction of PLXND1 and GNAI2 in C918 cells. Viability of C918 cells after (A) GNAI2 and (B) PLXND1 siRNA transfection. Gap closure rate of the (C) siGNAI2 and (D) siPLX1 groups after 20 h. (E) Representative images of the gap closure assay; scale bar, 200 µm. **P<0.01, ***P<0.001, ****P<0.0001. CON, control; GNAI2, G protein subunit α I2; PLXND1, plexin D1; si, small interfering (RNA).

Table I. Small interfering RNA sequences used in the present study.

Gene	Sequence, 5′-3′	
GNAI2	Sense: GGACCUGAAUAAGCGCAAA	
	Anti-sense: UUUGCGCUUAUUCAGGUCC	
TPM4	Sense: UGCUGAAUUUGCAGAGAGA	
	Anti-sense: UCUCUCUGCAAAUUCAGCA	
SEC14L1	Sense: GCUGGAUUACAUCGACAAA	
	Anti-sense: UUUGUCGAUGUAAUCCAGC	
PLXND1	Sense: CCAUGAGUCUCAUAGACAA	
	Anti-sense: UUGUCUAUGAGACUCAUGG	
Negative	Sense: UUCUCCGAACGUGUCACGU	
control	Anti-sense: ACGUGACACGUUCGGAGAA	
GNAI2, G protein subunit α I2; TPM4, tropomyosin 4; SEC14L1, SEC14-like lipid binding 1; PLXND1, plexin D1.

Table II. Primer sequences used in reverse transcription-quantitative PCR.

Gene	Primer sequences, 5′-3′	
GNAI2	Forward: CACCGCCGAGGAGCAAGG	
	Reverse: CTCCAGGTCGTTCAGGTAGTAGG	
TPM4	Forward: CCCTCAACCGACGCATCCAG	
	Reverse: TCACCTTCATTCCTCTCTCACTCTC	
SEC14L1	Forward: GCTGGAGAACGAAGACCTGAAG	
	Reverse: GACTGACGAGGCATCCACAATC	
TBX2	Forward: GCTGACCAACAACATCTCTGACAAG	
	Reverse: AGGTGCGGAAGGTGCTGTAAG	
PLXND1	Forward: GCCATCAAGCAGCAAATCAACAAG	
	Reverse: CCGCAGCAGCCACTCCTC	
GAPDH	Forward: CGACCACTTTGTCAAGCTCA	
	Reverse: AGGGGAGATTCAGTGTGGTG	
GNAI2, G protein subunit α I2; TPM4, tropomyosin 4; SEC14L1, SEC14-like lipid binding 1; PLXND1, plexin D1; TBX2, T-Box transcription factor 2.
==== Refs
References

1 McLaughlin CC Wu XC Jemal A Martin HJ Roche LM Chen VW Incidence of noncutaneous melanomas in the U.S Cancer 103 1000 1007 2005 10.1002/cncr.20866 15651058
2 Shields CL Furuta M Thangappan A Nagori S Mashayekhi A Lally DR Kelly CC Rudich DS Nagori AV Wakade OA Metastasis of uveal melanoma millimeter-by-millimeter in 8033 consecutive eyes Arch Ophthalmol 127 989 998 2009 10.1001/archophthalmol.2009.208 19667335
3 Damato B Ocular treatment of choroidal melanoma in relation to the prevention of metastatic death-A personal view Prog Retin Eye Res 66 187 199 2018 10.1016/j.preteyeres.2018.03.004 29571968
4 Damato B Eleuteri A Azzam FGT Coupland SE Estimating prognosis for survival after treatment of choroidal melanoma Prog Retina Eye Res 30 285 295 2011 10.1016/j.preteyeres.2011.05.003 21658465
5 Sun S Shi R Xu L Sun F Identification of heterogeneity and prognostic key genes associated with uveal melanoma using single-cell RNA-sequencing technology Melanoma Res 32 18 26 2022 10.1097/CMR.0000000000000783 34879031
6 Eskelin S Pyrhönen S Summanen P Hahka-Kemppinen M Kivel T Tumor doubling times in metastatic malignant melanoma of the uvea: Tumor progression before and after treatment Ophthalmology 107 1443 1449 2000 10.1016/S0161-6420(00)00182-2 10919885
7 Hou C Xiao L Ren X Tang F Guo B Zeng W Liang C Yan N Mutations of GNAQ, GNA11, SF3B1, EIF1AX, PLCB4 and CYSLTR in uveal melanoma in Chinese patients Ophthalmic Res 63 358 368 2020 10.1159/000502888 31614358
8 Robertson AG Shih J Yau C Gibb EA Oba J Mungall KL Hess JM Uzunangelov V Walter V Danilova L Integrative analysis identifies four molecular and clinical subsets in uveal melanoma Cancer Cell 32 204 220 2017 10.1016/j.ccell.2017.07.003 28810145
9 Gupta MP Lane AM Deangelis MM Mayne K Crabtree M Gragoudas ES Kim IK Clinical characteristics of uveal melanoma in patients with germline BAP1 mutations JAMA Ophthalmol 133 881 887 2015 10.1001/jamaophthalmol.2015.1119 25974357
10 Jager MJ Ly LV El Filali M Madigan MC Macrophages in uveal melanoma and in experimental ocular tumor models: Friends or foes? Prog Retin Eye Res 30 129 146 2011 10.1016/j.preteyeres.2010.11.004 21129496
11 Rossi E Schinzari G Zizzari IG Maiorano BA Pagliara MM Sammarco MG Fiorentino V Petrone G Cassano A Rindi G Immunological backbone of uveal melanoma: Is there a rationale for immunotherapy? Cancers (Basel) 11 1055 2019 10.3390/cancers11081055 31357439
12 Zhang Y Wang D Peng M Tang L Ouyang J Xiong F Guo C Tang Y Zhou Y Liao Q Single-cell RNA sequencing in cancer research J Exp Clin Cancer Res 40 81 2021 10.1186/s13046-021-01874-1 33648534
13 Pandiani C Strub T Nottet N Cheli Y Gambi G Bille K Husser C Dalmasso M Béranger G Lassalle S Single-cell RNA sequencing reveals intratumoral heterogeneity in primary uveal melanomas and identifies HES6 as a driver of the metastatic disease Cell Death Differ 28 1990 2000 2021 10.1038/s41418-020-00730-7 33462406
14 Durante MA Rodriguez DA Kurtenbach S Kuznetsov JN Sanchez MI Decatur CL Snyder H Feun LG Livingstone AS Harbour JW Single-cell analysis reveals new evolutionary complexity in uveal melanoma Nat Commun 11 496 2020 10.1038/s41467-019-14256-1 31980621
15 Schwager SC Taufalele PV Reinhart-King CA Cell-cell mechanical communication in cancer Cell Mol Bioeng 12 1 14 2019 10.1007/s12195-018-00564-x 31565083
16 Bai H Bosch JJ Heindl LM Current management of uveal melanoma: A review Clin Exp Ophthalmol 51 484 494 2023 10.1111/ceo.14214 37076276
17 Kaštelan S Antunica AG Oresković LB Pelčić G Kasun E Hat K Immunotherapy for uveal melanoma-Current knowledge and perspectives Curr Med Chem 27 1350 1366 2020 10.2174/0929867326666190704141444 31272342
18 Oliva M Rullan AJ Piulats JM Uveal melanoma as a target for immune-therapy Ann Transl Med 4 172 2016 10.21037/atm.2016.05.04 27275485
19 Tomczak K Czerwińska P Wiznerowicz M The cancer genome atlas (TCGA): An immeasurable source of knowledge Contemp Oncol (Pozn) 19 A68 A77 2015 25691825
20 Weinstein JN Collisson EA Mills GB Shaw KR Ozenberger BA Ellrott K Shmulevich I Sander C Stuart JM Cancer Genome Atlas Research Network The cancer genome atlas pan-cancer analysis project Nat Genet 45 1113 1120 2013 10.1038/ng.2764 24071849
21 Davis S Meltzer PS GEOquery: A bridge between the gene expression omnibus (GEO) and bioconductor Bioinformatics 23 1846 1847 2007 10.1093/bioinformatics/btm254 17496320
22 Hao Y Hao S Andersen-Nissen E Mauck WM III Zheng S Butler MJ Lee A Wilk AJ Darby C Zager M Integrated analysis of multimodal single-cell data Cell 184 3573 3587.e29 2021 10.1016/j.cell.2021.04.048 34062119
23 Garcia-Alonso L Lorenzi V Mazzeo CI Alves-Lopes JP Roberts K Sancho-Serra C Engelbert J Marečková M Gruhn WH Botting RA Single-cell roadmap of human gonadal development Nature 607 540 547 2022 10.1038/s41586-022-04918-4 35794482
24 Efremova M Vento-Tormo M Teichmann SA Vento-Tormo R CellPhoneDB: Inferring cell-cell communication from combined expression of multi-subunit ligand-receptor complexes Nat Protoc 15 1484 1506 2020 10.1038/s41596-020-0292-x 32103204
25 Yu G Wang LG Han Y He QY ClusterProfiler: An R package for comparing biological themes among gene clusters OMICS 16 284 287 2012 10.1089/omi.2011.0118 22455463
26 Shannon P Markiel A Ozier O Baliga NS Wang JT Ramage D Amin N Schwikowski B Ideker T Cytoscape: A software environment for integrated models of biomolecular interaction networks Genome Res 13 2498 2504 2003 10.1101/gr.1239303 14597658
27 Ishwaran H Kogalur UB Blackstone EH Lauer MS Random survival forests 2008 10.1214/08-AOAS169
28 Newman AM Steen CB Liu CL Gentles AJ Chaudhuri AA Scherer F Khodadoust MS Esfahani MS Luca BA Steiner D Determining cell type abundance and expression from bulk tissues with digital cytometry Nat Biotechnol 37 773 782 2019 10.1038/s41587-019-0114-2 31061481
29 Li H Han D Hou Y Chen H Chen Z Statistical inference methods for two crossing survival curves: A comparison of methods PLoS One 10 e0116774 2015 10.1371/journal.pone.0116774 25615624
30 Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method Methods 25 402 408 2001 10.1006/meth.2001.1262 11846609
31 Neophytou CM Panagi M Stylianopoulos T Papageorgis P The role of tumor microenvironment in cancer metastasis: Molecular mechanisms and therapeutic opportunities Cancers (Basel) 13 2053 2021 10.3390/cancers13092053 33922795
32 García-Mulero S Alonso MH Del Carpio LP Sanz-Pamplona R Piulats JM Additive role of immune system infiltration and angiogenesis in uveal melanoma progression Int J Mol Sci 22 2669 2021 10.3390/ijms22052669 33800878
33 Voigt AP Mullin NK Stone EM Tucker BA Scheetz TE Mullins RF Single-cell RNA sequencing in vision research: Insights into human retinal health and disease Prog Retin Eye Res 83 100934 2021 10.1016/j.preteyeres.2020.100934 33383180
34 Castet F Garcia-Mulero S Sanz-Pamplona R Cuellar A Casanovas O Caminal JM Piulats JM Uveal melanoma, angiogenesis and immunotherapy, is there any hope? Cancers (Basel) 11 834 2019 10.3390/cancers11060834 31212986
35 Notting IC Missotten GS Sijmons B Boonman ZF Keunen JE van der Pluijm G Angiogenic profile of uveal melanoma Curr Eye Res 31 775 785 2006 10.1080/02713680600865052 16966150
36 Potente M Mäkinen T Vascular heterogeneity and specialization in development and disease Nat Rev Mol Cell Biol 18 477 494 2017 10.1038/nrm.2017.36 28537573
37 Hanahan D Weinberg RA Hallmarks of cancer: The next generation Cell 144 646 674 2011 10.1016/j.cell.2011.02.013 21376230
38 Krüger-Genge A Blocki A Franke RP Jung F Vascular endothelial cell biology: An update Int J Mol Sci 20 4411 2019 10.3390/ijms20184411 31500313
39 Thiery JP Acloque H Huang RY Nieto MA Epithelial-mesenchymal transitions in development and disease Cell 139 871 890 2009 10.1016/j.cell.2009.11.007 19945376
40 Nieto MA The ins and outs of the epithelial to mesenchymal transition in health and disease Annu Rev Cell Dev Biol 27 347 376 2011 10.1146/annurev-cellbio-092910-154036 21740232
41 Kimura C Hayashi M Mizuno Y Oike M Endothelium-dependent epithelial-mesenchymal transition of tumor cells: Exclusive roles of transforming growth factor β1 and β2 Biochim Biophys Acta 1830 4470 4481 2013 10.1016/j.bbagen.2013.05.009 23668958
42 Shenoy AK Lu J Cancer cells remodel themselves and vasculature to overcome the endothelial barrier Cancer Lett 380 534 544 2016 10.1016/j.canlet.2014.10.031 25449784
43 Sonbul SN Aleskandarany MA Kurozumi S Joseph C Toss MS Diez-Rodriguez M Diez-Rodriguez M Nolan CC Mukherjee A Martin S Saccharomyces cerevisiae-like 1 (SEC14L1) is a prognostic factor in breast cancer associated with lymphovascular invasion Mod Pathol 31 1675 1682 2018 10.1038/s41379-018-0092-9 29955149
44 Agell L Hernández S Nonell L Lorenzo M Puigdecanet E de Muga S Juanpere N Bermudo R Fernández PL Lorente JA A 12-gene expression signature is associated with aggressive histological in prostate cancer: SEC14L1 and TCEB1 genes are potential markers of progression Am J Pathol 181 1585 1594 2012 10.1016/j.ajpath.2012.08.005 23083832
45 Guo Q Zhao L Yan N Li Y Guo C Dang S Shen X Han J Luo Y Integrated pan-cancer analysis and experimental verification of the roles of tropomyosin 4 in gastric cancer Front Immunol 14 1148056 2023 10.3389/fimmu.2023.1148056 36993958
46 Lu J Li XP Dong Q Kung HF He ML TBX2 and TBX3: The special value for anticancer drug targets Biochim Biophys Acta 1806 268 274 2010 20624445
47 Fatemi Langroudi SR Zeinaly M Ajamian F TBX21, the Master regulator of the type 1 immune response, overexpresses in the leukocytes of peripheral blood in patients with late-onset Alzheimer's disease Immun Ageing 20 59 2023 10.1186/s12979-023-00385-1 37950255
48 Hagihara K Haraguchi N Nishimura J Yasueda A Fujino S Ogino T Takahashi H Miyoshi N Uemura M Matsuda C PLXND1/SEMA3E promotes epithelial-mesenchymal transition partly via the PI3k/AKT-signaling pathway and induces heterogenity in colorectal cancer Ann Surg Oncol 29 7435 7445 2022 10.1245/s10434-022-12111-0 35917012
49 Jurcak NR Rucki AA Muth S Thompson E Sharma R Ding D Zhu Q Eshleman JR Anders RA Jaffeeet EM Axon guidance molecules promote perineural invasion and metastasis of orthotopic pancreatic tumors in mice Gastroenterology 157 838 850.e6 2019 10.1053/j.gastro.2019.05.065 31163177
50 Sun M Chen Z Song Y Zhang B Yang J Tan H PLXND1-mediated calcium dyshomeostasis impairs endocardial endothelial autophagy in atrial fibrillation Front Physiol 13 960480 2022 10.3389/fphys.2022.960480 36017337
51 Mehta V Pang KL Rozbesky D Nather K Keen A Lachowski D Kong Y Karia D Ameismeier M Huang J The guidance receptor plexin D1 is a mechanosensor in endothelial cells Nature 578 290 295 2020 10.1038/s41586-020-1979-4 32025034
52 Silva-Rodríguez P Fernández-Díaz D Bande M Pardo M Loidi L Blanco-Teijeiro MJ GNAQ and GNA11 Genes: A Comprehensive review on oncogenesis, prognosis and therapeutic opportunities in uveal melanoma Cancers (Basel) 14 3066 2022 10.3390/cancers14133066 35804836
53 Gilman AG G proteins: Transducers of receptor-generated signals Annu Rev Biochem 56 615 649 1987 10.1146/annurev.bi.56.070187.003151 3113327
54 Rodbell M Nobel Lecture. Signal transduction: Evolution of an idea Biosci Rep 15 117 133 1995 10.1007/BF01207453 7579038
55 Ha JH Jayaraman M Yan M Dhanasekaran P Isidoro C Song YS Dhanasekaran DN GNAi2/gip2-regulated transcriptome and its therapeutic significance in ovarian cancer Biomolecules 11 1211 2021 10.3390/biom11081211 34439877
56 Raymond JR Jr Appleton KM Pierce JY Peterson YK Suppression of GNAI2 message in ovarian cancer J Ovarian Res 7 6 2014 10.1186/1757-2215-7-6 24423449
57 Lapitz A Azkargorta M Milkiewicz P Olaizola P Zhuravleva E Grimsrud MM Schramm C Arbelaiz A O'Rourke CJ Casta AL Liquid biopsy-based protein biomarkers for risk prediction, early diagnosis, and prognostication of cholangiocarcinoma J Hepatol 79 93 108 2023 10.1016/j.jhep.2023.02.027 36868481
58 Polak ME Borthwick NJ Johnson P Hungerford JL Higgins B Di Palma S JagerM J Cree IA Presence and phenotype of dendritic cells in uveal melanoma Br J Ophthalmol 91 971 976 2007 10.1136/bjo.2006.110908 17347328
59 de Waard-Siebinga I Hilders CG Hansen BE van Delft JL Jager MJ HLA expression and tumor-infiltrating immune cells in uveal melanoma Graefes Arch Clin Exp Ophthalmol 234 34 42 1996 10.1007/BF00186516 8750848
60 Wang W Zhao H Wang S Identification of a novel immune-related gene signature for prognosis and the tumor microenvironment in patients with uveal melanoma combining single-cell and bulk sequencing data Front Immunol 14 1099071 2023 10.3389/fimmu.2023.1099071 36793711
61 Seth R Messersmith H Kaur V Kirkwood JM Kudchadkar R McQuade JL Provenzano A Swami U Weber J Alluri KC Systemic therapy for melanoma: ASCO Guideline J Clin Oncol 38 3947 3970 2020 10.1200/JCO.20.00198 32228358
62 Qi Y Cui Q Zhang W Yao R Xu D Zhang F Long non-coding RNA GAS5 targeting microRNA-21 to suppress the invasion and epithelial-mesenchymal transition of uveal melanoma Cancer Manag Res 12 12259 12267 2020 10.2147/CMAR.S260866 33273862
63 Tay Y Rinn J Pandolfi PP The multilayered complexity of ceRNA crosstalk and competition Nature 505 344 352 2014 10.1038/nature12986 24429633
64 Barbagallo C Di Maria A Alecci A Barbagallo D Alaimo S Colarossi L Ferro A Di Pietro C Purrello M Pulvirenti A Ragusa M VECTOR: An integrated correlation network database for the identification of CeRNA axes in uveal melanoma Genes (Basel) 12 1004 2021 10.3390/genes12071004 34210067
