
==== Front
J Insect Sci
J Insect Sci
jis
Journal of Insect Science
1536-2442
Oxford University Press US

10.1093/jisesa/ieae087
ieae087
Research
AcademicSubjects/SCI01382
Transgenic poplar (Populus davidiana×P. bolleana Loucne) expressing dsRNA of insect chitinase gene: lines identification and resistance assay
Jiang Yun-Xiao College of Forestry, Northeast Forestry University, Harbin, China

Li Man-Yu College of Forestry, Northeast Forestry University, Harbin, China

Han Qing College of Forestry, Northeast Forestry University, Harbin, China

Tan Jia-Lin College of Forestry, Northeast Forestry University, Harbin, China

Wang Zi-Yan College of Forestry, Northeast Forestry University, Harbin, China

https://orcid.org/0000-0002-3604-7711
Jing Tian-Zhong College of Forestry, Northeast Forestry University, Harbin, China

Ons Sheila Subject Editor
Corresponding author, email: Jingtianzhong@163.com
Yun-Xiao Jiang and Man-Yu Li have contributed equally to this work.

7 2024
03 9 2024
03 9 2024
24 4 2101 2 2024
26 7 2024
16 8 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of Entomological Society of America.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.

Abstract

Poplar is a valuable tree species that is distributed all over the world. However, many insect pests infest poplar trees and have caused significant damage. To control poplar pests, we transformed a poplar species, Populus davidiana × P. bolleana Loucne, with the dsRNA of the chitinase gene of a poplar defoliator, Clostera anastomosis (Linnaeus) (Lepidoptera: Notodontidae), employing an Agrobaterium-mediated approach. The transgenic plant has been identified by cloning the T-DNA flanking sequences using TAIL-PCR and quantifying the expression of the dsRNA using qPCR. The toxicity assay of the transgenic poplar lines was carried out by feeding the target insect species (C. anastomosis). The results showed that, in C. anastomosis, the activity of chitinase was significantly decreased, consistent with the expression on mRNA levels, and the larval mortality was significantly increased. These results suggested that the transgenic poplar of dsRNA could be used for pest control.

RNAi
insect control
Clostera anastomosis
TAIL-PCR
2030 Innovation Program of Science and Technology 2022ZD040150402 Natural Science Foundation of Heilongjiang Province 10.13039/501100005046 LH2022C014
==== Body
pmcIntroduction

Poplar is one of the most widely distributed and adaptable tree species in the world. It was estimated that there are more than 80 million ha poplar stands in the world (Dănilă et al. 2022). For example, China’s poplar forests cover an area of 10 million ha, 75% of which are artificial forests (Liu et al. 2023). The rapid increase in the area of poplar plantations has resulted in a high incidence of pests, so it is necessary to improve the insect resistance of poplar trees. The black-back prominent moth, Clostera anastomosis (Lepidoptera: Notodontidae), is one of the major leaf-feeding pests of poplar plantations, although it also damages willow (Salix spp.) (Salicales: Salicaceae) and birch (Betula spp.) (Fagales: Betulaceae). C. anastomosis is known for its high reproductive capacity in Asia, Europe, and North Africa (Tomescu and Nețoiu 2011). The first severe outbreak in Central and South Europe was recorded in the 1950s (Lupaștean et al. 2022). Since 1970, outbreaks have been reported in Asia (Duduman et al. 2015), specifically in Turkey (Aytar et al. 2017), Japan (Kamata 2002), and China (Li et al. 2006). In an outbreak, a large area of poplar leaves can be eaten up in a short time, seriously affecting the growth of poplar and causing a great loss of forestry production (Cai and Jin 2013, Luo et al. 2022). In 1971, for example, it caused the complete defoliation of poplar and willow forests in the Prut floodplain (Golaesti-Prisacani, Forest District Iasi) (Tomescu and Nețoiu 2011).

Many approaches, e.g., spraying chlorbenzuron (Wang et al. 2012) and releasing Trichogramma dendrolimi (Hymenoptera: Trichogrammatidae) (Wang et al. 2012), have been developed to control this moth. In addition, the toxicity of C. anastomosis granulovirus has been assayed and the results showed that the virus has a big potential in practical application (Li et al. 2006). Recently, transgenic plants expressing double-stranded RNAs (dsRNA) of pest genes have been shown as a promising strategy for improving plant resistance to insects (Zhang et al. 2017, Silver et al. 2021, Yan et al. 2021).

RNAi is the phenomenon whereby double-stranded RNA specifically and efficiently induces mRNA silencing of target genes in an organism (Fire et al. 1998). Currently, dsRNA introduction methods include microinjection (Wang et al. 2022), feeding (direct feeding of dsRNA or feeding of bacteria capable of expressing dsRNA of the target gene (Yu et al. 2013)), spraying (Hoang et al. 2022), soaking (Hoang et al. 2016), and transgenic plants (Luo et al. 2017). Among them, plant-mediated delivery of insect dsRNA is an optimization of the feeding delivery pathway, directly expresses target dsRNAs of target pests in plants, and has great application potential (Zhang et al. 2022) since it allows precise control of target pests without extra expenses of manpower and financial resources. For example, the knockdown of 2 reproductive genes by plant-mediated RNAi to control western corn rootworm (Diabrotica virgifera LeConte) (Coleoptera: Chrysomelidae) (Niu et al. 2017), aphid-resistant wheat has been obtained using a wheat-mediated RNA interference approach silencing an essential gene involved in infestation and digestion (Sun et al. 2019), and transgenic poplar trees expressing CYP6B53 dsRNAs enhanced the resistance to Lymantria dispar larvae (Sun et al. 2022). Here, we transformed the hybrid poplar variety “Shanxin” (Populus davidiana × P. bolleana Loucne) (Salicales: Salicaceae) with dsRNA of chitinase gene of C. anastomosis, and tested its resistance.

As presented above, genetic engineering and plant transformation have been widely used in pest control (Kumar et al. 2020). The commercial release of genetically modified (GM) crops for cultivation requires the approval of biosafety regulatory packages, which need line variety recognition (Akinbo et al. 2021, Ghimire et al. 2023). Line variety recognition is also a requirement of intellectual property protection (Singh et al. 2021, Tiwari et al. 2023). However, most previous studies only tested whether it is GM employing methods based on DNA, RNA, or protein (Nazir and Iqbal 2019). Recently, an event-specific multiplex PCR method was used for line variety recognition of GM soybean lines (Grohmann et al. 2017, Yan et al. 2019). In this study, a transgenic poplar line was identified by amplifying poplar sequences flanking T-DNA.

Materials and Methods

PCR of Insect Gene

Total RNA was extracted using the STE method (Dong et al. 2017). Briefly, after grind in liquid nitrogen, the insect tissues were transferred into a 1.5 ml centrifuge tube with 300 μl of STE buffer (1.0 M NaCl, 0.5 M Tris-HCL, 10 mM EDTA), 600 μl of PCI buffer (water-saturated phenol: chloroform: isoamyl alcohol = 25:24:1). The tube was then shaken vigorously and centrifuged at 4 °C and 13,000 rpm for 5 min. The supernatant was moved to a new tube, and 1/10 volume of sodium acetate and 2.5 times the volume of anhydrous ethanol were added into the tube to precipitate RNAs at −20°C for 20 min. The tube was centrifuged at 13,000 rpm at 4 °C for 10 min, and the supernatant was discarded. An appropriate amount of DEPC-treated water was added to dissolve the precipitate, and the RNA solution was treated with DNase I (Takara, Dalian, China) to eliminate potential genomic DNA contamination. After extraction with the PCI buffer, the RNAs were precipitated as before and dissolved in 20 μl of DEPC-treated water.

The genomic DNA of the insect was extracted using an SDS method. About 100 mg of tissue was put into a 1.5 ml centrifuge tube with 600 μl of SDS buffer (100 mM Tris (pH8.0), 50 mM EDTA, 200 mM NaCl, SDS 1%) and 40 μl of beta-mercaptoethanol, ground with a glass homogenizer, and incubated at room temperature for 30 min. Then 300 μl of tris-saturated phenol and 300 μl of chloroform/isoamyl alcohol (24:1) were added, mixed gently, and centrifuged at 12,000 rpm for 10 min. The supernatant was transferred to a new tube with 600 μl of chloroform/isoamyl alcohol (24:1) and centrifuged at 12,000 rpm for 10 min. Then, the supernatant was transferred to a new tube with 600 μl of isopropanol to precipitate at room temperature for 10 min. After 10 min centrifugation at 12,000 rpm, the supernatant was discarded. The precipitate was washed with 600 μl of 75% ethanol and dissolved in 50 μl of sterile deionized water.

RNA concentration was measured using a Nanodrop system (Thermo Fisher Scientific). The 260/280 ratio calculated from Nanodrop software was also used to evaluate RNA quality. First-strand complementary DNA (cDNA) was synthesized from 0.5 μg of total RNA following the manual instruction of PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China) and immediately stored at −80 °C for later use. The primers required in this study (Table 1) were synthesized by Sangon Biotech (Shanghai, China) Co. Using the cDNAs of C. anastomosis as templates, the fragments Chif and Chir in Fig. 1 were cloned by Chif-F and Chif-R primer pair and Chir-F and Chir-R primer pair (based on the sequence of OR951407), respectively. An intron sequence was amplified based on genomic DNA templates of C. anastomosis by primers ino-F and ino-R targeting the third intron of the PBAN (Pheromone biosynthesis activating neuropeptide) gene (EF614262). The total volume of the PCR reaction was 20 μl, which included 1 μl of template (using ddH2O as negative control), 2 μl of 10 μM forward and reverse primers, 0.5 μl of KOD plus DNA polymerase (Toyobo, Shanghai, China), 2 μl of 10× DNA polymerase buffer (Toyobo, Shanghai, China), 2 μl of 2.5 mM dNTP (Sangon, Shanghai, China) and 12.5 μl of ddH2O. For PCR analysis (PTC 200, Bio-rad, USA), the template was denatured at 94 °C for 5 min, followed by 30 amplification cycles (94 °C for 30 s, 60 °C for 30 s, and 72 °C for 70 s) and a final extension at 72 °C for 10 min. Agarose gels were used to check the sizes of the amplicons and the PCR results.

Table 1. Primer sequences in this study

Primer name	Restriction enzyme	Primer sequences	Expected size	Primer efficiency	Usage	
ino-F	BamHI	ACAggatccGTAAGTTTAACTACGGGC	480 bp		PCR of the intron of PBAN gene	
ino-R	SmaI	GGCcccgggCTGTTAACGAATAAAAAT		
Chif-F	XbaI	GGCtctagaTGGCATAGAAGACATCCC	552 bp		PCR of the forward sequence of the dsRNA	
Chif-R	BamHI	ACAggatccCGCCAAAGGTACAGCAAC		
Chir-F	SacI	GGCgagctcTGGCATAGAAGACATCCC	552 bp		PCR of the reverse sequence of the dsRNA	
Chir-R	SmaI	GGCcccgggCGCCAAAGGTACAGCAAC		
35-F		GCTCCTACAAATGCCATCA	195 bp		PCR assay of transformed poplar	
35-R	GATAGTGGGATTGTGCGTCA		
EF-F		TCACACCTGCCACATTGCTGT	230 bp	98.1%	Poplar elongation factor gene used as an internal reference in qRT-PCR	
EF-R		TCTTGATGACACCAACCGCCAC	
Act-F		AGCTGATCGAATGAGCAAG	202 bp	100.1%	Poplar β-actin gene used as internal reference in qRT-PCR	
Act-R		CTAGAAGCACTTCCTGTG	
Tub-F		GGACCCACAACTCATTCACAT	245 bp	107.9%	Poplar β-tubulin gene, used as internal reference in qRT-PCR	
Tub-R		TACCGAGGCTGAGAGTAACAT	
Chi-F		GGTGGCCCAAAAGAACACTA	195 bp	107.3%	Chitinase gene of C. anastomosis for quantification of the expression of the dsRNAs in transgenic poplar lines and C. anastomosis, using qRT-PCR	
Chi-R		CAAAGGTACAGCAACGGTCA	
Blin-F		CATCACGGCCTCCCTGCGTT	220 bp	107.7%	Insect α-tubulin gene used as internal reference in qRT-PCR	
Blin-R		TTGCCGTGGCGCGGGTCGCA	
T2F		AGCGATGAAGCGAAGAGC	480 bp		Gene-specific primers for PCR identification of transgenic poplar line M3	
T2R		ATTGAATCCTGTTGCCGGTCTTG		
AD1		NGTCGASWGANAWGAA			Random primers (AD1-8) used in Tail-PCR for cloning the poplar DNA sequences flanking T-DNA. Gene-specific primers in TAIL-PCRs.	
AD2		TGWGNAGSANCASAGA			
AD3		AGWGNAGWANCAWAGG			
AD4		STTGNTASTNCTNTGC			
AD5		NTCGASTWTSGWGTT			
AD6		NTCGASTWTSGWGTT			
AD7		GTNCGASWCANAWGTT			
AD8		NCAGCTWSCTNTSCTT			
CRBP1		ACTTTTGAACGCGCAATAATGGTTT			Gene-specific primers in TAIL-PCRs. These primers and a random primer compose 3 rounds of seminested primer pairs	
CRBP2		ATGTGCTTAGCTCATTAAACTCCAG			
CRBP3		CAGTTCCAAACGTAAAACGGCTTGT			
Primers works in pair. Gray shading is used to distinguish primers with same usage, which can increase the readability.

Fig. 1. Construction of RNAi vector of chitinase gene.

Graphical representation of the plasmid employed for genetic transformation, showing resistance, borders of T-DNA and the arrangement of 35S promoter, Nos terminator, and the foreign genes.

Construction of RNAi Vector of Chitinase Gene

The forward sequence of the Chi gene and the reverse sequence of the Chi gene (552 bp) were ligated at the 2 ends of an intron (480 bp) of the PBAN gene of C. anastomosis, respectively. The recombinant sequence was inserted into the plant expression vector PBI121 to obtain the plant expression dsRNA vector pBI121-chif-intron-chir (Fig. 1). Verified by double digestion with SacⅠ and XbaⅠ (Promega, USA) according to the manufacturer’s instructions, the vector pBI121-chif-intron-chir was transformed into Agrobacterium tumefaciens EHA105, and the strains of Agrobacterium harboring the vector pBI121-chif-intron-chir were stored at −80 °C for further use. The vector pBI121 and the bacteria strain EHA105 were a gift from the laboratory of Prof. Zhihua Liu (Northeast Forestry University).

Populus davidiana × P. bolleana Transformation

The poplar variety “Shanxin” (Populus davidiana × P. bolleana) was obtained by hybridizing Populus davidiana Dode (female parent) and Populus bolleana Lauche (male parent) (He et al. 2022). The tissue-cultured shoots of this hybrid were a gift from the laboratory of Prof. Zhihua Liu (Northeast Forestry University). The vector of pBI121-chif-intron-chir was used to transform poplar using Agrobacterium tumefaciens-mediated transformation. Leaf explants of 3-wk-old precultured on antibiotic-free MS medium for 48 h in darkness at 25 °C were agitated in a culture containing A. tumefaciens (strain EHA105) harboring the vector pBI121-chif-intron-chir for 10 min, and then the inoculated explants were placed on the coculture media (Antibiotic-free MS medium) in the dark at 25 °C ± 1 °C for 2–3 days (Supplementary Fig. S1A). The cocultured explants were washed 5 times with sterile distilled water containing 700 mg·l−1 cephalosporin (Hapharm group CO., Harbin, China) for 1 min each time, blotted on sterilized filter paper and incubated on MS medium supplemented with 700 mg·l−1 cephalosporin at 25 °C ± 1 for 7 days in 16-h light 8-h dark cycle with supplemental lighting of 2,000–3,000 lux (Supplementary Fig. S1B). The media were renewed every day. The infected explants were then transferred to a selective differentiation medium (MS + 0.08 mg·l−1 TDZ + 0.05 mg·l−1 NAA + 50 mg·l−1 kanamycin + 700 mg·l−1 Cephalosporin + 40 g·l−1 sucrose + 7.5 g·l−1 agar) for 3–4 wk (Supplementary Fig. S1C). The shoots that survived from kanamycin were cut from the explants and transferred to rooting media (1/2 MS + 0.01 mg·l−1 NAA + 0.1 mg·l−1 IBA + 700 mg·l−1 Cephalosporin + 30 mg·l−1 kanamycin + 20 g·l−1 sucrose + 7.5 g·l−1 agar) (Wang et al. 2020) (Supplementary Fig. S1D and E). Leaves of rooted plantlets were used for secondary differentiation and secondary rooting for propagation. The rooted plantlets were acclimatized in a growth chamber before being transferred to a greenhouse (Supplementary Fig. S1F).

PCR assay of Transformed Plantlets

Genomic DNA was isolated from the leaves of transformed and control plants using a CTAB method (Porebski et al. 1997). The PCR was performed using primers 35-F and 35-R (Table 1). The total volume of the PCR reaction was 10 μl, containing 0.5 μl of template (using ddH2O as negative control and plasmid pBI121-chif-intron-chir as positive control), 0.5 μl of 10 μM forward and reverse primers, 1 μl of 10× DNA Polymerase Buffer, 0.1 μl of rTaq (Takara Biotech Dalian, China), 0.8 μl of 2.5 mM dNTP (Sangon Biotech, Shanghai, China), and 7.3 μl of ddH2O. For PCR analysis, the DNA was denatured at 94 °C for 5 min, followed by 30 amplification cycles (94 °C for 30 s, 62 °C for 30 s, and 72 °C for 70 s) and a final extension at 72 °C for 10 min. Agarose gels were used to check the sizes of the amplicons and the PCR results.

qRT-PCR Assay

Following the manufacturer’s instructions, RNA extraction from leaves and reverse transcription were performed using the Column Plant RNAOUT 2.0 (TIANDZ, Beijing, China) and the PrimeScript RT reagent Kit (Perfect Real Time) (Takara Biotech, Dalian, China), respectively. RNA concentration was measured using a Nanodrop system (Thermo Fisher Scientific, USA). The 260/280 ratio calculated from Nanodrop software was also used to evaluate RNA quality. Approximately 0.5 μg DNaseI-treated RNA (RNeasy mini kit, Qiagen, German) was reverse-transcribed to cDNA using 1 μM of oligodeoxythymidine primer in a final reaction volume of 10 μl. The synthesized cDNA was diluted to 100 μl with sterile water and then used as a template for qPCR using MJ Opticon 2 (Bio-Rad, Hercules, CA, USA). Twenty milliliters of reaction mixture containing 10 μl of SYBR Green real-time PCR master mix (Toyobo, Shanghai, China), 0.5 mΜ each of forward and reverse primers (Chi-F and Chi-R, Table 1) and 2 μl of cDNA template (equivalent to 100 ng total RNA) were used. Amplification was carried out at 95 °C for 30 s followed by 45 cycles of 95 °C for 5 s, 59 °C for 15 s, 72 °C for 10s, and 82 °C for 1 s to allow plate reading. Melting curves were then generated for each sample at the end of each run to determine the purity of the amplification product. Expression levels were calculated using the 2−ΔΔCT method (Pfaffl et al. 2002). The elongation factor, β-actin and β-tubulin genes of Populus davidiana × P. bolleana were selected as internal references to normalize the gene expression of all poplar samples (Primers EF, Act and Tub are shown in Table 1). The α-tubulin gene of Lepidoptera was selected as internal references to normalize the gene expression of all insect samples (Primer pair Blin are shown in Table 1). The primer efficiency was tested in triplicate according to Bustin et al. (2009) to ensure that the result was robust (Table 1; Supplementary Fig. S2).

Cloning the Poplar DNA Sequences Flanking T-DNA

An approach containing 3 rounds of TAIL-PCRs was employed for cloning the poplar DNA sequences flanking T-DNAs (Jing et al. 2011). According to the sequences of the NOS promoter and NOS terminator in the vector pBI121, Eco81I (Bsu36I) (10 U/µl) (NEB, USA) and Eco88I (AVAI) (10 U/μl) (NEB, USA) were used to double-digest the genomic DNAs of PCR-positive transformed poplar lines. The total volume of the double digestion reaction was 30 μl, which consisted of 4 μl DNA, 1 μl AVAI, 1 μl Bsu36I, 3 μl 10× Buffer (NEB, USA), and 21 μl ddH2O. The solution was mixed well and then placed in the PCR instrument at 37 °C for 3 h digestion. The digested DNAs were used as templates for the first round of TAIL-PCR.

A total of 8 random primers AD1-8 (Table 1) (Liu et al. 1995) and 3 NOS terminator-specific primers CRBP1-3 were used for TAIL-PCR (Table 1). The total volume of the PCR reaction was 20 μl, containing 2 μl of template DNA, 2 μl of 10 μM primer 1 and 2, 2 μl of Easy taq Buffer, 0.4 μl of 10 mM dNTP (Sangon Biotech, Shanghai, China), 0.3 μl of Taq DNA polymerase (Takara, Dalian, China) (5 U/μl) and 13.3 μl of ddH2O. The conditions of the 3 rounds of Tail-PCRs are shown in Table 2. The products of the last round of Tail-PCRs were analyzed using 1.2% agarose gel electrophoresis, and the target bands recovered. The target genes were ligated into the vectors PEASY-T1 (TransGen Biotech, Beijing, China) or PMD18-T (Takara, Dalian, China) and transformed into competent Escherichia coli TOP10 cells for sequencing.

Table 2. TAIL-PCR reaction procedures

Reaction	Procedure number	Temperature setting	
TAIL-1	1.1	94 °C 4 min	
1.2	14 amplification cycles (94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min)	
1.3	94 °C 30 s, 25 °C 1.5 min, 0.3 °C/s to 72 °C 1.5 min	
1.4	14 amplification cycles (94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min, 94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min, 94 °C 30 s, 44 °C 45 s, 72 °C 1.5 min)	
1.5	72 °C 5 min	
1.6	4 °C forever	
TAIL-2	2.1	94 °C 4 min	
2.2	15 amplification cycles (94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min, 94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min, 94 °C 30 s, 44 °C 45 s, 72 °C 1.5 min)	
2.3	72 °C 5 min	
2.4	4 °C forever	
TAIL-3	3.1	94 °C 4 min	
3.2	19 amplification cycles (94 °C 30 s, 60 °C 45 s, 72 °C 1.5 min, 94 °C 30 s, 44 °C 45 s, 72 °C 1.5 min)	
3.3	72 °C 5 min	
3.4	4 °C forever	

Validating Transgenic Poplar Lines by PCR

According to the poplar DNA sequence flanking T-DNA, a pair of primers T2F and T2R (Table 1) were designed for PCR to detect the target transgenic poplar line. The total volume of the PCR reaction was 20 μl, which included 1 μl of template, 1 μl of 10 mM forward and reverse primers, 0.2 μl of Taq DNA polymerase (Takara, Dalian, China), 2 μl of 10× DNA polymerase buffer (Takara, Dalian, China), 0.4 μl of 10 mM dNTP (Sangon, Shanghai, China) and 15.4 μl of ddH2O. For PCR analysis, the DNA was denatured at 94 °C for 5 min, followed by 30 amplification cycles (94 °C for 30 s, 60 °C for 30 s, and 72 °C for 70 s) and a final extension at 72 °C for 10 min.

Feeding Experiment

In this study, the bioassays were conducted with the target insect C. anastomosis. The larvae of C. anastomosis were collected on poplar trees from Qian’an County, Jilin Province, China, and were then fed with fresh wild-type poplar leaves indoors at room temperature (25 °C ± 2 °C) and humidity till bioassay. All animals were starved for 24 h before bioassay. Fresh leaves of transgenic and wild-type plants grown in the greenhouse were collected from 7-month-old plants. The leaves were hand-picked, washed in distilled water, and kept on moist filter paper in petri dishes. The bioassays were performed in triplicates for each transgenic line. One replicate inoculated 20 larvae of the 4th instar. We did not test all PCR-positive lines but selected 2 lines, B4 and G7, for bioassay. The insects were raised at 25 °C ± 2 °C under a 14 h light-10 h dark photoperiod.

Chitinase Activity

The activity of chitinase in insects was quantified using a chitinase assay kit (Item No. JDZM-2-G, COMIN, Suzhou, China). Chitinase hydrolyzes chitin to produce N-acetyl-D-(+)-glucosamine, which further reacts with DNS Reagent to produce a brownish-red compound with a characteristic absorbance peak at 540 nm, and the rate of increase in absorbance reflects the activity of chitinase. The chitinase assay experiments were performed in 3 biological replicates, and OD540 values were detected by a V729 UV-visible photometer (Shanghai Yoke Instrument Co., Ltd, China). Standard curves were determined by Microsoft Excel software.

Statistical Analysis

All statistical analyses were performed using the SPSS 16.0 statistical package for Windows (SPSS Inc., Chicago, IL, USA). One-way ANOVA and Tukey multiple comparisons were used to assess differences in chitinase activities between larvae of C. anastomosis fed on transgenic and nontransgenic poplars. Generalized estimating equations (GEE) were employed to assess the differences in cumulative larval mortalities between groups feeding on transgenic and nontransgenic poplars. GEE was specially developed for longitudinal or repeated measures data (Liang and Zeger 1986, Paradis and Claude 2002). In this study, we measured the cumulative mortalities in percentage over a few days, producing repeated measures data.

Results

dsRNA Expression in Putative Transgenic Poplars

Seven out of 9 putative transformed lines were identified as positive by PCR (Supplementary Fig. S3). As expected, there were no specific bands in the lane of wild-type plants (Supplementary Fig. S3). Because no amplification signal was detected in the wild-type plants, one of the transformed lines was used as a standard for comparison of chitinase expression in the 7 transgenic poplar lines (Fig. 2). Line B4 had the highest relative expression, whereas A1 had the lowest relative expression.

Fig. 2. The expression of dsRNA of chitinase gene in transgenic lines.

Barplot showing the dsRNA expressing in seven transformed poplar lines.

Poplar Line M3 DNA Sequences Flanking T-DNA

After 3 rounds of TAIL-PCR amplification (Supplementary Fig. S4), the bands of the last rounds were recovered for sequencing. The results confirmed that the T-DNA has integrated into the genome of transformed plantlets of line M3 (Fig. 3).

Fig. 3. Comparison of the right border flanking sequences of line M3 with vector sequences and poplar DNA.

Sequences alignment showing the foreign dsRNA has been integrated into the genome of the poplar line M3.

PCR Identifying Line M3

The amplification was carried out using primers T2F and T2R, and the results showed that a specific band appeared on the lane of line M3, suggesting line M3 was successfully identified (Fig. 4).

Fig. 4. PCR identification of line M3; M, DL2000 DNA marker; Lane 1, wild-type poplar as a blank control; Lane 2, transgenic poplar line B4; Lane 3, transgenic poplar line M3.

Gel map showing poplar line M3 can be discriminated from lines B4 and wild type by PCR using gene-specific primers.

Activity of the Chitinase in Larval C. anastomosis

The activities of larval C. anastomosis were 0.846 ± 0.083 mg/h/g, 0.439 ± 0.011 mg/h/g, and 0.381 ± 0.077 mg/h/g for poplar lines WT, B4, and G7, respectively (Fig. 5A). The results from one-way ANOVA showed that there are significant differences among these lines (F(2,6) = 44.421, P < 0.001). The results from multiple comparisons showed that the activity between B4 and G7 did not differ significantly, but either of them significantly decreased from WT.

Fig. 5. A) The chitinase activity of larval C. anastomosis; one-way ANOVA followed by the Tukey’s test was used to perform the statistical analyses, and the error bar means the standard error of 3 biological replicates, * indicates P < 0.05, while ns represents P > 0.05. B) The expression of the chitinase gene of C. anastomosis; the error bar means the standard error of 5 biological replicates. C) Cumulative mortalities of C. anastomosis feeding on transgenic poplar lines. WT, wild-type; B4 and G7 are transgenic poplar lines.

Graphs labeled A to C. A is a histogram showing the enzymatic activities of the beetles feeding on poplar lines of WT, B4 and G7, with the results of multi-comparisons between lines. B is similar to A, but measuring the gene expression of the chitinase in the beetles feeding on the three poplar lines. C is a linear chart showing the cumulative mortalities of the beetles feeding on the three poplar lines.

Knockdown of the Chitinase Gene in C. anastomosis

After feeding on transgenic poplars, expression of chitinase genes was verified at the mRNA level by qRT-PCR in C. anastomosis (Fig. 5B). The expressions of the chintinase gene in the animals fed with B4 and G7 were knocked down to 0.42 and 0.43 proportion of those fed with wild-type poplar, respectively. As a rule of thumb, a 2-fold change in expression suggests significant up/down-regulation. So, our results showed that the expression of the target gene has been successfully knocked down.

Transgenic Poplar Plants Increase the Larval Mortality

After feeding on transgenic poplars, the cumulative mortality between transgenic and nontransgenic poplars was analyzed by GEE. The Wald chi-square test showed that the cumulative mortality rate of the transgenic line B4 was significantly different from that of wild-type poplar (χ2 = 2.600E + 12, df = 1, P < 0.001); G7 was also significantly different from that of wild-type poplar (χ2 = 1.1165E + 12, df = 1, P < 0.001) (Fig. 5C).

Discussion

Chitinases are often considered effective molecular targets for controlling pests since they are the key enzymes required to degrade chitin (Chen et al. 2024). For example, bacterial-expressed chitinase dsRNAs have been used to control Mythimna separata Walker (Lepidoptera: Noctuidae) via oral delivery (Ganbaatar et al. 2017). To control forest insects, in the present study, we employed a plant-mediated dsRNA delivery approach, which has obvious advantages over other dsRNA delivery approaches since trees are perennial and located in forests where other approaches are not easily applied. Furthermore, since larval mortality caused by RNAi-mediated silencing depends on the dsRNA injection time (Zhang et al. 2021), plant-mediated dsRNA delivery approaches are expected to have more effective control for transgenic trees that can supply the dsRNAs sustainably. Although some dsRNAs have been transformed into poplar (Sun et al. 2022), the present study is the first report on plant-mediated control of insects by chitinase dsRNAs.

In the present study, we transformed poplar with the dsRNA of Cloan-chi. Cloan-chi belongs to type 5, which possesses 4 conserved catalytic domains: KXXXAVGGW, FDGXDLDWEYP, MXYDLRG, and GAMXWAIDMDD, where X is a nonspecific amino acid (Supplementary Fig. S5). The results from RNAi-mediated knockdown showed that chi5 is essential in larval molting, pupation, and eclosion (Zhu et al. 2019). Transcriptome sequencing (RNA-seq) analysis of RNAi samples demonstrated that knockdown of the Hyphantria cunea Drury (Lepidoptera: Erebidae) Cht5 genes affected chitin metabolism and molting hormone signaling, as well as the expression of genes involved in detoxification metabolism (Zhang et al. 2021). Our results showed that the transgenic poplar expressed the dsRNA, decreased the expression of the chitinase gene, decreased the activity of the larval chitinase, and increased the mortality of the larvae of C. anastomosis. These results are similar to those in transgenic tomato and Helicoverpa armigera (Lepidoptera: Noctuidae) systems (Mamta et al. 2016), in Hyphantria cunea using injection of synthesized dsRNAs in vitro (Zhang et al. 2021), and in silencing of target chitinase genes via oral delivery of dsRNA in Mythimna separata (Lepidoptera: Noctuidae) (Cao et al. 2017), indicating the transgene approach is as effective as other approaches, irrespective for control of crop or forest insects.

As discussed above, plant-mediated RNAi has emerged as a promising means of pest control. With the rapid release of transgenic plants, there is a need for effective regulation. Therefore, identifying the transgenic line varieties is of significance for the safety evaluation. There are various methods for detecting sequences next to the integration site of exogenous genes, such as TAIL-PCR, inverse PCR, Chromosome walking, and genome sequencing (Guo et al. 2016, Jin et al. 2019, Feng et al. 2021b). Among them, TAIL-PCR has many advantages, such as ease of operation, high specificity and sensitivity, and the PCR products can be directly used for sequencing, which made it widely used in line variety recognition (Feng et al. 2021b). In the present study, we developed a modified TAIL-PCR approach, which improved the specificity of TAIL-PCR by cutting T-DNA concatemers. Using this modified method, we successfully cloned poplar DNA sequences flanking T-DNAs, which provided direct and solid proof of DNA integration. Based on this sequence, we identified the transgenic tree lines (Fig. 4). Since the sequence has been aligned to 2 chromosomes (6 and 17, Fig. 3) of Populus nigra, chromosomal rearrangements may have occurred, given the chromosome assemblages of P. davidiana × P. bolleana are the same as that of P. nigra. Chromosome rearrangement is common in plant genetic transformation, which has been reported in birch (Gang et al. 2019), rice (Gong et al. 2021), and Arabidopsis thaliana (Hu et al. 2017). Our results also showed that the right border of the T-DNA was completely lost in the transgenic poplar, which often occurs in plant genetic transformation. For example, the right border sequence of BADH transgenic alfalfa was completely missing (Zhang et al. 2011). Boundary deletions were also observed to varying degrees in rice (Jin et al. 2019), soybean (Yang et al. 2020), and sugarcane (Feng et al. 2021a). Flanking sequence characterization showed that some T-DNA boundary sequences were deleted, and others were retained and populated with a nucleotide sequence of unknown origin. In this experiment, we successfully amplified only the right boundary sequence of M3 but failed for the left border and the boundary sequences of other transgenic lines. The reason may lie in that we designed the primers based on the border sequence of T-DNA and the boundaries of the other line were missing to a large extent. These results suggested the complexity of the integration site and the difficulty in line identification.

Supplementary Material

ieae087_suppl_Supplementary_Figures_S1-S5

Acknowledgments

We also acknowledged Miss Yan-Li Shi and Miss Xin-Bo Gao (Northeast Forestry University) for their contributions to this work.

Author contributions

Yun-Xiao Jiang (Investigation [equal], Software [lead], Validation [equal], Writing—original draft [equal]), Man-Yu Li (Data curation [equal], Writing—original draft [equal], Writing—review & editing [equal]), Qing Han (Software [supporting], Writing—review & editing [supporting]), Jia-Lin Tan (Investigation [lead], Validation [supporting]), Zi-Yan Wang (Investigation [lead], Validation [supporting]), and Tian-Zhong Jing (Conceptualization [lead], Funding acquisition [lead], Project administration [lead], Supervision [lead], Writing—original draft [equal], Writing—review & editing [equal])

Funding

This study was co-funded by the  Major Project of Agricultural Biological Breeding (2022ZD0401504) and the Natural Science Foundation of Heilongjiang Province (LH2022C014).
==== Refs
References

Akinbo O , ObukosiaS, OuedraogoJ, et al . 2021. Commercial release of genetically modified crops in Africa: interface between biosafety regulatory systems and varietal release systems. Front. Plant Sci. 12 :605937. 10.3389/fpls.2021.605937 33828569
Aytar F , HızalE, KarakayaA. 2017. The first important outbreak of Clostera anastomosis Linnaeus 1758 (Lepidoptera; Notodontidae) on Populus plantations in Turkey. Paper Presented at: International Symposium on New Horizons in Forestry. Süleyman Demirel University, Faculty of Forestry; Isparta, Turkey.
Bustin SA , BenesV, GarsonJA, et al . 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55 (4 ):611–622. 10.1373/clinchem.2008.112797 19246619
Cai JW , JinK. 2013. Boat moths pests law and comprehensive anti-technology research on Populus. World J. For. 2 (2 ):13–16.
Cao BD , BaoWH, WuriyanghanH. 2017. Silencing of target chitinase genes via oral delivery of dsRNA caused lethal phenotypic effects in Mythimna separata (Lepidoptera: Noctuidae). Appl. Biochem. Biotechnol. 181 (2 ):860–866. 10.1007/s12010-016-2254-x 27663609
Chen Y , TangH, ZhouW, et al . 2024. Identification of chitinase genes and roles in the larval–pupal transition of Leptinotarsa decemlineata. Pest Manag. Sci. 80 (2 ):282–295. 10.1002/ps.7754 37671631
Dănilă I-C , MititeluC, PalaghianuC. 2022. Productivity of short-rotation poplar crops: a case study in the NE of Romania. Forests. 13 (7 ):1089. 10.3390/f13071089
Dong Y-Q , WangZ-Y, JingT-Z. 2017. Functional characterization of ASTC (allatostatin C) and ASTCC (allatostatin double C) in Clostera anastomosis (Lepidoptera: Notodontidae). Gene 598 :1–8. 10.1016/j.gene.2016.10.038 27815096
Duduman M , LupașteanD, PînzanuS, et al . 2015. Eficacitatea combaterii larvelor de Clostera anastomosis L. la ieșirea din hibernare. Bucovina Forestiera 15 (2 ):167–176.
Feng CL , WanY, WangJG, et al . 2021a. Establishment of a transformant-specific detection method for Cry1Ac-2A-gna transgenic sugarcane BCG-17. Biotechnol. Bull. 37 (5 ):248.
Feng L , WangX, XiaL, et al . 2021b. Construction and rapid identification of cucumber T-DNA insertion mutants using GFP gene. J. Nuclear Agric. Sci. 35 (7 ):1540–1547.
Fire A , XuS, MontgomeryMK, et al . 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391 (6669 ):806–811. 10.1038/35888 9486653
Ganbaatar O , CaoB, ZhangY, et al . 2017. Knockdown of Mythimna separata chitinase genes via bacterial expression and oral delivery of RNAi effectors. BMC Biotechnol. 17 (1 ):1–11.28056928
Gang HX , LiuGF, ZhangMM, et al . 2019. Comprehensive characterization of T-DNA integration induced chromosomal rearrangement in a birch T-DNA mutant. BMC Genomics 20 (1 ):1–11.30606130
Ghimire BK , YuCY, KimWR, et al . 2023. Assessment of benefits and risk of genetically modified plants and products: current controversies and perspective. Sustainability. 15 (2 ):1722. 10.3390/su15021722
Gong WK , ZhouY, WangR, et al . 2021. Analysis of T-DNA integration events in transgenic rice. J. Plant Physiol. 266 :153527. 10.1016/j.jplph.2021.153527 34563791
Grohmann L , BelterA, SpeckB, et al . 2017. Screening for six genetically modified soybean lines by an event-specific multiplex PCR method: collaborative trial validation of a novel approach for GMO detection. J. Consum. Prot Food Saf. 12 (1 ):23–36. 10.1007/s00003-016-1056-y
Guo BF , GuoY, HongHL, et al . 2016. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method. Front. Plant Sci. 7 :1009.27462336
He Y , ZhaoC, YuY, et al . 2022. Expression analysis of the PdbFLAs during the treatment of tension wood. J. Northeast For. Univ. 50 (10 ):1–9.
Hoang KP , TeoTM, HoTX, et al . 2016. Mechanisms of sex determination and transmission ratio distortion in Aedes aegypti. Parasit. Vectors 9 (1 ):1–13.26728523
Hoang BTL , FletcherSJ, BrosnanCA, et al . 2022. RNAi as a foliar spray: efficiency and challenges to field applications. Int. J. Mol. Sci. 23 (12 ):6639. 10.3390/ijms23126639 35743077
Hu YF , ChenZY, ZhuangCX, et al . 2017. Cascade of chromosomal rearrangements caused by a heterogeneous T‐DNA integration supports the double‐stranded break repair model for T‐DNA integration. Plant J. 90 (5 ):954–965. 10.1111/tpj.13523 28244154
Jin YM , MaR, YuZJ, et al . 2019. Integration analysis of exogenous gene and line-specific detection in the insect-resistant cry1C-transgenic rice Jishengjing3. Biotechnol. Bull. 35 (3 ):6.
Jing TZ , WangZY, QiFH, 2011. A method for cloning multicopy T-DNA Flanking plant DNA sequences. Chinese Patent # ZL200810064648.X.
Kamata N. 2002. Outbreaks of forest defoliating insects in Japan, 1950–2000. Bull. Entomol. Res. 92 (2 ):109–117. 10.1079/ber2002159 12020368
Kumar K , GambhirG, DassA, et al . 2020. Genetically modified crops: current status and future prospects. Planta. 251 (4 ):1–27.
Li HX , WangZY, GuoSP, et al . 2006. Bioassay of Clostera anastomosis granulosis virus. J. For. Res. 17 (1 ):50–52.
Liang K-Y , ZegerSL. 1986. Longitudinal data analysis using generalized linear models. Biometrika 73 (1 ):13–22. 10.2307/2336267
Liu YG , MitsukawaN, OosumiT, et al . 1995. Efficient isolation and mapping of Arabidopsis thaliana T‐DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8 (3 ):457–463. 10.1046/j.1365-313x.1995.08030457.x 7550382
Liu XT , ZhaoQS, YinP, et al . 2023. Variation and stability analysis of growth traits of poplar clones in the seedling stage in northeast China. J. For. Res. 34 (4 ):1107–1116. 10.1007/s11676-022-01529-7
Luo J , LiangS, LiJ, et al . 2017. A transgenic strategy for controlling plant bugs (Adelphocoris suturalis) through expression of double‐stranded RNA homologous to fatty acyl‐coenzyme A reductase in cotton. New Phytol. 215 (3 ):1173–1185. 10.1111/nph.14636 28608990
Luo P , ChenLH, ChenL, et al . 2022. Emergence and reproductive rhythm of Clostera anastomosis (Lepidoptera: Notodontidae). J. Entomol. Sci. 57 (4 ):447–459.
Lupaștean D , IsaiaG, DănilăI-C, et al . 2022. Growth and mortality of hybrid poplar short rotation culture (AF8 Clone) in response to Clostera anastomosis L. (Lepidoptera: Notodontidae) defoliation. Forests 14 (1 ):20. 10.3390/f14010020
Mamta , ReddyKRK, RajamMV. 2016. Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato. Plant Mol. Biol. 90 (3 ):281–292.26659592
Nazir S , Zaffar IqbalM, Sajid-ur-Rahman. 2019. Molecular identification of genetically modified crops for biosafety and legitimacy of transgenes. In: ChenY-C, ChenS-J, editors. Gene editing: technologies and applications. London: IntechOpen. p. 18. 10.5772/intechopen.81079
Niu X , KassaA, HuX, et al . 2017. Control of western corn rootworm (Diabrotica virgifera virgifera) reproduction through plant-mediated RNA interference. Sci. Rep. 7 (1 ):12591. 10.1038/s41598-017-12638-3 28974735
Paradis E , ClaudeJ. 2002. Analysis of comparative data using generalized estimating equations. J. Theor. Biol. 218 (2 ):175–185. 10.1006/jtbi.2002.3066 12381290
Pfaffl MW , HorganGW, DempfleLJN. 2002. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30 (9 ):e36–e36. 10.1093/nar/30.9.e36 11972351
Porebski S , BaileyLG, BaumBR. 1997. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol. Biol. Rep. 15 (1 ):8–15. 10.1007/bf02772108
Silver K , CooperAM, ZhuKY. 2021. Strategies for enhancing the efficiency of RNA interference in insects. Pest Manag. Sci. 77 (6 ):2645–2658. 10.1002/ps.6277 33440063
Singh MK , SinghAV, JaiswalP et al. 2021. Chapter 5: Genetically modified crops and intellectual property rights: Indian scenario. In: SinghP, BorthakurA, SinghAA et al. editors. Policy issues in genetically modified crops. USA: Academic Press; p. 97–108. 10.1016/B978-0-12-820780-2.00005-4
Sun Y , SparksC, JonesH, et al . 2019. Silencing an essential gene involved in infestation and digestion in grain aphid through plant‐mediated RNA interference generates aphid‐resistant wheat plants. Plant Biotechnol. J. 17 (5 ):852–854. 10.1111/pbi.13067 30582665
Sun LL , GaoY, ZhangQH, et al . 2022. Resistance to Lymantria dispar larvae in transgenic poplar plants expressing CYP6B53 double‐stranded RNA. Ann. Appl. Biol. 181 (1 ):40–47. 10.1111/aab.12752
Tiwari A , TikooSK, AngadiSP et al. 2023. Regulatory aspects of the seed business in relation to plant breeding. In: TiwariA, TikooSK, AngadiSP et al . editors. Market-driven plant breeding for practicing breeders. Singapore: Springer; p. 323–387. 10.1007/978-981-19-5434-4_10
Tomescu R , NețoiuC. 2011. Pyagera (Clostera) anastomosis Linnaeus, 1758 (Lepidoptera, Notodontidae)-an insect with an increased damaging potential of poplars and willows. Paper Presented at: Biennial International Symposium, ‘Forest and Sustainable Development’ (15–16th October 2010, Brașov, Romania), pp. 217–228. Transilvania University Publishing House; Braşov. Romania.
Wang FW , NiuYZ, HouLW, et al . 2012. Study on the bionomics and control of Clostera anastomosis. For. Res. 11 (3 ):325–329.
Wang XD , HuangJJ, FanY, et al . 2020. Construction of an ERF transgenic factor gene RAP2L15-RNAi vector and transformation in poplar . Plant Physiol. J. 56 (12 ):2705–2715.
Wang Y , RensinkAH, FrickeU, et al . 2022. Double sex regulates male-specific differentiation during distinct developmental time windows in a parasitoid wasp. Insect Biochem. Mol. Biol. 142 :103724.35093500
Yan W , LongLK, LiCC, et al . 2019. Establishment of detection system for three genetically modified soybean lines. Soybean Sci. 38 (5 ):7.
Yan S , RenBY, ShenJ. 2021. Nanoparticle‐mediated double‐stranded RNA delivery system: a promising approach for sustainable pest management. Insect Sci. 28 (1 ):21–34. 10.1111/1744-7917.12822 32478473
Yang QH , DongDK, CaoJ, et al . 2020. PCR detection and T-DNA flanking sequence analysis of GmWRKY70 in transgenic Soybean (Glycine max). J. Agric. Biotechnol. 28 (7 ):1203–1210.
Yu N , ChristiaensO, LiuJ, et al . 2013. Delivery of dsRNA for RNAi in insects: an overview and future directions. Insect Sci. 20 (1 ):4–14. 10.1111/j.1744-7917.2012.01534.x 23955821
Zhang YM , ZhangHM, XiangJY, et al . 2011. Analysis of T-DNA flanking sequences and event-specific detection of transgenic alfalfa with gene encoding betaine aldehyde dehydrogenase. Acta Agronom. Sin. 37 (3 ):397–404. 10.1016/s1875-2780(11)60011-4
Zhang J , KhanSA, HeckelDG, et al . 2017. Next-generation insect-resistant plants: RNAi-mediated crop protection. Trends Biotechnol. 35 (9 ):871–882. 10.1016/j.tibtech.2017.04.009 28822479
Zhang X , WangY, ZhangSF, et al . 2021. RNAi-mediated silencing of the chitinase 5 gene for fall webworm (Hyphantria cunea) can inhibit larval molting depending on the timing of dsRNA injection. Insects. 12 (5 ):406. 10.3390/insects12050406 33946562
Zhang SF , ZhangR, ZhangZ. 2022. Molecular control technology of pest population and its research progress in forest pest control. For. Pest Dis. 41 (5 ):22–31.
Zhu B , ShanJQ, LiR, et al . 2019. Identification and RNAi‐based function analysis of chitinase family genes in diamondback moth, Plutella xylostella. Pest Manag. Sci. 75 (7 ):1951–1961. 10.1002/ps.5308 30578597
