
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)12022-1
10.1016/j.heliyon.2024.e35991
e35991
Research Article
Distribution of virulence genes and antimicrobial resistance of Escherichia coli isolated from hospitalized neonates: A multi-center study across China
Guo Yuting ab1
Xiao Ruiqi c1
Feng Jinxing d1
Wang Xiaoyun e1
Lai Jidong f
Kang Wenqing g
Li Yangfang h
Zhu Xueping i
Ji Tongzhen j
Huang Xuerong f
Pang Dan k
An Yanbin e
Meng Lihui mengmlh@163.com
l⁎⁎
Wang Yajuan cxswyj@vip.sina.com
m⁎
a Beijing Children's Hospital, Capital Medical University, National Center for Children's Health, Beijing, China
b Department of Neonatology, Fifth Medical Center of Chinese PLA General Hospital, Beijing, China
c Capital Institute of Pediatrics, Beijing, China
d Department of Neonatology, Shenzhen Children's Hospital, Shenzhen, China
e Inner Mongolia Maternity and Child Health Care Hospital, Inner Mongolia, China
f Department of Neonatology, Women and Children's Hospital, School of Medicine, Xiamen University, Xiamen, Fujian, China
g Neonatal Intensive Care Unit, Children's Hospital Affiliated to Zhengzhou University, Henan Children's Hospital, Zhengzhou, Henan, China
h Department of Neonatology, Children's Hospital of Kunming, Kunming, Yunnan, China
i Department of Neonatology, Children's Hospital of Soochow University, Suzhou City, Jiangsu Province, China
j Clinical Laboratory, Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing Maternal and Child Health Care Hospital, Beijing, China
k Clinical Laboratory,Inner Mongolia Maternity and Child Health Care Hospital,Inner Mongolia, China
l Department of Infectious Diseases, Children's Hospital, Capital Institute of Pediatrics, 2# Yabao Road, Chaoyang District, Beijing 100020, China
m Department of Neonatology, Children's Hospital, Capital Institute of Pediatrics, 2# Yabao Road, Chaoyang District, Beijing 100020, China
⁎ Corresponding author. Children's Hospital, Capital Institute of Pediatrics,2# Yabao Road, Chaoyang District, Beijing, 100020, China. cxswyj@vip.sina.com
⁎⁎ Corresponding author. mengmlh@163.com
1 Contributed equally.

13 8 2024
30 8 2024
13 8 2024
10 16 e3599111 4 2024
14 7 2024
7 8 2024
© 2024 The Authors. Published by Elsevier Ltd.
2024

https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Background

Escherichia coli is the most common gram-negative pathogen to cause neonatal infections. Contemporary virulence characterization and antimicrobial resistance (AMR) data of neonatal E. coli isolates in China are limited.

Methods

A total of 159 E. coli strains isolated from neonates were collected and classified into invasive and non-invasive infection groups, according to their site of origin. The presence of virulence genes was determined using polymerase chain reaction (PCR). All the strains were subjected to antimicrobial susceptibility testing using the broth dilution method.

Results

The top three virulence genes with the highest detection rates were fimH (90.6 %), iutA (88.7 %), and kspMT II (88.1 %). The prevalences of fyuA (p = 0.023), kpsMT K1 (p = 0.019), ibeA (p < 0.001), and iroN (p = 0.027) were significantly higher in the invasive infection group than in the non-invasive infection group. Resistance to ceftazixime, sulfamethoxazole/trimethoprim, and ciprofloxacin was 75.5 %, 65.4 %, and 48.4 %, respectively. Lower rates of resistance to ceftazidime (p = 0.022), cefepime (p = 0.005), ticarcillin/clavulanic acid (p = 0.020) and aztreonam (p = 0.001) were observed in the invasive infection group compared to the non-invasive infection group. The number of virulence genes carried by E. coli was positively correlated with the number of antibiotics to which the isolates were resistant (r = 0.71, p = 0.016), and a specific virulence gene was associated with resistance to various species of antibiotics.

Conclusions

Neonatal E. coli isolates carried multiple virulence genes and were highly resistant to antibiotics. Further studies are needed to understand the molecular mechanisms underlying the association between virulence and AMR.

Keywords

Neonatal infection
Escherichia coli
Virulence gene
Antimicrobial resistance
Epidemiology
==== Body
pmc1 Introduction

Escherichia coli is a multifaceted microbe since some are commensals, normally inhabiting the intestinal tracts of both humans and animals whereas others are pathogenic responsible for a wide range of intestinal and extra-intestinal infections. Pathogenic E. coli can be broadly divided into two groups: intestinal pathogenic E. coli (InPEC) and extra-intestinal pathogenic E. coli (ExPEC) [1]. E. coli is the most common gram-negative pathogen to cause neonatal infections worldwide and has been implicated as the main causative agent of severe infectious diseases in newborns (including sepsis and bacterial meningitis), especially in developing countries [2,3].

E. coli can cause infections and diseases through various mechanisms including adhesion and colonization, toxin production, cellular invasion, and immune escape [4]. Several specific virulence factors (VFs), such as adhesins, invasins, iron-acquisition systems, protectines/serum resistance and toxins, have been identified in ExPEC strains, which evade host defenses, invade host tissues and ultimately elicit host inflammation [5,6]. VFs are either encoded by virulence genes on the bacterial chromosome, where they are usually located within pathogenicity islands (PAIs), or on plasmids [7]. PAIs are a group of large (>10 kb) integrative elements that accumulate virulence genes in specific regions of the bacterial chromosome, which can be propagated in bacterial populations via horizontal transfer to promote bacterial evolution [8].

The burden of antimicrobial resistance (AMR) in E. coli is severe, particularly with the emergence of multidrug-resistant (MDR) isolates, which have become one of the major public health threats in the twenty-first century [9,10]. AMR and virulence are not two independent characteristics, but rather a negative or positive relationship exists between them [11]. This relationship provides advantages to microorganisms, endowing them with characteristics that enable them to survive in different niches with different selective pressures (such as the presence of antibiotics) [12]. In the evolution of pathogens, the correlation between AMR and virulence has become an enormous concern, which could cause successful highly virulent and resistant clones such as ST131 being disseminated worldwide [12,13].

There is a paucity of large-scale, neonatal-specific studies on the distribution of virulence and AMR in E. coli. Therefore, knowledge regarding these data is essential for the optimal management of neonatal infections. In this study, we evaluated virulence genes distribution of E. coli in hospitalized neonates across China and determined their correlation with AMR.

2 Materials and methods

2.1 Collection of clinical strains

Clinical samples were collected from neonates (under 28 days of age) at six tertiary hospitals in six cities across China. A total of 159 strains were obtained, of which 60, 53, 18, 15, nine, and four were isolated from Zhengzhou, Kunming, Beijing, Suzhou, Shenzhen, and Hohhot, respectively. Patients hospitalized between November 2019 and October 2020, with positive E. coli cultures from any of the specimens, pharyngeal swabs, sputum, blood, cerebrospinal fluid, urine, ascites, or peripherally inserted central catheter (PICC) tips were included in this study. Specimens were collected from patients who matched these conditions: blood was collected from sepsis, cerebrospinal fluid was collected from meningitis, pharyngeal swabs and sputum was collected from lower respiratory tract infection, ascites was collected from intraperitoneal infection, and the PICC tips were collected from catheter-related blood infection. The specimens were stored in a freezer at −80 °C. The study was conducted in accordance with the Declaration of Helsinki, met all ethical requirements, and was approved by the Ethics Committee of Beijing Children's Hospital.

2.2 Strain identification and antimicrobial susceptibility testing

Clinical specimens were inoculated into MacConkey agar plate medium (CM00078) using the three-zone delineation method and incubated at 37 °C for 24h. The colonies were inoculated into E. coli chromogenic medium (EC166, Beijing Landbridge Technology Co., Ltd.) and cultured at 37 °C for 24h, and the blue colony phenotype indicated the presence of E. coli isolate. Isolated and purified strains were preserved in the freezer, at −80 °C [14].

Antimicrobial susceptibility testing was performed using the broth microdilution method, according to the instructions of the Sensititre™ Gram-Negative GNX2F Plate (Thermo Fisher Scientific, USA). Briefly, 3–5 colonies were mixed with H2O to reach a McFarland value of 0.5 using a nephelometer, and 10 μL of the suspension was mixed into Sensititre Mueller Hinton Broth. The plate was inoculated with 50 μL of the suspension per well, using an 8-channel pipette. The Sensititre plate was sealed and incubated at 34–36 °C in a Sensititre ARIS 2X† for 18–24 h. In total, 21 antimicrobial agents were evaluated, namely: ticarcillin/clavulanic acid, piperacillin/tazobactam, ceftazidime, cefotaxime, cefepime, aztreonam, ertapenem, doripenem, meropenem, imipenem, tobramycin, gentamicin, amikacin, levofloxacin, ciprofloxacin, doxycycline, tigecycline, minocycline, sulfamethoxazole/trimethoprim, polymyxin B, and colistin. E. coli ATCC 25922 was used as the quality control strain. Antimicrobial susceptibility testing results were classified as susceptible (S), intermediate (I), or resistant (R), in accordance with Clinical and Laboratory Standards Institute (CLSI) 2023 standards [15].

According to the international classification of the different degrees of multi-resistance [16], E. coli isolates were classified as follows: multidrug-resistant (MDR) was defined as acquired non-susceptibility to at least one agent in more than three antimicrobial categories, and extensively drug-resistant (XDR) was defined as non-susceptibility to at least one agent in all but two or fewer antimicrobial categories. Pandrug resistance (PDR) was defined as non-susceptibility to all agents in all antimicrobial categories.

2.3 Detection of virulence genes

DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Biotech Co., Ltd., Beijing, China). Virulence genes were detected using polymerase chain reaction (PCR), including genes associated with adhesins (papA, papG, papEF, sfa/focDE, papC, afa/draBC, fimH), iron acquisition (fyuA, iutA, iroN), capsule synthesis/immune evasion (kpsMT K1, kpsMT II, kpsMT III, traT, rfc), toxins (hlyA, cnf1), invasion (ibeA), and pathogenicity-associated island (PAI-ICFT073) [17,18]. The PCR was performed in a 25 μL mixture comprised of 12.5 μL of 2 × Taq PCR Mix, 1 μL of upstream and downstream primers, 1 μL of DNA template and 9.5 μL of sterilized ultrapure water. The program for PCR amplification was as follows: pre-denaturation at 93 °C for 5 min, denaturation at 93 °C for 30 s, annealing at a temperature determined individually for each gene (Table 1), and extension at 65 °C for 30 s. Thirty cycles were performed, followed by incubation at 72 °C for 5 min. The PCR products were identified by agarose gel electrophoresis and compared to a 100-bp ladder to confirm their appropriate size. The presence of a band of the expected size was considered as positivity to the presence of the corresponding gene. E. coli ATCC 25922 was used as the standard quality control strain.Table 1 Specific primers used in this study.

Table 1Target	Primer direction	Sequence (5’ → 3′)	Annealing temperature (°C)	Product length (bp)	
PAI-ICFT073f	Forward	GGACATCCTGTTACAGCGCGCA	65	930 [18]	
Reverse	TCGCCACCAATCACAGCGAAC			
papAa	Forward	ATGGCAGTGGTGTCTTTTGGTG	60	720 [17]	
Reverse	CGTCCCACCATACGTGCTCTTC			
papG allele IIa	Forward	GGGATGAGCGGGCCTTTGAT	64	190 [17]	
Reverse	CGGGCCCCCAAGTAACTCG			
papEFa	Forward	GCAACAGCAACGCTGGTTGCATCAT	60	336 [17]	
Reverse	AGAGAGAGCCACTCTTATACGGACA			
fyuAb	Forward	TGATTAACCCCGCGACGGGAA	60	880 [17]	
Reverse	CGCAGTAGGCACGATGTTGTA			
kpsMT K1c	Forward	TAGCAAACGTTCTATTGGTGC	56	153 [18]	
Reverse	CATCCAGACGATAAGCATGAGCA			
hlyAd	Forward	AACAAGGATAAGCACTGTTCTGGCT	62	1177 [17]	
Reverse	ACCATATAAGCGGTCATTCCCGTCA			
sfa/focDEa	Forward	CTCCGGAGAACTGGGTGCATFTTAC	63	410 [17]	
Reverse	CGGAGGAGTAATTACAAACCTGGCA			
kpsMT IIc	Forward	GCGCATTTGCTGATACTGTTG	60	272 [17]	
Reverse	CATCCAGACGATAAGCATGAGCA			
kpsMT IIIc	Forward	TCCTCTTGCTACTATTCCCCCT	60	392 [17]	
Reverse	AGGCGTATCCATCCCTCCTAAC			
iutAb	Forward	GGCTGGACATCATGGGAACTGG	64	300 [17]	
Reverse	CGTCGGGAACGGGTAGAATCG			
papCa	Forward	GTGGCAGTATGAGTAATGACCGTTA	60	200 [17]	
Reverse	ATATCCTTTCTGCAGGGATGCAATA			
fimHa	Forward	CACTCAGGGAACCATTCAGGCA	58	975 [18]	
Reverse	CTTATTGATAAACAAAAGTCAC			
afa/draBCa	Forward	GGCAGAGGGCCGGCAACAGGC	60	559 [17]	
Reverse	CCCGTAACGCGCCAGCATCTC			
traTc	Forward	GGTGTGGTGCGATGAGCACAG	64	290 [17]	
Reverse	CACGGTTCAGCCATCCCTGAG			
cnf1d	Forward	AAGATGGAGTTTCCTATGCAGGAG	64	498 [17]	
Reverse	CATTCAGAGTCCTGCCCTCATTATT			
rfcc	Forward	ATCCATCAGGAGGGGACTGGA	58	788 [17]	
Reverse	AACCATACCAACCAATGCGAG			
ibeAe	Forward	AGGCAGGTGTGCGCCGCGTAC	60	170 [17]	
Reverse	TGGTGCTCCGGCAAACCATGC			
iroNb	Forward	AAGTCAAAGCAGGGGTTGCCCG	60	667 [18]	
Reverse	GACGCCGACATTAAGACGCAG			
Note.

a adhesins-related.

b iron acquisition-related.

c capsule synthesis/immune evasion-related.

d toxins-related.

e invasin-related.

f pathogenicity-associated island.

2.4 Definitions and strain grouping

The strains were categorized into invasive and non-invasive infection groups based on the site of isolation and whether the specimen was sterile body fluid or not [[19], [20], [21]]. Strains isolated from sterile body fluids such as blood, cerebrospinal fluid, and ascites were categorized into the invasive infection group, and strains isolated from sputum, pharyngeal swabs, and urine were categorized into the non-invasive infection group.

2.5 Statistical analysis

SPSS 23.0 software (IBM SPSS, Chicago, IL, USA) was used for data processing and analysis. Count data were expressed as proportions (%), and Fisher' s exact test was used for comparisons between groups. Pearson's correlation (r) coefficient and a binary logistic regression model were used to analyze the correlation between virulence genes and AMR. Differences with p < 0.05 were considered to be statistically significant.

3 Results

3.1 General characteristics of E. coli strains

We identified 159 E. coli strains isolated from neonates that provided microbiologic data from 2019 through 2020. Among the 159 strains, 34 were from blood, 11 from cerebrospinal fluid, 2 from ascites, 1 from the PICC tip, 86 from sputum, 16 from pharyngeal swabs, and 9 from urine. The strains were categorized into two groups according to their isolation sites, the invasive infection group (n = 48) from blood, cerebrospinal fluid, ascites, and the PICC tip, and the non-invasive infection group (n = 111) from sputum, pharyngeal swabs, and urine.

3.2 Prevalence of virulence genes

In this study, 159 strains of E. coli were tested for the presence of genes encoding 19 VFs. The most frequently detected E. coli virulence gene was fimH (90.6 %, 144/159), followed by iutA (88.7 %, 141/159), kspMT II (88.1 %, 140/159), and fyuA (86.2 %, 137/159). Only kpsMT III had a distribution of less than 10 % (4.4 %, 7/159). The virulence genes with higher detection rates in the invasive infection group were fyuA (95.8 %, 46/48), fimH (95.8 %, 46/48), and iutA (91.7 %, 44/48), and the corresponding genes in the non-invasive infection group were fimH (88.3 %, 98/111), iutA (87.4 %, 97/111), and kspMT II (86.5 %. 96/111). A comparison of the invasive and non-invasive infection groups revealed that the prevalence of fyuA (p = 0.023), kpsMT K1 (p = 0.019), ibeA (p < 0.001), and iroN (p = 0.027) were significantly higher in the invasive infection group than in the non-invasive infection group, whereas that of afa/draBC (p = 0.005) was significantly lower in the invasive infection group than in the non-invasive infection group (Table 2).Table 2 Prevalence of virulence genes in neonatal E. coli isolates, and virulence gene frequencies among invasive infection group compared to those with non-invasive infection group.

Table 2Virulence genes	Invasive infection group n = 48 (%)	Non-invasive infection group n = 111 (%)	Total n = 159 (%)	p	
PAI-ICFT073	40 (83.3)	81 (73.0)	121 (76.1)	0.224	
papA	27 (56.3)	66 (59.5)	93 (58.5)	0.729	
papG allele II	32 (66.7)	80 (72.1)	112 (70.4)	0.571	
papEF	23 (47.9)	64 (54.7)	87 (54.7)	0.299	
fyuA	46 (95.8)	91 (82.0)	137 (86.2)	0.023	
kpsMT K1	23 (50.0)	34 (30.1)	57 (35.8)	0.019	
hlyA	17 (35.4)	43 (38.7)	60 (37.7)	0.725	
sfa/focDE	22 (45.8)	50 (45.0)	72 (45.3)	1.000	
kpsMT II	44 (91.7)	96 (86.5)	140 (88.1)	0.434	
kpsMT III	3 (6.2)	5 (4.5)	7 (4.4)	0.699	
iutA	44 (91.7)	97 (87.4)	141 (88.7)	0.588	
papC	27 (56.3)	54 (48.6)	81 (50.9)	0.394	
fimH	46 (95.8)	98 (88.3)	144 (90.6)	0.235	
afa/draBC	5 (10.4)	35 (31.5)	40 (25.2)	0.005	
traT	37 (77.1)	88 (79.3)	125 (78.6)	0.834	
cnf1	20 (41.7)	39 (35.1)	59 (37.1)	0.477	
ibeA	13 (27.1)	3 (2.7)	16 (10.1)	0.000	
rfc	25 (52.1)	60 (54.1)	85 (53.5)	0.864	
iroN	42 (87.5)	79 (71.2)	121 (76.1)	0.027	
Note: bold values indicate virulence genes with significant differences among the two groups (p < 0.05).

3.3 AMR

Of the 21 antibiotics tested, the neonatal E. coli isolates exhibited a high rate of resistance to cefotaxime (75.5 %, 120/159), trimethoprim/sulfamethoxazole (65.4 %, 104/159) and ciprofloxacin (48.4 %, 77/159). No isolates were resistant to amikacin, tigecycline, polymyxin B, and only one was resistant to colistin, and all were more than 90 % susceptible to carbapenems (Table 3). Applying the classification of multiple degrees of resistance, we observed that 61.6 % (98/159) of the isolates were MDR, 10.1 % (16/159) were XDR, and none were PDR. Regarding the distribution of resistance in the invasive and non-invasive infection groups, we found that the invasive infection group had lower rates of AMR to ceftazidime (p = 0.022), cefepime (p = 0.005), ticarcillin/clavulanic acid (p = 0.020), and aztreonam (p = 0.001) (Table 4).Table 3 Susceptibility of 159 E. coli strains to 21 antibiotic agents (%).

Table 3Antibiotic agent		R (%)	I (%)	S (%)	
Carbapenems	Imipenem	7 (4.4)	1 (0.6)	151 (95.0)	
Ertapenem	15 (9.4)	1 (0.6)	143 (90.0)	
Doripenem	7 (4.4)	2 (1.2)	150 (94.3)	
Meropenem	10 (6.3)	2 (1.2)	147 (92.5)	
Sulfonamides	Sulfamethoxazole/trimethoprim	104 (65.4)	0 (0)	55 (34.6)	
Cephalosporins	Ceftazidime	35 (22.0)	20 (12.6)	104 (65.4)	
Cefotaxime	120 (75.5)	2 (1.2)	37 (23.2)	
Cefepime	40 (25.2)	0 (0)	119 (74.8)	
Aminoglycosides	Tobramycin	19 (11.9)	31 (19.5)	109 (68.6)	
Gentamicin	47 (29.6)	2 (1.2)	110 (69.2)	
Amikacin	0 (0)	0 (0)	159 (100.0)	
Penicillins	Ticarcillin/clavulanic acid	26 (16.4)	54 (34.0)	79 (49.7)	
Piperacillin/tazobactam	16 (10.1)	4 (2.5)	139 (87.4)	
Quinolones	Levofloxacin	73 (45.9)	86 (54.1)	0 (0)	
Ciprofloxacin	77 (48.4)	13 (8.2)	69 (43.4)	
Monobactams	Aztreonam	62 (39.0)	17 (10.7)	80 (50.3)	
Tetracyclines	Doxycycline	72 (45.3)	42 (26.4)	45 (28.3)	
Tigecycline	0 (0)	0 (0)	159 (100.0)	
Minocycline	20 (12.6)	23 (14.5)	116 (72.6)	
Polypeptides	Colistin	1 (0.6)	0 (0)	158 (99.4)	
Polymyxin B	0 (0)	91 (57.2)	68 (42.8)	

Table 4 AMR in invasive and non-invasive infection groups.

Table 4Antibiotic	Invasive infection group (n = 48)	Non-invasive infection group (n = 111)	Total (n = 159)	p	
Sulfamethoxazole/trimethoprim	34 (70.8)	70 (63.1)	104 (65.4)	0.370	
Ceftazidime	5 (10.4)	31 (27.9)	36 (22.6)	0.022	
Cefotaxime	31 (64.6)	88 (79.3)	119 (74.8)	0.072	
Cefepime	5 (10.4)	35 (31.5)	40 (25.2)	0.005	
Gentamicin	11 (22.9)	36 (32.4)	47 (29.6)	0.260	
Ticarcillin/clavulanic acid	3 (6.3)	24 (21.6)	27 (17.0)	0.020	
Levofloxacin	21 (43.8)	53 (47.7)	74 (46.5)	0.730	
Ciprofloxacin	22 (45.8)	55 (49.5)	77 (48.4)	0.731	
Aztreonam	10 (20.8)	53 (47.7)	63 (39.6)	0.001	
Doxycycline	23 (47.9)	49 (44.1)	72 (45.3)	0.730	
Note: bold values indicate antibiotics with significant differences among the two groups (p < 0.05).

3.4 Correlation between virulence genes and AMR

We found a positive correlation between the total number of virulence genes and the number of antibiotics to which the isolates were resistant (r = 0.71, p = 0.016). Table 5 summarizes the correlation between distinct virulence genes and AMR in E. coli strains isolated from neonates. AMR affected by virulence includes resistance to sulfamethoxazole/trimethoprim, ceftazidime, cefotaxime, gentamicin, ticarcillin/clavulanic acid, levofloxacin, ciprofloxacin, and doxycycline. The strongest positive correlation was observed between kspMT III and ciprofloxacin (OR, 7.875; 95 % CI, 0.991 to 62.555), and the strongest negative correlation was observed between papA and levofloxacin (OR, 0.193; 95 % CI, 0.092 to 0.407). Resistance to quinolones was elevated in strains harboring kspMT III and fimH and decreased in strains harboring papA and traT. Strains with detectable rfc had higher resistance to cefotaxime and ciprofloxacin and lower resistance to doxycycline. Furthermore, sfa/focDE positively correlated with ticarcillin/clavulanic acid and doxycycline resistance and negatively correlated with gentamicin resistance. For strains with detectable cnf1 and kpsMT K1, resistance to ciprofloxacin and cefotaxime was reduced, respectively.Table 5 Logistic regression analysis of the relationship between virulence genes and AMR.

Table 5Antibiotic	Virulence gene	Regression coefficient (β)	p	Odds ratio (OR)	OR 95 % confidence interval (CI)	
Sulfamethoxazole/trimethoprim	papA	−0.897	0.033	0.408	0.179–0.931	
hlyA	−0.894	0.022	0.409	0.190–0.931	
Ceftazidime	afa/draBC	0.983	0.019	2.672	1.175–6.078	
iroN	−1.000	0.019	0.368	0.160–0.847	
Cefotaxime	kpsMT K1	−0.875	0.029	0.417	0.190–0.914	
papC	1.017	0.018	2.766	1.191–6.424	
iroN	−1.248	0.037	0.287	0.089–0.928	
rfc	1.189	0.005	3.284	1.431–7.537	
Gentamicin
Ticarcillin/clavulanic acid	sfa/focDE	−1.365	0.001	0.255	0.118–0.552	
papA	−1.553	0.002	0.212	0.081–0.556	
sfa/focDE	1.082	0.035	2.951	1.081–8.050	
iroN	−1.060	0.037	0.346	0.128–0.937	
Levofloxacin	papA	−1.645	0.000	0.193	0.092–0.407	
kspMT III	1.674	0.010	5.335	1.497–19.010	
fimH	1.679	0.028	5.361	1.197–24.009	
traT	−1.285	0.005	0.277	0.114–0.673	
Ciprofloxacin	papA	−1.611	0.000	0.200	0.089–0.447	
kspMT III	2.064	0.050	7.875	0.991–62.555	
fimH	1.935	0.014	6.927	1.472–32.604	
traT	−1.572	0.002	0.208	0.076–0.563	
cnf1	−1.153	0.006	0.316	0.138–0.719	
rfc	1.156	0.006	3.176	1.397–7.220	
Doxycycline	sfa/focDE	0.983	0.010	2.673	1.262–5.663	
hlyA	−0.966	0.015	0.380	0.175–0.828	
rfc	−0.747	0.040	0.474	0.232–0.967	

4 Discussion

Neonates, especially preterm infants, face a higher risk of infection because of the immaturity and immunologic incompetence of the immune system [22], and E. coli is the main cause of serious infections in term and preterm infants [23]. In this study, we retrospectively investigated the prevalence of virulence genes and AMR in E. coli isolates from hospitalized neonates in a multicenter setting across China.

Data are very limited on the prevalence of virulence genes in neonatal E. coli strains. Our study showed that neonatal E. coli isolates carried multiple virulence genes, the most common of which were fimH, iutA, kspMT II, and fyuA, consistent with the findings of Cole et al. [24]. When grouped based on specimen source, fyuA, fimH, and iutA had higher positive detection rates in the invasive infection group, whereas fimH, iutA, kspMT II had higher positive detection rates in the non-invasive infection group.

FimH is a type 1 fimbrial adhesin with strong affinity to mannosylated glycoproteins of the urinary tract epithelium and CD48 receptor of human brain microvascular endothelial cells (HBMECs), enabling bacteria invasion, colonization, proliferation and subsequent formation of biofilm-like intracellular bacterial communities (IBCs) within host cells, which act as an important VF for adherence and invasion of extra-intestinal tissues [5,25]. In this study, the fimH detection rate was high in both groups, which suggests possible horizontal transfer from different sources or tissues as well as adhesion and invasion of cells in the respiratory tract, urinary tract, blood, cerebrospinal fluid, or other tissues [26]. IutA and fyuA, which are involved in iron metabolism, were also prevalent. In addition, kpsMT II encodes group 2 capsules (e.g., K1, K2, K5, and K15), which act as the protection factor against phagocytosis and the spreading factor [27]. Group 2 capsules predominate in ExPEC isolates and are considered to be required to prevent the host immune system [28].

Comparing the prevalence of virulence genes between the invasive and non-invasive infection groups, we found significantly higher detection rates of fyuA, K1, ibeA, and iroN in the invasive group. Among them, fyuA and iroN are both iron acquisition-related virulence genes [28]. Iron acquisition systems are commonly associated with ExPEC strains isolated from patients with bacteremia and are involved in the efficient uptake of iron from the blood as well as bacterial invasion of the bloodstream from the urinary tract [29,30]. The K1 capsule has been linked to neonatal sepsis and bacterial meningitis, and also correlates with disease severity [31,32]. Studies have shown that K1 capsule was present in 50 % of isolates from neonatal sepsis and 80 % of isolates from neonatal meningitis [33,34]. The K1 capsule is composed of polysialic acid (polySia), that mimics the polySia modification found on human neuronal and immune cells and likely promotes the capacity of K1-expressing E. coli to hide and reside within the blood and neuronal compartments [35]. Indeed, polySia prevents the full activation of host innate defenses and confers resistance to complement- and phagocyte-mediated killing [36]. Consistent with validation in animal models, K1 expression promotes the development of invasive infections by E. coli [37]. Regarding IbeA proteins, it has been suggested that Caspr1, a membrane protein expressed on HBMEC, acts as a receptor for IbeA to facilitate blood–brain barrier penetration and entry of E. coli into brain neurons via ligand-receptor interactions [38].

In our study, the invasive infection group contained 11 cerebrospinal fluid specimens, with 90.9 % (10/11) K1 detection rate and 36.4 % (4/11) ibeA detection rate, which further validated that K1 capsule and IbeA proteins assisted E. coli to cross the blood-brain barrier (BBB). Our findings suggest that fyuA, K1, ibeA, and iroN may be the key virulence genes that determine the development of invasive infectious events such as neonatal sepsis and meningitis.

In addition to virulence genes prevalence data, our study also provides information on the AMR of neonatal E. coli strains. A substantial proportion of neonatal E. coli isolates were resistant to commonly administered antibiotics, with cefotaxime showing the highest rate of resistance (75.5 %, 120/159), and 98 (61.6 %) isolates were MDR. Although this may be affected by differences in sample isolation sites, the antibiotic resistance situation in China is more severe than that in developed regions such as the United States and Europe [23,39]. A particular concern is the discovery of a strain with a colistin-resistant phenotype in this study. Colistin is considered among the last resort for treating MDR Enterobacteriaceaea, and the emergence of its resistance could pose a severe threat to the healthcare system [40].

E. coli antibiotic resistance has become a global challenge, and although virulence and resistance develop at different times, they are not independent characteristics; rather, there is a relationship between them [13]. We analyzed the correlation between virulence genes and AMR using epidemiological data. Overall, the number of virulence genes carried by each E. coli strain positively correlated with the number of resistant antibiotics, which possibly reflects the evolutionary trend of clonal populations combining resistance and virulence, such as ST131 [41]. In this study, the strongest positive correlation was observed in kpsMT III & ciprofloxacin. KpsMT III encodes group III capsules (K10 and K54) [42], which are protective structures on the surfaces of bacteria [27]. It is not surprising to find elevated resistance in kpsMT III-positive strains; however, there is very little information available about group III capsules, and the specific molecular mechanisms require further exploration.

Notably, the detection of kpsMT III and fimH was associated with increased quinolone resistance, whereas the detection of traT and papA was associated with decreased quinolone resistance. Resistance to quinolones is largely mediated by point mutations in DNA gyrases and topoisomerases, but it may also be due to the synergistic combination of efflux pumps and plasmid-mediated mechanisms [43]. Despite repeated attempts at explaining the biology of the inverse link between quinolone-resistance and virulence, the conflicting results found in the literature underlie the complexity of the topic [44]. Typically, ExPEC-associated virulence, such as P fimbriae (pap) and haemolysin (hly), have been found to be less common in the genomes of quinolone-resistant isolates. This finding may be explained by the acquisition of quinolone resistance by E. coli naturally lacking these virulence genes, subsequently spread in a clonal fashion [45]. Another hypothesis is that during the development of quinolone resistance, antibiotics can increase the deletion or translocation of some DNA regions containing virulence genes, or partial or total loss of PAI due to possible inhibition of topoisomerases II and IV [46,47]. There are positive and negative correlations between antibiotic resistance and virulence, depending on the antibiotic studied, the mechanism of resistance and the type of E. coli [12]. The mechanisms involved in the relationship between resistance and virulence are complex, and epidemiological associations are only the first step to understanding them. Therefore, more in-depth molecular studies of virulence genes and AMR determinants at the genetic level are urgently needed to explore the interactions and co-evolutionary paths between virulence and resistance.

The strength of our study is that the samples were obtained from multiple medical centers across China, and thus, our findings provide specific information on virulence genes and AMR in neonatal E. coli infections across Chinese populations. However, this study has several limitations that should be noted when interpreting our findings. First, we examined only virulence genes and antimicrobial susceptibility in E. coli, and our findings lack further patient categorization, clinical symptom, and diagnostic information. Records on antibiotic dose and administration frequency and detailed patient-level data were not recorded nor included in the analyses. Second, we acknowledge that the patients included in this study were from tertiary hospitals and their condition might be more severe than that of sick infants in primary medical centers.

In conclusion, we have characterized in detail the virulence and AMR of E. coli isolates from Chinese hospitalized neonates. We found that neonatal E. coli isolates carried several virulence genes and were severely resistant to commonly administered antibiotics. We also showed a higher prevalence of fyuA, K1, ibeA and iroN in E. coli causing invasive infections. The presence of these virulence genes may predict the site of infection and severity of disease. This knowledge can be used for the molecular detection of virulent strains, and could also be targets for the development of new therapeutic strategies, such as vaccines, in the era of antimicrobial resistance. A correlation between virulence genes and AMR was observed in this work. Further studies will be needed to understand the molecular mechanisms underlying the correlation between virulence and AMR.

5 Transparency declaration

The authors declare that they have no conflicts of interest. This work was funded by the 10.13039/501100001809 National Natural Science Foundation of China (Grant No. 81872676) and Beijing Natural Science Foundation (Grant No. 7232009).

Data Availability statement

Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Yajuan Wang cxswyj@vip.sina.com. The data reported in this paper may be shared by the lead contact on request and pending approval from ethics and regulatory committees where relevant. This study didn't report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Ethics declarations

This study was reviewed and approved by Beijing Children's Hospital with the approval number: No. 2019-k-350, dated Oct 7, 2019.

CRediT authorship contribution statement

Yuting Guo: Writing – review & editing, Writing – original draft, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Ruiqi Xiao: Writing – review & editing, Writing – original draft, Methodology, Investigation, Formal analysis, Data curation. Jinxing Feng: Writing – review & editing, Investigation, Data curation. Xiaoyun Wang: Writing – review & editing, Resources, Methodology, Investigation, Data curation. Jidong Lai: Resources, Methodology, Investigation. Wenqing Kang: Resources, Investigation. Yangfang Li: Resources, Investigation. Xueping Zhu: Resources, Investigation. Tongzhen Ji: Resources, Investigation. Xuerong Huang: Resources, Investigation. Dan Pang: Resources, Investigation. Yanbin An: Resources, Investigation. Lihui Meng: Writing – review & editing, Project administration, Conceptualization. Yajuan Wang: Writing – review & editing, Project administration, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following are the Supplementary data to this article.Multimedia component 1

Multimedia component 1

Multimedia component 2

Multimedia component 2

Acknowledgements

All data generated and analyzed during this study are included in this published article. We thank all hospital staff involved in the study and appreciate the willingness of patients and their families to help advance pediatric medicine by participating.

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e35991.
==== Refs
References

1 Geurtsen J. de Been M. Weerdenburg E. Zomer A. McNally A. Poolman J. Genomics and pathotypes of the many faces of Escherichia coli FEMS Microbiol. Rev. 46 2022 fuac031 10.1093/femsre/fuac031
2 Tan L.E. Gram negative organisms and viral infections in neonatal sepsis BMJ 371 2020 m4248 10.1136/bmj.m4248 33144290
3 van der Flier M. Neonatal meningitis: small babies, big problem Lancet Child Adolesc Health 5 2021 386 387 10.1016/S2352-4642(21)00092-4 33894158
4 Croxen M.A. Finlay B.B. Molecular mechanisms of Escherichia coli pathogenicity Nat. Rev. Microbiol. 8 2010 26 38 10.1038/nrmicro2265 19966814
5 Dale A.P. Woodford N. Extra-intestinal pathogenic Escherichia coli (ExPEC): disease, carriage and clones J. Infect. 71 2015 615 626 10.1016/j.jinf.2015.09.009 26409905
6 Croxen M.A. Finlay B.B. Molecular mechanisms of Escherichia coli pathogenicity Nat. Rev. Microbiol. 8 2010 26 38 10.1038/nrmicro2265 19966814
7 Denamur E. Clermont O. Bonacorsi S. Gordon D. The population genetics of pathogenic Escherichia coli Nat. Rev. Microbiol. 19 2021 37 54 10.1038/s41579-020-0416-x 32826992
8 Desvaux M. Dalmasso G. Beyrouthy R. Barnich N. Delmas J. Bonnet R. Pathogenicity factors of genomic islands in intestinal and extraintestinal Escherichia coli Front. Microbiol. 11 2020 2065 10.3389/fmicb.2020.02065 33101219
9 Antimicrobial Resistance Collaborators Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis Lancet 399 2022 629 655 10.1016/S0140-6736(21)02724-0 35065702
10 Shafiq M. Zeng M. Permana B. Bilal H. Huang J. Yao F. Algammal A.M. Li X. Yuan Y. Jiao X. Coexistence of bla NDM-5 and tet(X4) in international high-risk Escherichia coli clone ST648 of human origin in China Front. Microbiol. 13 2022 1031688 10.3389/fmicb.2022.1031688
11 Lazar V. Oprea E. Ditu L.-M. Resistance, tolerance, virulence and bacterial pathogen fitness-current state and envisioned solutions for the near future Pathogens 12 2023 746 10.3390/pathogens12050746 37242416
12 Cepas V. Soto S.M. Relationship between virulence and resistance among gram-negative bacteria Antibiotics (Basel) 9 2020 719 10.3390/antibiotics9100719 33092201
13 Beceiro A. Tomás M. Bou G. Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world? Clin. Microbiol. Rev. 26 2013 185 230 10.1128/CMR.00059-12 23554414
14 G. S, L. J, K. W, L. Y, Z. X, J. T, F. J, Z. L, L. Z, D. L, H. G, Z. Y, L. ZC H. H G. D P. Y W. Drug resistance characteristics and molecular typing of Escherichia coli isolates from neonates in class A tertiary hospitals: a multicentre study across China J. Infect. 85 2022 10.1016/j.jinf.2022.09.014
15 Xiao R. Li Y. Liu X. Ding Y. Lai J. Li Y. Kang W. Zou P. Wang J. Du Y. Zhang J. Wang Y. Antibiotic susceptibility of Escherichia coli isolated from neonates admitted to neonatal intensive care units across China from 2015 to 2020 Front. Cell. Infect. Microbiol. 13 2023 1183736 10.3389/fcimb.2023.1183736
16 Magiorakos A.-P. Srinivasan A. Carey R.B. Carmeli Y. Falagas M.E. Giske C.G. Harbarth S. Hindler J.F. Kahlmeter G. Olsson-Liljequist B. Paterson D.L. Rice L.B. Stelling J. Struelens M.J. Vatopoulos A. Weber J.T. Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance Clin. Microbiol. Infect. 18 2012 268 281 10.1111/j.1469-0691.2011.03570.x 21793988
17 Hyun M. Lee J.Y. Kim H.A. Differences of virulence factors, and antimicrobial susceptibility according to phylogenetic group in uropathogenic Escherichia coli strains isolated from Korean patients Ann. Clin. Microbiol. Antimicrob. 20 2021 77 10.1186/s12941-021-00481-4 34758824
18 Barrios-Villa E. Cortés-Cortés G. Lozano-Zaraín P. Arenas-Hernández M.M. de la P. Martínez de la Peña C.F. Martínez-Laguna Y. Torres C. Rocha-Gracia R.D.C. Adherent/invasive Escherichia coli (AIEC) isolates from asymptomatic people: new E. coli ST131 O25:H4/H30-Rx virotypes Ann. Clin. Microbiol. Antimicrob. 17 2018 42 10.1186/s12941-018-0295-4 30526606
19 Miller J.M. Binnicker M.J. Campbell S. Carroll K.C. Chapin K.C. Gonzalez M.D. Harrington A. Jerris R.C. Kehl S.C. Leal S.M. Patel R. Pritt B.S. Richter S.S. Robinson-Dunn B. Snyder J.W. Telford S. Theel E.S. Thomson R.B. Weinstein M.P. Yao J.D. Guide to utilization of the microbiology laboratory for diagnosis of infectious diseases: 2024 update by the infectious diseases society of America (IDSA) and the American society for microbiology (ASM) Clin. Infect. Dis. 2024 10.1093/cid/ciae104 ciae104
20 Doua J. Rodríguez-Baño J. Froget R. Puranam P. Go O. Geurtsen J. van Rooij S. Vilken T. Minoru I. Yasumori I. Spiessens B. Tacconelli E. Biehl L.M. Thaden J.T. Sarnecki M. Goossens H. Poolman J. Bonten M. Ekkelenkamp M. COMBACTE-NET Consortium/EXPECT Study Group, Clinical presentation and antimicrobial resistance of invasive Escherichia coli disease in hospitalized older adults: a prospective multinational observational study Infection 52 2024 1073 1085 10.1007/s15010-023-02163-z 38267801
21 Shakir S.M. Goldbeck J.M. Robison D. Eckerd A.M. Chavez-Bueno S. Genotypic and phenotypic characterization of invasive neonatal Escherichia coli clinical isolates Am. J. Perinatol. 31 2014 975 982 10.1055/s-0034-1370341 24566757
22 Collins A. Weitkamp J.-H. Wynn J.L. Why are preterm newborns at increased risk of infection? Arch. Dis. Child. Fetal Neonatal Ed. 103 2018 F391 F394 10.1136/archdischild-2017-313595 29382648
23 Flannery D.D. Akinboyo I.C. Mukhopadhyay S. Tribble A.C. Song L. Chen F. Li Y. Gerber J.S. Puopolo K.M. Antibiotic susceptibility of Escherichia coli among infants admitted to neonatal intensive care units across the US from 2009 to 2017 JAMA Pediatr. 175 2021 168 175 10.1001/jamapediatrics.2020.4719 33165599
24 Cole B.K. Ilikj M. McCloskey C.B. Chavez-Bueno S. Antibiotic resistance and molecular characterization of bacteremia Escherichia coli isolates from newborns in the United States PLoS One 14 2019 e0219352 10.1371/journal.pone.0219352
25 Mydock-McGrane L.K. Hannan T.J. Janetka J.W. Rational design strategies for FimH antagonists: new drugs on the horizon for urinary tract infection and Crohn's disease Expert Opin Drug Discov 12 2017 711 731 10.1080/17460441.2017.1331216 28506090
26 Johnson J.R. Johnston B.D. Porter S. Thuras P. Aziz M. Price L.B. Accessory traits and phylogenetic background predict Escherichia coli extraintestinal virulence better than does ecological source J. Infect. Dis. 219 2019 121 132 10.1093/infdis/jiy459 30085181
27 Sora V.M. Meroni G. Martino P.A. Soggiu A. Bonizzi L. Zecconi A. Extraintestinal pathogenic Escherichia coli: virulence factors and antibiotic resistance Pathogens 10 2021 1355 10.3390/pathogens10111355 34832511
28 Sarowska J. Futoma-Koloch B. Jama-Kmiecik A. Frej-Madrzak M. Ksiazczyk M. Bugla-Ploskonska G. Choroszy-Krol I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: recent reports Gut Pathog. 11 2019 10 10.1186/s13099-019-0290-0 30828388
29 Kirtikliene T. Mierauskaitė A. Razmienė I. Kuisiene N. Genetic characterization of multidrug-resistant E. coli isolates from bloodstream infections in Lithuania Microorganisms 10 2022 449 10.3390/microorganisms10020449 35208903
30 El-Baz R. Said H.S. Abdelmegeed E.S. Barwa R. Characterization of virulence determinants and phylogenetic background of multiple and extensively drug resistant Escherichia coli isolated from different clinical sources in Egypt Appl. Microbiol. Biotechnol. 106 2022 1279 1298 10.1007/s00253-021-11740-x 35050388
31 Arredondo-Alonso S. Blundell-Hunter G. Fu Z. Gladstone R.A. Fillol-Salom A. Loraine J. Cloutman-Green E. Johnsen P.J. Samuelsen Ø. Pöntinen A.K. Cléon F. Chavez-Bueno S. De la Cruz M.A. Ares M.A. Vongsouvath M. Chmielarczyk A. Horner C. Klein N. McNally A. Reis J.N. Penadés J.R. Thomson N.R. Corander J. Taylor P.W. McCarthy A.J. Evolutionary and functional history of the Escherichia coli K1 capsule Nat. Commun. 14 2023 3294 10.1038/s41467-023-39052-w 37322051
32 D'Onofrio V. Cartuyvels R. Messiaen P.E.A. Barišić I. Gyssens I.C. Virulence factor genes in invasive Escherichia coli are associated with clinical outcomes and disease severity in patients with sepsis: a prospective observational cohort study Microorganisms 11 2023 1827 10.3390/microorganisms11071827 37512999
33 Nhu N.T.K. Phan M.-D. Hancock S.J. Peters K.M. Alvarez-Fraga L. Forde B.M. Andersen S.B. Miliya T. Harris P.N.A. Beatson S.A. Schlebusch S. Bergh H. Turner P. Brauner A. Westerlund-Wikström B. Irwin A.D. Schembri M.A. High-risk Escherichia coli clones that cause neonatal meningitis and association with recrudescent infection Elife 12 2024 RP91853 10.7554/eLife.91853 38622998
34 Shakir S.M. Goldbeck J.M. Robison D. Eckerd A.M. Chavez-Bueno S. Genotypic and phenotypic characterization of invasive neonatal Escherichia coli clinical isolates Am. J. Perinatol. 31 2014 975 982 10.1055/s-0034-1370341 24566757
35 Evolutionary and functional history of the Escherichia coli K1 capsule - PubMed, (n.d.). https://pubmed.ncbi.nlm.nih.gov/37322051/(accessed July 13, 2024).
36 Abreu A.G. Barbosa A.S. How Escherichia coli circumvent complement-mediated killing Front. Immunol. 8 2017 452 10.3389/fimmu.2017.00452 28473832
37 Birchenough G.M.H. Dalgakiran F. Witcomb L.A. Johansson M.E.V. McCarthy A.J. Hansson G.C. Taylor P.W. Postnatal development of the small intestinal mucosa drives age-dependent, regio-selective susceptibility to Escherichia coli K1 infection Sci. Rep. 7 2017 83 10.1038/s41598-017-00123-w 28250440
38 Zhao W.-D. Liu D.-X. Wei J.-Y. Miao Z.-W. Zhang K. Su Z.-K. Zhang X.-W. Li Q. Fang W.-G. Qin X.-X. Shang D.-S. Li B. Li Q.-C. Cao L. Kim K.S. Chen Y.-H. Caspr1 is a host receptor for meningitis-causing Escherichia coli Nat. Commun. 9 2018 2296 10.1038/s41467-018-04637-3 29895952
39 Minotti C. Di Caprio A. Facchini L. Bedetti L. Miselli F. Rossi C. Della Casa Muttini E. Lugli L. Luppi L. Ferrari F. Berardi A. Antimicrobial resistance pattern and empirical antibiotic treatments in neonatal sepsis: a retrospective, single-center, 12-year study Antibiotics (Basel) 12 2023 1488 10.3390/antibiotics12101488 37887188
40 Ma J. Tang B. Lin J. Ed-Dra A. Lin H. Wu J. Dong Y. Yang H. Yue M. Genome assessment of carbapenem- and colistin-resistant Escherichia coli from patients in a sentinel hospital in China Cells 11 2022 3480 10.3390/cells11213480 36359876
41 Dahbi G. Mora A. López C. Alonso M.P. Mamani R. Marzoa J. Coira A. García-Garrote F. Pita J.M. Velasco D. Herrera A. Viso S. Blanco J.E. Blanco M. Blanco J. Emergence of new variants of ST131 clonal group among extraintestinal pathogenic Escherichia coli producing extended-spectrum β-lactamases Int. J. Antimicrob. Agents 42 2013 347 351 10.1016/j.ijantimicag.2013.06.017 23992646
42 Whitfield C. Biosynthesis and assembly of capsular polysaccharides in Escherichia coli Annu. Rev. Biochem. 75 2006 39 68 10.1146/annurev.biochem.75.103004.142545 16756484
43 Majalekar P.P. Shirote P.J. Fluoroquinolones: blessings or curses Curr. Drug Targets 21 2020 1354 1370 10.2174/1389450121666200621193355 32564750
44 Da Silva G.J. Mendonça N. Association between antimicrobial resistance and virulence in Escherichia coli Virulence 3 2012 18 28 10.4161/viru.3.1.18382 22286707
45 Da Silva G.J. Mendonça N. Association between antimicrobial resistance and virulence in Escherichia coli Virulence 3 2012 18 28 10.4161/viru.3.1.18382 22286707
46 Vila J. Simon K. Ruiz J. Horcajada J.P. Velasco M. Barranco M. Moreno A. Mensa J. Are quinolone-resistant uropathogenic Escherichia coli less virulent? J. Infect. Dis. 186 2002 1039 1042 10.1086/342955 12232848
47 Liu B. Zhang X. Ding X. Wang Y. Zhu G. Regulatory mechanisms of sub-inhibitory levels antibiotics agent in bacterial virulence Appl. Microbiol. Biotechnol. 105 2021 3495 3505 10.1007/s00253-021-11291-1 33893838
