
==== Front
Animal Model Exp Med
Animal Model Exp Med
10.1002/(ISSN)2576-2095
AME2
Animal Models and Experimental Medicine
2096-5451
2576-2095
John Wiley and Sons Inc. Hoboken

38807299
10.1002/ame2.12418
AME212418
AMEM-2023-0105.R1
Original Article
Themed Section: Study on Cardiovascular and Cerebrovascular Diseases
Themed Section: Original Article
MiR‐106a targets ATG7 to inhibit autophagy and angiogenesis after myocardial infarction
Bai et al.
Bai Guofeng 1 2 3
Yang Jinghao https://orcid.org/0000-0002-4428-2172
1 2
Liao Weili 1 2
Zhou Xiaofeng 2
He Yingting 2
Li Nian 2
Zhang Liuhong 1 2
Wang Yifei 2
Dong Xiaoli 4
Zhang Hao 2
Pan Jinchun 1
Lai Liangxue 5
Yuan Xiaolong 1 2 5 yxl@scau.edu.cn

Wang Xilong 1 wangxilonggd@163.com

1 Guangdong Provincial Key Laboratory of Laboratory Animals Guangdong Laboratory Animals Monitoring Institute Guangzhou China
2 Guangdong Laboratory of Lingnan Modern Agriculture, National Engineering Research Center for Breeding Swine Industry, State Key Laboratory of Swine and Poultry Breeding Industry, Guangdong Provincial Key Laboratory of Agro‐Animal Genomics and Molecular Breeding College of Animal Science, South China Agricultural University Guangzhou Guangdong China
3 Huidong County Animal Quarantine and Inspection Institute Huizhou Guangdong China
4 Department of Cardiology Hainan General Hospital, Hainan Affiliated Hospital of Hainan Medical University, Hainan Clinical Medicine Research Institution Haikou People's Republic of China
5 Key Laboratory of Regenerative Biology Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences Guangzhou Guangdong China
* Correspondence
Xiaolong Yuan and Xilong Wang, Guangdong Provincial Key Laboratory of Laboratory Animals, Guangdong Laboratory Animals Monitoring Institute, Guangzhou, Guangdong 510663, China.
Email: yxl@scau.edu.cn and wangxilonggd@163.com

28 5 2024
8 2024
7 4 10.1002/ame2.v7.4 Themed Issue: Study on Cardiovascular and Cerebrovascular Diseases 408418
27 9 2023
25 3 2024
© 2024 The Authors. Animal Models and Experimental Medicine published by John Wiley & Sons Australia, Ltd on behalf of The Chinese Association for Laboratory Animal Sciences.
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.

Abstract

Background

Myocardial infarction (MI) is an acute condition in which the heart muscle dies due to the lack of blood supply. Previous research has suggested that autophagy and angiogenesis play vital roles in the prevention of heart failure after MI, and miR‐106a is considered to be an important regulatory factor in MI. But the specific mechanism remains unknown. In this study, using cultured venous endothelial cells and a rat model of MI, we aimed to identify the potential target genes of miR‐106a and discover the mechanisms of inhibiting autophagy and angiogenesis.

Methods

We first explored the biological functions of miR‐106a on autophagy and angiogenesis on endothelial cells. Then we identified ATG7, which was the downstream target gene of miR‐106a. The expression of miR‐106a and ATG7 was investigated in the rat model of MI.

Results

We found that miR‐106a inhibits the proliferation, cell cycle, autophagy and angiogenesis, but promoted the apoptosis of vein endothelial cells. Moreover, ATG7 was identified as the target of miR‐106a, and ATG7 rescued the inhibition of autophagy and angiogenesis by miR‐106a. The expression of miR‐106a in the rat model of MI was decreased but the expression of ATG7 was increased in the infarction areas.

Conclusion

Our results indicate that miR‐106a may inhibit autophagy and angiogenesis by targeting ATG7. This mechanism may be a potential therapeutic treatment for MI.

MiR‐106a inhibits autophagy and angiogenesis of vein endothelial cells by targeting the 3′‐UTR region of ATG7 after myocardial infarction.

angiogenesis
ATG7
autophagy
miR‐106a
miRNAs
myocardial infarction
National Natural Science Foundation of China 10.13039/501100001809 32070542 Guangdong Basic and Applied Basic Research Foundation 10.13039/501100021171 2021A1515010873 2022A1515011455 Breed Industry Innovation Park of Guangdong Xiaoerhua Pig2022‐4408X1‐43010402‐0019 Hainan Provincial Natural Science Foundation 10.13039/501100004761 818MS132 source-schema-version-number2.0
cover-dateAugust 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:03.09.2024
Bai G , Yang J , Liao W , et al. MiR‐106a targets ATG7 to inhibit autophagy and angiogenesis after myocardial infarction. Anim Models Exp Med. 2024;7 :408‐418. doi:10.1002/ame2.12418
==== Body
pmc1 INTRODUCTION

Myocardial Infarction (MI) is an ischemic heart disease caused by acute occlusion of the coronary artery, which causes irreversible myocardial damage to the heart muscles, and the regeneration of damaged cardio myocytes is a challenging task. 1 Angiogenesis is a process of growing new capillaries and restoring blood flowing to ischemic tissues that plays an essential role in various physiological and pathological processes, such as embryonic development, 2 wound healing, 3 and cancer cell proliferation. 4 After MI, the rapid formation of blood vessels in the infarcted areas and the improvement of blood supply are essential for the survival of the heart muscles and the prevention of heart failure. 5 Autophagy plays a crucial role in the self‐renewal of cells, and prevents the accumulation of damaged proteins and organelles. Recently studies have shown that the increased autophagy promotes the angiogenesis of human umbilical vein endothelial cells in vitro. 6 , 7 The activation of autophagy promotes the recovery of cardiac function in mice after myocardial infarction. 8 , 9

MicroRNAs (miRNAs) are small endogenous non‐coding RNA molecules that inhibit translation or promote RNA degradation at the transcription level as the unique factor in regulating gene expression. 10 Reports have shown that the regulation of autophagy‐related genes by miRNAs affects the secretion of proangiogenic factors and regulates angiogenesis in venous endothelial cells. 6 MiR‐106a is a member of the miR‐17 family, which plays an important regulatory role in the occurrence and development of various cancer diseases in human, 11 , 12 but there were fewer studies on cardiovascular diseases. A previous study has shown that the expression of miR‐106a decreases after the occurrence of cardiovascular disease in human based on sequencing, suggesting that miR‐106a may participate in the angiogenesis. 13 In addition, miR‐106a‐5p, miR‐424‐5p, miR‐7g‐5p, miR‐144‐3p, and miR‐660‐5p are predictors of diseases in acute myocardial infarction. 14

In this study, we aimed to identify the potential target genes of miR‐106a and discover the mechanisms of inhibiting autophagy and angiogenesis. We first explored the biological functions of miR‐106a on autophagy and angiogenesis on endothelial cells. Then we identified ATG7, which was the downstream target gene of miR‐106a. Furthermore, the expressions of miR‐106a and ATG7 were confirmed in the Rat model of MI. The results suggested that miR‐106a plays a vital role in regulating angiogenesis after MI by targeting binding to ATG7 and it may be a potential treatment for myocardial infarction.

2 METHODS

2.1 Cell culture and treatment

Venous endothelial cells were purchased from ScienCell (California), and cultured in endothelial cell medium (ECM), supplemented with 5% fetal bovine serum (FBS), 1% (100 μg/mL) penicillin–streptomycin (100 U/mL) and 1% endothelial cell growth factor (ECGS). The cells were cultured in a humidifying chamber containing 5% carbon dioxide at 37 °C, and fresh medium was added every 48 h.

miR‐106a mimic (5′‐AAAAGUGCUUACAGUGCAGGUAG‐3′), miR‐106a inhibitor (5′‐UAUGGCUUUUUAUUCCUAUGUGA‐3′), and si‐ATG7 (5′‐GCAGCAGCTGAACAACATG‐3′) were designed and purchased from Ribo Bio (Guangzhou, China). PcDNA3.1‐ATG7 (NM_001136031.3) was purchased from MiaoLing Bio (Wuhan, China). The miR‐106a inhibitor was a complementary small RNA to miR‐106a. miR‐106a mimic (50 nmol/L), MiR‐106a inhibitor (50 nmol/L), pcDNA3.1‐ATG7 (400 ng), or si‐ATG7 (50 nmol/L) was transfected into cells (1 × 104 cells) using Lipofectamine® 3000 (Invitrogen, USA), according to the manufacturer's instructions.

2.2 Cell viability assay

Cell viability was detected using the Cell Counting Kit‐8 (CCK8) (Takara, Japan). Briefly, CCK8 solution was added to the complete medium after transfection. The cells were cultured in a humid atmosphere with 5% CO2 at 37 °C for 2 h. Microplate Reader (Promega, USA) was used to measure the absorbance at 450 nm.

2.3 EdU staining

The BeyoClick™ EdU cell proliferation kit was used to detect the cell proliferation capacity of venous endothelial cells using Alexa Fluo 567 (RiBo bio, China). In simple terms, 10 μmol/L EdU reagent was added to each group of cells administered into a 48‐well plate. The cells were cultured for 2 h at 37 °C. Excess reagent was washed away with phosphate buffered saline (PBS) and 500 μL of 80% acetone was added to fix the cells, which were then incubated for 10 min with 0.5% Triton X‐100. Each well then received 500 μL of Apollo reaction solution, and the cells were incubated for 30 min at room temperature without light. Hoechst staining solution was then added to the cells, which were further incubated for another 30 min. Finally, the EdU‐cpositive stained cells were observed using a copolymer microscope (Leica, Germany) and counted using ImageJ (National Institutes of Health) software.

2.4 Flow cytometry

The Annexinv V‐fluorescein isothiocyanate (FITC)/propidium iodide (PI) kit (Solarbio, China) was used for apoptosis analysis. Briefly, cells were seeded into the 12‐well plate at 5 × 104 cells/well and transfected for 24 h. The cells were washed three times in pre‐cooled PBS (Solarbio, China) and resuspended in 200 μL buffer. Then the cells were incubated in 10 μL Annexin V‐FITC and 10 μL PI dye in the dark for 30 min at the room temperature. Flow cytometry analysis was completed within 1 h. The results are shown in four quadrants in the figures: the lower right quadrant is annexin‐positive/PI‐negative early apoptotic cells, the upper right quadrant is annexin‐positive/PI‐positive late apoptotic cells, the lower left quadrant is living cells, and the upper left quadrant is mechanically injured cells. FlowJo 10.4 software (TreeStar, Ashland) was used to analyze the data. In this study, the apoptotic ratio of vein endothelial cells is the sum of early and late apoptosis.

2.5 GFP‐mRFP‐LC3 analysis

Cells were seeded in a 12‐well plate at 5 × 104 cells/well. When the cell density reached 50%, 30 MOI of GFP‐mRFP‐LC3 (HanHengBio, China) was added to each well for infection. The culture medium was refreshed, and the cells were then transfected with the miR‐106a mimic or inhibitor for 24 h. The cells were then fixed in 4% formaldehyde for 10 min, washed with PBS, and a copolymer microscope was used for inspection at 100× magnification. The images were analyzed with the ImageJ software.

2.6 In vitro matrigel tube formation assay

Vein endothelial cells were grown and transfected with the miR‐106a mimic or inhibitor for 24 h. Venous endothelial cells (1 × 104 cells per well) were inoculated onto the matrix gel (Angke Bio, China) plate (containing 100 μL matrix gel) and cultured in 5% CO2 at 37 °C for 6 h. Under phase contrast microscopy, there were obvious capillary‐like structures, and the network formed by venous endothelial cells was quantified using ImageJ software.

2.7 Bioinformatic analysis

We used TargetScan (https://www.targetscan.org/vert_80/) to predict miR‐106‐a targets, and the DAVID website (http://david.abcc.ncifcrf.gov) for gene enrichment analysis.

2.8 Dual‐luciferase assay

The TargetScan website (http://www.targetscan.org/) predicted the potential binding relation of miR‐106a to ATG7 3′‐UTR. The sequences which predicted binding to the 3′‐UTR of ATG7 were synthetically produced by PCR and transferred into a luciferase reporter vector (Promega, USA). Vein endothelial cells were seeded in 96‐well plates. Then the cells were co‐transfected 100 ng of ATG7 3′‐UTR luciferase reporter plasmid and 50 nmol/L of either miR‐106b mimic oligonucleotide or a non‐targeting miRNA mimic control (Negative‐Control) for 24 h. We used the Dual Glo Luciferase Assay System (Promega, USA), according to the manufacturer's instructions, to measure the luciferase activity of each well.

2.9 Real‐time quantitative PCR

Using RNAiso Plus reagent (Takara), we extracted total RNA from the venous endothelial cells and heart. For mRNA analysis, the PrimeScript RT reagent kit (Takara, Japan) was used to reverse transcribe total RNA into complementary cDNA. Upstream and downstream primers of miRNA were designed by Ribo Bio (Guangzhou, China). We then used the miDETECT A TrackTM micrornas qRT – PCR Starter Kit (RiboBio, China) to track total microRNAs polyA and reverse transcription. For all real‐time fluorescent quantitative PCR we adapted the ABI system, using the SYBR Green real‐time detection method. The 2−△△CT method was used to calculate the relative expression levels of mRNA or microRNAs, and normalized to the GAPDH or U6 levels, respectively. The primer sequences used in this study are given in Table S1.

2.10 Western blot analysis

A RIPA lysis buffer (Thermo, USA) containing a protease inhibitor (Nacalai Tesque) was used to prepared protein samples from cells which has been transfected for 48 h. The Pierce™ BCA protein detection kit (Thermo, USA) was used to measure protein concentration. SDS‐PAGE gel electrophoresis was used to separate the total protein (20 μg). Protein bands were then transferred to polyvinylidene difluoride (PVDF) membranes (Merck Millipore, USA). The membranes were fixed with 5% skim milk for 2 h, followed by incubation with rabbit anti‐ATG7 (1:1000) (Abcam, UK), rabbit anti‐LC3 (1:1000) (Abcam, UK), and rabbit anti‐GAPDH (1:1000) (Abcam, UK) antibodies overnight at 4°C and the washed membranes were then incubated with goat anti‐rabbit IgG (1:10 000) (Abcam, UK) at 37 °C for 2 h. An enhanced chemiluminescence (ECL) substrate kit was used to observe the protein bands (Merck Millipore, USA). The Tanon 5200 Muti system (Shanghai, China) was then used to observe the blots and Image J software was used to analyze the blots. Samples prepared from three independent experiments were analyzed on the same membrane.

2.11 Establishment of MI animal model

Male SD rats (220 g) were purchased from the Guangdong Medical Laboratory Animal Center. The rats were injected with 1 mg/kg of 20% Sumiaxin. Thoracotomy was then performed to expose the left ventricle after anesthesia. Ligation on the left anterior descending branch between the outflow tract of the pulmonary artery and the left atrium was performed. Echocardiography was performed on anesthetized rats on the 21st day after MI, using the Vevo 2100 system (VisualSonics Inc., Canada) with an 80‐MHz probe.

2.12 Masson staining

The excised hearts of rats were fixed in 4% paraformaldehyde, embedded in paraffin and then cut into 4 μm sections. The dewaxed sections were incubated with Hematoxylin for 5 min and then incubated with Ponceau S for 5 min. Next, they were treated with phosphomolybdate aqueous solution for 5 min, and finally they were dyed with aniline blue for 5 min. The sections were dehydrated and sealed after addition of 1% acetic acid treatment for 1 min, and then examined under an optical microscope (Leica, Germany).

2.13 Hematoxylin and Eosin (H&E) staining

Paraformaldehyde (4%) was used to fix the rat hearts. The hearts were embedded in paraffin and cut into 4 μm sections. The sections were incubated together with Hematoxylin solution for 5 min and Eosin solution for 3 min, and then dehydrated and sealed. Finally, the sections were placed under a white light microscope to observe the staining.

2.14 Data analysis

PRISM software (GraphPad, USA) was used to perform the statistical analyses. At least three replicates were used for each set of experiments. Data were expressed as means ± SD, and a two‐tailed t test was used for statistical analysis. p < 0.05 (*), p < 0.01 (**), or p < 0.001 (***) were considered statistically significant.

3 RESULTS

3.1 MiR‐106a inhibited autophagy and angiogenesis in vein endothelial cells

The mature sequences of miR‐106a were compared and found to be highly homologous across species (Figure 1A). While miR‐106a has been shown to mediate autophagy in various cancer cells, 15 , 16 its role in vein endothelial cells remains unclear. To investigate the mechanism, mimics and inhibitors of miR‐106a were synthesized and their effects were detected by qRT‐PCR. These results suggested that the miR‐106a mimic significantly promoted the expression of miR‐106a, while the miR‐106a inhibitor significantly inhibited the expression of miR‐106a (Figure 1B). We used the monomeric red fluorescent protein (mRFP)–Green fluorescent protein (GFP)–microtubule‐associated protein 1 light chain 3 (LC3) to estimate the level of autophagy flux. The mRFP was used to label LC3, and the decreased fluorescence of GFP indicated the formation of autophagosomes. The yellow dots represented the autophagosome and the red dots represented the autophagolysosome. We found miR‐106a inhibited the formation of red dots and yellow dots. The result indicated that miR‐106a inhibited the activation of autophagy flux (Figure 1C). The results of Western Blot showed that miR‐106a mimic significantly reduced the protein level of LC3 in transfected cells (Figure 1D). MiR‐106a has been reported to be a member of the miR‐17 family, and identified as a key regulator of angiogenesis. 17 , 18 , 19 To detect the effect of miR‐106a on angiogenesis in vein endothelial cells, matrigel angiogenesis assay was used to investigate whether miR‐106a affected the ability of vein endothelial cells to form tubes. Compared with the control group, the formation of tubes was significantly increased after treating with miR‐106a, but the opposite was true after treating with miR‐106a inhibitor (Figure 1E). Compared with the control group, the mRNA expressions of matrix metalloproteinase 2 (MMP2) and vascular endothelial growth factor A (VEGFA) were significantly decreased after treating with miR‐106a mimic, and the opposite was true after treating with miR‐106a inhibitor (Figure 1F).

FIGURE 1 MiR‐106a inhibited autophagy and angiogenesis in vein endothelial cells. (A) The sequences of miR‐106a in different species. (B) The expression efficiency of miR‐106a mimic and inhibitor was detected by qRT‐PCR. (C) MiR‐106a inhibited the activation of autophagy flux detected by GFP‐mRFP‐LC3 analysis. (D) The protein level of LC3 in vein endothelial cells treated with miR‐106a mimic and inhibitor. (E) The ability of angiogenesis in vein endothelial cells treated with miR‐106a mimic and inhibitor. (F) The mRNA expressions of matrix metalloproteinases 2 (MMP2) and vascular endothelial growth factor A (VEGFA) in vein endothelial cells treated with miR‐106a mimic and inhibitor. (*p < 0.05, **p < 0.01, ***p < 0.001. Data are shown as mean ± SD. NC, negative control).

3.2 The regulation of cell functions by miR‐106a in vein endothelial cells

We investigated the effects of miR‐106a on the proliferation, activity, cell cycle and apoptosis in vein endothelial cells. Thel proliferation was detected by EdU assay. The proliferation level of vein endothelial cells transfected with miR‐106a was significantly enhanced compared with the control group, while transfected with miR‐106a inhibitor was the opposite (Figure 2A). CCK8 assay was used to detect the activity of vein endothelial cells at 12, 24, and 48 h after transfection. Similarly, compared with the control group, the activity of vein endothelial cells was obviously decreased at all three periods after treating with miR‐106a mimic, but increased after treating with miR‐106a inhibitor (Figure 2B). The course of the cell cycle greatly influences the rate of the cell proliferation. We used flow cytometry to detect the cell cycle. The result showed that the cell cycle was blocked in the S phase by miR‐106a (Figure 2C). Flow cytometry also showed that miR‐106a promoted the apoptosis of vein endothelial cells (Figure 2D).

FIGURE 2 The regulation of cell functions by miR‐106a in vein endothelial cells. (A) The proliferation of vein endothelial cells treated with miR‐106a mimic and inhibitor. (B) The cell activity of vein endothelial cells treated with miR‐106a mimic and inhibitor. (C) The regulation of the cell cycle in vein endothelial cells by miR‐106a mimic and inhibitor. (D) The apoptosis of vein endothelial cells treated with miR‐106a mimic and inhibitor. (*p < 0.05, **p < 0.01, ***p < 0.001. Data are shown as mean ± SD. NC, negative control).

3.3 The functional screening of target genes for miR‐106a‐mediated autophagy and angiogenesis

To explore the potential target genes for miR‐106a in vein endothelial cells, TargetScan was used for prediction, and GO analysis was used to analyze the enrichment pathways. The results indicated that miR‐106a targeted the autophagy signaling pathway (Figure 3B). The binding sites for miR‐106a to Recombinant Autophagy Related Protein 7 (ATG7) were found, and the binding sites of miR‐106a and ATG7 in different species were highly conserved among species (Figure 3A). ATG7 was this identified as the target gene. The wild‐type vector of the ATG7 3′‐UTR region and the luciferase reporter vector with miR‐106a complementary sites mutation were constructed, and co‐transfected into vein endothelial cells. It was found that the fluorescence intensity decreased in the WT‐ATG7 3′‐UTR + miR‐106a group, but there was no significant difference in the MUT‐ATG7 3′‐UTR + miR‐106a group (Figure 3D). The results of RT‐qPCR showed that the expression of ATG7 was significantly decreased by miR‐106a mimic and increased by miR‐106a inhibitor (Figure. 3C). miR‐106a mimic treatment significantly reduced the protein level of ATG7, and the opposite was achieved by treating with miR‐106a inhibitor (Figure 3E). These results indicated that ATG7 served as a downstream target gene of miR‐106a and was negatively regulated by miR‐106a through direct binding.

FIGURE 3 The functional screening of target genes of miR‐106a‐mediated autophagy and angiogenesis. (A) The sequences of miR‐106a and ATG7 3′‐UTR binding sites in different species. (B) GO analysis showed enrichment of the genes predicted by TargetScan to target miR‐106a. (C) Effect of miR‐106a on the mRNA expression of ATG7. (D) The binding activity of miR‐106a mimic to wild‐type ATG7 3′‐UTR region and mutant ATG7 3′‐UTR region. (E) Regulation of ATG7 protein level in vein endothelial cells by miR‐106a mimic and inhibitor. (*p < 0.05, **p < 0.01, ***p < 0.001. Data are shown as mean ± SD. NC, negative control).

3.4 ATG7 rescued the inhibitory by miR‐106a on proliferation, autophagy, and angiogenesis in vein endothelial cells

To explore the role of miR‐106a in regulating cellular function by targeting ATG7 in vein endothelial cells, the cells were respectively treated with mimic NC, miR‐106a mimic, miR‐106a mimic + pcDNA, miR‐106a mimic + pcDNA‐ATG7, inhibitor NC, miR‐106a inhibitor, miR‐106a inhibitor + si‐NC, and miR‐106a inhibitor + si‐ATG7. ATG7 was found to rescue the inhibition by miR‐106a of autophagy flux (Figure 4A), proliferation (Figure 4B), and angiogenesis (Figure 4C) in vein endothelial cells. Conversely, interference with ATG7 reversed the promotion by the miR‐106a inhibitor of cellular proliferation (Figure 4B), angiogenesis (Figure 4C), and autophagy flux (Figure 4A). These results indicated that miR‐106a inhibited the proliferation, angiogenesis, and autophagy in vein endothelial cells by targeting ATG7.

FIGURE 4 ATG7 rescued the inhibitory by miR‐106a on proliferation, autophagy, and angiogenesis in vein endothelial cells. (A) ATG7 rescued the inhibition by miR‐106a of autophagy flux. (B) ATG7 rescued the inhibition by miR‐106a of proliferation. (C) ATG7 rescued the inhibition by miR‐106a of angiogenesis. (*p < 0.05, **p < 0.01, ***p < 0.001. Data are shown as mean ± SD. NC, negative control).

3.5 The expression of miR‐106a was decreased and ATG7 was increased after MI

The downregulation of miR‐106a after MI suggested its possible involvement in the pathogenesis of the disease. To confirm the occurrence of MI, we established a rat MI model by ligating the left anterior descending coronary artery. Real‐time electrocardiograph monitoring and Doppler ultrasound showed that the ST‐segment continued to rise after MI (Figure 5A). Masson and HE staining showed that myocardial fibrosis had increased, and the myocardial injuries were aggravated (Figure 5A). The fraction shortening (FS, Figure 5B) of the heart and the ejection fraction (EF, Figure 5C) were significantly reduced after MI. The results proved that the rat myocardial infarction model was successfully constructed. The protein levels of ATG7 and cell adhesion molecule‐1 (CD31) in the heart after MI were detected by immunohistochemical methods, and the results showed that the protein levels of ATG7 and CD31 were increased in the heart after MI compared with the control group (Figure 5A). In addition, the expression of miR‐106a decreased (Figure 5D), while the mRNA expression of ATG7 (Figure 5E) and the number of new blood vessels (Figure 5F) increased after MI.

FIGURE 5 The expression of miR‐106a was decreased and ATG7 was increased after MI. (A) Electrocardiogram, ultrasonographic diagnosis map, cardiac histopathological staining (HE staining and Masson staining) and immunohistochemical staining (antigen‐labeled of ATG7 and CD31) of hearts were obtained in the MI group and control group. (B) The ejection fraction (EF, in %) in hearts. (C) The fraction shortening (FS, in %) in hearts. (D) The expression of miR‐106a in hearts of the MI group and control group. (E) The mRNA expression of ATG7 in the hearts of the MI group and control group. (F) The number of new blood vessels in the hearts of the MI group and control group. (*p < 0.05, **p < 0.01, ***p < 0.001. Data are shown as mean ± SD. NC, negative control).

4 DISCUSSION

MI is a severe ischemic heart disease characterized by myocardial necrosis resulting from myocardial ischemia. Data from the 2015–2018 National Health and Nutrition Examination Survey (NHANES) showed that the prevalence of MI in adults over the age of 20 in the United States was 3.1%, with the average 30‐day mortality rate of 13.6% after acute myocardial infarction. 20 , 21 The promotion of cardiac angiogenesis has been found to enhance cardiac function and facilitate recovery in MI patients. 22 , 23 , 24 , 25 Multiple studies have reported the involvement of miRNAs in the regulation of angiogenesis, which is crucial for improving cardiac function after MI. 26 , 27 , 28 As a member of the miR‐17 family, miR‐106a plays an important role in regulating angiogenesis. 17 , 18 , 19 In addition, it has been showed that miR‐106a inhibits angiogenesis by suppressing the expression of VEGFA in atherosclerosis 29 and renal cell carcinoma. 30 The down‐regulation of miR‐106a‐5p effectively reduces endothelial cell damage caused by oxidative stress‐mediated by targeting STAT3. 31

Autophagy is an essential mechanism for maintaining cellular homeostasis and plays different regulatory roles in multiple cardiovascular diseases. 32 , 33 , 34 , 35 , 36 Metformin protects endothelial cells by inhibiting autophagy under hyperglycemia, 37 but studies have shown that promoting autophagy promotes angiogenesis in vein endothelial cells. 38 , 39 , 40 miR‐149 treats ox‐LDL‐mediated vein endothelial cell injury by promoting autophagy. 38 Existing studies indicate that miRNAs regulate blood vessels through autophagy. 11 , 41 , 42 However, there is no report that miR‐106a regulates angiogenesis through autophagy. Autophagy flux is often used to evaluate the intensity of autophagy. 43 In this study, we explored the regulatory effects of miR‐106a on autophagy flux, angiogenesis and other cellular functions in vein endothelial cells. The results showed that miR‐106a inhibited proliferation (Figure 2), arrested cell cycle (Figure 2), inhibited cell angiogenesis (Figure 1) and autophagy flux (Figure 1) in vein endothelial cells, but promoted cell apoptosis (Figure 2), to supported the theory that miR‐106a plays a role in the regulation of angiogenesis. 44 , 45

We found that miR‐106a inhibited autophagy flux and the expression of autophagy‐marker protein LC3, consistent with results in colon cancer cells. 46 It has been suggested that miR‐106a may affect the cellular function of vein endothelial cells by regulating autophagy. Next, we conducted an online prediction of potential target genes of miR‐106a through the TargetScan website, and performed GO enrichment analysis on these genes (Figure 3). We found that miR‐106a could indeed exert its biological function by regulating the autophagy signaling pathway. Notably, the conservation of the binding site between miR‐106a and ATG7 across various species prompted the selection of ATG7 as a prospective target gene (Figure 3). ATG7 is an autophagy related gene that encodes the core of a classical protein essential for the degradation of autophagy, which activates ATG12 to promote the formation of the ATG5‐ATG12‐ATG16L1 complex. 47 , 48 ATG7 promotes the formation of LC3 by binding phosphatidyl hexylamine and LC3 1. It also promotes the combination of LC3II and the autophagic vesicle membranes. 47 , 49 MiR‐188‐3p inhibits autophagy and myocardial infarction by targeting ATG7. 7 Using the luciferase gene reporter vector, we further verified that miR‐106a bound to the 3′‐UTR region of ATG7 and inhibited the expression of ATG7 in vein endothelial cells (Figure 3), which is consistent with the results in cancer cells. 16 , 50 To further clarify the regulatory mechanism of miR‐106a and ATG7 in vein endothelial cells, we performed ATG7 rescue experiments. These results showed that ATG7 reversed the inhibitory effect of miR‐106a on autophagy and angiogenesis of vein endothelial cells, indicating that miR‐106a inhibited autophagy and angiogenesis by targeting ATG7 (Figure 4).

Rats are frequently utilized as disease models. 51 , 52 In this research, we constructed a rat model of MI by ligating the anterior descending branch of the left coronary artery. In 1999, the European Society of Cardiology and the American College of Cardiology collaborated to revise the definition of myocardial infarction, highlighting the significance of persistent ST‐segment elevation on the electrocardiograph as an indicator of ischemic changes in the heart. 53 The diagnosis of myocardial infarction can be confirmed through imaging and pathology, thus facilitating the identification of myocardial infarction. 53 We monitored the electrocardiograph before and after the operation of the rats, and the results showed that the ST segment was elevated, and the Doppler ultrasound diagnosis was in line with the diagnostic criteria for MI (Figure 5). In addition, HE, and Masson staining showed the myocardial necrosis lesions had intensified (Figure 5). These results confirmed the successful construction of our model. We found the expression of miR‐106a decreased after MI, but the mRNA expression of ATG7 increased in the rat hearts. We believe that miR‐106a inhibited the expression of ATG7 to regulate the autophagy and angiogenesis, and low expression of miR‐106a promoted the expression of ATG7 to promote autophagy and angiogenesis after myocardial infarction (MI). Previous studies have shown that miR‐221 inhibits autophagy, and the expression of miR‐221 was decreased, while the expression of ATG7 was increased in MI tissues. 54 The results are in line with our results. A limitation of our study is that the functions of miR‐106a and ATG7 should be futher explored in animal models, but low expression of miR‐106a was detected in the MI tissues, and high protein levels of ATG7 and CD31 were also detected in the MI tissues (Figure 5). These results might represent the close relationship among miR‐106a, ATG7, and CD31. Combined with our results on endothelial cells, these data indirectly indicate miR‐106a might inhibit autophagy and angiogenesis through lowering the level of the ATG7 expression in the endothelial cells.

In general, our results showed for the first time that miR‐106a inhibits angiogenesis by targeting ATG7 to inhibit autophagy in vein endothelial cells. LncRNA‐H19 spongy adsorbs miR‐106a to promote the expression of Angpt1 and VEGFA to promote angiogenesis, 55 which is consistent with our results. Interestingly, it has been reported that circFASTKD1 inhibits angiogenesis of vein endothelial cells through competitive adsorption of miR‐106a, which is in contrast to our results. 19 This may be because miR‐106a has more than one role in vein endothelial cells and may be related to the level of its exogenous expression in vein endothelial cells. Unfortunately, the concentration of miR‐106a used was not reported, and its specific concentration may be considered a potential area for future research. Similarly, miR‐106a‐5p mimic not only inhibits proliferation and promotes apoptosis but also promotes MMP secretion in vascular smooth muscle cells (VSMCs). 56 Our study provides additional insights into recovery from MI caused by down‐regulation of miR‐106a, and identifies ATG7 as potential therapeutic target. These results provides a theoretical foundation for the involvement of miR‐106a in the development of MI, as well as a potential diagnostic marker for early detection of MI, and a novel therapeutic target.

AUTHOR CONTRIBUTIONS

Guofeng Bai and Jinghao Yang wrote the first draft. Xiaolong Yuan and Xilong Wang designed the framework of the article. Weili Liao contributed to the organization of the table. All authors participated in the revision of the manuscript and accepted the submitted version.

FUNDING INFORMATION

This study was supported the National Natural Science Foundation of China (32070542), the Guangdong Basic and Applied Basic Research Foundation (2021A1515010873 and 2022A1515011455), Breed Industry Innovation Park of Guangdong Xiaoerhua Pig (2022‐4408X1‐43010402‐0019), and Hainan Provincial Natural Science Foundation (818MS132).

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no competing interests.

ETHICS STATEMENT

The study was conducted according to the guidelines of the Regulations for Administration of Affairs Concerning Experimental Animals, and approved by the Ethics Committee of Guangdong Laboratory Animals Monitoring Institute (IACUC2021151). Data is contained within the article or Supplementary Material.

Supporting information

Table S1.
==== Refs
REFERENCES

1 Gracia E , Hamid A , Butler J . Timely Management of new‐Onset Heart Failure. Circulation. 2019;140 :621‐623.31424994
2 Benson CE , Southgate L . The DOCK protein family in vascular development and disease. Angiogenesis. 2021;24 :417‐433.33548004
3 Guillamat‐Prats R . The role of MSC in wound healing, scarring and regeneration. Cells. 2021;10 :1729.34359898
4 Sajib S , Zahra FT , Lionakis MS , German NA , Mikelis CM . Mechanisms of angiogenesis in microbe‐regulated inflammatory and neoplastic conditions. Angiogenesis. 2018;21 :1‐14.29110215
5 Huang P , Wang L , Li Q , et al. Atorvastatin enhances the therapeutic efficacy of mesenchymal stem cells‐derived exosomes in acute myocardial infarction via up‐regulating long non‐coding RNA H19. Cardiovasc Res. 2020;116 :353‐367.31119268
6 Zou J , Fei Q , Xiao H , et al. VEGF‐A promotes angiogenesis after acute myocardial infarction through increasing ROS production and enhancing ER stress‐mediated autophagy. J Cell Physiol. 2019;234 :17690‐17703.30793306
7 Wang K , Liu CY , Zhou LY , et al. APF lncRNA regulates autophagy and myocardial infarction by targeting miR‐188‐3p. Nat Commun. 2015;6 :6779.25858075
8 Zhou M , Zou YG , Xue YZ , et al. Long non‐coding RNA H19 protects acute myocardial infarction through activating autophagy in mice. Eur Rev Med Pharmacol Sci. 2018;22 :5647‐5651.30229841
9 El Agaty AS , Nassef NA , Abou‐Bakr DA , Hanafy AA . Chronic activation of cardiac Atg‐5 and pancreatic Atg‐7 by intermittent fasting alleviates acute myocardial infarction in old rats. Egypt Heart J. 2022;74 :31.35416562
10 Krol J , Loedige I , Filipowicz W . The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet. 2010;11 :597‐610.20661255
11 Pan YJ , Zhuang Y , Zheng JN , Pei DS . MiR‐106a: promising biomarker for cancer. Bioorg Med Chem Lett. 2016;26 :5373‐5377.27780637
12 He L , Chu Y , Yang J , et al. Activation of autophagic flux maintains mitochondrial homeostasis during cardiac ischemia/reperfusion injury. Cells. 2022;11 :2111.35805195
13 Wicik Z , Czajka P , Eyileten C , et al. The role of miRNAs in regulation of platelet activity and related diseases – a bioinformatic analysis. Platelets. 2022;33 :1052‐1064.35285386
14 Bye A , Røsjø H , Nauman J , et al. Circulating microRNAs predict future fatal myocardial infarction in healthy individuals – the HUNT study. J Mol Cell Cardiol. 2016;97 :162‐168.27192016
15 Rothschild SI , Gautschi O , Batliner J , Gugger M , Fey MF , Tschan MP . MicroRNA‐106a targets autophagy and enhances sensitivity of lung cancer cells to Src inhibitors. Lung Cancer. 2017;107 :73‐83.27372519
16 Hao H , Xia G , Wang C , Zhong F , Liu L , Zhang D . miR‐106a suppresses tumor cells death in colorectal cancer through targeting ATG7. Med Mol Morphol. 2017;50 :76‐85.27981410
17 Gu H , Liu Z , Zhou L . Roles of miR‐17‐92 cluster in cardiovascular development and common diseases. Biomed Res Int. 2017;2017 :9102909.28164128
18 Zhou M , Cai J , Tang Y , Zhao Q . MiR‐17‐92 cluster is a novel regulatory gene of cardiac ischemic/reperfusion injury. Med Hypotheses. 2013;81 :108‐110.23639284
19 Gao WQ , Hu XM , Zhang Q , et al. Downregulation of circFASTKD1 ameliorates myocardial infarction by promoting angiogenesis. Aging (Albany NY). 2020;13 :3588‐3604.33411690
20 Virani SS , Alonso A , Aparicio HJ , et al. Heart disease and stroke Statistics‐2021 update: a report from the American Heart Association. Circulation. 2021;143 :e254‐e273.33501848
21 Zheng Y , Zhu K , Wang G . miR‐106a‐5p carried by tumor‐derived extracellular vesicles promotes the invasion and metastasis of ovarian cancer by targeting KLF6. Clin Exp Metastasis. 2022;39 :603‐621.35449340
22 Jin L , Pan Y , Li Q , Li J , Wang Z . Elabela gene therapy promotes angiogenesis after myocardial infarction. J Cell Mol Med. 2021;25 :8537‐8545.34291565
23 Wu X , Reboll MR , Korf‐Klingebiel M , Wollert KC . Angiogenesis after acute myocardial infarction. Cardiovasc Res. 2021;117 :1257‐1273.33063086
24 Badimon L , Borrell M . Microvasculature recovery by angiogenesis after myocardial infarction. Curr Pharm Des. 2018;24 :2967‐2973.29962335
25 Dudenbostel T . Correction to: heart disease and stroke Statistics‐2022 update: a report from the American Heart Association. Circulation. 2022;146 :e141.36067280
26 Gabisonia K , Prosdocimo G , Aquaro GD , et al. MicroRNA therapy stimulates uncontrolled cardiac repair after myocardial infarction in pigs. Nature. 2019;569 :418‐422.31068698
27 Xiao Y , Zhao J , Tuazon JP , Borlongan CV , Yu G . MicroRNA‐133a and myocardial infarction. Cell Transplant. 2019;28 :831‐838.30983393
28 Zhang D , Ning J , Ramprasath T , et al. Kynurenine promotes neonatal heart regeneration by stimulating cardiomyocyte proliferation and cardiac angiogenesis. Nat Commun. 2022;13 :6371.36289221
29 Cuevas A , Saavedra N , Cavalcante MF , Salazar LA , Abdalla DS . Identification of microRNAs involved in the modulation of pro‐angiogenic factors in atherosclerosis by a polyphenol‐rich extract from propolis. Arch Biochem Biophys. 2014;557 :28‐35.24792245
30 Ma J , Wang W , Azhati B , Wang Y , Tusong H . miR‐106a‐5p functions as a tumor suppressor by targeting VEGFA in renal cell carcinoma. Dis Markers. 2020;2020 :8837941.33224312
31 Hu Y , Xu R , He Y , et al. Downregulation of microRNA106a5p alleviates oxLDLmediated endothelial cell injury by targeting STAT3. Mol Med Rep. 2020;22 :783‐791.32626987
32 Du J , Li Y , Zhang C . Application of autophagy in cardiovascular diseases. Adv Exp Med Biol. 2020;1207 :265.32671754
33 Bravo‐San PJ , Kroemer G , Galluzzi L . Autophagy and mitophagy in cardiovascular disease. Circ Res. 2017;120 :1812‐1824.28546358
34 Gatica D , Chiong M , Lavandero S , Klionsky DJ . The role of autophagy in cardiovascular pathology. Cardiovasc Res. 2022;118 :934‐950.33956077
35 Zhang L , Zhang Y , Yu F , Li X , Gao H , Li P . The circRNA‐miRNA/RBP regulatory network in myocardial infarction. Front Pharmacol. 2022;13 :941123.35924059
36 Ajoolabady A , Chiong M , Lavandero S , Klionsky DJ , Ren J . Mitophagy in cardiovascular diseases: molecular mechanisms, pathogenesis, and treatment. Trends Mol Med. 2022;28 :836‐849.35879138
37 Niu C , Chen Z , Kim KT , et al. Metformin alleviates hyperglycemia‐induced endothelial impairment by downregulating autophagy via the Hedgehog pathway. Autophagy. 2019;15 :843‐870.30653446
38 Zhu Z , Li J , Tong R , Zhang X , Yu B . miR‐149 alleviates ox‐LDL‐induced endothelial cell injury by promoting autophagy through Akt/mTOR pathway. Cardiol Res Pract. 2021;2021 :9963258.34484820
39 Guo H , Ding H , Yan Y , et al. Intermittent hypoxia‐induced autophagy via AMPK/mTOR signaling pathway attenuates endothelial apoptosis and dysfunction in vitro. Sleep Breath. 2021;25 :1859‐1865.33483906
40 Zhao F , Satyanarayana G , Zhang Z , Zhao J , Ma XL , Wang Y . Endothelial autophagy in coronary microvascular dysfunction and cardiovascular disease. Cells. 2022;11 :2081.35805165
41 Zhou Y , Zhang Y , Li Y , et al. MicroRNA‐106a‐5p promotes the proliferation, autophagy and migration of lung adenocarcinoma cells by targeting LKB1/AMPK. Exp Ther Med. 2021;22 :1422.34707704
42 Tang J , Hu P , Zhou S , Zhou T , Li X , Zhang L . Lymphoma cell‐derived extracellular vesicles inhibit autophagy and apoptosis to promote lymphoma cell growth via the microRNA‐106a/Beclin1 axis. Cell Cycle. 2022;21 :1280‐1293.35285412
43 Li R , Lu Y , Zhang Q , et al. Piperine promotes autophagy flux by P2RX4 activation in SNCA/alpha‐synuclein‐induced Parkinson disease model. Autophagy. 2022;18 :559‐575.34092198
44 Zeng H , He D , Xie H , et al. H19 regulates angiogenic capacity of extravillous trophoblasts by H19/miR‐106a‐5p/VEGFA axis. Arch Gynecol Obstet. 2020;301 :671‐679.32107606
45 Behera J , Kumar A , Voor MJ , Tyagi N . Exosomal lncRNA‐H19 promotes osteogenesis and angiogenesis through mediating Angpt1/Tie2‐NO signaling in CBS‐heterozygous mice. Theranostics. 2021;11 :7715‐7734.34335960
46 Salgado‐Garcia R , Coronel‐Hernández J , Delgado‐Waldo I , et al. Negative regulation of ULK1 by microRNA‐106a in autophagy induced by a triple drug combination in colorectal cancer cells in vitro. Genes. 2021;12 :245.33572255
47 Collier JJ , Olahova M , McWilliams TG , Taylor RW . ATG7 safeguards human neural integrity. Autophagy. 2021;17 :2651‐2653.34313536
48 Mizushima N , Noda T , Yoshimori T , et al. A protein conjugation system essential for autophagy. Nature. 1998;395 :395‐398.9759731
49 Galluzzi L , Baehrecke EH , Ballabio A , et al. Molecular definitions of autophagy and related processes. EMBO J. 2017;36 :1811‐1836.28596378
50 Liu K , Hong D , Zhang F , et al. MicroRNA‐106a inhibits autophagy process and antimicrobial responses by targeting ULK1, ATG7, and ATG16L1 during mycobacterial infection. Front Immunol. 2020;11 :610021.33505399
51 Hundahl LA , Tfelt‐Hansen J , Jespersen T . Rat models of ventricular fibrillation following acute myocardial infarction. J Cardiovasc Pharmacol Ther. 2017;22 :514‐528.28381093
52 Ji Z , Wang C , Tong Q . Role of miRNA‐324‐5p‐modified adipose‐derived stem cells in post‐myocardial infarction repair. Int J Stem Cells. 2021;14 :298‐309.34158416
53 Alpert JS , Thygesen K , Antman E , Bassand JP . Myocardial infarction redefined–a consensus document of the Joint European Society of Cardiology/American College of Cardiology Committee for the redefinition of myocardial infarction. J Am Coll Cardiol. 2000;36 :959‐969.10987628
54 Li F , Long TY , Bi SS , Sheikh SA , Zhang CL . circPAN3 exerts a profibrotic role via sponging miR‐221 through FoxO3/ATG7‐activated autophagy in a rat model of myocardial infarction. Life Sci. 2020;257 :118015.32629000
55 Hao L , Wang J , Bi SJ , Cheng C . Upregulation of Long noncoding RNA FGD5‐AS1 ameliorates myocardial ischemia/reperfusion injury via MicroRNA‐106a‐5p and MicroRNA‐106b‐5p. J Cardiovasc Pharmacol. 2021;78 :e45‐e54.34173804
56 Han ZL , Wang HQ , Zhang TS , He YX , Zhou H . Up‐regulation of exosomal miR‐106a may play a significant role in abdominal aortic aneurysm by inducing vascular smooth muscle cell apoptosis and targeting TIMP‐2, an inhibitor of metallopeptidases that suppresses extracellular matrix degradation. Eur Rev Med Pharmacol. 2020;24 :8087.
