
==== Front
Animal Model Exp Med
Animal Model Exp Med
10.1002/(ISSN)2576-2095
AME2
Animal Models and Experimental Medicine
2096-5451
2576-2095
John Wiley and Sons Inc. Hoboken

38962826
10.1002/ame2.12461
AME212461
Short Communication
Regular Article
Short Communication
Elimination of GGTA1 , CMAH , β4GalNT2 and CIITA genes in pigs compromises human versus pig xenogeneic immune reactions
Xu et al.
Xu Jing 1 2 3
Ren Jilong 1 2 4
Xu Kai 1 2 4
Fang Minghui 5
Ka Meina 1 2 3
Xu Fei 5
Wang Xin 1 2 3
Wang Jing 1 2 3
Han Zhiqiang 1 2 3
Feng Guihai 1 2 4
Zhang Ying 1 2 4
Hai Tang 1 2 6 haitang@ioz.ac.cn

Li Wei 1 2 4 3 liwei@ioz.ac.cn

Hu Zheng 5 zhenghu@jlu.edu.cn

1 State Key Laboratory of Stem Cell and Reproductive Biology, Institute of Zoology Chinese Academy of Sciences Beijing China
2 Key Laboratory of Organ Regeneration and Reconstruction Chinese Academy of Sciences Beijing China
3 University of Chinese Academy of Sciences Beijing China
4 Beijing Institute for Stem Cell and Regenerative Medicine Beijing China
5 Key Laboratory of Organ Regeneration and Transplantation of the Ministry of Education, The First Hospital Jilin University Changchun China
6 Beijing Farm Animal Research Center, Institute of Zoology Chinese Academy of Sciences Beijing China
* Correspondence
Tang Hai, Beijing Farm Animal Research Center, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China.
Email: haitang@ioz.ac.cn
Wei Li, State Key Laboratory of Stem Cell and Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China.
Email: liwei@ioz.ac.cn
Zheng Hu, Key Laboratory of Organ Regeneration and Transplantation of the Ministry of Education, The First Hospital, Jilin University, Changchun 10061, China.
Email: zhenghu@jlu.edu.cn

04 7 2024
8 2024
7 4 10.1002/ame2.v7.4 Themed Issue: Study on Cardiovascular and Cerebrovascular Diseases 584590
09 5 2024
13 6 2024
© 2024 The Author(s). Animal Models and Experimental Medicine published by John Wiley & Sons Australia, Ltd on behalf of The Chinese Association for Laboratory Animal Sciences.
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.

Abstract

Background

Pig organ xenotransplantation is a potential solution for the severe organ shortage in clinic, while immunogenic genes need to be eliminated to improve the immune compatibility between humans and pigs. Current knockout strategies are mainly aimed at the genes causing hyperacute immune rejection (HAR) that occurs in the first few hours while adaptive immune reactions orchestrated by CD4 T cell thereafter also cause graft failure, in which process the MHC II molecule plays critical roles.

Methods

Thus, we generate a 4‐gene (GGTA1, CMAH, β4GalNT2, and CIITA) knockout pig by CRISPR/Cas9 and somatic cell nuclear transfer to compromise HAR and CD4 T cell reactions simultaneously.

Results

We successfully obtained 4KO piglets with deficiency in all alleles of genes, and at cellular and tissue levels. Additionally, the safety of our animals after gene editing was verified by using whole‐genome sequencing and karyotyping. Piglets have survived for more than one year in the barrier, and also survived for more than 3 months in the conventional environment, suggesting that the piglets without MHC II can be raised in the barrier and then gradually mated in the conventional environment.

Conclusions

4KO piglets have lower immunogenicity, are safe in genomic level, and are easier to breed than the model with both MHC I and II deletion.

The GGTA1, CMAH, β4GalNT2 and CIITA knockout Bama pigs were successfully generated using CRISPR/Cas9, and it was confirmed that the deletion of four genes occurred at the gene, cell and tissue levels. Knockout of CIITA induced significant changes in the immune system of piglets. The low immunogenicity of 4KO piglets was verified by mixed lymphocyte reaction, serum‐mediated antibody binding reaction and complement‐dependent cytotoxicity assay.

CD4 T cell
genetically edited pig
immune rejection
major histocompatibility complex II
xenotransplantation
National Key Research and Development Program 10.13039/501100012166 2019YFA0903800 2021YFA0805701 2021YFA0805905 2022YFA1103603 CAS Project for Young Scientists in Basic ResearchYSBR‐012 STI 2030‐Major Project2023ZD0407503 National Natural Science Foundation of China 10.13039/501100001809 32071456 82241224 Strategic Priority Research Program of the Chinese Academy of SciencesXDA16030000 source-schema-version-number2.0
cover-dateAugust 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:03.09.2024
Xu J , Ren J , Xu K , et al. Elimination of GGTA1 , CMAH , β4GalNT2 and CIITA genes in pigs compromises human versus pig xenogeneic immune reactions. Anim Models Exp Med. 2024;7 :584‐590. doi:10.1002/ame2.12461

Jing Xu, Jilong Ren, Kai Xu and Minghui Fang contributed equally.
==== Body
pmc1 INTRODUCTION

Organ transplantation is the only way to cure patients with end stage organ failure, but thousands of patients currently die because of severe organ shortages. Xenotransplantation, specifically the use of porcine organs for human transplantation, has been thought of as an alternative to resolve the organ shortage. In pig‐to‐human xenotransplantation, reducing the level of incompatible antigens between pigs and humans can decrease instances of rejection after transplantation. Hence, identifying and knocking out α‐1,3‐galactosidases (α‐Gal) to reduce hyperacute rejections was a pivotal breakthrough. 1 , 2 , 3 Subsequently, knockout of CMAH and β4GalNT2, the main carbohydrate antigen producers, was found to further reduce delayed xenograft rejections in the early stages of xenotransplantation. 4 , 5 , 6 To increase the survival of pig organs in recipients, many genes are overexpressed to decrease the complement cascade reaction, coagulation disorders, inflammations, cell‐mediated rejection (CMR), and antibody‐mediated rejection (AMR). 7 , 8 However, long‐term survival likely requires additional optimization of the AMR and CMR, which appears later in xenotransplantation.

Major histocompatibility complex (MHC) molecules play crucial roles in immunological rejection mediated by the adaptive immune system in allo/xeno‐transplantation, in which MHC I and II trigger CD8 and CD4 T cell‐mediated rejection, respectively. In a reported case of α‐Gal knockout/CD55 transgenic pig kidney transplantation into rhesus macaques, the effect of blocking CD4 and CD8 T cells on survival was compared. The results showed that the group with blocked CD8 T cells showed early cellular rejection, and the group with blocked CD4 T cells exhibited normal biopsies until late chronic antibody rejection. 9 , 10 The study suggests that CD4 T cells (MHC II‐induced) have a more prominent role than CD8 T cells (MHC I‐induced) in xenograft rejection. Additionally, in clinical cases, anti‐HLA DQ antibodies (MHC II derived antibodies) have been observed to cause of kidney graft failure, 11 suggesting that elimination of MHC II may benefit graft survival in later xenotransplantation stages. 12 Additionally, MHC I is expressed in all cell types, and deletion of pig MHC I increases the risk of infection and death in pigs bred in conventional facilities. 13 In contrast, it is unknown whether knockout of MHC II affects the survival of individual pigs.

In this study, we introduced a novel genetic manipulation involving the combined knockout of four genes: GGTA1, CMAH, β4GalNT2 and CIITA (referred to as the 4KO) in Bama pigs. We conducted verification of the four gene deletions at the protein and tissue levels. We verified the low immunogenicity of 4KO piglets by mixed lymphocyte reaction, serum‐mediated antibody binding reaction and complement‐dependent cytotoxicity assay. In summary, the 4KO Bama pig has a markedly reduced immunogenicity and could be a valuable organ donor for organ xenotransplantation.

2 METHODS

2.1 Vector construction

Single‐guide RNAs (sgRNAs) targeting gene sites on GGTA1 (5′‐GTCCCAGACAATGTGGTGAAGGG‐3′) and (5′TTGAGATCAAGTCCGAGAAGAGG); CMAH (5′‐TCTTGACAGAAGCTTCCAGGAGG‐3′), β4GalNT2 (5′‐GTCCCAGACA‐ATGTGGT‐GAAGGG‐3′), CIITA (5′‐TTTGGGAGGCTATGGACAGGGGG‐3′) and (5′‐GGGGAGGTCAGCTGCTGACGGGG‐3′) were designed (Table S1). The products of annealed sgRNA PCR were connected to the PUC19‐U6‐sgRNA vector by T4 ligase (M0202S, NEB, Rowley, MA, USA).

2.2 Cell culture and single cell clone production

Fibroblast cells from the porcine ear were cultured in Minimum Essential Medium α (12571–063, Gibco™, Carlsbad, CA, USA) with 1% GlutaMAX™ (35050–079, Gibco™), 100 UmL−1 penicillin–streptomycin (15 140 122, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 1% non‐essential amino acids solution (35050–079, Gibco™), and 2.5 ng/mL basic fibroblast growth factor (233‐FB, R&D Systems, Minneapolis, MN, USA). All cells were maintained at 37°C under 5% CO2. Cas9‐GFP and sgRNA plasmids were nucleofected by 4D lonza at 90% confluency; next, a single cell clone was sorted into a 96‐well plate by using a Moflo Astrios EQ cell sorter (572022–0810‐1, Beckman, Danvers, MA, USA).

2.3 Identification GGTA1 −/−, CMAH −/−, β4GalNT2 −/−, and CIITA −/− cell lines

A portion from each single cell clone was lysed using buffer L (PD101‐01, Vazyme, Nanjing, China) with protease K at 55°C overnight and heated at 95°C for 10 min. The cells were then extracted as the template for the PCR test. The PCR test sample contained 10 μL 2 × Phanta Max Master Mix (Dye Plus) DNA Polymerase (P525‐01, Vazyme), 1 μL template, 1 μL F/R (Table S2), made up to 20 μL with water. The reaction protocol was 95°C, 5 min; 95°C, 30 s; 60°C, 30 s and 72°C, 1 min, 35 cycles; and 72°C, 5 min. The PCR product was then detected by Sanger sequencing to sort the mutative cell line.

2.4 SCNT to generate cloned pigs

Genetically selected single cell clones were passaged and digested into single cells and used as nuclear donors for SCNT, which was performed as described previously. 14 After nuclear transfer, embryos were transferred into the oviducts of surrogates. Cloned piglets were delivered at day 114 of gestation by natural birth for pigs raised in conventional environment or by caesarean section for pigs raised under barrier conditions.

2.5 Flow cytometric analysis of antigens in PBMCs of piglets

The PBMCs of WT and 4KO pigs were ficolled from anticoagulant fresh blood. A total of 1 × 106 PBMCs were stained for 30 min at 4°C in PBS with 1% BSA using FITC conjugated Isolectin B4 for αGal (L2895, Sigma, St Louis, MO, USA, 1:400); chicken anti‐Neu5Gc antibody (146 901, Biolegend, London, UK, 1:400) and goat anti‐chicken IgY (H + L) antibody (A11039, Invitrogen, 1:400) to label Neu5Gc; Fluorescein Dolichos Biflorus Agglutinin (DBA) (FL‐1031, Vector Laboratories, Newark, CA, USA, 1:200) to label SDa; purified mouse anti‐pig SLA‐DR (553 642, BD Bioscience, La Jolla, CA, USA, 1:400) and FITC anti‐Mouse IgG2a antibody (553 390, BD Bioscience, 1:400) for labeling SLA‐DR. Antigens of αGal, Neu5Gc, SDa, SLA‐DR were detected after knocking out the genes of GGTA1, CMAH, β4GalNT2, CIITA.

2.6 Off‐target analysis in 4KO piglets using whole genome sequencing

The sequenced FASTQ files were mapped to the reference pig genome (susScr11) using bowtie2 (Ver. 0.12.9). Duplicated reads were removed using a homemade script. Each bam file was analyzed using GATK (Ver41.3.0) to identify SNV and indel events based on default parameters. We focused on small indels as potential off‐target mutations. The 20 bp sequence windows were set upstream and downstream of the PAM sequence of potential off‐target sites. Identified indels within the off‐target site windows were annotated based on susScr11.ncbiRefSeq.gtf, downloaded from UCSC.

2.7 HE staining

The tissue of 4KO piglets was gradually dehydrated using ethanol and xylene. Tissues were embedded with paraffin and cut into slices 5 μm thick. The slides were stained using HE after dewaxing and drying. Panorama scanning (WS‐10, Wisleap, Changzhou, China) was used to scan the slides.

2.8 Immunofluorescence

The tissues from 4KO and WT piglets were embedded with optimal cutting temperature compound (4583, SAKURA, Nagano, Japan). The block was then slowly put into liquid nitrogen until it froze, after which it was cut into slices 10 μm thick using a freezing microtome (14 047 742 456, Leica CM1950, Wetzlar, Germany). Each slide was stained with FITC conjugated Isolectin B4 (ALX‐650‐001F‐MC05, Enzo, Broomfield, CO, USA, 1:40) to label αGal, chicken anti‐Neu5Gc antibody (146 901, Biolegend, 1:400) and goat anti‐chicken IgY (H + L) antibody (A11039, Invitrogen, 1:400) to label Neu5Gc, and Fluorescein Dolichos Biflorus Agglutinin (DBA) (FL‐1031, Vector Laboratories, 1:200) to label SDa. Mouse anti‐swine MHC II monoclonal antibody (WS0589S‐100, Kingfisher Biotech, St Paul, MN, USA, 1:40) and goat anti‐mouse IgG (H + L) cross‐adsorbed antibody (A21235, Invitrogen, 1:100) to label SLA II at 4°C and Hoechst33342 for nuclear staining. Slides were imaged using a fluorescence microscope (572020–1842‐1, Zeiss LSM 880, Bonn, Germany).

2.9 Mixed lymphocyte reaction (MLR)

Two cell types were used in the MLR: stimulated (pig cells) and effector (human cells) cells. The human PBMCs were from volunteers. Stimulated pig cell samples were 2 × 105 WT or 4KO pig PBMCs treated with 50 μg/mL Mitomycin C (S8146, Selleck, Houston, TX, USA) for 20 min at 37°C to block their capacity for proliferation. Effector cell samples were 4 × 105 human PBMCs, labeled with 1 μmol/L CSFE (SCT110, Sigma). The two types of cells were mixed in an ultra‐low round bottom 96‐well plate (7007, Corning, Corning, NY, USA) and cultured in 100 μL DMEM (11965092, Gibco™) with 10% FBS for 5 days. The cells were then stained with anti‐human CD4 antibody (300 518, Biolegend) and anti‐human CD8 antibody (3344732, Biolegend), followed by gating CSFE in human CD4 positive cells. All data were recorded using a BD Fortessa flow cytometer (572020–1590, BD Bioscience) and analyzed using FlowJo.

2.10 Serum‐mediated antibody binding reaction

The human serum was from volunteers. The serum was diluted in 25%, 12.5%, and 6.25% using PBS with 1% BSA after being inactivated at 56°C for 30 min. Next, 1 × 105 WT and 4KO PBMCs were incubated using diluted serum at room temperature for 30 min. All samples were stained with PerCPCy‐5.5 conjugated goat anti‐human IgM (314 512, BioLegend, 1:50) and AF647 conjugated mouse anti‐human IgG antibody (A21445, Invitrogen, 1:100) at 4°C, 30 min. All samples were detected using a BD Fortessa flow cytometer (572020–1590, BD Bioscience) and analyzed using Flowjo.

2.11 Complement‐dependent cytotoxicity assay

Human serum was from volunteers. PBMCs from WT and 4KO were washed twice with PBS and resuspended, after which 1 × 105 cells were mixed with human serum (concentrations as 6.25%, 12.5%, and 25%). In every reaction, DMEM was added up to 100 μL after 45 min at 37°C and 5% CO2. Cells were stained with propidium iodide (P8080, SOLARBIO, Beijing, China) for 5 min and analyzed using a BD Fortessa flow cytometer (572020–1590, BD Bioscience).

2.12 Statistical analysis

Statistical analyses were performed using an unpaired two‐tailed t test in GraphPad Prism 6.0 (GraphPad Software). p < 0.05 was considered statistically significant.

3 RESULTS

3.1 Generation of GGTA1, CMAH, β4GalNT2, and CIITA knockout piglets

The process of generating the 4KO pigs included constructing the sgRNA plasmid, transfecting cells and using somatic cell nuclear transfer (SCNT) to obtain piglets (Figure 1A). First, different sgRNA fragments were constructed in PUC‐19 plasmids (Figure S1A), and sgRNAs with more than 80% knockout efficiency were selected by Sanger sequencing (Table S1). We confirmed the mutations of all 10 alleles of the 4 genes (Figure 1B). Fifteen 4KO single cell lines were identified, among them 4KO#24 and 4KO#32, which were used as donors for SCNT (Table S3). Elimination of GGTA1, CMAH, β4GalNT2, and CIITA was verified in the 4KO piglet genome (Figure S1B,C). αGal, Neu5Gc, SDa, and SLA class II molecules are important antigens causing xeno‐immune reactions between human and pig tissues, and knockout of GGTA1, CMAH, β4GalNT2, and CIITA impairs, respectively, the αGal, Neu5Gc, SDa, and SLA class II proteins. Therefore, we checked for deficiency of αGal, Neu5Gc, SDa, and SLA class II‐DR molecules in peripheral blood mononuclear cells (PBMCs) (Figure 1C) and kidney tissues (Figure 1D) from 4KO piglets. Immunofluorescence results from heart and lung also confirmed the deficiencies (Figure S2A). Next, we confirmed whether the deficiency in the four genes would bring off‐target in potential predicted sites. Wild‐type DNA from Bama pig, used as a WGS reference, was aligned to 4KO (Figure S3A). Mutation reads covered the introns, exons, untranslated regions, and intergenic regions. We found that all sites had 1–2 error mutation reads compared with correct reads, and these thimbleful mutation reads were attributed to sequencing errors (Table S4). Karyotyping and histopathology analysis of knockout piglets at the cell and tissue level were also performed to prove the viability of the model. WT and 4KO piglets were of normal [36 + XY] karyotype (Figure S3B). To investigate the impact of gene knockout on tissue organization in selected organs of the model pigs, we conducted Hematoxylin and Eosin (HE) staining on tissues from vital organs, namely heart, lung, kidney, and thymus. All examined tissues within the model pig exhibited normal morphology without detectable abnormalities (Figure 1E).

FIGURE 1 Construction and evaluation of 4KO piglets in xenotransplantation. (A) Schematic diagram of method for generating 4KO piglets. (B) Schematic of the 10 modified alleles. We generated the 4KO edits using CRISPR–Cas9 with gRNAs targeting the 2 copies of GGTA1, 2 copies of CMAH, 4 copies of β4GalNT2 and 2 copies of the CIITA. (C) Deficiency of GGTA1, CMAH, β4GalNT2, and CIITA can impair the antigens of αGal, Neu5Gc, SDa, and SLA class II molecules, respectively. Flow cytometry was used to verify the deficiency of αGal, Neu5Gc, SDa, and SLA class II‐DR molecules at the cellular level in 4KO piglets. PBMCs of 4KO pigs had negative population cells (WT = 3, 4KO = 3). (D) Immunofluorescence results showed that αGal, Neu5Gc, SDa, and SLA class II molecules were not expressed in kidney tissue of 4KO piglets, and GGTA1, CMAH, β4GalNT2, and CIITA are genes were used to knockout the antigen of αGal, Neu5Gc, SDa and SLA class II molecules, respectively. Scale bar: 20 μm. (E) Verification by HE staining of the viability of 4KO tissue after gene editing; Scale bar: 100 μm.

3.2 Deficiency of CIITA changes the differentiation of T cell

CIITA is a master transcription factor for MHC II. MHC acts as a medium for selecting CD4 and CD8 T cell development in the thymus. Thus, we verified the changes that occur in the immune system using flow cytometry. There was no significant difference in the percentage of CD3 T cells in 4KO (85.0%) and WT (70.8%) pigs (Figure 2A,C). The γδ T cell is MHC independent, and as expected, there was no significant difference between 4KO (32.4%) and WT (35.9%), in this population (Figure 2B,D). Notably, the population of 4KO CD4+ T cells (10.7%) was impaired compared with that of WT (35.5%), and the population of 4KO CD8+ T cells (35.6%) was higher than that of WT (12.5%) (Figure 2E,F). This result is similar to the trend in T cell changes in mouse models. The T cell counts confirm this (Figure S4). We also tested B and NK cells. The difference between 4KO (50.5%) and WT (61.9%) B cells was not significant (Figure 2G,H). The 4KO NK cell population (1.24%) significantly decreased relative to WT (6.66%) (Figure 2I,J).

FIGURE 2 Changes in the pig immune system induced by CIITA deficiency (WT = 3, 4KO = 3): (A) Percentage of the population of CD3 in WT and 4KO. (B) Percentage of the population of γδT in WT and 4KO. (C) 4KO CD3 T cells are not significantly different from WT. (D) 4KO γδT are not significantly different from WT. (E) Percentage of the population of CD4+ T and CD8+ T in WT and 4KO. (F) 4KO CD4+ T cells significantly decreased relative to WT; 4KO CD8+ T cells significantly increased relative to WT. (G) B cell population of WT and 4KO PBMCs.(n = 3). (H) No significant difference between WT and 4KO in the population of B cells. (I) Percentage of 4KO NK cell population significantly decreased relative to WT. (J) NK cell population of WT and 4KO PBMCs. **p < 0.01; *p < 0.05.

3.3 4KO piglets have lower xenogeneic immune reactions

MHC is the essential antigen that triggers T‐cell proliferation; thus, we tested the ability of WT and 4KO cells to reduce T‐cell proliferation using the mixed lymphocyte reaction (MLR). The proliferation of human CD4+ T cells stimulated by 4KO cells (27.6%) was significantly lower than that by WT cells (36.2%) (Figures 3A,B, S5). To determine if a deficiency in GGTA1, CMAH, and β4GalNT2 can reduce the response of natural antibodies, we performed a serum‐mediated antibody binding reaction in WT and 4KO cells. In the 6.25%, 12.5%, and 25% concentrations of human serum, the mean fluorescence intensity (MFI) of IgG binding to WT (circa 1500) was significantly higher than that of 4KO (circa 310). The MFI of IgM binding to WT (circa 3000) was significantly higher than that of 4KO (circa 390) (Figure 3C). Finally, we assessed the difference between WT and 4KO using an antibody‐mediated complement‐dependent cytotoxicity assay. In the 6.25%, 12.5%, and 25% concentrations of human serum, WT PBMCs incubated with human serum showed 90% cell lysis; in contrast, 4KO PBMCs showed 50% cell survival (Figure 3D).

FIGURE 3 (A) Verifying the function of CIITA deficiency, T cell proliferation was analyzed based on dilution of the proliferation dye CSFE with each cell division, Proliferation of human CD4+ T cells is depicted as percent of divided cell (WT = 3; 4KO = 3). (B) 4KO has lower immunogenicity to lead human CD4+ T proliferation than WT (WT = 3; 4KO = 3). (C) Verifying the Serum‐mediated antibody binding reaction of WT and 4KO, compared with WT, 4KO show significantly reduced binding to human IgG (a) and IgM (WT = 8; 4KO = 8). (D) Verifying the Human complement‐dependent cytotoxicity of WT and 4KO, 4KO show significantly lower antibody‐dependent complement cytotoxicity compared with WT (WT = 5; 4KO = 5). Unpaired two‐tailed t‐test; **p < 0.01; *p < 0.05).

4 DISCUSSION

The use of low‐immunogenicity animals in research is crucial for advancing medical knowledge and treatments. Pigs with low immunogenicity are valuable animal models for two main reasons: they can serve as donors for xenotransplantation or mechanism studies when mouse models are of limited value. Thus, we successfully generated GGTA1, CMAH, β4GalNT2, and CIITA knockout pigs using CRISPR/Cas9 and confirmed that the deficiencies in the four genes occurred at the genetic, cellular, and tissue levels, respectively. We also evaluated the viability of the piglets using off‐target examinations, karyotype analysis and histopathological observation. The results showed that the knockout of the four genes was not lethal. Our findings also indicated that knocking out of CIITA induced significant alterations in the immune system of the piglets. Notably, the proportion of CD4+ T cells decreased, and the proportion of CD8+ T cells increased. The phenotype of CIITA‐induced deletion of Class II molecules was consistent with the phenotype of similarly treated mice. 15 , 16 Finally, CIITA deficiency decreased the proliferation of human CD4+ T cells, and GGTA1, CMAH, and β4GalNT2 deficiencies decreased the natural antibody reactions. Thus, 4KO piglets may be an ideal knockout combination for xenotransplantation.

So far, the collective knockouts of GGTA1, CMAH, and β4GalNT2 have been widely used as an effective approach to overcome HAR. However, MHCs are also a xenoantigen, leading to AMR and CMR at the end of xenotransplantation. Studies have reported knocking out β2M and CIITA to damage MHC I and MHC II. 17 , 18 , 19 , 20 The limitation of the aforementioned research is that a deficiency of Class I molecules results in unknown risks and increases the difficulty of breeding. Additionally, the combination of GGTA1, CMAH, and β4GalNT2 produced the lowest carbohydrate antibody‐mediated immune response for humans. Therefore, we aimed to use a new combination to overcome this limitation. Thus, we focused on donor viability after gene editing. Notably, 4KO piglets can survive more than 1 year under barrier conditions and more than 3 months at conventional facilities. Thus, 4KO piglets who survive under barrier conditions can return to the farm to mate gradually.

However, in the context of actual clinical xenotransplantation, overexpression of genes, such as hCD46, hCD55, hEPCR, and hTBM, which are part of the complement and coagulation cascade signaling pathways, and others, are indispensable. Regarding the quest for an optimal combination of knockouts, we propose that 4KO is a highly suitable option.

5 CONCLUSIONS

Here we provide a combination of basic knockouts to mitigate immune rejection in xenotransplantation. 4KO pig model can be used as a basis for further modifications in xenotransplantation.

AUTHOR CONTRIBUTIONS

Zheng Hu, Wei Li and Tang Hai designed the experiment. Jing Xu, Kai Xu, Jilong Ren, Minghui Fang, Meina Ka, Fei Xu, Xin Wang, Jing Wang and Zhiqiang Han performed the experiment. Jing Xu and Xin Wang carried out data analysis. Ying Zhang, Guihai Feng, Tang Hai, Jilong Ren and Jing Xu prepared the manuscript. All authors have read and approved the final manuscript.

FUNDING INFORMATION

This study was supported by grants from the National Key Research and Development Program (2019YFA0903800, 2021YFA0805701, 2021YFA0805905, 2022YFA1103603), the CAS Project for Young Scientists in Basic Research (YSBR‐012 to W.L.), STI 2030‐Major Project (2023ZD0407503), the National Natural Science Foundation of China (32071456, 82241224) and the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA16030000).

CONFLICT OF INTEREST STATEMENT

The authors declare that there are no conflicts of interest.

ETHICS STATEMENT

All animal experiments were conducted in compliance with the guidelines set by the Institutional Animal Care and Use Committee of Institute of Zoology Chinese Academy of Sciences (ID: IOZ‐IACUC‐2021‐134).

Supporting information

Data S1

Table S4

ACKNOWLEDGMENTS

We thank the Q.Z. and W.L. laboratory members for helpful discussions and comments on the manuscript. We thank Qing Meng from the Institute of Zoology of the Chinese Academy of Sciences for their help with cell sorting. We thank Yanan Xu from the Institute of Zoology of the Chinese Academy of Sciences for discussions in the area of Immunology. We also thank the staff of the Beijing Farm Animal Research Center of the Institute of Zoology of Chinese Academy of Sciences for their assistance in animal experiments.
==== Refs
REFERENCES

1 Cooper DK , Good AH , Koren E , et al. Identification of alpha‐galactosyl and other carbohydrate epitopes that are bound by human anti‐pig antibodies: relevance to discordant xenografting in man. Transpl Immunol. 1993;1 (3 ):198‐205.7521740
2 Lai L , Kolber‐Simonds D , Park K‐W , et al. Production of α‐1,3‐galactosyltransferase knockout pigs by nuclear transfer cloning. Science. 2002;295 (5557 ):1089‐1092.11778012
3 Phelps CJ , Koike C , Vaught TD , et al. Production of α1,3‐galactosyltransferase‐deficient pigs. Science. 2003;299 (5605 ):411‐414.12493821
4 Estrada JL , Martens G , Li P , et al. Evaluation of human and non‐human primate antibody binding to pig cells lacking GGTA1/CMAH/β4GalNT2 genes. Xenotransplantation. 2015;22 (3 ):194‐202.25728481
5 Yoon S , Lee S , Park C , et al. An efficacious transgenic strategy for triple knockout of Xeno‐reactive antigen genes GGTA1, CMAH, and B4GALNT2 from Jeju native pigs. Vaccines (Basel). 2022;10 (9 ):1503.
6 Chen G , Qian H , Starzl T , et al. Acute rejection is associated with antibodies to non‐gal antigens in baboons using gal‐knockout pig kidneys. Nat Med. 2005;11 (12 ):1295‐1298.16311604
7 Lu T , Yang B , Wang R , Qin C . Xenotransplantation: current status in preclinical research. Front Immunol. 2020;10 :3060.32038617
8 Sykes M , Sachs DH . Progress in xenotransplantation: overcoming immune barriers. Nat Rev Nephrol. 2022;18 (12 ):745‐761.36198911
9 Kim SC , Mathews DV , Breeden CP , et al. Long‐term survival of pig‐to‐rhesus macaque renal xenografts is dependent on CD4 T cell depletion. Am J Transplant. 2019;19 (8 ):2174‐2185.30821922
10 Hara H , Witt W , Crossley T , et al. Human dominant‐negative class II transactivator transgenic pigs – effect on the human anti‐pig T‐cell immune response and immune status. Immunology. 2013;140 (1 ):39‐46.23566228
11 Issa N , Cosio FG , Gloor JM , et al. Transplant glomerulopathy: risk and prognosis related to anti‐human leukocyte antigen class II antibody levels. Transplantation. 2008;86 (5 ):681‐685.18791449
12 Hammer SE , Ho CS , Ando A , et al. Importance of the major histocompatibility complex (swine leukocyte antigen) in swine health and biomedical research. Annu Rev Anim Biosci. 2020;8 :171‐198.31846353
13 Sake HJ , Frenzel A , Lucas‐Hahn A , et al. Possible detrimental effects of beta‐2‐microglobulin knockout in pigs. Xenotransplantation. 2019;26 (6 ):e12525.31119817
14 Ren J , Yu D , Wang J , et al. Generation of immunodeficient pig with hereditary tyrosinemia type 1 and their preliminary application for humanized liver. Cell Biosci. 2022;12 (1 ):26.35255981
15 Chang CH , Guerder S , Hong SC , van Ewijk W , Flavell RA . Mice lacking the MHC class II transactivator (CIITA) show tissue‐specific impairment of MHC class II expression. Immunity. 1996;4 (2 ):167‐178.8624807
16 Williams GS , Malin M , Vremec D , et al. Mice lacking the transcription factor CIITA—a second look. Int Immunol. 1998;10 (12 ):1957‐1967.9885917
17 Martens GR , Reyes LM , Butler JR , et al. Humoral reactivity of renal transplant‐waitlisted patients to cells from GGTA1/CMAH/B4GalNT2, and SLA class I knockout pigs. Transplantation. 2017;101 (4 ):e86‐e92.28114170
18 Ladowski JM , Reyes LM , Martens GR , et al. Swine Leukocyte Antigen Class II Is a Xenoantigen. Transplantation. 2018;102 (2 ):249‐254.28846555
19 Fu R , Fang M , Xu K , et al. Generation of GGTA1−/−β2M−/‐CIITA−/− pigs using CRISPR/Cas9 technology to alleviate xenogeneic immune reactions. Transplantation. 2020;104 (8 ):1566‐1573.32732833
20 Xu K , Yu H , Chen S , et al. Production of triple‐gene (GGTA1, B2M and CIITA)‐modified donor pigs for xenotransplantation. Front Vet Sci. 2022;9 :848833.35573408
