
==== Front
J Cardiothorac Surg
J Cardiothorac Surg
Journal of Cardiothoracic Surgery
1749-8090
BioMed Central London

2995
10.1186/s13019-024-02995-2
Research
Mechanism of KLF2 in young mice with pneumonia induced by Streptococcus pneumoniae
Li Xiaoshuang lixiaoshuang_12@163.com

Xu Weihua
Jing Tao
https://ror.org/04je70584 grid.489986.2 0000 0004 6473 1769 Department of Emergency, Anhui Provincial Children’s Hospital, No. 39 Wangjiang East Road, Hefei, Anhui Province 230022 China
2 9 2024
2 9 2024
2024
19 50911 3 2024
13 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Streptococcus pneumoniae (Spn) is a major causative agent of pneumonia, which can disseminate to the bloodstream and brain. Pneumonia remains a leading cause of death among children aged 1–59 months worldwide. This study aims to investigate the role of Kruppel-like factor 2 (KLF2) in lung injury caused by Spn in young mice.

Methods

Young mice were infected with Spn to induce pneumonia, and the bacterial load in the bronchoalveolar lavage fluid was quantified. KLF2 expression in lung tissues was analyzed using real-time quantitative polymerase chain reaction and Western blotting assays. Following KLF2 overexpression, lung tissues were assessed for lung wet-to-dry weight ratio and Myeloperoxidase activity. The effects of KLF2 on lung injury and inflammation were evaluated through hematoxylin and eosin staining and enzyme-linked immunosorbent assay. Chromatin immunoprecipitation and dual-luciferase assay were conducted to examine the binding of KLF2 to the promoter of microRNA (miR)-222-3p and cyclin-dependent kinase inhibitor 1B (CDKN1B), as well as the binding of miR-222-3p to CDKN1B. Levels of miR-222-3p and CDKN1B in lung tissues were also determined.

Results

In young mice with pneumonia, KLF2 and CDKN1B were downregulated, while miR-222-3p was upregulated in lung tissues. Overexpression of KLF2 reduced lung injury and inflammation, evidenced by decreased bacterial load, reduced lung injury, and lower levels of proinflammatory factors. Co-transfection of miR-222-3p-WT and oe-KLF2 significantly reduced luciferase activity, suggesting that KLF2 binds to the promoter of miR-222-3p and suppresses its expression. Transfection of CDKN1B-WT with miR-222-3p mimics significantly reduced luciferase activity, indicating that miR-222-3p binds to CDKN1B and downregulates its expression. Overexpression of miR-222-3p or downregulation of CDKN1B increased bacterial load in BALF, lung wet/dry weight ratio, MPO activity, and inflammation, thereby reversing the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia.

Conclusions

KLF2 alleviates lung injury in young mice with Spn-induced pneumonia by transcriptional regulation of the miR-222-3p/CDKN1B axis.

Keywords

Pneumonia
Streptococcus pneumoniae
Lung injury
KLF2
miR-222-3p
Key Research and Development Program Projects in Anhui Province1804h08020285 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Pneumonia, an acute respiratory infection primarily affecting the alveoli and distal bronchioles, represents a significant global health challenge, particularly among children under the age of 5 [1]. Both viral and bacterial infections are common etiological agents of pediatric pneumonia, including those Haemophilus influenzae, Streptococcus pyogenes, Mycoplasma pneumoniae, and Streptococcus pneumoniae (Spn) [2]. Among them, Spn is the most prevalent bacterial cause, leading to symptoms such as fever, rapid breathing, coughing, and difficulty in breathing [3]. Spn, a gram-positive bacterium with 92 identified serotypes, can asymptomatically colonize the nasopharynx and is a major cause of severe morbidity and mortality in infants, the elderly, and immunocompromised individuals [4]. Current treatments for Spn-induced pneumonia typically involve antibiotics like ampicillin, aqueous penicillin G, or amoxicillin as first-line options. However, high-dosage antibiotic therapy can disrupt the patient’s microbiome and promote drug resistance [5]. Therefore, there is a pressing need for more effective treatment options.

The Kruppel-like factor (KLF) family, a group of transcription factors characterized by zinc finger proteins, plays a crucial role in the regulation of transcription by binding to DNA, RNA, and proteins [6]. KLF2, in particular, is dysregulated in various lung injury models. Notably, decreased KLF2 expression is associated with acute respiratory distress syndrome, leading to the dysregulation of pulmonary microvascular homeostasis [7]. In mouse models of acute lung injury, reduced KLF2 levels are implicated in the polarization of M1/M2 macrophages [8]. Enhancing KLF2 expression has been shown to promote alveolar development and mitigate bronchopulmonary dysplasia following hyperoxic lung injury [9]. However, the role of KLF2 in lung injury caused by Spn-induced pneumonia in young mice remains unclear.

MicroRNAs (miRNAs/miRs) are small non-coding RNAs that regulate complex genetic networks and cellular signaling cascades through the control of their promoters [10]. miRNAs are closely associated with the occurrence, progression, and outcome of bacterial pneumonia, participating in the antibacterial process through intricate interactions between host cells and bacterial pathogens [11]. For instance, miR-222-3p is upregulated in mycoplasma pneumoniae-induced pneumonia, enhancing the production of pro-inflammatory factors [12]. Notably, elevated levels of miR-222-3p have been observed in children with Mycoplasma pneumoniae-induced pneumonia [13]. In this study, we aim to explore the underlying mechanisms of miR-222-3p in Spn-induced pediatric pneumonia.

Cyclin-dependent kinase inhibitor 1B (CDKN1B, alias p27) is a transcriptional regulator that binds to specific chromatin domains and is involved in various cellular processes, including the cell division cycle, RNA processing, translation [14]. CDKN1B is a common target of miRNAs and plays a role in the development of severe pneumonia, such as that induced by COVID-19 [15]. In lipopolysaccharide (LPS)-induced lung inflammation, CDKN1B expression is decreased, which can lead to macrophage proliferation [16]. Interestingly, significant downregulation of CDKN1B has been observed following the introduction of miR-222 mimics in mouse alveolar epithelial cells stimulated by LPS [17]. However, the expression and role of CDKN1B in Spn-induced pneumonia remain unexplored.

In this study, we aim to investigate the effect of KLF2 on lung injury in young mice with Spn-induced pneumonia and elucidate the specific downstream mechanisms of KLF2, with the goal of identifying new targets for the treatment of pediatric pneumonia.

Methods

Ethics statement

All animal experimental protocols were approved by the Ethics Committee of Anhui Provincial Children’s Hospital (Approval number: EYLL-2018-010). All methods complied with the Guidelines for the Care and Use of Laboratory Animals.

Preparation of Spn

Spn (ATCC49619, Type Culture Collection, Rockville, MD, USA) was inoculated onto THY sheep blood agar (Shanghai Aiyan Biological Technology Co., Ltd., China) and incubated at 37°C with 5% CO2 for 18 h. The bacteria were then collected by centrifugation and resuspended in sterile phosphate-buffered saline (PBS, 0.15 M, pH 7.2) to a concentration of 109 colony-forming units (CFU)/mL.

Establishment of animal models

Male BALB/c mice (3 weeks old, weighing 12–15 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Shanghai branch) (License number: SYXK (Hu) 2022-0018). The mice were housed in a ventilated room at 20–25°C with a 12-hour light/dark cycle and had ad libitum access to water and food.

Based on a previous study [18], a mouse model of Spn-induced pneumonia was established. The young mice were anesthetized with 50 mg/kg pentobarbital sodium (Sigma-Aldrich, St. Louis, MO, USA) by intraperitoneal injection. The model group was established by inoculating 100 µL of PBS containing 1 × 108 CFU of Spn through both nostrils using a 29-gauge needle. The mice in the sham group were given an injection of sterile PBS as a control.

Lentiviral injection

Lentivirus containing KLF2 overexpression vector (KLF2), miR-222-3p agomir (ago-222), CDKN1B shRNA (sh-CDKN1B), and their respective negative controls (NC, ago-NC, and sh-NC) were provided by Shanghai Gemma Pharmaceutical Technology Co., Ltd. The lentivirus was intravenously injected (viral titer of 1 × 109 TU/mL, volume of 3 µL dissolved in 100 µL of PBS) into mice two days before model induction [19].

Animal grouping and allocation

A total of 144 young mice were randomized into the following groups (N = 18): sham group, model group, model + NC group, model + KLF2 group, model + KLF2 + ago-NC group, model + KLF2 + ago-222 group, model + KLF2 + sh-NC group, and model + KLF2 + sh-CDKN1B group. The mice were observed daily to assess their mental status, food intake, body weight changes, fur luster, and activity level. Following a 14-day treatment period, the mice were humanely euthanized via intraperitoneal injection of 100 mg/kg of pentobarbital sodium. Each group of mice was further divided for different analyses: wet-to-dry weight analysis (N = 6), collection of bronchoalveolar lavage fluid (BALF) (N = 6), and hematoxylin and eosin (H&E) staining and tissue homogenate analysis (N = 6).

Lung wet-to-dry weight ratio

Fresh lung tissues were collected and weighed using an electronic balance to obtain the wet weight. The lung tissues were then placed in an oven at 70°C and dried until weight was constant (dry weight). The wet-to-dry weight ratio was calculated as follows: wet-to-dry weight ratio = wet weight/dry weight.

Bacterial load in BALF

After the young mice were anesthetized with pentobarbital sodium via intraperitoneal injection, BALF was collected from mice in each group. The BALF was centrifuged at 260 g, 4°C for 10 min, and the precipitate was resuspended in 0.5 mL of sterile PBS. The suspension was serially diluted 10-fold, and the final dilution (50 mL) was spread onto sheep blood agar and incubated at 37°C, 5% CO2. After 18 h, the colony-forming units were counted.

H&E staining

Lung tissues from each group of young mice were fixed in 4% paraformaldehyde for 24 h, washed, dehydrated in gradient ethanol, and embedded in paraffin. The samples were then cut into 4 μm sections, dried, and deparaffinized. The sections were stained with hematoxylin (Solarbio, Beijing, China) for 5 min, followed by a 3-second rinse with running water. They were then differentiated in 1% hydrochloric acid ethanol for 3 s, stained with 5% eosin staining solution (Solarbio) for 3 min, dehydrated, cleared, and sealed. The morphology of the lung tissues was observed under an optical microscope (Olympus, Japan) [19].

Myeloperoxidase (MPO) activity

Lung tissues from young mice were homogenized in Hank’s buffered salt solution, and the supernatant was collected after centrifugation at 10,000 g for 20 min at 4°C. MPO activity in the lung homogenate was determined using the MPO Activity Assay Kit (Colorimetric; ab105136, Abcam, Cambridge, MA, USA) according to the manufacturer’s instructions.

Enzyme-linked immunosorbent assay (ELISA)

The levels of interleukin (IL)-10 (ab255729, Abcam), IL-6 (ab222503, Abcam), and IL-1β (ab197742, Abcam) in the lung tissue supernatant were measured using ELISA kits according to the manufacturer’s instructions. The absorbance was measured using a microplate reader (Bio-Rad, Hercules, CA, USA).

Chromatin immunoprecipitation (ChIP)

ChIP was performed using the ChIP Assay Kit (WanleiBio, Shenyang, China) according to the manufacturer’s protocol. Briefly, tissues were cross-linked with 1% formaldehyde for 15–20 minutes, followed by the addition of glycine to terminate cross-linking. After centrifugation at 4°C and 3000 g for 5 minutes, the supernatant was removed. The cross-linked tissues were homogenized 10–20 times using a homogenization buffer, and the supernatant was removed after centrifugation. The tissue particles were resuspended in lysis buffer containing protease inhibitors, and the chromatin was cleaved by sonication and centrifuged at 4°C. The cross-linked DNA was incubated overnight with KLF2 antibody (23384-1-AP, Proteintech Group, Inc) or immunoglobulin G antibody (ab205718, Abcam), and immunoprecipitation complexes were collected with protein A beads. After decross-linking, DNA was purified using a gel DNA purification kit (WanleiBio) and subjected to the polymerase chain reaction (PCR). The miR-222-3p promoter primers used in PCR were as follows: forward 5’-TCACCATCGTTGCACACTGC-3’ and reverse 5’-GAAATTAATTGCCCTAAATCC-3’.

Dual-luciferase assay

The downstream target genes of miR-222-3p were predicted using the Targetscan database (http://www.targetscan.org/vert_71/) [20], Starbase database (http://starbase.sysu.edu.cn/index.php) [21], miRDB database (https://mirdb.org/index.html) [22], and miRTarBase database (https://mirtarbase.cuhk.edu.cn/~miRTarBase/miRTarBase_2019/php/index.php) [23]. The intersection of the predicted genes was obtained. The binding sites identified from the Targetscan database were used to clone the wild-type (WT) and mutant (MUT) sequences of CDKN1B, which were then inserted into the pGL3-Basic vector (Promega, Madison, WI, USA). The binding sites between KLF2 and the miR-222-3p promoter were predicted using the JASPAR database (https://jaspar.elixir.no/) [24], and the WT and MUT promoter regions of miR-222-3p were cloned into the pGL3-Basic vector. 293T cells were cultured to approximately 70% confluence and co-transfected with miR-222-3p-WT or miR-222-3p-MUT luciferase reporter vectors (2 µg) along with miR-222-3p mimics or mimics NC (2 µg)/KLF2 pcDNA3.1 (oe-KLF2) or NC pcDNA3.1 (oe-NC) in six-well plates. Luciferase activity was measured 48 h later.

Real-time quantitative PCR

The total RNA was extracted from lung tissues using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The extracted RNA was reverse-transcribed into complementary DNA (cDNA) using Super M-MLV Reverse Transcriptase (Invitrogen). cDNA amplification and quantification were performed using Taq PCR MasterMix (Solarbio) and SYBR Green (Solarbio) on the ABI 7500 RT-PCR system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as the internal reference for mRNA, and U6 was used as the internal reference for miRNA [12]. Relative expression levels were calculated using the 2−ΔΔCt method [25]. The primer sequences are listed in Table 1.

Table 1 PCR primer sequences

Gene	Sequence (5’-3’)	
KLF2	F: AACTGCGGCAAGACCTACAC	
R: GAACTTCCAGCCGCATCCTT	
CDKN1B	F: CAGATACGAGTGGCAGGAGG	
R: ACCCAATTAAAGGCACCGCC	
miR-222-3p	F: GTCGTCAGCTACATCTGGCTAC	
R: TCAACTGGTGTCGTGGAGTCGG	
U6	F: CGCTTCGGCAGCACATATACT	
R: CTTCACGAATTTGCGTGTCAT	
GAPDH	F: GGTCCCAGCTTAGGTTCATCA	
R: AATCCGTTCACACCGACCTT	

Western blot assay

The lung tissues were lysed using radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China) containing 1% phenylmethanesulfonyl fluoride (Beyotime) to extract the total protein. Proteins were separated on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (ThermoFisher Scientific, Waltham, MA, USA). After blocking with 5% bovine serum albumin (Biosharp, Hefei, China) in Tris-buffered saline with 0.15% Tween-20 for 1 h, membranes were incubated with primary antibodies KLF2 (1:1000, ab314430, Abcam), CDKN1B (1:5000, ab32034, Abcam), and β-actin (1:1000, ab8227, Abcam) overnight at 4°C, followed by incubation with secondary antibody (1:2000, ab205718, Abcam) for 40–45 min at 37°C. Blots were exposed to an enhanced chemiluminescence substrate (7 Sea Biotech, Shanghai, China). β-actin (1:1000, ab8227, Abcam) was used as the internal control.

Statistical methods

All data were analyzed and plotted using SPSS 21.0 (IBM, Armonk, NY, USA) and GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, CA, USA). Normality and homogeneity of variance tests were conducted to ensure the data followed a normal distribution and had homogeneity of variance. For comparisons among multiple groups, one-way or two-way analysis of variance (ANOVA) was conducted, followed by Tukey’s multiple comparisons test for post-hoc analysis. A p value < 0.05 was considered statistically significant.

Results

Overexpression of KLF2 alleviates lung injury in young mice with Spn-induced pneumonia

In our study, we investigated the role of KLF2 in mitigating lung injury induced by Spn-induced pneumonia in young mice. Initially, we observed downregulation of KLF2 in lung tissues of the model mice (p < 0.01, Fig. 1A-B). Subsequently, overexpression of KLF2 significantly increased its expression levels (p < 0.01, Fig. 1A-B) and correspondingly reduced the bacterial load in the BALF (p < 0.01, Fig. 1C). Moreover, lung injury was exacerbated in the model group of mice compared to the sham group, whereas it was attenuated in the model + KLF2 group compared to the model + NC group (p < 0.01, Fig. 1D). Spn infection increased the wet-to-dry weight ratio and MPO activity in lung tissue (p < 0.01, Fig. 1E-F), whereas KLF2 overexpression decreased these parameters (p < 0.01, Fig. 1E) (p < 0.01, Fig. 1F). Additionally, KLF2 overexpression reduced the levels of IL-1β and IL-6 while increasing IL-10 levels (p < 0.01, Fig. 1G). These findings collectively indicate that KLF2 overexpression alleviates lung injury in Spn-induced pneumonia in young mice.

Fig. 1 Overexpression of KLF2 alleviates lung injury in young mice with Spn-induced pneumonia. Lentivirus carrying KLF2 overexpression vector (KLF2) was administered to mice by intravenous injection, with empty vector (NC) as a negative control. The murine model of pneumonia was established by Spn induction. A-B: Expression of KLF2 in lung tissues of mice in each group detected by real-time quantitative PCR and Western blot assay. C: Bacterial load in BALF of mice in each group. D: Representative images of lung tissue after H&E staining. E: Lung wet-to-dry weight ratio of mice in each group. F: MPO activity in lung tissues. G: Levels of IL-1β, IL-6, and IL-10 in lung tissues detected by ELISA. N = 6, data were presented as mean ± SD. Comparisons among multiple groups in panels A-F were performed using one-way ANOVA, and comparisons among multiple groups in panel G were performed using two-way ANOVA, followed by Tukey’s multiple comparisons test. ** p < 0.01

KLF2 binds to the mir-222-3p promoter and suppresses mir-222-3p expression

As a transcription factor, KLF2 can suppress downstream factors [26]. Utilizing the JASPAR database (https://jaspar.elixir.no/) [24], we predicted the binding of KLF2 to the miR-222-3p promoter (Fig. 2A). Given that miR-222-3p expression is elevated in pneumonia [12, 13], we conducted ChIP assays, which revealed increased KLF2 enrichment on the miR-222-3p promoter upon KLF2 overexpression (p < 0.01, Fig. 2B). Furthermore, co-transfection experiments with miR-222-3p-WT/miR-222-3p MUT with oe-KLF2/oe-NC in 293T cells demonstrated that miR-222-3p-WT co-transfected with oe-KLF2 significantly reduced the luciferase activity (p < 0.01, Fig. 2C), indicating that KLF2 suppresses miR-222-3p expression through transcriptional regulation. Moreover, in the model group, miR-222-3p expression was significantly elevated (p < 0.01, Fig. 2D), whereas its expression was reduced in the model + KLF2 group (p < 0.01, Fig. 2D). In summary, these results suggest that KLF2 binds to the miR-222-3p promoter and inhibits miR-222-3p expression, thereby potentially modulating the inflammatory response in Spn-induced pneumonia.

Fig. 2 KLF2 binds to the miR-222-3p promoter and suppresses miR-222-3p expression. A: Binding of KLF2 to the miR-222-3p promoter predicted using the JASPAR database. B: ChIP analysis to examine the enrichment of KLF2 on the miR-222-3p promoter. C: Dual-luciferase assay in 293T cells to validate the binding between KLF2 and the miR-222-3p promoter. D: Expression of miR-222-3p in lung tissues of mice in each group detected by real-time quantitative PCR. N = 6, data presented as mean ± SD. Comparisons among multiple groups in panel D were performed using one-way ANOVA, and comparisons among multiple groups in panels B and C were performed using two-way ANOVA, followed by Tukey’s multiple comparisons test. ** p < 0.01

Overexpression of miR-222-3p reverses the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia

Following the overexpression of miR-222-3p expression via lentiviral injection (p < 0.01, Fig. 3A), we observed a significant increase in bacterial load in the BALF (p < 0.01, Fig. 3B) and enhanced severity of lung injury (p < 0.01, Fig. 3F). Additionally, miR-222-3p overexpression led to elevated wet-to-dry weight ratio, MPO activity, and levels of IL-1β and IL-6 (p < 0.01, Fig. 3C-E) in lung tissue, accompanied by a decrease in IL-10 levels (p < 0.01, Fig. 3E). These findings collectively indicate that overexpression of miR-222-3p reverses the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia.

Fig. 3 Overexpression of miR-222-3p reverses the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia. Lentivirus carrying miR-222-3p agomir (ago-222) was administered to mice by intravenous injection, with lentivirus carrying NC agomir (ago-NC) as a negative control. A murine model of pneumonia was established by Spn induction. A: Expression of miR-222-3p in lung tissues of mice in each group detected by real-time quantitative PCR. B: Bacterial load in BALF of mice in each group. C: Lung wet-to-dry weight ratio of mice in each group. D: MPO activity in lung tissues. E: Levels of IL-1β, IL-6, and IL-10 in lung tissues detected by ELISA. F: Representative images of lung tissue after H&E staining. N = 6, data presented as mean ± SD. Comparisons among multiple groups in panels A-D were performed using one-way ANOVA, and comparisons among multiple groups in panel E were performed using two-way ANOVA, followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01

Mir-222-3p targets CDKN1B and suppresses CDKN1B expression

To identify downstream target genes of miR-222-3p, we utilized multiple databases and identified CDKN1B as a target (Fig. 4A). CDKN1B expression is known to decrease in lung cells treated with LPS [17], prompting us to investigate its role further. Co-transfection of CDKN1B-WT with miR-222-3p mimics significantly reduced luciferase activity (p < 0.01, Fig. 4B), confirming direct binding between miR-222-3p and CDKN1B. Moreover, CDKN1B expression was decreased in lung tissues of mice in the model group, whereas it was increased in lung tissues of mice in the model + KLF2 group (p < 0.01, Fig. 4C-D). These results indicate that miR-222-3p targets CDKN1B and suppresses its expression.

Fig. 4 miR-222-3p targets CDKN1B and suppresses CDKN1B expression. A: Downstream target genes of miR-222-3p predicted using databases with CDKN1B identified at the intersection. B: Dual-luciferase assay in 293T cells to validate the binding between miR-222-3p and CDKN1B. C-D: Expression of CDKN1B in lung tissues of mice in each group detected by real-time quantitative PCR and Western blot assay. N = 6, data presented as mean ± SD. Comparisons among multiple groups in panels C-D were performed using one-way ANOVA, and comparisons among multiple groups in panel B were performed using two-way ANOVA, followed by Tukey’s multiple comparisons test. ** p < 0.01

Downregulation of CDKN1B diminishes the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia

Finally, to validate the mechanism, we utilized lentivirus containing CDKN1B shRNA to down-regulate CDKN1B expression (p < 0.01, Fig. 5A-B). Subsequent knockdown of CDKN1B intensified the severity of lung injury in pneumonia mice, evidenced by increased bacterial load in BALF (p < 0.01, Fig. 5C), elevated wet-to-dry weight ratio (p < 0.01, Fig. 5D), enhanced MPO activity (p < 0.01, Fig. 5E), and heightened levels of inflammatory factors (p < 0.01, Fig. 5F-G). In summary, these findings indicate that downregulation of CDKN1B diminishes the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia.

Fig. 5 Downregulation of CDKN1B diminishes the protective effect of KLF2 overexpression on lung injury in young mice with pneumonia. Lentivirus carrying CDKN1B shRNA (sh-CDKN1B) was administered to mice by intravenous injection, with lentivirus carrying NC shRNA (sh-NC) as a negative control. A murine model of pneumonia was established by Spn induction. A-B: Expression of CDKN1B in lung tissues of mice in each group detected by real-time quantitative PCR and Western blot assay. C: Bacterial load in BALF of mice in each group. D: Lung wet-to-dry weight ratio of mice in each group. E: MPO activity in lung tissues. F: Levels of IL-1β, IL-6, and IL-10 in lung tissues detected by ELISA. G: Representative images of lung tissue stained with H&E. N = 6, data presented as mean ± SD. Comparisons among multiple groups in panels A-E were performed using one-way ANOVA, and comparisons among multiple groups in panel F were performed using two-way ANOVA, followed by Tukey’s multiple comparisons test. ** p < 0.01

Discussion

Spn is a predominant pathogen implicated in childhood pneumonia, contributing significantly to pulmonary pathology [18]. In this study, we successfully established a pediatric pneumonia model by young mice infected with Spn. Our findings underscored the pivotal role of KLF2 in this model, where KLF2 was found to bind to the miR-222-3p promoter in lung tissue, thereby suppressing its expression. This regulatory mechanism subsequently led to the upregulation of CDKN1B, resulting in the attenuation of lung injury in our pneumonia mouse model.

The multifaceted role of KLF2 in mitigating lung injury hinges on its ability to modulate inflammatory responses. Previous studies have demonstrated that KLF2 levels decrease in murine models of LPS-induced acute lung injury. Notably, overexpression of KLF2 orchestrates a phenotypic shift in alveolar macrophages from a pro-inflammatory M1 phenotype to an anti-inflammatory M2 phenotype. This transition effectively curtails excessive inflammation and mitigates tissue damage [8]. Furthermore, the protective effects of KLF2 extend to conditions like pulmonary fibrosis, where its overexpression has been shown to ameliorate alveolar space destruction and collagen hyperplasia in the pulmonary interstitium. KLF2 also down-regulates the production of pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α, IL-1ß, and IL-6 in lung tissue, underscoring its potent anti-inflammatory properties [27]. Interestingly, our study revealed a decrease in KLF2 expression in young mice afflicted with pneumonia. Subsequent upregulation of KLF2 expression in the lung tissue of Spn-infected mice resulted in a decrease in bacterial load in the BALF, reduced lung tissue wet-to-dry weight ratio, and lowered levels of pro-inflammatory factors. Collectively, these findings substantiate that augmenting KLF2 can effectively mitigate lung injury by alleviating inflammation. Moreover, the role of KLF2 in immune-mediated injury is further highlighted by studies demonstrating that its downregulation promotes neutrophil extracellular trap formation, exacerbating conditions like transfusion-related acute lung injury [28]. Additionally, KLF2 levels are diminished in the serum of patients suffering from COVID-19 pneumonia, where its aberrant expression correlates with endothelial inflammation and endothelial dysfunction [29]. These insights underscore the potential of KLF2 as a biomarker for lung injury in clinical settings. In conclusion, our study underscores that overexpression of KLF2 represents a robust therapeutic strategy for alleviating lung injury in young mice with Spn-induced pneumonia. By mitigating inflammation and fostering lung tissue recovery, KLF2 emerges as a promising target for therapeutic intervention in pediatric pneumonia and potentially other inflammatory lung diseases.

As a transcription factor, KLF2 plays a crucial role in inhibiting the expression of downstream factors, and its regulatory relationship with miRNAs is well-established in the literature [26, 30, 31]. The miRbase database indicated that the sequence of miR-222-3p is highly conserved in humans, mice, and rats. Our study validated that KLF2 binds to the miR-222-3p promoter and suppresses miR-222-3p expression. This miRNA is highly conserved across species, as indicated by the miRbase database, and its dysregulation has been implicated in various inflammatory conditions. For instance, miR-222-3p levels are elevated in BALF from mice with lipid-associated membrane proteins-stimulated mycoplasma pneumoniae, correlating with increased bacterial load and heightened pro-inflammatory cytokine levels [13]. Consistently, our findings demonstrate that overexpression of miR-222-3p reverses the protective effects of KLF2 overexpression on lung injury in neonatal mice with pneumonia. Previous studies have also implicated miR-222 in conditions like acute lung injury caused by Staphylococcus enterotoxin B, where its inhibition attenuated pulmonary inflammation by targeting Foxo3 [32]. Moreover, miR-222 has been shown to exacerbate LPS-induced inflammatory injury in cell models [33]. Collectively, these studies suggest that miR-222-3p may modulate pneumonia progression through mechanisms involving macrophage polarization and inflammatory cytokine regulation, providing novel insights into potential therapeutic avenues for childhood pneumonia.

miRNAs are pivotal regulators involved in diverse physiological processes and disease pathogenesis [34, 35]. Our study identified miR-222-3p as having a targeted binding site with CDKN1B, a key cell cycle regulator. Notably, CDKN1B expression was reduced in young mice with Spn-induced pneumonia. Upregulation of CKDN1B has been associated with enhanced neuronal cell survival by suppressing IL-6 and TNF-α, thereby reducing cellular apoptosis and inflammation levels [36]. Conversely, decreased CDKN1B expression has been observed in the pulmonary arteries of mice with hypoxic pulmonary hypertension and was restored by Astragaloside IV treatment, highlighting its role in endothelial cell dysfunction and inflammation in pulmonary diseases [37, 38]. Our findings provide the first evidence of CDKN1B expression dynamics and its impact in neonatal mice with Spn-induced pneumonia. By elucidating the mechanisms underlying CDKN1B in pneumonia, our study suggests CDKN1B as a potential therapeutic target for future molecular interventions aimed at mitigating lung injury and inflammation.

Despite the insights gained from our study, several limitations warrant consideration. Firstly, our research focused exclusively on elucidating a single downstream molecular mechanism of KLF2 in Spn-induced pneumonia in young mice. Further investigations should delve into the upstream regulatory mechanisms influencing KLF2 expression to provide a more comprehensive understanding of its role in pneumonia pathogenesis. Moreover, while we explored the regulation of CDKN1B by miR-222-3p, the broader impact of miR-222-3p on other downstream target genes and their functional consequences remains unclear. Additionally, the expression pattern of miR-222-3p in pneumonia, particularly its differential expression across various tissues, requires further exploration to fully grasp its role in disease progression. Lastly, the lack of in vitro rescue experiments limits the validation of CDKN1B’s function in Spn-induced pneumonia, and the potential bystander effect of CDKN1B remains unverified. Moving forward, our future research directions will encompass validating the effect of KLF2 on pyroptosis and apoptosis in vivo, exploring the intricate upstream regulatory mechanism governing KLF2 expression, analyzing the tissue-specific expression patterns of miR-222-3p in pneumonia, and identifying novel therapeutic targets for pneumonia treatment.

Conclusions

In conclusion, our study reveals that KLF2 binds to the miR-222-3p promoter, thereby suppressing its expression and alleviating the targeted inhibition of CDKN1B by miR-222-3p. Consequently, this mechanism leads to the upregulation of CDKN1B, which effectively reduces lung injury in young mice with Spn-induced pneumonia. These findings underscore the potential of KLF2 and its downstream targets as promising avenues for developing targeted therapies aimed at mitigating lung injury and improving clinical outcomes in pediatric pneumonia.

Acknowledgements

Not applicable.

Author contributions

Xiaoshuang Li: Conceptualization, Data curation, Funding acquisition, Methodology, Validation, Writing – original draft, Writing – review & editing; Weihua Xu: Conceptualization, Data curation, Investigation, Methodology, Visualization; Tao Jing: Conceptualization, Formal Analysis, Methodology, Supervision.

Funding

This work was supported by Key Research and Development Program Projects in Anhui Province (Grant No. 1804h08020285).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

All animal experimental protocols were approved by the Ethics Committee of Anhui Provincial Children’s Hospital (Approval number: EYLL-2018-010), and the methods complied with the Guidelines for the Care and Use of Laboratory Animals.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

KLF2 Kruppel-like factor 2

miR MicroRNA

CDKN1B Cyclin-dependent kinase inhibitor 1B

LPS Lipopolysaccharide

CFU Colony-forming units

PBS Phosphate-buffered saline

BALF Bronchoalveolar lavage fluid

H&E Hematoxylin and eosin

MPO Myeloperoxidase

ELISA Enzyme-linked immunosorbent assay

IL Interleukin

ChIP Chromatin immunoprecipitation

PCR Polymerase chain reaction

WT Wild-type

MUT mutant

cDNA Complementary DNA

GAPDH Glyceraldehyde-phosphate dehydrogenase

ANOVA Analysis of variance

TNF Tumor necrosis factor

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Torres A Cilloniz C Niederman MS Menendez R Chalmers JD Wunderink RG van der Poll T Pneumonia Nat Rev Dis Primers 2021 7 1 25 10.1038/s41572-021-00259-0 33833230
Torres A, Cilloniz C, Niederman MS, Menendez R, Chalmers JD, Wunderink RG, van der Poll T, Pneumonia. Nat Rev Dis Primers. 2021;7(1):25.33833230 10.1038/s41572-021-00259-0
2. Leung AKC Wong AHC Hon KL Community-Acquired Pneumonia in Children Recent Pat Inflamm Allergy Drug Discov 2018 12 2 136 44 10.2174/1872213X12666180621163821 29932038
Leung AKC, Wong AHC, Hon KL. Community-Acquired Pneumonia in Children. Recent Pat Inflamm Allergy Drug Discov. 2018;12(2):136–44.29932038 10.2174/1872213X12666180621163821
3. Katz SE Williams DJ Pediatric Community-Acquired Pneumonia in the United States: changing Epidemiology, Diagnostic and Therapeutic challenges, and Areas for Future Research Infect Dis Clin North Am 2018 32 1 47 63 10.1016/j.idc.2017.11.002 29269189
Katz SE, Williams DJ. Pediatric Community-Acquired Pneumonia in the United States: changing Epidemiology, Diagnostic and Therapeutic challenges, and Areas for Future Research. Infect Dis Clin North Am. 2018;32(1):47–63.29269189 10.1016/j.idc.2017.11.002
4. Kim GL Seon SH Rhee DK Pneumonia and Streptococcus pneumoniae vaccine Arch Pharm Res 2017 40 8 885 93 10.1007/s12272-017-0933-y 28735461
Kim GL, Seon SH, Rhee DK. Pneumonia and Streptococcus pneumoniae vaccine. Arch Pharm Res. 2017;40(8):885–93.28735461 10.1007/s12272-017-0933-y
5. Nascimento-Carvalho CM Community-acquired pneumonia among children: the latest evidence for an updated management J Pediatr (Rio J) 2020 96 Suppl 1Suppl 1 29 38 10.1016/j.jped.2019.08.003 31518547
Nascimento-Carvalho CM. Community-acquired pneumonia among children: the latest evidence for an updated management. J Pediatr (Rio J). 2020;96(Suppl 1Suppl 1):29–38.31518547 10.1016/j.jped.2019.08.003
6. Yuce K Ozkan AI The kruppel-like factor (KLF) family, diseases, and physiological events Gene 2024 895 148027 10.1016/j.gene.2023.148027 38000704
Yuce K, Ozkan AI. The kruppel-like factor (KLF) family, diseases, and physiological events. Gene. 2024;895:148027.38000704 10.1016/j.gene.2023.148027
7. Huang RT Wu D Meliton A Oh MJ Krause M Lloyd JA Nigdelioglu R Hamanaka RB Jain MK Birukova A Kress JP Birukov KG Mutlu GM Fang Y Experimental lung Injury reduces kruppel-like factor 2 to increase endothelial permeability via regulation of RAPGEF3-Rac1 signaling Am J Respir Crit Care Med 2017 195 5 639 51 10.1164/rccm.201604-0668OC 27855271
Huang RT, Wu D, Meliton A, Oh MJ, Krause M, Lloyd JA, Nigdelioglu R, Hamanaka RB, Jain MK, Birukova A, Kress JP, Birukov KG, Mutlu GM, Fang Y. Experimental lung Injury reduces kruppel-like factor 2 to increase endothelial permeability via regulation of RAPGEF3-Rac1 signaling. Am J Respir Crit Care Med. 2017;195(5):639–51.27855271 10.1164/rccm.201604-0668OC
8. Sun Q Xia Y Qin H Zhang W Wang J Ning Y Dong Y MEF2 intervened LPS-induced acute lung injury by binding to KLF2 promoter and modulating macrophage phenotype Int Immunopharmacol 2022 108 108873 10.1016/j.intimp.2022.108873 35729843
Sun Q, Xia Y, Qin H, Zhang W, Wang J, Ning Y, Dong Y. MEF2 intervened LPS-induced acute lung injury by binding to KLF2 promoter and modulating macrophage phenotype. Int Immunopharmacol. 2022;108:108873.35729843 10.1016/j.intimp.2022.108873
9. Wang X Huo R Liang Z Xu C Chen T Lin J Li L Lin W Pan B Fu X Chen S Simvastatin inhibits NLRP3 inflammasome activation and ameliorates Lung Injury in Hyperoxia-Induced Bronchopulmonary Dysplasia via the KLF2-Mediated mechanism Oxid Med Cell Longev 2022 2022 8336070 35509841
Wang X, Huo R, Liang Z, Xu C, Chen T, Lin J, Li L, Lin W, Pan B, Fu X, Chen S. Simvastatin inhibits NLRP3 inflammasome activation and ameliorates Lung Injury in Hyperoxia-Induced Bronchopulmonary Dysplasia via the KLF2-Mediated mechanism. Oxid Med Cell Longev. 2022;2022:8336070.35509841
10. Diener C Keller A Meese E Emerging concepts of miRNA therapeutics: from cells to clinic Trends Genet 2022 38 6 613 26 10.1016/j.tig.2022.02.006 35303998
Diener C, Keller A, Meese E. Emerging concepts of miRNA therapeutics: from cells to clinic. Trends Genet. 2022;38(6):613–26.35303998 10.1016/j.tig.2022.02.006
11. Zhang F Zhou Y Ding J The current landscape of microRNAs (miRNAs) in bacterial pneumonia: opportunities and challenges Cell Mol Biol Lett 2022 27 1 70 10.1186/s11658-022-00368-y 35986232
Zhang F, Zhou Y, Ding J. The current landscape of microRNAs (miRNAs) in bacterial pneumonia: opportunities and challenges. Cell Mol Biol Lett. 2022;27(1):70.35986232 10.1186/s11658-022-00368-y
12. Yang L Zhang X Liu X Long non–coding RNA GAS5 protects against Mycoplasma pneumoniae pneumonia by regulating the microRNA–222–3p/TIMP3 axis Mol Med Rep 2021 23 5 380 10.3892/mmr.2021.12019 33760178
Yang L, Zhang X, Liu X. Long non–coding RNA GAS5 protects against Mycoplasma pneumoniae pneumonia by regulating the microRNA–222–3p/TIMP3 axis. Mol Med Rep. 2021;23(5):380.33760178 10.3892/mmr.2021.12019
13. Chu C Lei X Li Y Luo Y Ding Y Zhou W Ji W High expression of mir-222-3p in children with Mycoplasma pneumoniae pneumonia Ital J Pediatr 2019 45 1 163 10.1186/s13052-019-0750-7 31842954
Chu C, Lei X, Li Y, Luo Y, Ding Y, Zhou W, Ji W. High expression of mir-222-3p in children with Mycoplasma pneumoniae pneumonia. Ital J Pediatr. 2019;45(1):163.31842954 10.1186/s13052-019-0750-7
14. Bachs O Gallastegui E Orlando S Bigas A Morante-Redolat JM Serratosa J Farinas I Aligue R Pujol MJ Role of p27(Kip1) as a transcriptional regulator Oncotarget 2018 9 40 26259 78 10.18632/oncotarget.25447 29899857
Bachs O, Gallastegui E, Orlando S, Bigas A, Morante-Redolat JM, Serratosa J, Farinas I, Aligue R, Pujol MJ. Role of p27(Kip1) as a transcriptional regulator. Oncotarget. 2018;9(40):26259–78.29899857 10.18632/oncotarget.25447
15. Gaytan-Pacheco N Ibanez-Salazar A Herrera-Van Oostdam AS Oropeza-Valdez JJ Magana-Aquino M Adrian Lopez J Monarrez-Espino J Lopez-Hernandez Y miR-146a, miR-221, and miR-155 are involved in inflammatory Immune response in severe COVID-19 patients Diagnostics (Basel) 2022 13 1 133 10.3390/diagnostics13010133 36611425
Gaytan-Pacheco N, Ibanez-Salazar A, Herrera-Van Oostdam AS, Oropeza-Valdez JJ, Magana-Aquino M, Adrian Lopez J, Monarrez-Espino J, Lopez-Hernandez Y. miR-146a, miR-221, and miR-155 are involved in inflammatory Immune response in severe COVID-19 patients. Diagnostics (Basel). 2022;13(1):133.36611425 10.3390/diagnostics13010133
16. Jiang K Yang J Guo S Zhao G Wu H Deng G Peripheral circulating exosome-mediated delivery of miR-155 as a Novel mechanism for Acute Lung inflammation Mol Ther 2019 27 10 1758 71 10.1016/j.ymthe.2019.07.003 31405809
Jiang K, Yang J, Guo S, Zhao G, Wu H, Deng G. Peripheral circulating exosome-mediated delivery of miR-155 as a Novel mechanism for Acute Lung inflammation. Mol Ther. 2019;27(10):1758–71.31405809 10.1016/j.ymthe.2019.07.003
17. Zhu Z Zhang D Lee H Menon AA Wu J Hu K Jin Y Macrophage-derived apoptotic bodies promote the proliferation of the recipient cells via shuttling microRNA-221/222 J Leukoc Biol 2017 101 6 1349 59 10.1189/jlb.3A1116-483R 28274991
Zhu Z, Zhang D, Lee H, Menon AA, Wu J, Hu K, Jin Y. Macrophage-derived apoptotic bodies promote the proliferation of the recipient cells via shuttling microRNA-221/222. J Leukoc Biol. 2017;101(6):1349–59.28274991 10.1189/jlb.3A1116-483R
18. Feng J Dai W Zhang C Chen H Chen Z Chen Y Pan Q Zhou Y Shen-Ling-bai-zhu-san ameliorates inflammation and lung injury by increasing the gut microbiota in the murine model of Streptococcus pneumonia-induced pneumonia BMC Complement Med Ther 2020 20 1 159 10.1186/s12906-020-02958-9 32460745
Feng J, Dai W, Zhang C, Chen H, Chen Z, Chen Y, Pan Q, Zhou Y. Shen-Ling-bai-zhu-san ameliorates inflammation and lung injury by increasing the gut microbiota in the murine model of Streptococcus pneumonia-induced pneumonia. BMC Complement Med Ther. 2020;20(1):159.32460745 10.1186/s12906-020-02958-9
19. Wang P Zhang H Zhao W Dai N Silencing of long non-coding RNA KCNQ1OT1 alleviates LPS-induced lung injury by regulating the miR-370-3p/FOXM1 axis in childhood pneumonia BMC Pulm Med 2021 21 1 247 10.1186/s12890-021-01609-0 34301223
Wang P, Zhang H, Zhao W, Dai N. Silencing of long non-coding RNA KCNQ1OT1 alleviates LPS-induced lung injury by regulating the miR-370-3p/FOXM1 axis in childhood pneumonia. BMC Pulm Med. 2021;21(1):247.34301223 10.1186/s12890-021-01609-0
20. Agarwal V Bell GW Nam JW Bartel DP Predicting effective microRNA target sites in mammalian mRNAs Elife 2015 4 e05005 10.7554/eLife.05005 26267216
Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015;4:e05005.26267216 10.7554/eLife.05005
21. Li JH Liu S Zhou H Qu LH Yang JH starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data Nucleic Acids Res 2014 42 Database issue D92 7 10.1093/nar/gkt1248 24297251
Li JH, Liu S, Zhou H, Qu LH, Yang JH. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2014;42(Database issue):D92–7.24297251 10.1093/nar/gkt1248
22. Chen Y Wang X miRDB: an online database for prediction of functional microRNA targets Nucleic Acids Res 2020 48 D1 D127 31 10.1093/nar/gkz757 31504780
Chen Y, Wang X. miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020;48(D1):D127–31.31504780 10.1093/nar/gkz757
23. Huang HY Lin YC Li J Huang KY Shrestha S Hong HC Tang Y Chen YG Jin CN Yu Y Xu JT Li YM Cai XX Zhou ZY Chen XH Pei YY Hu L Su JJ Cui SD Wang F Xie YY Ding SY Luo MF Chou CH Chang NW Chen KW Cheng YH Wan XH Hsu WL Lee TY Wei FX Huang HD miRTarBase 2020: updates to the experimentally validated microRNA-target interaction database Nucleic Acids Res 2020 48 D1 D148 54 31647101
Huang HY, Lin YC, Li J, Huang KY, Shrestha S, Hong HC, Tang Y, Chen YG, Jin CN, Yu Y, Xu JT, Li YM, Cai XX, Zhou ZY, Chen XH, Pei YY, Hu L, Su JJ, Cui SD, Wang F, Xie YY, Ding SY, Luo MF, Chou CH, Chang NW, Chen KW, Cheng YH, Wan XH, Hsu WL, Lee TY, Wei FX, Huang HD. miRTarBase 2020: updates to the experimentally validated microRNA-target interaction database. Nucleic Acids Res. 2020;48(D1):D148–54.31647101
24. Rauluseviciute I Riudavets-Puig R Blanc-Mathieu R Castro-Mondragon JA Ferenc K Kumar V Lemma RB Lucas J Cheneby J Baranasic D Khan A Fornes O Gundersen S Johansen M Hovig E Lenhard B Sandelin A Wasserman WW Parcy F Mathelier A JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles Nucleic Acids Res 2024 52 D1 D174 82 10.1093/nar/gkad1059 37962376
Rauluseviciute I, Riudavets-Puig R, Blanc-Mathieu R, Castro-Mondragon JA, Ferenc K, Kumar V, Lemma RB, Lucas J, Cheneby J, Baranasic D, Khan A, Fornes O, Gundersen S, Johansen M, Hovig E, Lenhard B, Sandelin A, Wasserman WW, Parcy F, Mathelier A. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2024;52(D1):D174–82.37962376 10.1093/nar/gkad1059
25. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Methods 2001 25 4 402 8 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.11846609 10.1006/meth.2001.1262
26. Li R Chen J Gao X Jiang G Transcription factor KLF2 enhances the sensitivity of breast cancer cells to cisplatin by suppressing kinase WEE1 Cancer Biol Ther 2021 22 7–9 465 77 10.1080/15384047.2021.1949228 34486497
Li R, Chen J, Gao X, Jiang G. Transcription factor KLF2 enhances the sensitivity of breast cancer cells to cisplatin by suppressing kinase WEE1. Cancer Biol Ther. 2021;22(7–9):465–77.34486497 10.1080/15384047.2021.1949228
27. Shi J Zhou LR Wang XS Du JF Jiang MM Song Z Han GC Mai ZT KLF2 attenuates bleomycin-induced pulmonary fibrosis and inflammation with regulation of AP-1 Biochem Biophys Res Commun 2018 495 1 20 6 10.1016/j.bbrc.2017.10.114 29079188
Shi J, Zhou LR, Wang XS, Du JF, Jiang MM, Song Z, Han GC, Mai ZT. KLF2 attenuates bleomycin-induced pulmonary fibrosis and inflammation with regulation of AP-1. Biochem Biophys Res Commun. 2018;495(1):20–6.29079188 10.1016/j.bbrc.2017.10.114
28. Le A Wu Y Liu W Wu C Hu P Zou J Kuang L MiR-144-induced KLF2 inhibition and NF-kappaB/CXCR1 activation promote neutrophil extracellular trap-induced transfusion-related acute lung injury J Cell Mol Med 2021 25 14 6511 23 10.1111/jcmm.16650 34120407
Le A, Wu Y, Liu W, Wu C, Hu P, Zou J, Kuang L. MiR-144-induced KLF2 inhibition and NF-kappaB/CXCR1 activation promote neutrophil extracellular trap-induced transfusion-related acute lung injury. J Cell Mol Med. 2021;25(14):6511–23.34120407 10.1111/jcmm.16650
29. Xu S Liu Y Ding Y Luo S Zheng X Wu X Liu Z Ilyas I Chen S Han S Little PJ Jain MK Weng J The zinc finger transcription factor, KLF2, protects against COVID-19 associated endothelial dysfunction Signal Transduct Target Ther 2021 6 1 266 10.1038/s41392-021-00690-5 34253708
Xu S, Liu Y, Ding Y, Luo S, Zheng X, Wu X, Liu Z, Ilyas I, Chen S, Han S, Little PJ, Jain MK, Weng J. The zinc finger transcription factor, KLF2, protects against COVID-19 associated endothelial dysfunction. Signal Transduct Target Ther. 2021;6(1):266.34253708 10.1038/s41392-021-00690-5
30. Dai Y Yan T Gao Y Silence of mir-32-5p promotes endothelial cell viability by targeting KLF2 and serves as a diagnostic biomarker of acute myocardial infarction Diagn Pathol 2020 15 1 19 10.1186/s13000-020-00942-y 32127011
Dai Y, Yan T, Gao Y. Silence of mir-32-5p promotes endothelial cell viability by targeting KLF2 and serves as a diagnostic biomarker of acute myocardial infarction. Diagn Pathol. 2020;15(1):19.32127011 10.1186/s13000-020-00942-y
31. He S Yang L Li D Li M Kruppel-Like Factor 2-Mediated suppression of MicroRNA-155 reduces the Proinflammatory activation of macrophages PLoS ONE 2015 10 9 e0139060 10.1371/journal.pone.0139060 26406238
He S, Yang L, Li D, Li M, Kruppel-Like. Factor 2-Mediated suppression of MicroRNA-155 reduces the Proinflammatory activation of macrophages. PLoS ONE. 2015;10(9):e0139060.26406238 10.1371/journal.pone.0139060
32. Chen L, Chen J, Xie G, Zhu L. MiR-222 inhibition alleviates Staphylococcal Enterotoxin B-induced inflammatory acute lung injury by targeting Foxo3. J Biosci. 2020; 45:Article number 65.
33. Wei E Fang X Jia P Li M Jin P Li F Wang H Gao D Ginsenoside Rb1 alleviates Lipopolysaccharide-Induced Inflammatory Injury by Downregulating miR-222 in WI-38 cells Cell Transpl 2021 30 9636897211002787 10.1177/09636897211002787
Wei E, Fang X, Jia P, Li M, Jin P, Li F, Wang H, Gao D. Ginsenoside Rb1 alleviates Lipopolysaccharide-Induced Inflammatory Injury by Downregulating miR-222 in WI-38 cells. Cell Transpl. 2021;30:9636897211002787.10.1177/09636897211002787
34. Liao L Chen J Zhang C Guo Y Liu W Liu W Duan L Liu Z Hu J Lu J LncRNA NEAT1 promotes high glucose-Induced Mesangial Cell Hypertrophy by Targeting miR-222-3p/CDKN1B Axis Front Mol Biosci 2020 7 627827 10.3389/fmolb.2020.627827 33585566
Liao L, Chen J, Zhang C, Guo Y, Liu W, Liu W, Duan L, Liu Z, Hu J, Lu J. LncRNA NEAT1 promotes high glucose-Induced Mesangial Cell Hypertrophy by Targeting miR-222-3p/CDKN1B Axis. Front Mol Biosci. 2020;7:627827.33585566 10.3389/fmolb.2020.627827
35. Liu J Yu J Jiang W He M Zhao J Targeting of CDKN1B by mir-222-3p may contribute to the development of intervertebral disc degeneration FEBS Open Bio 2019 9 4 728 35 10.1002/2211-5463.12609 30984546
Liu J, Yu J, Jiang W, He M, Zhao J. Targeting of CDKN1B by mir-222-3p may contribute to the development of intervertebral disc degeneration. FEBS Open Bio. 2019;9(4):728–35.30984546 10.1002/2211-5463.12609
36. Chen D Wang X Huang J Cui S Zhang L CDKN1B mediates apoptosis of neuronal cells and inflammation Induced by Oxyhemoglobin via Mir-502-5p after subarachnoid hemorrhage J Mol Neurosci 2020 70 7 1073 80 10.1007/s12031-020-01512-z 32152938
Chen D, Wang X, Huang J, Cui S, Zhang L. CDKN1B mediates apoptosis of neuronal cells and inflammation Induced by Oxyhemoglobin via Mir-502-5p after subarachnoid hemorrhage. J Mol Neurosci. 2020;70(7):1073–80.32152938 10.1007/s12031-020-01512-z
37. Luo Y Zhang B Dong HY Liu Y Li ZC Dong MQ Gao YQ Prevention of hypoxic pulmonary hypertension by hypoxia-inducible expression of p27 in pulmonary artery smooth muscle cells Gene Ther 2014 21 8 751 8 10.1038/gt.2014.49 24871579
Luo Y, Zhang B, Dong HY, Liu Y, Li ZC, Dong MQ, Gao YQ. Prevention of hypoxic pulmonary hypertension by hypoxia-inducible expression of p27 in pulmonary artery smooth muscle cells. Gene Ther. 2014;21(8):751–8.24871579 10.1038/gt.2014.49
38. Jin H Jiao Y Guo L Ma Y Zhao R Li X Shen L Zhou Z Kim SC Liu J Astragaloside IV blocks monocrotaline–induced pulmonary arterial hypertension by improving inflammation and pulmonary artery remodeling Int J Mol Med 2021 47 2 595 606 10.3892/ijmm.2020.4813 33416126
Jin H, Jiao Y, Guo L, Ma Y, Zhao R, Li X, Shen L, Zhou Z, Kim SC, Liu J. Astragaloside IV blocks monocrotaline–induced pulmonary arterial hypertension by improving inflammation and pulmonary artery remodeling. Int J Mol Med. 2021;47(2):595–606.33416126 10.3892/ijmm.2020.4813
