
==== Front
Virol J
Virol J
Virology Journal
1743-422X
BioMed Central London

2479
10.1186/s12985-024-02479-8
Research
Epidemiology and genetic characterization of human parainfluenza virus-1 infection in pediatric patients from Hangzhou China, 2021–2022
Guo Ya-jun 1
Sun Jian 2
Li Ya-lin 3
Lai Qin-rui 1
Li Lin 4
Zhou Hang-yu zhy@ism.cams.cn

5
Li Wei chweige@zju.edu.cn

16
1 grid.13402.34 0000 0004 1759 700X Department of Clinical Laboratory, The Children’s Hospital, Zhejiang University School of Medicine, National Clinical Research Center for Child Health, Hangzhou, 310052 PR China
2 https://ror.org/05m1p5x56 grid.452661.2 0000 0004 1803 6319 Department of Stomatology, The First Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, 310003 PR China
3 https://ror.org/02m2h7991 grid.510538.a 0000 0004 8156 0818 Zhejiang LAB, Hangzhou, 310003 PR China
4 https://ror.org/05n13be63 grid.411333.7 0000 0004 0407 2968 Department of Infectious Diseases, Fujian Branch of Shanghai Children’s Medical Center, Fujian Children’s Hospital, Fuzhou, 350014 Fujian Province China
5 grid.506261.6 0000 0001 0706 7839 State Key Laboratory of Common Mechanism Research for Major Diseases, Suzhou Institute of Systems Medicine, Chinese Academy of Medical Sciences and Peking Union Medical College, Suzhou, 215123 Jiangsu China
6 https://ror.org/025fyfd20 grid.411360.1 The Children’s Hospital of Zhejiang University School of Medicine, 3333 Binsheng road, Hangzhou, 310052 China
2 9 2024
2 9 2024
2024
21 2061 4 2024
21 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Human parainfluenza virus-1 (HPIV-1) is a notable pathogen instigating acute respiratory tract infections in children. The article is to elucidate the epidemiological and genetic characteristics of HPIV-1 circulating in Hangzhou during the period of 2021–2022.

Methods

A cohort of 2360 nasopharyngeal swabs were amassed and subsequently examined via RT-PCR, with HPIV-1 positive samples undergoing P gene sequencing.

Results

The highest HPIV-1 infection rates were found in children aged between 3 and 6 years. A pronounced positive rate persisted through the latter half of 2021, with a notable decline observed in the initial half of 2022. All HPIV-1 strains could be clustered into 2 groups: Cluster 1, with strains similar to those found in Japan (LC764865, LC764864), and Cluster 2, with strains similar to the Beijing strain (MW575643).

Conclusion

In conclusion, our study contributes to the comprehensive data on the epidemiological and genetic characteristics of HPIV-1 in pediatric patients from Hangzhou, post the COVID-19 peak.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12985-024-02479-8.

Keywords

Human parainfluenza virus-1
Children
Infectious
Epidemiology
Genetic
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Acute respiratory tract infection (ARTI) is a major threat to the health of children worldwide, and virus is the main pathogen of ARTI in children. ARTI has become the second leading cause of death in children under 5 years of age [1]. Human parainfluenza virus (HPIV) is an important pathogen causing respiratory diseases in children and adults. It has a wide range of clinical manifestations, from colds and asthma to bronchiolitis and pneumonia. It poses a huge disease burden on children, accounting for 40% of all hospitalizations for lower respiratory diseases and 75% of asthma cases [2]. Serological evidence shows that most children over the age of five are infected with HPIVs [3].

Human parainfluenza virus (HPIV) belongs to paramyxoviridae. HPIV is an enveloped, unsegmented, single-stranded, antisense RNA virus with a genome length of 14.9-17.3 kb, which encodes six common structural proteins: nucleoprotein (NP), phosphoprotein (P), matrix protein(M), fusion (F), hemagglutinin neuraminidase (HN) and large (L); F and HN glycoproteins are membrane binding proteins and N, P and L are nucleocapsid related proteins [4]. Viral RNA with nucleoprotein (NP), phosphoprotein (P) and large (L) protein form the nucleocapsid, while glycosylated proteins haemagglutinin–neuraminidase (HN) and fusion (F) protrude from the viral envelope, and matrix protein(M) forms the inner layer of the envelope [5]. According to heredity and antigenic variation, HPIV was classified into four serotypes (HPIV 1–4), of which HPIV 1 and HPIV 3 were classified as respiratory syndrome viruses, while HPIV 2 and HPIV 4 were classified as rheumatoid viruses [6]. The molecular weight of P protein varies greatly, with HPIV 1 and HPIV 3 being 83–90 kDa and HPIV 4 being 49–53 kDa [7]. P protein plays an important role in the formation of new nucleocapsid in the process of virus genome replication. P protein interacts with N protein to prevent N protein from forming nonspecific nucleocapsid on cells [8]. P protein and L protein are two subunits of RNA-dependent RNA polymerase, which can form a polymerase complex (P-L) and regulate the synthesis of viral RNA [9]. The P gene of some paramyxoviruses produces many small nonstructural proteins from multiple overlapping reading frames. For example, P gene of HPIV 1–3 can encode a nonstructural protein(C) [10–12]. In addition, the P gene of HPIV2 has an additional non-structural protein (V) that HPIV1 does not have [10, 13, 14]. These nonstructural proteins bind to N proteins and play a regulatory role in the process of virus replication [15]. The interaction of C and V proteins with interferon may determine the host range of some infections caused by HPIV-1 [16]. Study have shown that, V protein can prolong the cell cycle and contribute to virus replication [17].

HPIV infections can compromise human immune function. At present, no effective drug against HPIV infections has been found, and most of them are symptomatic treatments. Different HPIV-1 subtypes can cause different clinical diseases and clinical manifestations. Wheezing syndrome (group) mainly manifested as fever, larynx, hoarseness and barking cough, accounting for 40% of HPIV-1 infected patients, mainly caused by HPIV-1 infection. The patients usually occur in children between 1 and 2 years old [18, 19]. Bronchiolitis is most common with HPIV1 and HPIV3 infection, and its clinical features are fever, wheezing and three concave signs. Most of the patients are less than 1 year old [20]. The severity of the disease also depends on the titer, type and host heredity of HPIVs. Anti-NH protein antibodies and anti-P protein antibodies play an important role in preventing HPIV infection. Due to the incomplete development of an infant’s immune system, their immune response and ability to fight off infections are relatively weak. As a result, antibodies remain in their bodies for a short time, leaving them vulnerable to repeated infections.

At present, a perfect HPIV1 surveillance system has not been established in China. Therefore, this study analyzed the age, sex and seasonal distribution of the outpatient with ARTIs in Children’s Hospital, Zhejiang University School of Medicine from July 2021 to July 2022 after the outbreak of COVID-19, and then the P gene of HPIV1 positive samples were sequenced to explore the genetic characteristics of HPIV1 in China and the law of global HPIV1 molecular evolution. To provide a basic scientific basis for HPIV1 surveillance, prevention, control, and vaccine research and development in China.

Methods

Clinical samples

From July, 2021 to July, 2022, 2360 nasopharyngeal swabs were obtained from pediatric outpatients diagnosed with Acute Respiratory Tract Infections (ARTIs) exhibiting symptoms such as fever (body temperature ≥ 37.5 °C), cough, sore throat, nasal blockage, runny nose, or expectoration and so on, at The Children’s Hospital of Zhejiang University School of Medicine (Hangzhou, Zhejiang). The collected throat swabs were preserved in viral transport medium (KaiBiLi, Hangzhou, China) of 2.5 ml capacity. Relevant data, inclusive of demographic details, case histories, symptomatology, and clinical outcomes, was gathered for each patient. Screening focused on HPIV-1 along with common respiratory virus strains like influenza virus Type-A and Type-B, respiratory syncytial virus, human parainfluenza virus-3, and human adenovirus.

Nucleic acid extraction and screening for respiratory viruses

Following the protocols provided by the manufacturer, the viral RNA and DNA were isolated from a 300 µL nasopharyngeal swab using a magnetic bead nucleic acid extraction Kit (Catalog Z-ME-0044, Shanghai Zhijiang Biotechnology Ltd. Co, China). Utilizing the Applied Biosystems 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA), a real-time PCR analysis was performed to screen for intended respiratory viruses (XABT, Beijing, China; CFDA: 20213400026). The thermocycling process incorporated reverse transcription, comprising a 10-min stage at 45 °C, a 5-min interval at 95 °C, and 45 repetition cycles of 15-second denaturation at 95 °C followed by 45-second annealing at 60 °C. All experimental techniques were executed with rigorous adherence to the guidelines provided by the manufacturer.

PCR for P gene amplification of HPIV-1

The HPIV-1 positive samples were selected and reverse transcription of the extracted viral RNA was performed by using the MonScript RTIII Super Mix with dsDNase (Monad Biotech Co.Lid, China). The P gene of HPIV was amplified by PCR [5]. PCR was carried out using two primers as shown in Table 1: P1-1671 F/P1-2900R and P2-2694 F/P2-3737R. with the forward primer P2-2694 F and the reverse primer P2-3737R. 4 µl of cDNA were added to 21 µl PCR reagents (2 × Taq MasterMix, CWBio Co., Ltd, China). Amplification was carried out at 94 °C for 2 min, followed by 40 cycles at 94 °C for 30s, 56 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 4 min. PCR products were analyzed by electrophoresis on 1.0% agarose gel and sent to Youkang Biological Technology Co., Ltd. (Hangzhou, China) for sanger sequencing.

Table 1 The primer of PCR for P gene amplification of HPIV-1

Primers	Sequence(5’-3’)	
P1-1671 F	GCTGCAGGGATAGGAGGAATT	
P1-2900R	CATGACTTGCACTCCTAGAT	
P2-2694 F	AGAACAACCACAACCACAG	
P2-3737R	GAGAGGGAGAGGTTCTACTGTC	

Phylogenetic analysis

The P gene of HPIV-1 was sequenced in terms of nucleotide. The comparison was made between the output sequences and the HPIV-1 sequences available in GenBank. MAFFT v7.4.1 [21] was employed to align all sequences and IQTREE v2.1.3 [22] was used for the construction of phylogenetic trees, which were visualized by the ggtree package [23] in R. The tree was constructed using the maximum likelihood method with a GTR + F + R4 model and tested with bootstrapping (1000 replicates). Complete gap deletion or missing data was analyzed, and genetic distances were also calculated using the Kimura 2-Parameter method in MEGA-X [24]. The amino acid mutations were displayed with snipit (https://github.com/aineniamh/snipit) using the multiple sequence alignmenet file. The matrix was generate with sitePath (https://bioconductor.org/packages/sitePath/) and plot with pheatmap package (https://cran.r-project.org/web/packages/pheatmap/index.html).

Nucleotide sequence accession numbers

Representative nucleotide sequences of HPIV-1 were submitted to GenBank and given accession numbers PP291742-PP291756.

Result

In the course of this investigation, we collected a total of 2360 samples from pediatric patients presenting with ARTIs. Of these, 86 cases, representing 3.64% of the total, tested positive for HPIV-1. The age of the infected children spanned from 1 month to 12 years and 6 months. Evaluating age-wise distribution, the highest HPIV-1 positivity was noted in the 3-6-year age group during the study period. Detailed age-group distribution was as follows: 0 out of 43 (0%) in the 0- to 6-month age group, 3 out of 221 (1.36%) in the 6-month to 1-year age group, 33 out of 760 (4.34%) in the 1- to 3-year age group, and 5 out of 487 cases (1.03%) in the > 6-year age group (Fig. 1A and B). The temporal distribution of HPIV-1 infection from July 2021 to July 2022 is depicted in Fig. 2A and B, showing a peak positivity rate of 8.30% in December 2021, followed by a significant decrease in the first half of 2022, with the lowest rates of 0% noted in April and July.

Fig. 1 Age distribution of the positive rates in children with HPIV-1 infection. A Total cases and positive cases with HPIV-1 infection; B Positive rates in children with HPIV-1 infection

Fig. 2 Monthly distribution of the positive rates in children with HPIV-1 infection. A Total cases and positive cases with HPIV-1 infection; B Positive rates in children with HPIV-1 infection

For further investigation, 15 complete P genes have been successfully spliced. All the HPIV-1 strains from these 15 sequences could be segregated into 2 distinct clusters: 14 in cluster 1, and 1 in cluster 2 (Fig. 3). Phylogenetic analysis of the P gene relative to the HPIV-1 strain (Fig. 3) revealed that the strains isolated in the present study from cluster 1 were similar to strains (LC764865, LC764864) previously identified in Japan. Strains from cluster 2 were analogous to strains reported from Beijing (MW575643).

Fig. 3 P gene phylogenetic trees of HPIV-1 strains. Phylogenetic trees of HPIV-1 strains derived in the study during 2021–2022 based on the P gene. The phylogenetic trees were constructed using the maximum likelihood method with 1000 bootstraps. The sequences of HPIV-1 in this study are labeled with blue dots

Comparing with the reference strain NC_003461, all amino acid mutations of HPIV-1 are illustrated in Fig. 4. 15 HPIV-1 strains had 27 mutations at the same locus: F8L, P62S, A66S, G87E, G89R, G110D, S140P, L151P, R179G, D185N, P231Q, S246N, S247P, E255G, N256D, S279P, T282A, P283Q, R293K, E319G, K365Q, I376L, N401D, N440D, G473T, K491R, N498Y. Except for HPIV1-202 strain, the other 14 strains had the following mutations: T94A, L106F, V170A, L249F, K270R, T295A, and S349N. There were N56S mutations in all strains except HPIV1-202 and 104 and S95G mutations except HPIV1-117.

Fig. 4 Deduced amino acid alignments of the P genes from Hangzhou HPIV-1 strains and reference strains (NC_003461)

In terms of nucleic acid, the strains popular in 2022 have been popular all over the world in 2005, 2007, 2009, 2010 to 2012, 2014 (Fig. 5). In terms of amino acids, the prevalent HPIV subtypes in 2021 and 2022 are different, and those in 2022 are similar to those once popular in China in 2018 (Fig. 6). The attachment (Fig. S1-S10) shows differential fixed sites that analyze the sequence of HPIV1 that was circulating in China in 2021 and 2022, indicating that the epidemic strains are different, which may also indicate that the infected people have different adaptability to the two pandemic of HPIV1 strains.

Fig. 5 Similarity analysis of base sequences

Fig. 6 Similarity analysis of amino acid sequences

Discussion

Our investigation enhances the understanding of the epidemic trajectory and molecular epidemiological nuances of HPIV-1 infection amidst the COVID-19 pandemic. The detection rate in our cohort was 3.64%, surpassing those reported in Germany (2.53%, 2015–2019) and the USA (0.83%, 2011–2019) [25, 26]. It also exceeded the 0.19% detection rate in Shaoxing, a city in Zhejiang province, from 2001 to 2006 [27]. Earlier studies from the USA reported the most frequent detections in children aged ≤ 2 years [26], whereas, in our study, the HPIV-1 positivity rate was highest in the 3–6 years age group. This decrease in HPIV infections might be due to the strict measures taken during the COVID-19 pandemic. Because Immunity to HPIV is short-lived and weakens over time [7], when things started returning to normalized management after the big outbreak, children’s immunity to HPIV went down a lot. Kids aged 3–6 have more social contact than younger kids, leading to a higher infection rate. Previous research has reported a biennial fall epidemic of HPIV-1 [19]. Traditionally, HPIV-1 infections have been reported to surge in the summer, peaking in the September to December window of odd-numbered years [26, 28]. Our data similarly reveal a gradual increase in HPIV-1 positivity beginning in September, peaking in December, and then rapidly declining in January. This reaffirms the notion that the prevalence of HPIV-1 displays a rather stable seasonality.

Mizuta et al. [29] demonstrated that HPIV1 strains isolated within the same regions could be classified into two clusters based on the HN gene. The P gene encodes auxiliary proteins that facilitate the transcription/translation of viral nucleic acids and assist in suppressing the host’s innate immune response by acting as an antagonist of IFN and apoptotic pathways [30]. A study conducted in the U.S. suggested that while the P gene is variable, the proteins it encodes display conservation across different branches, possibly due to their structural or functional significance [31]. However, no reports so far have addressed the genetic analysis of the P gene in HPIV-1 within China. We have shown that HPIV-1 detected in Hangzhou can be classified into three distinct lineages using P gene analysis. Our findings also suggest a high degree of conservation across all strains. To compare the phylogenetics of the P genes of HPIV-1 with those detected elsewhere, we assembled comprehensive data on HPIV-1 P gene sequences from GenBank. The strains isolated in our study and foreign strains were in close proximity on the phylogenetic trees. Additionally, the genetic distances (P-distances) between these strains were relatively short. Strains from cluster 1 in our study resembled strains (LC764865, LC764864) identified in Japan, while cluster 2 strain was akin to strains from Beijing (MW575643). These discoveries could help to better understand and predict how HPIV-1 spreads and to figure out key virus traits and evolving trends.

In summary, our study provides insights into the epidemiological and genetic characteristics of HPIV-1 in paediatric patients in Hangzhou following the peak of COVID-19. Despite the execution of preventive and control measures in China, the prevalence of HPIV-1 remained high. Positivity rates were highest among children aged 3–6 years, and phylogenetic analysis revealed a close relatedness among all strains from July 2021 to July 2022 in Hangzhou.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Supplementary Material 4

Supplementary Material 5

Supplementary Material 6

Supplementary Material 7

Supplementary Material 8

Supplementary Material 9

Supplementary Material 10

Acknowledgements

We thank all parents and children for their consent and cooperation.

Author contributions

Ya-jun Guo and Jian Sun: Conceptualization; Data curation; Formal analysis; Investigation; Writing- original draft. Lin Li: Data curation; Investigation; Formal analysis. Qin-rui Lai: Project administration; Data curation. Yaling Li: Investigation; Supervision. Wei Li$Hangyu Zhou: Conceptualization; Supervision; Writing—review and editing.

Funding

This work was supported by Key Projects of Zhejiang Provincial Administration of Traditional Chinese Medicine (GZY-ZJ-KJ-24085).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The study was approved by the Children’s Hospital Ethics Committee at Zhejiang University School of Medicine(2021-IRB-182), and all study participants’ parents or legal guardians provided written informed consent.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. van Woensel JB van Aalderen WM Kimpen JL Viral lower respiratory tract infection in infants and young children BMJ 2003 327 7405 36 40 10.1136/bmj.327.7405.36 12842956
van Woensel JB, van Aalderen WM, Kimpen JL. Viral lower respiratory tract infection in infants and young children. BMJ. 2003;327(7405):36–40.12842956 10.1136/bmj.327.7405.36
2. Branche AR Falsey AR Parainfluenza virus infection Semin Respir Crit Care Med 2016 37 04 538 54 10.1055/s-0036-1584798 27486735
Branche AR, Falsey AR. Parainfluenza virus infection. Semin Respir Crit Care Med. 2016;37(04):538–54.27486735 10.1055/s-0036-1584798
3. Parrott RH, Vargosko AJ, Kim HW, Bell JA, Chanock RM. Acute respiratory diseases of viral etiology.III. parainfluenza. Myxoviruses. Am J Public Health Nations Health. 1962;52:907–17. 10.2105/ajph.52.6.907. PMID: 14038204.
4. Karron RA, Collins PL. Parainfluenza viruses. In: Knipe DM, and Howley PM, editors. Fields virology, 6th Edn. Philadelphia: Lippincott-Williams & Wilkins; 2013. p. 996–1023.
5. Tanja Košutic Gulija A Slovic S Ljubin-Sternak A study of genetic variability of human parainfluenza virus type 1 in Croatia, 2011–2014 J Med Microbiol 2016 65 793 803 10.1099/jmm.0.000297 27302417
Tanja Košutic Gulija A, Slovic S, Ljubin-Sternak, et al. A study of genetic variability of human parainfluenza virus type 1 in Croatia, 2011–2014. J Med Microbiol. 2016;65:793–803.27302417 10.1099/jmm.0.000297
6. Canchola J argosko V Kim AJ Parrott HW Christmas RH Jeffries E Antigenic variation among newly isolated strains of parainfluenza type 4 virus Am J Hyg 1964 79 357 64 10.1093/oxfordjournals.aje.a120390 14159955
Canchola J, argosko V, Kim AJ, Parrott HW, Christmas RH, Jeffries E, B., et al. Antigenic variation among newly isolated strains of parainfluenza type 4 virus. Am J Hyg. 1964;79:357–64. 10.1093/oxfordjournals.aje.a120390.14159955 10.1093/oxfordjournals.aje.a120390
7. Henrickson KJ Parainfluenza viruses Clin Microbiol Rev 2003 16 2 242 64 10.1128/CMR.16.2.242-264.2003 12692097
Henrickson KJ. Parainfluenza viruses. Clin Microbiol Rev. 2003;16(2):242–64.12692097 10.1128/CMR.16.2.242-264.2003
8. Das T Banerjee AK Role of the phosphoprotein (P) in the encapsidation of presynthesized and de novo synthesized vesicular stomatitis virus RNA by the nucleocapsid protein (N) in vitro Cell Mol Biol 1992 38 1 17 26 1313745
Das T, Banerjee AK. Role of the phosphoprotein (P) in the encapsidation of presynthesized and de novo synthesized vesicular stomatitis virus RNA by the nucleocapsid protein (N) in vitro. Cell Mol Biol. 1992;38(1):17–26.1313745
9. Matsumoto Y Ohta K Yumine N Identification of two essential aspartates for polymerase activity in parainfluenza virus L protein by a minireplicon system expressing secretory luciferase Microbiol Immunol 2015 59 11 676 83 10.1111/1348-0421.12329 26446904
Matsumoto Y, Ohta K, Yumine N, et al. Identification of two essential aspartates for polymerase activity in parainfluenza virus L protein by a minireplicon system expressing secretory luciferase. Microbiol Immunol. 2015;59(11):676–83.26446904 10.1111/1348-0421.12329
10. Matsuoka Y Curran J Pelet T Kolakofsky D Ray R Compans RW The P gene of human parainfluenza virus type 1 encodes P and C proteins but not a cysteine-rich V protein J Virol 1991 65 3406 10 10.1128/jvi.65.6.3406-3410.1991 1851888
Matsuoka Y, Curran J, Pelet T, Kolakofsky D, Ray R, Compans RW. The P gene of human parainfluenza virus type 1 encodes P and C proteins but not a cysteine-rich V protein. J Virol. 1991;65:3406–10.1851888 10.1128/jvi.65.6.3406-3410.1991
11. Ohgimoto S Bando H Kawano M Okamoto K Kondo K Tsurudome KM Nishio M Ito Y Sequence analysis of P gene of human parainfluenza type 2 virus: P and cysteone-rich proteins are trans- lated by two mRNAs that differ by two nontemplated G residues Virology 1990 177 116 23 10.1016/0042-6822(90)90465-4 2162103
Ohgimoto S, Bando H, Kawano M, Okamoto K, Kondo K, Tsurudome KM, Nishio M, Ito Y. Sequence analysis of P gene of human parainfluenza type 2 virus: P and cysteone-rich proteins are trans- lated by two mRNAs that differ by two nontemplated G residues. Virology. 1990;177:116–23.2162103 10.1016/0042-6822(90)90465-4
12. Spriggs MK Collins PL Human parainfluenza virus type 3: messenger RNAs, polypeptide coding assignments, intergenic sequences, and genetic map J Virol 1986 59 646 54 10.1128/jvi.59.3.646-654.1986 3016327
Spriggs MK, Collins PL. Human parainfluenza virus type 3: messenger RNAs, polypeptide coding assignments, intergenic sequences, and genetic map. J Virol. 1986;59:646–54.3016327 10.1128/jvi.59.3.646-654.1986
13. Durbin AP McAuliffe JM Collins PL Murphy BR Mutations in the C, D, and V open reading frames of human parainfluenza virus type 3 attenuate replication in rodents and primates Virology 1999 261 319 30 10.1006/viro.1999.9878 10497117
Durbin AP, McAuliffe JM, Collins PL, Murphy BR. Mutations in the C, D, and V open reading frames of human parainfluenza virus type 3 attenuate replication in rodents and primates. Virology. 1999;261:319–30.10497117 10.1006/viro.1999.9878
14. Southern JA Precious O Randall RE Two nontemplated nucleotide additions are required to generate the P mRNA of parainfluenza virus type 2 since the RNA genome encodes protein V Virology 1990 177 388 90 10.1016/0042-6822(90)90497-F 2162111
Southern JA, Precious O, Randall RE. Two nontemplated nucleotide additions are required to generate the P mRNA of parainfluenza virus type 2 since the RNA genome encodes protein V. Virology. 1990;177:388–90.2162111 10.1016/0042-6822(90)90497-F
15. Watanabe N Kawano M Tsurudome M Nishio M Ito M Ohgimoto S Suga S Komada H Ito Y Binding of the V proteins to the nucleocapsid proteins of human parainfluenza type 2 virus Scand J Microbiol Immunol 1996 185 89 94
Watanabe N, Kawano M, Tsurudome M, Nishio M, Ito M, Ohgimoto S, Suga S, Komada H, Ito Y. Binding of the V proteins to the nucleocapsid proteins of human parainfluenza type 2 virus. Scand J Microbiol Immunol. 1996;185:89–94.
16. Malur AG Hoffman MA Banerjee AK The human parainfluenza virus type 3(HPIV 3) C protein inhibits viral transcription Virus Res 2004 99 2 199 204 10.1016/j.virusres.2003.11.009 14749186
Malur AG, Hoffman MA, Banerjee AK. The human parainfluenza virus type 3(HPIV 3) C protein inhibits viral transcription. Virus Res. 2004;99(2):199–204.14749186 10.1016/j.virusres.2003.11.009
17. Lin GY Lamb RA The paramyxovirus simian virus 5 V protein slows progression of the cell cycle J Virol 2000 74 19 9152 66 10.1128/JVI.74.19.9152-9166.2000 10982362
Lin GY, Lamb RA. The paramyxovirus simian virus 5 V protein slows progression of the cell cycle. J Virol. 2000;74(19):9152–66.10982362 10.1128/JVI.74.19.9152-9166.2000
18. Zhao H, Harris RJ, Ellis J et al. Epidemiology of parainfluenza infection in England and Wales, 1998–2013: any evidence of change? Epidemiol Infect, 2017: 1–11.
19. Murphy B Phelan PD Jack I Seasonal pattern in childhood viral lower respiratory tract infections in Melbourne Med J Aust 1980 1 1 22 4 10.5694/j.1326-5377.1980.tb134568.x 6244480
Murphy B, Phelan PD, Jack I, et al. Seasonal pattern in childhood viral lower respiratory tract infections in Melbourne. Med J Aust. 1980;1(1):22–4.6244480 10.5694/j.1326-5377.1980.tb134568.x
20. Henrickson KJ Kuhn SM Savatski LL Epidemiology and cost of infection with human parainfluenza virus types 1 and 2 in young children Clin Infect Dis 1994 18 5 770 9 10.1093/clinids/18.5.770 8075269
Henrickson KJ, Kuhn SM, Savatski LL. Epidemiology and cost of infection with human parainfluenza virus types 1 and 2 in young children. Clin Infect Dis. 1994;18(5):770–9.8075269 10.1093/clinids/18.5.770
21. Katoh K Standley DM MAFFT multiple sequence alignment software version 7: improvements in performance and usability Mol Biol Evol 2013 30 4 772 80 10.1093/molbev/mst010 23329690
Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30(4):772–80.23329690 10.1093/molbev/mst010
22. Nguyen LT Schmidt HA Von Haeseler A Minh BQ IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies Molecul Biol Evol 2015 32 1 268 74 10.1093/molbev/msu300
Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecul Biol Evol. 2015;32(1):268–74.10.1093/molbev/msu300
23. Yu G Smith DK Zhu H Guan Y Lam TTY Ggtree: an R package for visualization and annotation of phylogenetic trees with their covariates and other associated data, methods Ecol Evolut 2015 8 1 28 36
Yu G, Smith DK, Zhu H, Guan Y, Lam TTY. Ggtree: an R package for visualization and annotation of phylogenetic trees with their covariates and other associated data, methods Ecol. Evolut. 2015;8(1):28–36.
24. Kumar S Stecher G Li M Knyaz C Tamura K MEGA X: molecular evolutionary genetics analysis across computing platforms Molec Biol Evol 2018 35 6 1547 10.1093/molbev/msy096 29722887
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molec Biol Evol. 2018;35(6):1547.29722887 10.1093/molbev/msy096
25. Oh D-Y Biere B Grenz M Wolff T Schweiger B Dürrwald R Virological Surveillance and Molecular Characterization of Human Parainfluenzavirus Infection in children with Acute Respiratory illness: Germany, 2015–2019 Microorganisms 2021 9 7 1508 10.3390/microorganisms9071508 34361941
Oh D-Y, Biere B, Grenz M, Wolff T, Schweiger B, Dürrwald R. Virological Surveillance and Molecular Characterization of Human Parainfluenzavirus Infection in children with Acute Respiratory illness: Germany, 2015–2019. Microorganisms. 2021;9(7):1508. 10.3390/microorganisms9071508. Published 2021 Jul 14.34361941 10.3390/microorganisms9071508
26. Nicholas PDG Haynes AK Taylor C Killerby ME Dahl RM Mustaquim D Susan I Gerber, John T Watson Human parainfluenza virus circulation, United States, 2011–2019 J Clin Virol 2020 124 104261 10.1016/j.jcv.2020.104261 31954277
Nicholas PDG, Haynes AK, Taylor C, Killerby ME, Dahl RM, Mustaquim D, Susan I, Gerber, John T, Watson. Human parainfluenza virus circulation, United States, 2011–2019. J Clin Virol. 2020;124:104261. 10.1016/j.jcv.2020.104261.31954277 10.1016/j.jcv.2020.104261
27. Jia-li Lu Pathogenic analysis of children with common respiratory virus infections in shaoxing city of China Chin J Viral Di 2021 11 3 193 6
Jia-li, Lu. Pathogenic analysis of children with common respiratory virus infections in shaoxing city of China. Chin J Viral Di. 2021;11(3):193–6. [Chinese].
28. Branche AR Falsey AR Parainfluenza Virus infection Semin Respir Crit Care Med 2016 37 4 538 54 10.1055/s-0036-1584798 27486735
Branche AR, Falsey AR. Parainfluenza Virus infection. Semin Respir Crit Care Med. 2016;37(4):538–54. 10.1055/s-0036-1584798.27486735 10.1055/s-0036-1584798
29. Mizuta K Saitoh M Kobayashi M Tsukagoshi H Aoki Y Ikeda T Abiko C Katsushima N Itagaki T Noda M Kozawa K Ahiko T Kimura H Detailed genetic analysis of hemagglutinin-neuraminidase glycoprotein gene in human parainfluenza virus type 1 isolates from patients with acute respiratory infection between 2002 and 2009 in Yamagata prefecture, Japan Virol J 2011 8 533 10.1186/1743-422X-8-533 22152158
Mizuta K, Saitoh M, Kobayashi M, Tsukagoshi H, Aoki Y, Ikeda T, Abiko C, Katsushima N, Itagaki T, Noda M, Kozawa K, Ahiko T, Kimura H. Detailed genetic analysis of hemagglutinin-neuraminidase glycoprotein gene in human parainfluenza virus type 1 isolates from patients with acute respiratory infection between 2002 and 2009 in Yamagata prefecture, Japan. Virol J. 2011;8:533.22152158 10.1186/1743-422X-8-533
30. Chambers R Takimoto T Host specificity of the anti-interferon and anti-apoptosis activities of parainfluenza virus P/C gene products J Gen Virol 2009 90 Pt 8 1906 10.1099/vir.0.011700-0 19423549
Chambers R, Takimoto T. Host specificity of the anti-interferon and anti-apoptosis activities of parainfluenza virus P/C gene products. J Gen Virol. 2009;90(Pt 8):1906.19423549 10.1099/vir.0.011700-0
31. Beck ET, He J, Nelson MI et al. Genome sequencing and phylogenetic analysis of 39 human parainfluenza virus type 1 strains isolated from 1997–2010. 2012.
