
==== Front
BMC Infect Dis
BMC Infect Dis
BMC Infectious Diseases
1471-2334
BioMed Central London

9810
10.1186/s12879-024-09810-2
Research
Vibriocidal efficacy of Bifidobacterium bifidum and Lactobacillus acidophilus cell-free supernatants encapsulated in chitosan nanoparticles against multi-drug resistant Vibrio cholerae O1 El Tor
Derakhshan-sefidi Mozhgan 1
Bakhshi Bita B.Bakhshi@modares.ac.ir

1
Rasekhi Aliakbar 2
1 https://ror.org/03mwgfy56 grid.412266.5 0000 0001 1781 3962 Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
2 https://ror.org/03mwgfy56 grid.412266.5 0000 0001 1781 3962 Department of Biostatistics, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
2 9 2024
2 9 2024
2024
24 90527 4 2024
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Cholera is a diarrheal disease recognized for being caused by toxin-producing Vibrio (V.) cholerae. This study aims to assess the vibriocidal and immunomodulatory properties of derived cell-free supernatants (CFSs) of Bifidobacterium (B.) bifidum and Lactobacillus (L.) acidophilus encapsulated in chitosan nanoparticles (CFSb-CsNPs and CFSa-CsNPs) against clinical multi-drug resistance (MDR) isolates of V. cholerae O1 El Tor.

Methods

We synthesized CFSb-CsNPs and CFSa-CsNPs using the ionic gelation technique. The newly nanostructures were characterized for size, surface zeta potential, morphology, encapsulation efficacy (EE), stability in different pH values and temperatures, release profile, and in vitro cytotoxicity. The antimicrobial and antibiofilm effects of the obtained nanocomposites on clinical MDR isolates (N = 5) of V. cholerae E1 Tor O1 were investigated by microbroth dilution assay and crystal violet staining, respectively. We conducted quantitative real-time PCR (qRT-PCR) to analyze the relative gene expressions of Bap, Rbmc, CTXAB, and TCP in response to CFSb-CsNPs and CFSa-CsNPs. Additionally, the immunomodulatory effects of formulated structures on the expression of TLR2 and TLR4 genes in human colorectal adenocarcinoma cells (Caco-2) were studied.

Results

Nano-characterization analyses indicated that CFSb-CsNPs and CFSa-CsNPs exhibit spherical shapes under scanning electron microscopy (SEM) imaging, with mean diameters of 98.16 ± 0.763 nm and 83.90 ± 0.854 nm, respectively. Both types of nanoparticles possess positive surface charges. The EE% of CFSb-CsNPs was 77 ± 4.28%, whereas that of CFSa-CsNPs was 62.5 ± 7.33%. Chitosan (Cs) encapsulation leads to increased stability of CFSs in simulated pH conditions of the gastrointestinal tract in which the release rates for CFSb-CsNPs and CFSa-CsNPs were reached at 58.00 ± 1.24% and 55.01 ± 1.73%, respectively at pH = 7.4. The synergistic vibriocidal effects observed from the co-administration of both CFSb-CsNPs and CFSa-CsNPs, as evidenced by a fractional inhibitory concentration (FIC) index of 0.57, resulting in a significantly lower MIC of 2.5 ± 0.05 mg/mL (p < 0.0001) compare to individual administration. The combined antibacterial effect of CFSb-CsNPs and CFSa-CsNPs on Bap (0.14 ± 0.05), Rbmc (0.24 ± 0.01), CTXAB (0.30 ± 0.09), and TCP (0.38 ± 0.01) gene expression was significant (p < 0.001). Furthermore, co-administration of CFSb-CsNPs and CFSa-CsNPs also demonstrated the potency of suppressing TLR 2/4 (0.20 ± 0.01 and 0.12 ± 0.02, respectively) gene expression (p = 0.0019) and reduced Caco-2 cells attached bacteria to 526,000 ± 51,46 colony-forming units/mL (11.19%) (p < 0.0001).

Conclusion

Our study revealed that encapsulating CFSs within CsNPs enhances their vibriocidal activity by improving stability and enabling a controlled release mechanism at the site of interaction between the host and bacteria. Additionally, the simultaneous use of CFSb-CsNPs and CFSa-CsNPs exhibited superior vibriocidal potency against MDR V. cholerae O1 El Tor strains, indicating these combinations as a potential new approach against MDR bacteria.

Keywords

Cell-free supernatant
Lactobacillus acidophilus
Bifidobacterium bifidum
Vibrio cholerae
Nanoparticles
Antibacterial
http://dx.doi.org/10.13039/501100003968 Iran National Science Foundation 4012567 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Cholera is a worldwide health issue that is of great concern in the medical field, particularly in developing countries like Iran [1]. While antibiotic treatment is typically the initial approach for treating bacterial infections, the emergence of multidrug-resistance (MDR) strains has restricted the effectiveness of antibiotics [2, 3].

Probiotics possess significant antimicrobial or antagonistic capabilities, which encompass the secretion of antimicrobial substances like bacteriocins, competitive displacement of pathogens, reinforcement of the intestinal barrier to resist pathogens, and bolstering the host’s immune system to effectively fight against infectious agents [4]. Clinical trials have underscored the success of probiotics in managing gut-related health issues, producing favorable results [5]. Probiotics are a broad category that includes many different kinds of bacteria and fungus; however, the most widespread probiotic strains are Lactobacillus and Bifidobacterium (B.) species [6]. Research indicates that numerous Bifidobacterium strains possess antibacterial properties effective against a range of pathogens, such as Escherichia (E.) coli, Salmonella (S.) typhi [7], Streptococcus (S.) mutans [8], Propionibacterium acnes [9], and Listeria (L.) monocytogenes [10]. Furthermore, investigations suggest that Bifidobacterium strains can be utilized against MDR microorganisms. Notably, a study found that probiotics, including certain Lactobacillus strains, were capable of inhibiting or dismantling the biofilm produced by MDR E. coli; notably, B. longum exhibited the most potent inhibition against the biofilm generated by E. coli IC2 [11].

Vibriocidal effects of probiotic bacteria were studied in some limited investigations; such as Leuconostoc mesenteroides and Bacillus subtilis natto, alone and in combination [12], Bacillus velezensis [13], and Lactobacillus reuteri [14].

Exposure of Vibrio (V.) cholerae to antibiotics creates a stressful environment, prompting the bacterium to initiate biofilm formation as a response to these circumstances [15]. During biofilm formation in V. cholerae, two crucial matrix proteins, RbmC and Bap, are secreted at different stages and serve distinct roles within the biofilm. Bap is responsible for anchoring the biofilm to the surface, while RbmC facilitates cell-to-cell connectivity [16]. Previous studies have indicated that the absence of RbmC has a minimal impact on the structure of the biofilm pellicle in V. cholerae. However, the loss of both Bap and RbmC results in a significant reduction in biofilm formation [17]. Furthermore, the TCP gene production promotes the aggregation of multiple V. cholerae cells, enabling the close association and clustering necessary for micro-colony formation. The coordinated activation of CTXAB genes enables the production and release of cholera toxin, which significantly contributes to the development of cholera and its associated symptoms [18]. On the other hand, once biofilms are established, they withstand both immune responses and antibiotic treatments, contributing to the recurring nature of the infection [19]. Antimicrobial probiotics with the ability to disperse biofilms show promise for improved clinical outcomes in treating diarrhea caused by Vibrio species, as they could potentially serve as single-agent therapies [20]. Moreover, cholera is described as an inflammatory disorder that specifically impacts the small intestine. The interaction between V. cholerae and Toll-like receptors (TLRs), particularly TLR2 and 4, plays a crucial role in the initiation and progression of the inflammatory response [21]. Cell-free supernatants (CFSs) from vibrant probiotic cultures, particularly those high in antimicrobial compounds including lactic acid bacteria (LAB), undoubtedly stand out as a highly effective natural antimicrobial agent. Previous studies investigated the antimicrobial effects of probiotic CFSs against pathogens such as E. coli [22], S. Typhi, S. Typhimurium [23], L. monocytogenes [24], and Staphylococcus (S.) aureus [25]. A study by Beristain-Bauza in 2015 found that the antimicrobial capabilities of the cell-free supernatant produced by Lactobacillus (L.) rhamnosus are largely attributed to the presence of lactic acid and a bacteriocin-like compound [26].

The application of nanoparticles (NPs) to encapsulate drugs for delivery has attracted considerable interest owing to its numerous benefits over conventional drug delivery techniques [27]. Nanocapsulation safeguards drugs against degradation within the gastrointestinal tract, thereby enhancing their absorption [28]. Chitosan nanoparticles (CsNPs), recognized for their mucoadhesive and biodegradable nature, along with their positively charged amine groups, interact effectively with the negatively charged elements of the bacterial cell wall [29]. CsNPs possess the capability to act as an absorption booster in the intestinal lining, extending the dwell time of delivery vehicles at absorption locations and easing the tight junctions of cellular membranes [30]. Incorporating antimicrobial agents into CsNPs represents a significant advancement in probiotic research. This approach not only fortifies the stability of CFSs but also leverages Cs’s natural antimicrobial features to markedly enhance antibacterial and antibiofilm effectiveness [31].

Herein, we aim to investigate vibriocidal and immunomodulatory properties of newly-synthesized CFSb-CsNPs (cell-free supernatant of B. bifidum encapsulated in CsNPs) and CFSa-CsNPs (cell-free supernatant of L. acidophilus encapsulated in CsNPs), particularly their combined action against MDR V. cholerae strains. The current study hypothesized that incorporating CFSb and CFSa within CsNPs increases the antibacterial potency via the controlled release profile of cargo at the specific host-bacteria interface, improves its stability in the gastrointestinal (GI) tract, and can introduce novel nanocomponent to tackle V.cholerae infection.

Materials and methods

Preparation of bacterial strains

The probiotic strains used in this study were L. acidophilus ATCC 4356 and B. bifidum ATCC 29,521. This research included clinical strains of V. cholerae (N = 5), sourced from the microbial archives of the bacteriology department at the Faculty of Science, Tarbiat Modares University, Tehran, Iran. These strains were collected during the most recent cholera outbreak in the country. The identification of V. cholerae strains was based on biochemical assays as well as PCR amplification of the 16–23 s rRNA intergenic region specific to V. cholerae [32]. The strains exhibited resistance to tetracycline, cotrimoxazole, and trimethoprim. For the current project, the strains were cultured on Brain Heart Agar (Sigma, USA) medium and incubated at 37 °C for 24 h, after which they were used in our study.

CFS preparation of B. Bifidum and L. Acidophilus

The CFSs from B. bifidum and L. acidophilus were prepared following the method outlined by Jeffrey et al. in 2020 [33], with a few modifications. The active overnight culture of B. bifidum and L. acidophilus strains was diluted in fresh de Man–Rogosa–Sharpe (MRS) broth medium (Ibresco, Iran) (OD600nm = 0.23), and incubated at 37 °C for 48 h in microaerobiosis. To prepare CFSs of probiotic strains following overnight culture, the cells were removed by centrifuging at 6,000×g/4°C (Microcentrifuge sigma 1-14k, Germany) for 15 min. The generated supernatants were meticulously harvested and processed through sterilization via 0.22 μm polyvinylidene fluoride (PVDF) filters (Millipore Sigma, USA) to eliminate any traces of live cells. Following this treatment, samples of the CFS from each probiotic strain were placed onto a solid MRS medium and incubated at 37 °C for 48 h to verify the complete eradication of viable cells. The sterilized supernatants were divided into smaller portions to facilitate storage and future use and stored at -20 °C.

Synthesis and confirmation of nanoparticles

The ionotropic gelation technique was employed in the fabrication of CFSb-CsNPs and CFSa-CsNPs utilizing tripolyphosphate (TPP; molecular weight: 367.86 g/mol, Sigma-Aldrich, USA), following a method previously outlined [34]. This method hinges on the ionic interaction between the primary amine groups present in the Cs solution, which carries a positive charge, and the phosphate groups of the TPP solution, which bear a negative charge. In short, low molecular weight (50–200 kDa, Sigma, USA) chitosan (Cs; 0.05% w/v) was dispersed in an aqueous acetic acid solution (1.0% v/v) and stirred using magnetic stirrers (IKA@RH basic 2, Germany) until complete dissolution occurred. The pH of the Cs solution was adjusted to 6 using 1.0 N sodium hydroxide (NaOH), which ensures that Cs remains soluble over the concentrations tested. An aqueous TPP solution was then formulated at a concentration of 0.2 mg/mL (pH = 4). A 0.45 μm pore filter (Millipore, Sigma) was used to filter both the Cs and TPP solutions. The spontaneous formation of CFSb-CsNPs and CFSa-CsNPs occurred through the dropwise addition method. This involved carefully measured quantities of TPP solutions, prepared with precise amounts of each CFSb and CFSa (200.0 mg/mL), being added to Cs solutions. The volume ratios for Cs and TPP were maintained at 1:10 for both types of nanoparticles. The process was carried out using a disposable insulin needle, allowing for a controlled dropping rate of 0.20 mL/min. Throughout this procedure, the mixture was kept under constant magnetic stirring conditions for 2 h (25 °C, 450 rpm).

The NPs suspensions were purified via centrifugation (4 °C, 24,000 × g, 30 min), then washed and redispersed in deionized water before undergoing freeze-drying to yield the final synthesized nanoparticles (Zirbus VaCo5, Germany). The clear supernatant, rich in unentrapped CFS, was retained for calculation of drug encapsulation efficiency (EE %) by an indirect method using the Pierce™ BCA Protein assay kit (Thermo Scientific, UK) following the instructions provided by the manufacturer. The EE% was determined according to the formulation described below.

\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\rm{EE}}\% \, = \, {{{\rm{Loaded }}\,{\rm{protein}}\,{\rm{in}}\,{\rm{CFSb}}\, - \,{\rm{CsNPs }}/{\rm{CFSa}}{\kern 1pt} \, - \,{\rm{CsNPs }}\, - {\rm{ }}\,{\rm{CsNPs }}} \over {{\rm{Total }}\,{\rm{amount }}\,{\rm{of }}\,{\rm{protein}}\,{\rm{ in}}\,{\rm{CFSb }}\, - \,{\rm{CsNPs}}/{\rm{CFSa}}\,{\rm{ }} - \,{\rm{CsNPs }}}}\, \times \,100$$\end{document}

CS/TPP NPs were prepared using TPP solutions without CFS used as a control, following the same procedure.

To verify the precision of the synthesis of CFSb-CsNPs and CFSa-CsNPs, measurements of size distribution and zeta potential charge were performed (HORIBA-SZ100, Japan). For further confirmation of the created nanostructures, the nanopowders were dispersed in a 1.0% acetic acid solution, and a droplet was deposited onto an aluminum foil, followed by gold coating for morphological characterization using SEM imaging (20 kV, VEGA3 TESCAN, Czech Republic).

In vitro release kinetics of CFSs from CFSb-CsNPs and CFSa-CsNPs

The release kinetics profile of CFSs from CFSb-CsNPs and CFSa-CsNPs was conducted in buffers at varying pH levels. To achieve this, nanoparticles were suspended in phosphate buffer solutions (PBS) with a pH of 7.2 inside two distinct dialysis bags (Sigma, molecular weight cutoff = 12.0 kDa). Each sealed dialysis tube was subsequently submerged in a 20.0 mL solution at different pH values ranging from 1.2 to 7.4. At predetermined intervals (2, 4, 6, 8, 12, 24, 48, and 72 h), 5.0 mL aliquots were withdrawn and replenished with an equal volume of fresh solution. The quantity of CFSs discharged from both types of nanoparticles was determined utilizing the Pierce™ BCA Protein assay kit (Thermo Scientific, UK), following the manufacturer’s guidelines for usage. Bare CFSa and CFSb were used as positive controls.

Stability study of CFSb-CsNPs and CFSa-CsNPs

The stability analysis of the synthesized CFSb, CFSa, CFSb-CsNPs, and CFSa-CsNPs involves the examination of their size distribution, surface charge, and physical appearance at specific intervals over a period of 10, 20, 30, 45, and 60 days. The assessment of stability is conducted under different temperatures, including − 20 °C ± 1.03, 4 °C ± 0.37, 25 °C ± 0.16, and 37 °C ± 2.23 in a dark sealed glass container. To assess the quantity of protein loaded from the CFS encapsulated within CsNPs, following the evaluation of the antimicrobial properties of the synthesized nanostructures against MDR V. cholerae isolates at predetermined time intervals, the protein content was measured using the Pierce™ BCA Protein Assay Kit. To explore the pH stability of synthesized nanostructures, specifically CFSb-CsNPs, and CFSa-CsNPs, these particles were immersed in PBS at various pH levels 1.2, 4.5, 5.5, 6.5, and 7.4 at 37 °C. The pH of the PBS solutions was adjusted using either HCl (37.0% v/v) or NaOH (50.0% w/v) solutions. After a 2 h incubation period, which allowed for the establishment of swelling equilibrium, the particle size distribution was determined.

Antibacterial activity evaluation using microbroth dilution

The microbroth dilution assay, according to the Clinical and Laboratory Standards Institute [35], was done to determine the minimal inhibitory concentrations (MIC) of the synthesized nanoparticles. Briefly, cationic adjusted Muller Hinton Broth medium (MHB) (Merk, Germany) was utilized to achieve a final volume of 200.0 µL in each well of the 96-well microplate (SPL, Korea). This involved adding the overnight culture of clinical isolates of V. cholerae (20.0 µL) at a concentration of 1 × 108 CFU/mL (colony-forming units), along with 2-fold reduced serial concentrations of CsNPs, CFSb, CFSa, CFSb-CsNPs, and CFSa-CsNPs (800, 400, 200, 100, 50, 25, 10, 5, and 2.5 mg/mL). In the experiment, broth media with equal bacterial counts were utilized as the positive control, whereas blank broth media served as the negative control. The plates were then sealed and incubated for 18–24 h in a shaking incubator set at 37 °C (IKA@KS, Sigma, USA). The MIC values were determined by assessing the optical density (OD) of bacterial growth in wells treated with nanostructures versus the control wells (OD620 nm). Further, 100.0 µL of the supernatant from each well was inoculated onto a Brain heart infusion (BHI) agar medium to enumerate the viable bacteria that had been exposed to the synthesized nanoparticles. Initially, the ODs of bacterial samples subjected to varying nanoparticle concentrations at a wavelength of 620 nm were recorded. These readings were subsequently adjusted by subtracting the OD of the blank well. Ciprofloxacin (5.0 µg, Mast Group Ltd.) was also used as a positive control, revealing that 97.7 ± 0.02% of the strains exhibited susceptibility, while 2.3 ± 0.41% displayed an intermediate level of susceptibility. The checkerboard investigation also was carried out to study vibriocidal effects of co-administration of CFSb-CsNPs and CFSa-CsNPs. The concentration level of each nanostructure in combination ranged from 1/4 times the MIC (1/4 × MIC) to 4× MIC. To quantify the effect of the combinations, the fractional inhibitory concentration (FIC) was determined for each nanocomposite in combination with the FIC index being the sum of the FIC values of CFSb-CsNPs and CFSa-CsNPs. Synergistic interactions were characterized by an FIC index of ≤ 0.5 [36].

Microtitre biofilm inhibition study with crystal violet assay

To assess the prevention of biofilm development, we employed techniques outlined earlier [37]. Briefly, 90.0 µL of a bacterial solution in adjusted cations MHB (OD600 = 0.05), achieved by diluting overnight culture of bacteria in tryptic soy broth (TSB) with 1.0% sucrose, was introduced into the inner compartments of a 96-well polystyrene microtiter plate. This plate also contained 10.0 µL of CsNPs, CFSb, CFSa, CFSb-CsNPs, and CFSa-CsNPs, arranged in a 2-fold serial concentration (800 to 2.5 mg/mL). Following overnight incubation of sealed plates at 37 °C, allowing for bacterial proliferation and biofilm development, the next steps involved measuring the bacterial growth at OD600 (Epoch Microplate Spectrophotometer, BioTek Instruments Inc., USA). Subsequently, the planktonic cells and the remaining liquid were removed, and the attached mass was washed three times with distilled water. To visualize the biofilm, the mass was treated with a 0.1% crystal violet (CV) solution for 20 min, after which it was again rinsed three times with distilled water to eliminate any unattached dye. The dye that remained bound was then mixed gently with 70.0% ethanol, and the absorbance at 595 nm was measured on the same plate. The level of biofilm suppression was determined based on the quantity of biofilm formed in the absence of CsNPs, CFSb, CFSa, CFSb-CsNPs, and CFSa-CsNPs (considered as 100% biofilm) and the sterility of the media (rated as 0% biofilm). The findings were derived from averaging at least three independent experiments.

Cell culture cytotoxicity study

To investigate the cytotoxicity concentration of prepared nanostructures and bare CFSs, Caco-2 (human colorectal adenocarcinoma cell line) cells (Iranian Biological Resource Center) were seeded in a 96-well plate (4 × 105/well) in RPMI 1640 culture medium (Roswell Park Memorial Institute) supplemented with 12% fetal bovine serum (FBS), 1% l-glutathione, and 1% 10,000 I.U./mL penicillin and 10,000 µg/mL streptomycin (BioIdea, Iran). Following 85% confluence, CFSb-CsNPs, CFSa-CsNPs, CFSb, CFSa, and CsNPs were introduced to cells, and incubation in a humidified incubator was continued for 24, 48, and 72 h (25 °C, 5% Co2). Caco-2 cells infected with V. cholerae without treatment were the positive control, whereas those treated with PBS were designated as the negative control. The cytotoxicity of synthesized nanostructures (1-100 mg/mL) on Caco-2 cells was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit (Yekta Tajhiz Azma, Iran) according to manufacturer’s instructions. Each treatment was performed in triplicate.

In vitro gene expression evaluation

In vitro experimental groups and treatment conditions were established: (i) untreated Caco-2 cells (negative control), (ii) Caco-2 cells incubated with V. cholerae (positive control, MOI: 7), (iii) Caco-2 cells + V. cholerae + CFSb, (iv) Caco-2 cells + V. cholerae + CFSa, (v) Caco-2 cells + V. cholerae + CsNPs, (vi) Caco-2 cells + V. cholerae + CFSb-CsNPs, (vii) Caco-2 cells + V. cholerae + CFSa-CsNPs, and (viii) Caco-2 cells + V. cholerae + CFSb-CsNPs + CFSa-CsNPs. Following cytotoxicity evaluation of the designed nanosystem, according to half-inhibitory concentrations (IC50), CTXAB, Bap, RbmC, and TCP gene expression were measured by quantitative real-time PCR (qRT-PCR) at sub-MIC concentrations of CFSb-CsNPs, CFSa-CsNPs, CFSb, and CFSa in all MDR isolates of V. cholerae. To investigate TLR2 and 4 gene expression in Caco-2 cells infected with V.cholerae strains, following treatment with CFSb-CsNPs, CFSa-CsNPs, CFSb, and CFSa (37 °C, 24 h), RNA extraction and complementary DNA (cDNA) synthesis were performed according to the instructions by Total RNA extraction and cDNA synthesis kits (Yekta Tajhiz Azma, Iran). The qRT-PCR was done with applications of the 2−ΔΔCT method [38] with a total volume reaction of 25.0 µL, consisting of 2X Real Q plus SYBR Green Master Mix (Amplicon), 10.0 pmol of primers, and 1.0 µl of cDNA product obtained from reverse transcription (Table 1). All samples were triplicated by control gene expression (GAPDH and 16srRNA).

Table 1 Oligonucleotides sequences used in this study

Gene	Sequences (5’-3’)	Amplification
conditions	Amplification product size (bp)	Ref	
16srRNA	F*: GGAAACGATGGCTAATACCG

R: GCCCTTACCTCACCAACTAG

	94 °C (90 s)

60 °C (30 s)

72 °C (60 s)

	110	[77]	
Bap	F: CGCTGGCACACTAAACAAG

R: CCATACATTCATACCCAAGAGC

	94 °C (45 s)

60 °C (30 s)

72 °C (60 s)

	147	
RbmC	F: CGAGCAATAAGAAAGTGG

R: GCCTTCAACTAACCAAC

	94 °C (30 s)

52 °C (30 s)

72 °C (60 s)

	92	
CTXAB	F: TATGCCAAGAGGACAGAGTGAG

R: AACATATCCATCATCGTGCCTAAC

	94 °C (45 s)

62 °C (30 s)

72 °C (60 s)

	115	[78]	
TCP	F: ATCCTTTCACTGGTACAGCTATG

R: GTCAAGCCACCGACTGTAAT

	94 °C (60 s)

60 °C (30 s)

72 °C (60 s)

	91		
GAPDH	F: GAAGGTGAAGGTCGGAGTC

R: GAAGATGGTGATGGGATTTC

	95 °C (60 s)

52 °C (30 s)

72 °C (60 s)

	226	[79]	
TLR2	F: AACTTACTGGGAAATCCTTAC

R: AAAAATCTCCAGCAGTAAAAT

	94 °C (45 s)

55 °C (30 s)

72 °C (60 s)

	264	[80]	
TLR4	F: AAGCCGAAAGGTGATTGTTG

R: CTGAGCAGGGTCTTCTCCAC

	94 °C (60 s)

62 °C (30 s)

72 °C (60 s)

	153	[81]	
* F forward, R reverse

In vitro V. Cholerae isolates attachment and internalization study in the presence of CFSb-CsNPs and CFSa-CsNPs

5 × 106 Caco-2 cells were seeded in a 24-well polystyrene plate (SPL, Korea), and the cells were allowed to reach 80% confluence. At this point, the synthesized nanocomposites were introduced to the cells and incubated at 37 °C. The wells were washed three times with PBS and 2 × 107 CFU/mL of V. cholerae isolates (MOI:7) were introduced into the wells. To investigate the attached bacteria, 0.01% Triton-X 100 was added to each well and the lysates were then cultured on BHI agar.

Another triplicate set of infected cells was subjected to treatment with gentamicin (Sigma, USA) for a duration of 1 h. This treatment aimed to remove the attached bacteria. After the treatment, the cells were lysed using 0.01% Triton-X 100 in PBS. The lysates were then cultured on BHI agar at various dilutions. The average number of colonies obtained from the cultures represents the count of bacteria that invaded the cells. To observe the adhesion of V. cholerae strains to Caco-2 cells in the presence of CFSb-CsNPs and CFSa-CsNPs, and to enhance visualization, Giemsa staining was applied to infected cells that were fixed with cold isopropanol after being exposed to the nanoparticles for 3 h at 37 °C (LABOMED; Inc, USA).

Statistical analysis

Data were examined using the one-way ANOVA (Non-parametric tests) followed by the Sidaks test in GraphPad Prism 9.5.1 (GraphPad Software, Inc., La Jolla, CA, USA). A P-value less than 0.05 was considered significant. The mean ± standard deviation (Mean ± SD) of the replicate results was evaluated. All tests were performed in triplicate.

Results

Characterization of synthesized NPs

SEM images reveal the spherical and smooth morphology of the formulated nanostructures (Fig. 1A-B). DLS analysis indicates an optimal average size of 98.16 ± 0.763 nm for CFSb-CsNPs and 83.9 ± 0.854 nm for CFSa-CsNPs. The surface charge measurements also show a positive zeta potential of + 1.7 ± 0.427 mV for CFSb-CsNPs and + 3.3 ± 0.2 mV for CFSa-CsNPs (Fig. 1C- D). EE% of CFSs within CsNPs was found to be suitable at 77 ± 4.28% for CFSb-CsNPs and 62.5 ± 7.33% for CFSa-CsNPs.

Fig. 1 Physicochemical characteristics of synthesize nanostructures; SEM imaging; A CsNPs B CFSb-CsNPs, C CFSa-CsNPs; size distribution and zeta potential measurement; D CFSb-CsNPs, and E CFSa-CsNPs. CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles

In simulated GI system pH conditions and considering the typical transit times of orally administered drugs through various segments of the GI [39], we noted that over a maximum duration of 2 h post-stomach transit, approximately 23.33 ± 4.37% and 20.00 ± 1.15% of the drug was released for CFSb-CsNPs and CFSa-CsNPs, respectively, at pH = 1.2. The small intestine, the colonization site of V.cholerae, typically has a consistent transit time, averaging between 3 and 4 h, though this can range from 2 to 6 h among healthy individuals. Over a maximum 6 h period in the small intestine with a pH = 7.4, the release rates for CFSb-CsNPs and CFSa-CsNPs reached at 58.00 ± 1.24% and 55.01 ± 1.73%, respectively (Fig. 2A-B).

Fig. 2 Release profile analysis at various pH condition; A CFSb-CsNPs, B CFSa-CsNPs, C mean size distribution of fabricated nanostructures in response to 2 h incubation in different pH, D viable colony count in response to 24 h treatment with various convention of CsNPs, CFSa, CFSb, CFSa-CsNPs, and CFSb-CsNPs on brain heart infusion agar, E effect of CsNPs, CFSa, CFSb, CFSa-CsNPs, and CFSb-CsNPs composites on biofilm inhibition of multi-drug resistance Vibrio cholerae O1 El Tor isolates with CV staining in microtiter plate; cell cytotoxicity study, F 24 h, G 48 h, H 72 h. CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles

Stability assessment of CFSb-CsNPs and CFSa-CsNPs

In the stability study over 60 days, the nanostructures maintained minimal variation in size distribution with no change in the appearance of the lyophilized powder (Table 2). However, their zeta potentials underwent alterations, influenced by temperature changes which impacted their antimicrobial actions. The study on the alterations in the dimensions and surface charge of CFSb-CsNPs and CFSa-CsNPs nanostructures across varying temperatures reveals significant effects at 37 °C and 25 °C on nanoparticle size. However, the maximum stability of the nanostructure was obtained at 4 °C and especially at -20 °C. The analysis of protein levels using a Pierce™ BCA Protein Assay Kit over a designated timeframe revealed that at lower temperatures (4 °C and − 20 °C), after 60 days, the protein content in CFSb-CsNPs and CFSa-CsNPs only decreased to 82.02 ± 1.40% (6347.0 ± 10.37 µg/mL) and 78.064 ± 0.85% (6930.0 ± 22.38 µg/mL) at 4 °C and 88.32 ± 2.00% (7069.0 ± 12.0 µg/mL) and 85.0 ± 16.04% (7504.0 ± 16.04 µg/mL) at -20 °C, highlighting the preservation of their vibriocidal properties under lower storage conditions. This observation underscores the stabilizing effect of CsNPs on the encapsulated CFSs. In contrast, after only 20 days, the protein concentrations of CFSa and CFSb decreased to 523.0 ± 7.54 µg/mL and 517.0 ± 9.24 µg/mL at -20 °C, and 411.0 ± 7.85 µg/mL and 426.0 ± 3.04 µg/mL at 4 °C, respectively, which show decreased vibriocidal potency to 32.01 ± 0.05% and 19.01 ± 0.62%, respectively (Table 3). The impact of pH on the average diameters of CFSb-CsNPs and CFSa-CsNPs, following exposure to different pH levels of PBS solutions over 2 h, demonstrated a notable increase in size as the pH level rose from 4.5 to 5.5. However, beyond a pH = 5.5 up to the pH = 7.4, the particles exhibited remarkable stability in their size (p = 0.02) (Fig. 2C).

Table 2 Stability evaluation of synthesized nanostructures during 60 days in -20 °C, 4 °C, 25 °C, and 37 °C by measuring size distribution (nm) and surface charge (mV). CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in Chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles

Formulation	Temperature (°C)	Storage time (Days)	
0	10	20	30	60	
Size distribution (nm)/surface charge (mV)	
CFSb-CsNPs	-20 ± 1.03	98.02 ± 0.26

+ 1.7 ± 0.42

	98.11 ± 0.14

+ 1.7 ± 0.02

	98.11 ± 0.01

+ 1.7 ± 0.13

	99.11 ± 0.0

+ 1.7 ± 0.29

	100.11 ± 0.0

+ 1.7 ± 0.17

	
4 ± 0.37	99.19 ± 0.01

+ 1.7 ± 0.12

	99.3 ± 0.16

+ 1.00 ± 0.40

	100.50 ± 0.51

+ 0.93 ± 0.02

	100.93 ± 0.43

+ 0.81 ± 0.07

	
25 ± 1.40	99.47 ± 0.45

+ 1.7 ± 0.01

	107.9 ± 0.1

+ 1.00 ± 0.01

	111.33 ± 1.52

+ 0.23 ± 0.15

	116.6 ± 2.51

-1.32 ± 0.27

	
37 ± 2.23	100.11 ± 2.11

+ 1.65 ± 0.05

	118 ± 5.84

+ 0.85 ± 0.23

	122 ± 1.48

-1.23 ± 0.17

	141 ± 2.73

-2.54 ± 1.40

	
CFSa-CsNPs	-20 ± 1.03	83.66 ± 0.06

+ 3.3 ± 0.15

	84.75 ± 0.13

+ 3.3 ± 0.38

	84.79 ± 0.26

+ 3.2 ± 0.38

	89.80 ± 0.09

+ 3.00 ± 0.49

	
4 ± 0.37	85.89 ± 0.081

+ 3.3 ± 0.87

	87.9 ± 0.854

+ 3.15 ± 0.03

	92.96 ± 0.049

+ 2.46 ± 0.5

	98.10 ± 0.110

+ 2.55 ± 0.11

	
25 ± 1.40	85.91 ± 0.06

+ 3.3 ± 0.43

	91.96 ± 0.05

+ 3.11 ± 0.57

	101.03 ± 0.00

+ 3.07 ± 0.07

	118.40 ± 0.52

+ 2.93 ± 0.07

	
37 ± 2.23	85.11 ± 2.14

+ 2.37 ± 0.64

	90.14 ± 2.45

+ 2.00 ± 0.05

	93.62 ± 1.54

+ 1.02 ± 0.27

	132.72 ± 2.45

+ 0.57 ± 0.33

	

Table 3 Stability evaluation of synthesized nanostructures during 60 days in -20 °C, 4 °C, 25 °C, and 37 °C by measuring protein content using the Pierce™ BCA protein assay kit (Thermo Scientific, UK). CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in Chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles, CFSb cell-free supernatant of Bifidobacterium bifidum, and CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus

Formulation	Temperature (°C)	Storage time (Days)	
0	10	20	30	60	
Loading protein (µg/mL)	
CFSb	-20 ± 1.03	7971 ± 62.14	3160.0 ± 6.07	517.0 ± 9.24	35.14 ± 2.11	ND*	
4 ± 0.37	1327.10 ± 11.87	426.0 ± 3.04	11.0 ± 1.25	
25 ± 1.40	264.09 ± 10.67	87.0 ± 1.05	ND	
37 ± 2.23	230.0 ± 5.41	11.25 ± 1.40	
CFSa	-20 ± 1.03	2500.14 ± 8.02	523.0 ± 7.54	44.07 ± 3.60	ND	
4 ± 0.37	1026.0 ± 9.05	411.0 ± 7.85	15.36 ± 0.05	
25 ± 1.40	249.68 ± 3.55	53.36 ± 3.25	ND	
37 ± 2.23	174.13 ± 2.05	19.47 ± 0.81	
CFSb-CsNPs	-20 ± 1.03	7880 ± 22.04	7600.0 ± 17.24	7428.13 ± 9.53	7069.0 ± 12.0	
4 ± 0.37	7800.0 ± 12.0	7013.42 ± 6.78	6794.86 ± 11.0	6347.0 ± 10.37	
25 ± 1.40	6288.14 ± 9.46	5500.0 ± 19.78	4608.57 ± 13.0	3347.0 ± 11.0	
37 ± 2.23	4400.0 ± 24.22	3018.48 ± 14.37	2201.0 ± 14.92	1500.0 ± 9.25	
CFSa-CsNPs	-20 ± 1.03	7900.0 ± 39.11	7827.0 ± 12.64	7601.24 ± 25.43	7504.0 ± 16.04	
4 ± 0.37	7923.49 ± 08	7600.0 ± 23.07	7109.88 ± 16.22	6930.0 ± 22.38	
25 ± 1.40	6944.0 ± 16.15	5100.17 ± 15.99	3950.44 ± 19.37	3200.0 ± 14.11	
37 ± 2.23	5027.14 ± 33.0	3219.0 ± 14.08	2740.0 ± 9.74	930.06 ± 11.87	
ND* Not detectable

Antibacterial activity evaluation using microbroth dilution technique

The MIC value for CFSb-CsNPs was determined to be 10.56 ± 0.19 mg/mL, whereas that for CFSa-CsNPs was 48.27 ± 2.29 mg/mL. Interestingly, the MIC values for CFSb (476 ± 5.71 mg/mL), CFSa (512 ± 20.34 mg/mL), and CsNPs (110 ± 0.36 mg/mL) were all found to be greater than those for CFSb-CsNPs and CFSa-CsNPs (p < 0.001). The colony counts of viable V. cholerae in response to concentrations exceeding 5 ± 0.14 mg/mL of CFSb-CsNPs and above 25 ± 0.03 mg/mL of CFSa-CsNPs further demonstrates the antimicrobial efficacy of the formulated CFSs-Cs encapsulation (Fig. 2D). Additionally, the synergistic vibriocidal effects observed from the co-administration of both CFSb-CsNPs and CFSa-CsNPs, as evidenced by a fractional inhibitory concentration (FIC) index of 0.57, resulting in a significantly lower MIC of 2.5 ± 0.05 mg/mL. This MIC value is substantially lower than those of the individual CFSs, CFSb-CsNPs, and CFSa-CsNPs highlighting the enhanced antibacterial activity achieved through their combined use (p < 0.0001).

Microtitre biofilm inhibition study with crystal violet assay

The process of removing unattached bacteria from the microtiter plate and subsequently staining the adherent biomass with CV highlighted a significant correlation between the extent of biofilm development and the antibiofilm component of the culture medium used. In the study on MDR V.cholerae biofilms, it was observed that growth in TSB supplemented with 1.0% glucose led to significant adherence of bacteria (~ 100.0%). Further analysis showed that treating V.cholerae with varying concentrations of CsNPs, CFSb, CFSa, CFSb-CsNPs, and CFSa-CsNPs demonstrated that all these components, at concentrations exceeding 200 ± 4.23 mg/mL, were effective in inhibiting biofilm formation. Notably, the inhibitory concentration for the CFSb-CsNPs and CFSa-CsNPs was found to be lower, specifically at 10 ± 0.06 mg/mL (Fig. 2E). The findings indicate a significant synergistic effect between CsNPs and CFS in inhibiting bacterial biofilms (p ≤ 0.001).

Cell culture cytotoxicity study

Figure 2F-H displays the cytotoxicity data gathered over a 72-h period. The in vitro assessment of CFS cytotoxicity from both selected bacteria and CsNPs reveals an IC50 value exceeding 100.0 mg/ml. Similarly, the IC50 values for CFSb-CsNPs and CFSa-CsNPs surpassed 100.0 mg/mL after 48 h. By the end of the 72-h observation period, the IC50 values for CFSb-CsNPs and CFSa-CsNPs were calculated to be 25.33 ± 2.60 mg/mL and 50.73 ± 0.05 mg/mL, respectively (p ≤ 0.001). In contrast, the IC50 of CsNPs over 72 h remains above 100 mg/mL. These results indicate that at the MIC, the synthesized nanostructures pose no harm to Caco-2 cells.

In vitro gene expression evaluation

Upon addition of diverse compounds, including CFSb, CFSa, CsNPs, CFSb-CsNPs, CFSa-CsNPs, and CFSb-CsNPs + CFSa-CsNPs, to the Caco-2 cell medium, the TLR2 gene expression was determined to be 0.66 ± 0.18, 0.74 ± 0.04, 0.81 ± 0.91, 0.45 ± 0.02, 0.61 ± 0.46, and 0.20 ± 0.01, respectively. Similarly, the TLR4 gene expression was found to be 0.51 ± 0.08, 0.60 ± 0.02, 0.82 ± 0.14, 0.27 ± 0.16, 0.42 ± 0.05, and 0.12 ± 0.02, respectively. Significantly, there was a prominent difference in the downregulation of the TLR2 and TLR4 genes when treated with CFSb-CsNPs + CFSa-CsNPs compared to other compounds (p < 0.0001). Moreover, CFSb-CsNPs and CFSa-CsNPs demonstrated greater efficacy in inhibiting the expression of TLR2 and TLR4 genes compared to CFSb, CFSa, and CsNPs (Fig. 3A- B).

Fig. 3 Effect of CFSb, CFSa, CsNPs, CFSb-CsNPs, CFSa-CsNPs, and CFSb-CsNPs + CFSa-CsNPs on gene expression analysis by quantitative real-time PCR, A TLR2, B TLR4, C CTXAB, D TCP, E Bap, and F RbmC genes, non-parametric ANOVA (Sidaks test) was done for comparisons analysis (p˂0.05). CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles, Bap Biofilm associated protein, RbmC Rugosity and Biofilm Modulators, TCP Toxin-coregulated pilus, TLR Toll-like receptor

The expression levels of CTXAB and TCP genes in V. cholerae isolates were examined in response to treatments, including CFSb, CFSa, CsNPs, CFSb-CsNPs, CFSa-CsNPs, and CFSb-CsNPs + CFSa-CsNPs. The results showed a reduction in CTXAB gene expression by 1.38 ± 0.05, 1.28 ± 0.03, 1.09 ± 0.06, 1.92 ± 0.18, 1.61 ± 0.01, and 3.33 ± 0.09, respectively. The gene expression of TCP was reduced by 1.44 ± 0.03, 1.23 ± 0.04, 1.12 ± 0.13, 2.08 ± 0.05, 1.36 ± 0.07, and 2.63 ± 0.01, respectively (p < 0.001) (Fig. 3C-D).

The expression of Bap gene was found to be 0.80 ± 0.01, 0.78 ± 0.33, 0.91 ± 0.49, 0.61 ± 0.02, 0.74 ± 0.64, and 0.14 ± 0.05 fold changes, respectively, while for RbmC it was 0.73 ± 0.04, 0.78 ± 0.91, 0.83 ± 0.41, 0.61 ± 0.04, 0.72 ± 0.16, and 0.24 ± 0.01 respectively, in response to CFSb, CFSa, CsNPs, CFSb-CsNPs, CFSa-CsNPs, and CFSb-CsNPs + CFSa-CsNPs (p < 0.001). The combination of CFSb-CsNPs and CFSa-CsNPs demonstrated a winner nanocomponent that significantly attenuated the expression of all CTXAB, TCP, Bap, and RbmC genes in MDR clinical isolates of V.cholerae (Fig. 3E- F).

In vitro V. Cholerae isolates attachment and internalization study in the presence of CFSb-CsNPs and CFSa-CsNPs

According to the results in Fig. 4A, V. cholerae demonstrated a strong ability to attach to and form a robust biofilm on the surface of Caco-2 cells. However, when CFSb-CsNPs were applied (Fig. 4B), the number of attached bacteria decreased by 27.71 ± 0.03% (p < 0.0001). Similarly, when CFSa-CsNPs were applied (Fig. 4C), the number of attached bacteria decreased by 42.18 ± 0.14% (p < 0.0025). Co-administration of CFSb-CsNPs and CFSa-CsNPs resulted in a further reduction of attached bacteria to 526,000 ± 51,46 (11.19%) colony-forming units (CFU) (p < 0.0001) in the presence of 2 × 107 CFU/mL bacteria (Fig. 4D- F).

Fig. 4 Vibrio(V.) cholerae adhesion and internalization to monolayer Caco-2 cells (MOI: 7 V. cholerae /100 Caco-2 cells) observed after Giemsa staining using light microscopy ×40 in the presence of synthesized nanostructures, A positive control, B CFSb-CsNPs, C CFSa-CsNPs, D CFSb-CsNPs + CFSa-CsNPs, and E negative control; diagrams representing F attached V.cholerae and G bacterial internalization rates in Caco-2 cells in present of nanostructures; comparisons were analyzed with non-parametric ANOVA (Sidaks test) ****˂0.0001, ***˂0.0004, **˂0.0025, and *˂0.05. CFSb-CsNPs cell-free supernatant of Bifidobacterium bifidum encapsulated in chitosan nanoparticles, CFSa-CsNPs cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles, Caco-2 cells Human colorectal adenocarcinoma cells

The presence of CFSb-CsNPs also led to a bacterial internalization rate of approximately 20 ± 1.00 CFU/mL. In contrast, the presence of CFSa-CsNPs resulted in a higher internalization rate of approximately 31.67 ± 2.96 CFU/mL. However, when CFSb-CsNPs and CFSa-CsNPs were combined, a significant reduction in bacterial internalization was observed, with an internalization rate of approximately 4.66 ± 1.45 CFU/mL (Fig. 4G).

Discussion

V. cholerae, specifically serogroup O1, is accountable for the majority of cholera cases worldwide and has been subjected to treatment with multiple classes of antibiotics throughout the years [40]. Our investigation focuses on evaluating the antibacterial, antibiofilm, and immunomodulatory properties of CFSb-CsNPs and CFSa-CsNPs, against clinical isolates of MDR V. cholerae. Additionally, our research underscores the importance of CsNPs in boosting the stability and managing the release of CFSs under simulated GI pH levels and varying temperatures. Numerous literature studies have shown prominent antibacterial effects of probiotic bacteria and their CFSs. Recent in vitro investigations revealed antimicrobial effect of lactobacilli strains against various Vibrio species, including V. parahaemolyticus [41, 42] and V. cholerae [43]. Other study demonstrated the bactericidal or bacteriostatic effects of CFSs derived from four lactobacillus strains, namely L. acidophilus, L. delbrueckii, L. plantarum, and L. johnsonii, with doses ranging from 18 to 22%, 20–22%, 46–48%, and 50–54%, respectively, against Pseudomonas (p) aeruginosa strains [44]. The CFS of L. reuteri AN417 also exhibited antibacterial activity against three oral pathogens: Porphyromonas gingivalis, Fusobacterium nucleatum, and S. mutans [45]. M. K. Al-Malkey et al. (2017) [46] reported that bacteriocins produced by L. acidophilus and L. rhamnosus exhibited promising results as potential bio-therapeutic alternatives to combat multi-drug resistant P. aeruginosa. The largest inhibitory zones were observed with free cell supernatants, underscoring their significant antimicrobial potential. This finding aligns with the work of Daba and Saidi (2015) [47] who investigated the inhibitory effects of bacteriocin-producing LAB against P. aeruginosa and E.coli using CFSs and cell diffusion methods, reinforcing the role of these probiotics in combating antibiotic-resistant pathogens. Consistent with the aforementioned studies, our findings demonstrated that CFSb and CFSa exhibited MIC values of 476 ± 5.71 mg/mL and 512 ± 20.34 mg/mL, respectively, against MDR isolates of V. cholerae.

In the study conducted by Raafat et al., the impact of Cs on bacterial cells was explored, revealing its ability to modify the bacterial and indicated antimicrobial properties associated with Cs [48]. In a separate investigation, the incorporation of L. helveticus CFS into CsNPs resulted in notable antimicrobial activity against Bacillus cereus, Bacillus sciuri, E. coli, and P. aeruginosa, surpassing the efficacy of free CFS. However, the enhanced antimicrobial effect of CFS loaded into CsNPs was observed specifically against Salmonella enterica, reducing the MIC by 47% compared to free CFS [49]. We examined the vibriocidal properties of ionic gelation synthesized CFSb-CsNPs and CFSa-CsNPs, which were found to have optimal sizes and a positive surface charge. These synthesized nanostructures, due to their spherical shape, were efficiently taken up by bacteria through endocytosis, which significantly boosted their ability to kill bacteria. The MIC value of both CFSb-CsNPs and CFSa-CsNPs against MDR V. cholerae strains was substantially reduced to 10.56 ± 0.19 mg/mL and 48.27 ± 2.29 mg/mL, respectively, compared to Cs-free CFS (p < 0.0001). Additionally, the combined administration of CFSb-CsNPs and CFSa-CsNPs resulted in a notable increase in vibriocidal activity (FIC = 0.57).

The stability of the antibacterial properties of CFS is crucial for their commercial viability. Ideally, CFS should be kept at room temperature to minimize the extra expenses linked to refrigeration or freezing. However, their performance at 37 °C, which corresponds to the body temperature in vivo models, warrants consideration. Cardost et al. conducted a study on the stability of Enterococcus. faecalis DBFIQ E24 CFS at various temperatures (4 °C, 25 °C, 37 °C, and − 20 °C) over 5 months. The results showed that the CFS retained its antimicrobial effectiveness for only a month, after which a noticeable decline in antimicrobial activity was observed at all tested temperatures [50]. In contrast, Nakamura et al. found that concentrated CFS from L. gasseri LA39 exhibited good stability, with high bacteriocin activity observed for 2 months at 37 °C and up to 9 months at 4 °C. Similarly, stable results (3 months) were reported for CFS from L. plantarum YML007 when stored at room temperature [51].

To evaluate the benefits of nano-formulation compared to unformulated CFSs, our study employed two approaches: examining the stability of CFSs versus bare-CFSs, where we observed minimal changes in size distribution and no alteration in the appearance of the lyophilized powder of CFSb-CsNPs and CFSa-CsNPs over 60 days. Additionally, we noted the superior antimicrobial effectiveness of CFSb-CsNPs and CFSa-CsNPs relative to standalone CFSs, achieved through high protein loading capacity over a specified duration, and emphasized the retention of their vibriocidal properties even under less stringent storage conditions.The pH-responsive characteristics of CFSb-CsNPs and CFSa-CsNPs can be attributed to the protonation of the primary amino groups within the Cs backbone. This process enhances the electrical charge and the repulsive forces among the cross-linked chitosan chains [52]. Our findings suggest that the particle size is highly reactive to variations in the pH of the surrounding aqueous medium, implying that the surface concentration of protonated amino groups and the extent of protonation are inversely proportional to changes in solution pH. This research focuses on understanding the swelling and shrinking dynamics associated with fluctuating pH levels, aiming to develop intelligent nanoparticle systems suitable for targeted drug delivery. Specifically, we have shown that CsNPs exhibit pH sensitivity through a reversible cycle of particle expansion and contraction, with particle size diameters varying from approximately 150 nm to around 90 nm. Consistent with our results in the study by R. S. Tığlı Aydın et al. (2012) [53], the pH responsiveness of the 5FU-CsNPs was examined, revealing a notable swelling reaction at pH = 5. Previous literature reviews do not report on investigations into the stability of CFS at varying pH levels. However, in a study conducted by Wala’a and Nibras in 2013, they explored the stability of bacteriocins derived from L. acidophilus CFS against Serratia marcescens. Their findings indicated that bacteriocins from L. acidophilus were effective against Serratia marcescens. Specifically, the bacteriocin from L. acidophilus retained stability at pH = 4, with half of its activity diminished at pH = 8, and completely lost at other pH values [46].

The results of our study showed that the synthesized nanomedicine, with a focus on its vibriocidal property, exhibited controlled drug release profiles under both acidic and physiological conditions. These pH conditions were chosen to simulate the acidic environment of the GI, ranging from the mouth to the intestinal lumen. The present findings indicated that the optimal conditions for drug delivery were observed at pH = 7.2. This suggests that the nanostructures effectively retain their cargo until they reach the intended target in the intestinal lumen, where they are expected to interact with pathogens. Similar to our study, Sarveswari et al. conducted an in vivo cholera model and reported findings that align with our results. They observed a burst release of the drug at pH = 7, followed by a controlled and linear release in alkaline pH conditions [54]. Saberpour et al. conducted a study in which they investigated the release behavior of mesenchymal stem cells-derived conditioned media from Cs nanostructures under two different pHs 3.2 and 7.2. In contrast to our findings, they reported no initial burst release within the first few hours. Instead, they observed a gradual release of approximately 40% of the cargo for 12–48 h at pH 7.2 [55]. In line with these studies and our release profile of cargo, the prolonged release pattern of the cargo enables a consistent and uniform drug concentration to be maintained over an extended period. This ensures the effectiveness of the drug while minimizing the risk of side effects associated with rapid release. Our research specifically indicates that during the transition across the small intestine, the site of colonization for V. cholerae, CFSb-CsNPs and CFSa-CsNPs discharged their contents at rates of 35.01 ± 1.03% and 33.41 ± 0.24%, respectively.

To evaluate the primary inhibitory effects of CFSb-CsNPs and CFSa-CsNPs on MDR V. cholerae, we investigated the expression of virulence genes in the selected isolates. In our study, we observed that the combination of CFSb-CsNPs and CFSa-CsNPs had an impact on the growth environment of V. cholerae, leading to changes in the expression of genes involved in the bacteria’s pathogenesis. The analysis of gene expression revealed that CFSb-CsNPs, CFSa-CsNPs, and CFSb-CsNPs + CFSa-CsNPs exhibited attenuating effects on CTXAB and TCP genes expression in compare to Cs-free CFSs (p˂0.003). A recent study also reported L. rhamnosus GG and B. longum were both shown to be capable of removing 68% and 59%, respectively, of the cholera toxin from aqueous solutions over 18 h of incubation at 37 °C. By altering the toxin receptor through an enzymatic mechanism, probiotics have been used in several ways to interfere with the quorum-sensing function of the toxin receptor. Other proposed pathways include the inhibition of toxin synthesis, the lowering of gut pH, and the abatement of pathogenicity [56]. The findings of the study by Alamdary et al. [57] revealed that L. acidophilus is a safe supplement that has a protective effect on human epithelial colorectal cells and is potent enough to be utilized as an additional treatment for attenuating toxin production in acute infectious diarrhea brought on by V. cholerae.

In the exploration of the bactericidal abilities of probiotic bacteria and the CFSs they produce, several studies have concentrated on their antibiofilm properties. In an investigation in 2023, the CFS obtained from Lactobacillus spp. isolated from fecal samples of healthy children exhibited a remarkable preformed antibiofilm activity against V. cholerae, reducing it by 90% [58]. Other study demonstrated that the CFS derived from seven strains of Lactobacillus, isolated from infant feces, effectively inhibited the formation of biofilms by P. aeruginosa in burn wounds [59]. Zamani H., et al. [60] also revealed the CFS obtained from L.plantarum isolated from Siahmazgi cheese demonstrated significant anti-adhesive potential, inhibiting the adhesiveness of P.aeruginosa, S. aureus, and E.coli by 76.8%, 58.6%, and 52.2%, respectively [60]. However, our study revealed that while free CFSs did not have notable antibiofilm effects, CFSb-CsNPs and CFSa-CsNPs exhibited effective antibiofilm activity against MDR V.cholerae isolates. The application of CFSb-CsNPs resulted in a downregulation of Bap and RbmC genes in V. cholerae isolates (p = 0.0421). The substantial reduction in the number of Caco-2 cells attached bacteria, in comparison to the positive control (3,396,000 ± 205,066), offers additional proof of the inhibitory impact exerted by co-administration of CFSb-CsNPs + CFSa-CsNPs on the attachment of V. cholerae isolates to the cell surface. This finding further supports the antibiofilm properties of the synthesized nanostructures (p < 0.0001).

Cs and CsNPs, depending on their molecular weight [61], have been noted for their ability to bind to the bacterial membrane. This binding facilitates the deeper penetration of antibacterial agents into biofilms and alters their hydrophobic characteristics. This interaction is believed to contribute to the observed inhibition of adhesion [62, 63]. This is vital because biofilms create a physical obstacle that restricts the reach of antibiotics to the bacterial cells beneath [64]. The diminutive size and positive charge of CsNPs enable them to traverse the intricate structure of biofilms, accessing bacteria that would typically be shielded. Recent research findings have underscored the efficacy of Cs-nano-capsulation as a potent bactericide, demonstrating superior biofilm disruption capabilities. Additionally, these studies highlight the critical role of delivery systems in boosting antibacterial effectiveness [65–73].

Caco-2 cells are a suitable model for studying drug absorption, transport, and metabolism in the intestine due to their resemblance to human intestinal epithelial cells. They possess functional characteristics like microvilli and tight junctions, which are important for simulating the intestinal barrier [74]. Some studies have shown that V. cholerae induces an inflammatory response through TLR and NOD receptors [75], which can assist in the development of targeted drugs for regulating inflammation. Our study demonstrates that CFSa-CsNPs and CFSb-CsNPs effectively reduce the expression of TLR2 and TLR4 genes in Caco-2 cells. Notably, the reduction in gene expression is more pronounced when these probiotic components (CFSs) are combined (CFSa-CsNPs + CFSb-CsNPs) compared to their individual effects. These findings are consistent with previous research that highlights the synergistic benefits of combined interventions.

Consistent with our findings, previous research has examined the CFSs of various probiotics, including L. acidophilus, L. casei, L. lactis, L. reuteri, and Saccharomyces boulardii. The metabolites produced by these probiotics demonstrated the ability to reduce the expression of PGE-2 and IL-8 in human colon epithelial HT-29 cells. Furthermore, probiotic supernatants exhibited varying effects on the production of IL-1β, IL-6, TNF-α, and IL-10 by human macrophages, indicating their distinct anti-inflammatory activities [76].

Conclusion

In conclusion, this research indicates that the CFSs derived from probiotic bacteria L.acidophilus and B.bifidum possess vibriocidal capabilities. Furthermore, the synergy achieved by encapsulating selected probiotic CFSs within Cs in nanoscale exhibited enhanced antimicrobial and antibiofilm activities. This enhancement was attributed to the exceptional stability of the synthesized nanoparticles across various temperatures and pH levels. Importantly, the study highlights the superior vibriocidal therapeutic effects of combining CFSa-CsNPs and CFSb-CsNPs compared to their individual applications. While this study highlights the antimicrobial and antibiofilm properties of CFSb-CsNPs and CFSa-CsNPs, further research utilizing a cholera animal model may yield promising results regarding the effectiveness of probiotic CFSs in treatment. Additionally, the investigation and purification of active compounds within the CFS can open new avenues for treating bacterial infections and preventing the emergence of antibiotic-resistant strains.

Abbreviations

V. cholerae Vibrio cholerae

MDR Multi-drug resistance

Cs Chitosan

NPs Nanoparticles

CsNPs Chitosan nanoparticles

B. bifidum Bifidobacterium bifidum

L. acidophilus Lactobacillus acidophilus

CFSb-CsNPs Cell-free supernatant of Bifidobacterium bifidum encapsulated in chitosan nanoparticles

CFSa-CsNPs Cell-free supernatant of Lactobacillus acidophilus encapsulated in chitosan nanoparticles

TPP Sodium tripolyphosphate

PBS Phosphate-buffered saline

DLS/Zeta Dynamic light scattering/zeta potential

SEM Scanning electron microscopy

Bap Biofilm associated protein

RbmC Rugosity and Biofilm Modulators

TCP Toxin-coregulated pilus

TLR Toll-like receptor

Caco-2 cells Human colorectal adenocarcinoma cells

EE Encapsulation efficacy

Acknowledgements

The authors wish to thank the Research Council of Tarbiat Modares University for developing the project.

Author contributions

MDS conceptualization, performed the experiments, and drafted the manuscript. BB conceptualization, supervised the work, and revised the manuscript. AR contributed to data interpretation and validated the results. All authors reviewed and approved the final manuscript.

Funding

The study was supported by the Research Council of Tarbiat Modares University (Code Number: IR.MODARES.AEC.1401.036) and the Iran National Science Foundation (INSF) (Grant Number: 4012567).

Data availability

The datasets generated during and/or analyzed during the current study are available and/or analyzed during the current work are available from the corresponding authors upon reasonable request.

Declarations

Ethics approval and consent to participate

The study was reviewed and approved by the Medical Ethics Committee of Tarbiat Modares University (Code: IR.TMU.REC.1397.092) before the study began.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Nayak SR Nayak AK Biswal BL Pati S Pal BB Spread of Haitian variant Vibrio cholerae O1 causing cholera outbreaks in Odisha, India JJID 2021 74 2 137 43
Nayak SR, Nayak AK, Biswal BL, Pati S, Pal BB. Spread of Haitian variant Vibrio cholerae O1 causing cholera outbreaks in Odisha, India. JJID. 2021;74(2):137–43.
2. Derakhshan Sefidi M Heidary L Shams S Prevalence of imipenem-resistant Acinetobacter baumannii ISOLATES in Iran: a meta-analysis Infect Epidemiol Microbiol 2021 7 1 77 99 10.52547/iem.7.1.77
Derakhshan Sefidi M, Heidary L, Shams S. Prevalence of imipenem-resistant Acinetobacter baumannii ISOLATES in Iran: a meta-analysis. Infect Epidemiol Microbiol. 2021;7(1):77–99.10.52547/iem.7.1.77
3. Sefidi MD Rasooli I Owlia P Talei D Astaneh SDA Nazarian S Adjuvant role of Pseudomonas flagellin for Acinetobacter baumannii biofilm associated protein World J Methodol 2016 6 3 190 10.5662/wjm.v6.i3.190 27679782
Sefidi MD, Rasooli I, Owlia P, Talei D, Astaneh SDA, Nazarian S. Adjuvant role of Pseudomonas flagellin for Acinetobacter baumannii biofilm associated protein. World J Methodol. 2016;6(3):190.27679782 10.5662/wjm.v6.i3.190
4. Yibar A, Yildiz O, Kucuk S, Akay C. Investigation of vitality, antibacterial properties, and antagonistic effects of probiotic bacteria in probiotic dairy products. Int Food Res J. 2024;31(1).
5. Milner E Stevens B An M Lam V Ainsworth M Dihle P Utilizing probiotics for the prevention and treatment of gastrointestinal diseases Front Microbiol 2021 12 689958 10.3389/fmicb.2021.689958 34434175
Milner E, Stevens B, An M, Lam V, Ainsworth M, Dihle P, et al. Utilizing probiotics for the prevention and treatment of gastrointestinal diseases. Front Microbiol. 2021;12:689958.34434175 10.3389/fmicb.2021.689958
6. Salminen S Collado MC Endo A Hill C Lebeer S Quigley EM The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics Nat Rev Gastroenterol Hepatol 2021 18 9 649 67 10.1038/s41575-021-00440-6 33948025
Salminen S, Collado MC, Endo A, Hill C, Lebeer S, Quigley EM, et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat Rev Gastroenterol Hepatol. 2021;18(9):649–67.33948025 10.1038/s41575-021-00440-6
7. Inturri R Stivala A Furneri P Blandino G Growth and adhesion to HT-29 cells inhibition of Gram-negatives by Bifidobacterium longum BB536 e Lactobacillus rhamnosus HN001 alone and in combination Eur Rev Med Pharmacol Sci 2016 20 23 4943 9 27981539
Inturri R, Stivala A, Furneri P, Blandino G. Growth and adhesion to HT-29 cells inhibition of Gram-negatives by Bifidobacterium longum BB536 e Lactobacillus rhamnosus HN001 alone and in combination. Eur Rev Med Pharmacol Sci. 2016;20(23):4943–9.27981539
8. Lee DK Park SY An HM Kim JR Kim MJ Lee SW Antimicrobial activity of Bifidobacterium spp. isolated from healthy adult koreans against cariogenic microflora Arch Oral Biol 2011 56 10 1047 54 10.1016/j.archoralbio.2011.03.002 21439550
Lee DK, Park SY, An HM, Kim JR, Kim MJ, Lee SW, et al. Antimicrobial activity of Bifidobacterium spp. isolated from healthy adult koreans against cariogenic microflora. Arch Oral Biol. 2011;56(10):1047–54.21439550 10.1016/j.archoralbio.2011.03.002
9. Lee D-K Kim M-J Ham J-W An H-M Cha M-K Lee S-W In vitro evaluation of antibacterial activities and anti-inflammatory effects of Bifidobacterium spp. addressing acne vulgaris Arch Pharm Res 2012 35 1065 71 10.1007/s12272-012-0614-9 22870816
Lee D-K, Kim M-J, Ham J-W, An H-M, Cha M-K, Lee S-W, et al. In vitro evaluation of antibacterial activities and anti-inflammatory effects of Bifidobacterium spp. addressing acne vulgaris. Arch Pharm Res. 2012;35:1065–71.22870816 10.1007/s12272-012-0614-9
10. Munoz-Quezada S Chenoll E Vieites JM Genovés S Maldonado J Bermúdez-Brito M Isolation, identification and characterisation of three novel probiotic strains (Lactobacillus paracasei CNCM I-4034, Bifidobacterium breve CNCM I-4035 and Lactobacillus rhamnosus CNCM I-4036) from the faeces of exclusively breast-fed infants Br J Nutr 2013 109 S2 S51 62 10.1017/S0007114512005211 23360881
Munoz-Quezada S, Chenoll E, Vieites JM, Genovés S, Maldonado J, Bermúdez-Brito M, et al. Isolation, identification and characterisation of three novel probiotic strains (Lactobacillus paracasei CNCM I-4034, Bifidobacterium breve CNCM I-4035 and Lactobacillus rhamnosus CNCM I-4036) from the faeces of exclusively breast-fed infants. Br J Nutr. 2013;109(S2):S51–62.23360881 10.1017/S0007114512005211
11. Abdelhamid AG Esaam A Hazaa MM Cell free preparations of probiotics exerted antibacterial and antibiofilm activities against multidrug resistant E. Coli Saudi Pharm J 2018 26 5 603 7 10.1016/j.jsps.2018.03.004 29991904
Abdelhamid AG, Esaam A, Hazaa MM. Cell free preparations of probiotics exerted antibacterial and antibiofilm activities against multidrug resistant E. Coli. Saudi Pharm J. 2018;26(5):603–7.29991904 10.1016/j.jsps.2018.03.004
12. VidyaLaxme B Rovetto A Grau R Agrawal R Synergistic effects of probiotic Leuconostoc mesenteroides and Bacillus subtilis in malted ragi (Eleucine corocana) food for antagonistic activity against V. cholerae and other beneficial properties J Food Sci Technol 2014 51 11 3072 82 10.1007/s13197-012-0834-5 26396299
VidyaLaxme B, Rovetto A, Grau R, Agrawal R. Synergistic effects of probiotic Leuconostoc mesenteroides and Bacillus subtilis in malted ragi (Eleucine corocana) food for antagonistic activity against V. cholerae and other beneficial properties. J Food Sci Technol. 2014;51(11):3072–82.26396299 10.1007/s13197-012-0834-5
13. Zhu X Zhang S Zhou L Ao S Tang H Zhou Y Probiotic potential of Bacillus velezensis: antimicrobial activity against non-O1 Vibrio cholerae and immune enhancement effects on Macrobrachium nipponense Aquaculture 2021 541 736817 10.1016/j.aquaculture.2021.736817
Zhu X, Zhang S, Zhou L, Ao S, Tang H, Zhou Y, et al. Probiotic potential of Bacillus velezensis: antimicrobial activity against non-O1 Vibrio cholerae and immune enhancement effects on Macrobrachium nipponense. Aquaculture. 2021;541:736817.10.1016/j.aquaculture.2021.736817
14. Spinler JK Taweechotipatr M Rognerud CL Ou CN Tumwasorn S Versalovic J Human-derived probiotic Lactobacillus reuteri demonstrate antimicrobial activities targeting diverse enteric bacterial pathogens Anaerobe 2008 14 3 166 71 10.1016/j.anaerobe.2008.02.001 18396068
Spinler JK, Taweechotipatr M, Rognerud CL, Ou CN, Tumwasorn S, Versalovic J. Human-derived probiotic Lactobacillus reuteri demonstrate antimicrobial activities targeting diverse enteric bacterial pathogens. Anaerobe. 2008;14(3):166–71.18396068 10.1016/j.anaerobe.2008.02.001
15. Chatterjee T Saha T Sarkar P Hoque KM Chatterjee BK Chakrabarti P The gold nanoparticle reduces Vibrio cholerae pathogenesis by inhibition of biofilm formation and disruption of the production and structure of cholera toxin Colloids Surf 2021 204 111811 10.1016/j.colsurfb.2021.111811
Chatterjee T, Saha T, Sarkar P, Hoque KM, Chatterjee BK, Chakrabarti P. The gold nanoparticle reduces Vibrio cholerae pathogenesis by inhibition of biofilm formation and disruption of the production and structure of cholera toxin. Colloids Surf. 2021;204:111811.10.1016/j.colsurfb.2021.111811
16. Saha S Aggarwal S Singh DV Attenuation of quorum sensing system and virulence in Vibrio cholerae by phytomolecules Front Microbiol 2023 14 1133569 10.3389/fmicb.2023.1133569 37065125
Saha S, Aggarwal S, Singh DV. Attenuation of quorum sensing system and virulence in Vibrio cholerae by phytomolecules. Front Microbiol. 2023;14:1133569.37065125 10.3389/fmicb.2023.1133569
17. Teschler JK Nadell CD Drescher K Yildiz FH Mechanisms underlying Vibrio cholerae biofilm formation and dispersion Annu Rev Microbiol 2022 76 503 32 10.1146/annurev-micro-111021-053553 35671532
Teschler JK, Nadell CD, Drescher K, Yildiz FH. Mechanisms underlying Vibrio cholerae biofilm formation and dispersion. Annu Rev Microbiol. 2022;76:503–32.35671532 10.1146/annurev-micro-111021-053553
18. Ramamurthy T Nandy RK Mukhopadhyay AK Dutta S Mutreja A Okamoto K Virulence regulation and innate host response in the pathogenicity of Vibrio cholerae Front cell Infect Microbiol 2020 10 572096 10.3389/fcimb.2020.572096 33102256
Ramamurthy T, Nandy RK, Mukhopadhyay AK, Dutta S, Mutreja A, Okamoto K, et al. Virulence regulation and innate host response in the pathogenicity of Vibrio cholerae. Front cell Infect Microbiol. 2020;10:572096.33102256 10.3389/fcimb.2020.572096
19. Nadar S Khan T Patching SG Omri A Development of antibiofilm therapeutics strategies to overcome antimicrobial drug resistance Microorganisms 2022 10 2 303 10.3390/microorganisms10020303 35208758
Nadar S, Khan T, Patching SG, Omri A. Development of antibiofilm therapeutics strategies to overcome antimicrobial drug resistance. Microorganisms. 2022;10(2):303.35208758 10.3390/microorganisms10020303
20. Aghamohammad S Rohani M Antibiotic resistance and the alternatives to conventional antibiotics: the role of probiotics and microbiota in combating antimicrobial resistance Microbiol Res 2023 267 127275 10.1016/j.micres.2022.127275 36493661
Aghamohammad S, Rohani M. Antibiotic resistance and the alternatives to conventional antibiotics: the role of probiotics and microbiota in combating antimicrobial resistance. Microbiol Res. 2023;267:127275.36493661 10.1016/j.micres.2022.127275
21. Achek A Yesudhas D Choi S Toll-like receptors: promising therapeutic targets for inflammatory diseases Arch Pharmacal Res 2016 39 1032 49 10.1007/s12272-016-0806-9
Achek A, Yesudhas D, Choi S. Toll-like receptors: promising therapeutic targets for inflammatory diseases. Arch Pharmacal Res. 2016;39:1032–49.10.1007/s12272-016-0806-9
22. Kaewchomphunuch T Charoenpichitnunt T Thongbaiyai V Ngamwongsatit N Kaeoket K Cell-free culture supernatants of Lactobacillus spp. and Pediococcus spp. inhibit growth of pathogenic Escherichia coli isolated from pigs in Thailand BMC Vet Res 2022 18 1 60 10.1186/s12917-022-03140-8 35093088
Kaewchomphunuch T, Charoenpichitnunt T, Thongbaiyai V, Ngamwongsatit N, Kaeoket K. Cell-free culture supernatants of Lactobacillus spp. and Pediococcus spp. inhibit growth of pathogenic Escherichia coli isolated from pigs in Thailand. BMC Vet Res. 2022;18(1):60.35093088 10.1186/s12917-022-03140-8
23. Pelyuntha W Chaiyasut C Kantachote D Sirilun S Cell-free supernatants from cultures of lactic acid bacteria isolated from fermented grape as biocontrol against Salmonella Typhi and Salmonella Typhimurium virulence via autoinducer-2 and biofilm interference PeerJ 2019 7 e7555 10.7717/peerj.7555 31523511
Pelyuntha W, Chaiyasut C, Kantachote D, Sirilun S. Cell-free supernatants from cultures of lactic acid bacteria isolated from fermented grape as biocontrol against Salmonella Typhi and Salmonella Typhimurium virulence via autoinducer-2 and biofilm interference. PeerJ. 2019;7:e7555.31523511 10.7717/peerj.7555
24. Hartmann HA Wilke T Erdmann R Efficacy of bacteriocin-containing cell-free culture supernatants from lactic acid bacteria to control Listeria monocytogenes in food Int J Food Microbiol 2011 146 2 192 9 10.1016/j.ijfoodmicro.2011.02.031 21411169
Hartmann HA, Wilke T, Erdmann R. Efficacy of bacteriocin-containing cell-free culture supernatants from lactic acid bacteria to control Listeria monocytogenes in food. Int J Food Microbiol. 2011;146(2):192–9.21411169 10.1016/j.ijfoodmicro.2011.02.031
25. Arrioja-Bretón D Mani-López E Bach H López-Malo A Antimicrobial activity of protein-containing fractions isolated from Lactobacillus plantarum NRRL B-4496 culture Brazilian J Microbiol 2020 51 1289 96 10.1007/s42770-020-00266-5
Arrioja-Bretón D, Mani-López E, Bach H, López-Malo A. Antimicrobial activity of protein-containing fractions isolated from Lactobacillus plantarum NRRL B-4496 culture. Brazilian J Microbiol. 2020;51:1289–96.10.1007/s42770-020-00266-5
26. Beristain-Bauza S Mani-López E Palou E López-Malo A Antimicrobial activity and physical properties of protein films added with cell-free supernatant of Lactobacillus rhamnosus Food Control 2016 62 44 51 10.1016/j.foodcont.2015.10.007
Beristain-Bauza S, Mani-López E, Palou E, López-Malo A. Antimicrobial activity and physical properties of protein films added with cell-free supernatant of Lactobacillus rhamnosus. Food Control. 2016;62:44–51.10.1016/j.foodcont.2015.10.007
27. Derakhshan-Sefidi M Bakhshi B Rasekhi A Thiolated chitosan nanoparticles encapsulated nisin and selenium: antimicrobial/antibiofilm/anti-attachment/immunomodulatory multi-functional agent BMC Microbiol 2024 24 1 257 10.1186/s12866-024-03400-7 38997643
Derakhshan-Sefidi M, Bakhshi B, Rasekhi A. Thiolated chitosan nanoparticles encapsulated nisin and selenium: antimicrobial/antibiofilm/anti-attachment/immunomodulatory multi-functional agent. BMC Microbiol. 2024;24(1):257.38997643 10.1186/s12866-024-03400-7
28. Hedyeloo F Moradian F Rostami M Nanoencapsulation of oral-pharmaceutical lactoferrin using chitosan and the evaluation of stability against trypsin and pepsin and its antibacterial effect Micro Nano Lett 2023 18 9–12 e12174 10.1049/mna2.12174
Hedyeloo F, Moradian F, Rostami M. Nanoencapsulation of oral-pharmaceutical lactoferrin using chitosan and the evaluation of stability against trypsin and pepsin and its antibacterial effect. Micro Nano Lett. 2023;18(9–12):e12174.10.1049/mna2.12174
29. Wike NY Akinbo O Olaniyan OT Adetunji CO Adetunji JB The role of nanochitosan for effective delivery of nutrients and drugs including hormones and vaccines in cattle 2023 Next Generation Nanochitosan Elsevier 171 202
Wike NY, Akinbo O, Olaniyan OT, Adetunji CO, Adetunji JB. The role of nanochitosan for effective delivery of nutrients and drugs including hormones and vaccines in cattle. Next Generation Nanochitosan: Elsevier; 2023. pp. 171–202.
30. Pathak R, Bhatt S, Punetha VD, Punetha M. Chitosan nanoparticles and based composites as a biocompatible vehicle for drug delivery: a review. Int J Biol Macromol. 2023:127369.
31. Wu Y Gao H Liu J Liang H Chitosan nanoparticles efficiently enhance the dispersibility, stability and selective antibacterial activity of insoluble isoflavonoids Int J Biol Macromol 2023 232 123420 10.1016/j.ijbiomac.2023.123420 36708890
Wu Y, Gao H, Liu J, Liang H. Chitosan nanoparticles efficiently enhance the dispersibility, stability and selective antibacterial activity of insoluble isoflavonoids. Int J Biol Macromol. 2023;232:123420.36708890 10.1016/j.ijbiomac.2023.123420
32. Octavia S Salim A Kurniawan J Lam C Leung Q Ahsan S Population structure and evolution of non-O1/non-O139 Vibrio cholerae by multilocus sequence typing PLoS ONE 2013 8 6 e65342 10.1371/journal.pone.0065342 23776471
Octavia S, Salim A, Kurniawan J, Lam C, Leung Q, Ahsan S, et al. Population structure and evolution of non-O1/non-O139 Vibrio cholerae by multilocus sequence typing. PLoS ONE. 2013;8(6):e65342.23776471 10.1371/journal.pone.0065342
33. Jeffrey MP MacPherson CW Mathieu O Tompkins TA Green-Johnson JM Secretome-mediated interactions with intestinal epithelial cells: a role for Secretome components from Lactobacillus rhamnosus R0011 in the attenuation of Salmonella enterica serovar typhimurium secretome and TNF-α–induced proinflammatory responses J Immun 2020 204 9 2523 34 10.4049/jimmunol.1901440 32238458
Jeffrey MP, MacPherson CW, Mathieu O, Tompkins TA, Green-Johnson JM. Secretome-mediated interactions with intestinal epithelial cells: a role for Secretome components from Lactobacillus rhamnosus R0011 in the attenuation of Salmonella enterica serovar typhimurium secretome and TNF-α–induced proinflammatory responses. J Immun. 2020;204(9):2523–34.32238458 10.4049/jimmunol.1901440
34. Calvo P Remuñan-López C Vila-Jato JL Alonso MJ Chitosan and chitosan/ethylene oxide-propylene oxide block copolymer nanoparticles as novel carriers for proteins and vaccines Pharm Res 1997 14 1431 6 10.1023/A:1012128907225 9358557
Calvo P, Remuñan-López C, Vila-Jato JL, Alonso MJ. Chitosan and chitosan/ethylene oxide-propylene oxide block copolymer nanoparticles as novel carriers for proteins and vaccines. Pharm Res. 1997;14:1431–6.9358557 10.1023/A:1012128907225
35. M100 Cg. Clinical and Laboratory Standards Institute (CLSI) Performance Standards for Antimicrobial Susceptibility Testing. 2023.
36. Black C Al Mahmud H Howle V Wilson S Smith AC Wakeman CA Development of a polymicrobial checkerboard assay as a tool for determining combinatorial antibiotic effectiveness in polymicrobial communities Antibiotics 2023 12 7 1207 10.3390/antibiotics12071207 37508303
Black C, Al Mahmud H, Howle V, Wilson S, Smith AC, Wakeman CA. Development of a polymicrobial checkerboard assay as a tool for determining combinatorial antibiotic effectiveness in polymicrobial communities. Antibiotics. 2023;12(7):1207.37508303 10.3390/antibiotics12071207
37. Haney EF Trimble MJ Cheng JT Vallé Q Hancock RE Critical assessment of methods to quantify biofilm growth and evaluate antibiofilm activity of host defence peptides Biomolecules 2018 8 2 29 10.3390/biom8020029 29883434
Haney EF, Trimble MJ, Cheng JT, Vallé Q, Hancock RE. Critical assessment of methods to quantify biofilm growth and evaluate antibiofilm activity of host defence peptides. Biomolecules. 2018;8(2):29.29883434 10.3390/biom8020029
38. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method Methods 2001 25 4 402 8 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods. 2001;25(4):402–8.11846609 10.1006/meth.2001.1262
39. Nguyen HT Van Duong T Taylor LS Impact of gastric pH variations on the release of amorphous solid dispersion formulations containing a weakly basic drug and enteric polymers Mol Pharm 2023 20 3 1681 95 10.1021/acs.molpharmaceut.2c00895 36730186
Nguyen HT, Van Duong T, Taylor LS. Impact of gastric pH variations on the release of amorphous solid dispersion formulations containing a weakly basic drug and enteric polymers. Mol Pharm. 2023;20(3):1681–95.36730186 10.1021/acs.molpharmaceut.2c00895
40. Garbern SC Chu T-C Yang P Gainey M Nasrin S Kanekar S Clinical and socio-environmental determinants of multidrug-resistant vibrio cholerae 01 in older children and adults in Bangladesh Int J Infect Dis 2021 105 436 41 10.1016/j.ijid.2021.02.102 33647514
Garbern SC, Chu T-C, Yang P, Gainey M, Nasrin S, Kanekar S, et al. Clinical and socio-environmental determinants of multidrug-resistant vibrio cholerae 01 in older children and adults in Bangladesh. Int J Infect Dis. 2021;105:436–41.33647514 10.1016/j.ijid.2021.02.102
41. Zhang X Esmail GA Alzeer AF Arasu MV Vijayaraghavan P Choi KC Probiotic characteristics of Lactobacillus strains isolated from cheese and their antibacterial properties against gastrointestinal tract pathogens Saudi J Biol Sci 2020 27 12 3505 13 10.1016/j.sjbs.2020.10.022 33304162
Zhang X, Esmail GA, Alzeer AF, Arasu MV, Vijayaraghavan P, Choi KC, et al. Probiotic characteristics of Lactobacillus strains isolated from cheese and their antibacterial properties against gastrointestinal tract pathogens. Saudi J Biol Sci. 2020;27(12):3505–13.33304162 10.1016/j.sjbs.2020.10.022
42. Ladda B Theparee T Chimchang J Tanasupawat S Taweechotipatr M In vitro modulation of tumor necrosis factor α production in THP-1 cells by lactic acid bacteria isolated from healthy human infants Anaerobe 2015 33 109 16 10.1016/j.anaerobe.2015.03.002 25759008
Ladda B, Theparee T, Chimchang J, Tanasupawat S, Taweechotipatr M. In vitro modulation of tumor necrosis factor α production in THP-1 cells by lactic acid bacteria isolated from healthy human infants. Anaerobe. 2015;33:109–16.25759008 10.1016/j.anaerobe.2015.03.002
43. Petrova PM Petrov KK Antimicrobial activity of starch-degrading Lactobacillus strains isolated from boza Biotechnol Biotechnol Equip 2011 25 sup1 114 6 10.5504/BBEQ.2011.0124
Petrova PM, Petrov KK. Antimicrobial activity of starch-degrading Lactobacillus strains isolated from boza. Biotechnol Biotechnol Equip. 2011;25(sup1):114–6.10.5504/BBEQ.2011.0124
44. Drumond MM Tapia-Costa AP Neumann E Nunes ÁC Barbosa JW Kassuha DE Cell-free supernatant of probiotic bacteria exerted antibiofilm and antibacterial activities against Pseudomonas aeruginosa: a novel biotic therapy Front Pharmacol 2023 14 1152588 10.3389/fphar.2023.1152588 37397469
Drumond MM, Tapia-Costa AP, Neumann E, Nunes ÁC, Barbosa JW, Kassuha DE, et al. Cell-free supernatant of probiotic bacteria exerted antibiofilm and antibacterial activities against Pseudomonas aeruginosa: a novel biotic therapy. Front Pharmacol. 2023;14:1152588.37397469 10.3389/fphar.2023.1152588
45. Yang KM Kim J-S Kim H-S Kim Y-Y Oh J-K Jung H-W Lactobacillus reuteri AN417 cell-free culture supernatant as a novel antibacterial agent targeting oral pathogenic bacteria Sci Rep 2021 11 1 1631 10.1038/s41598-020-80921-x 33452304
Yang KM, Kim J-S, Kim H-S, Kim Y-Y, Oh J-K, Jung H-W, et al. Lactobacillus reuteri AN417 cell-free culture supernatant as a novel antibacterial agent targeting oral pathogenic bacteria. Sci Rep. 2021;11(1):1631.33452304 10.1038/s41598-020-80921-x
46. Al-Malkey MK, Ismeeal MC, Al-Hur FJA, Mohammed SW, Nayyef HJ. Antimicrobial effect of probiotic Lactobacillus spp. on Pseudomonas aeruginosa. J Contemp Med Sci. 2017;3(10).
47. Daba H, Saidi S. Detection of bacteriocin-producing lactic acid bacteria from milk in various farms in north-east Algeria by a new procedure. Agron Res. 2015;13(4).
48. Raafat D Von Bargen K Haas A Sahl H-G Insights into the mode of action of Chitosan as an antibacterial compound AEM 2008 74 12 3764 73 10.1128/AEM.00453-08
Raafat D, Von Bargen K, Haas A, Sahl H-G. Insights into the mode of action of Chitosan as an antibacterial compound. AEM. 2008;74(12):3764–73.10.1128/AEM.00453-08
49. Sharaf OM Al-Gamal MS Ibrahim GA Dabiza NM Salem SS El-Ssayad MF Evaluation and characterization of some protective culture metabolites in free and nano-chitosan-loaded forms against common contaminants of Egyptian cheese Carbohydr Polym 2019 223 115094 10.1016/j.carbpol.2019.115094 31426998
Sharaf OM, Al-Gamal MS, Ibrahim GA, Dabiza NM, Salem SS, El-Ssayad MF, et al. Evaluation and characterization of some protective culture metabolites in free and nano-chitosan-loaded forms against common contaminants of Egyptian cheese. Carbohydr Polym. 2019;223:115094.31426998 10.1016/j.carbpol.2019.115094
50. Delas Cardoso M Manzo RM Tonarelli GG Simonetta AC Characterisation of a cell-free supernatant obtained from cultures of Enterococcus faecalis DBFIQ E24 with antagonistic activity against bacteria, yeasts and moulds Int J Dairy Technol 2012 65 4 568 77 10.1111/j.1471-0307.2012.00852.x
Delas Cardoso M, Manzo RM, Tonarelli GG, Simonetta AC. Characterisation of a cell-free supernatant obtained from cultures of Enterococcus faecalis DBFIQ E24 with antagonistic activity against bacteria, yeasts and moulds. Int J Dairy Technol. 2012;65(4):568–77.10.1111/j.1471-0307.2012.00852.x
51. Ahmad Rather I Seo B Rejish Kumar V Choi UH Choi KH Lim J Isolation and characterization of a proteinaceous antifungal compound from Lactobacillus plantarum YML007 and its application as a food preservative Lett Appl Microbiol 2013 57 1 69 76 10.1111/lam.12077 23565693
Ahmad Rather I, Seo B, Rejish Kumar V, Choi UH, Choi KH, Lim J, et al. Isolation and characterization of a proteinaceous antifungal compound from Lactobacillus plantarum YML007 and its application as a food preservative. Lett Appl Microbiol. 2013;57(1):69–76.23565693 10.1111/lam.12077
52. Lin J Meng H Guo X Tang Z Yu S Natural aldehyde-Chitosan Schiff Base: fabrication, pH-Responsive properties, and Vegetable Preservation Foods 2023 12 15 2921 10.3390/foods12152921 37569191
Lin J, Meng H, Guo X, Tang Z, Yu S. Natural aldehyde-Chitosan Schiff Base: fabrication, pH-Responsive properties, and Vegetable Preservation. Foods. 2023;12(15):2921.37569191 10.3390/foods12152921
53. Tığlı Aydın RS Pulat M 5-Fluorouracil encapsulated chitosan nanoparticles for pH‐stimulated drug delivery: evaluation of controlled release kinetics J Nanomaterials 2012 2012 1 313961 10.1155/2012/313961
Tığlı Aydın RS, Pulat M. 5-Fluorouracil encapsulated chitosan nanoparticles for pH‐stimulated drug delivery: evaluation of controlled release kinetics. J Nanomaterials. 2012;2012(1):313961.10.1155/2012/313961
54. Sarveswari HB Gupta KK Durai R Solomon AP Development of a smart pH-responsive nano-polymer drug, 2-methoxy-4-vinylphenol conjugate against the intestinal pathogen, Vibrio cholerae Sci Rep 2023 13 1 1250 10.1038/s41598-023-28033-0 36690664
Sarveswari HB, Gupta KK, Durai R, Solomon AP. Development of a smart pH-responsive nano-polymer drug, 2-methoxy-4-vinylphenol conjugate against the intestinal pathogen, Vibrio cholerae. Sci Rep. 2023;13(1):1250.36690664 10.1038/s41598-023-28033-0
55. Saberpour M, Bakhshi B, Najar-Peerayeh S. Evaluation of the antimicrobial and antibiofilm effect of chitosan nanoparticles as carrier for supernatant of mesenchymal stem cells on multidrug-resistant Vibrio cholerae. Infect drug Resist. 2020:2251–60.
56. Bermudez-Brito M Plaza-Díaz J Muñoz-Quezada S Gómez-Llorente C Gil A Probiotic mechanisms of action Ann Nutr Metab 2012 61 2 160 74 10.1159/000342079 23037511
Bermudez-Brito M, Plaza-Díaz J, Muñoz-Quezada S, Gómez-Llorente C, Gil A. Probiotic mechanisms of action. Ann Nutr Metab. 2012;61(2):160–74.23037511 10.1159/000342079
57. Alamdary SZ Bakhshi B Lactobacillus acidophilus attenuates toxin production by Vibrio cholerae and shigella dysenteriae following intestinal epithelial cells infection Microb Pathog 2020 149 104543 10.1016/j.micpath.2020.104543 33010360
Alamdary SZ, Bakhshi B. Lactobacillus acidophilus attenuates toxin production by Vibrio cholerae and shigella dysenteriae following intestinal epithelial cells infection. Microb Pathog. 2020;149:104543.33010360 10.1016/j.micpath.2020.104543
58. Van Holm W Carvalho R Delanghe L Eilers T Zayed N Mermans F Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms Npj Biofilms Microbiomes 2023 9 1 3 10.1038/s41522-023-00370-y 36681674
Van Holm W, Carvalho R, Delanghe L, Eilers T, Zayed N, Mermans F, et al. Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms. Npj Biofilms Microbiomes. 2023;9(1):3.36681674 10.1038/s41522-023-00370-y
59. Asadzadegan R Haratian N Sadeghi M Maroufizadeh S Mobayen M Sedigh Ebrahim Saraei H Antibiofilm and antimicrobial activity of Lactobacillus cell free supernatant against Pseudomonas aeruginosa isolated from burn wounds Int Wound J 2023 20 10 4112 21 10.1111/iwj.14305 37455022
Asadzadegan R, Haratian N, Sadeghi M, Maroufizadeh S, Mobayen M, Sedigh Ebrahim Saraei H, et al. Antibiofilm and antimicrobial activity of Lactobacillus cell free supernatant against Pseudomonas aeruginosa isolated from burn wounds. Int Wound J. 2023;20(10):4112–21.37455022 10.1111/iwj.14305
60. Zamani H Rahbar S Garakoui SR Afsah Sahebi A Jafari H Antibiofilm potential of Lactobacillus plantarum spp. cell free supernatant (CFS) against multidrug resistant bacterial pathogens Pharm Biomedical Res 2017 3 2 39 44 10.29252/pbr.3.2.39
Zamani H, Rahbar S, Garakoui SR, Afsah Sahebi A, Jafari H. Antibiofilm potential of Lactobacillus plantarum spp. cell free supernatant (CFS) against multidrug resistant bacterial pathogens. Pharm Biomedical Res. 2017;3(2):39–44.10.29252/pbr.3.2.39
61. Chávez de Paz LE Resin A Howard KA Sutherland DS Wejse PL Antimicrobial effect of chitosan nanoparticles on Streptococcus mutans biofilms Appl Environ Microbiol 2011 77 11 3892 5 10.1128/AEM.02941-10 21498764
Chávez de Paz LE, Resin A, Howard KA, Sutherland DS, Wejse PL. Antimicrobial effect of chitosan nanoparticles on Streptococcus mutans biofilms. Appl Environ Microbiol. 2011;77(11):3892–5.21498764 10.1128/AEM.02941-10
62. Kong M Chen XG Xing K Park HJ Antimicrobial properties of chitosan and mode of action: a state of the art review Int J Food Microbiol 2010 144 1 51 63 10.1016/j.ijfoodmicro.2010.09.012 20951455
Kong M, Chen XG, Xing K, Park HJ. Antimicrobial properties of chitosan and mode of action: a state of the art review. Int J Food Microbiol. 2010;144(1):51–63.20951455 10.1016/j.ijfoodmicro.2010.09.012
63. Borges O Cordeiro-da-Silva A Romeijn SG Amidi M de Sousa A Borchard G Uptake studies in rat Peyer’s patches, cytotoxicity and release studies of alginate coated chitosan nanoparticles for mucosal vaccination J Controlled Release 2006 114 3 348 58 10.1016/j.jconrel.2006.06.011
Borges O, Cordeiro-da-Silva A, Romeijn SG, Amidi M, de Sousa A, Borchard G, et al. Uptake studies in rat Peyer’s patches, cytotoxicity and release studies of alginate coated chitosan nanoparticles for mucosal vaccination. J Controlled Release. 2006;114(3):348–58.10.1016/j.jconrel.2006.06.011
64. Xu J Lin Q Sheng M Ding T Li B Gao Y Antibiofilm effect of cinnamaldehyde-chitosan nanoparticles against the biofilm of Staphylococcus aureus Antibiotics 2022 11 10 1403 10.3390/antibiotics11101403 36290061
Xu J, Lin Q, Sheng M, Ding T, Li B, Gao Y, et al. Antibiofilm effect of cinnamaldehyde-chitosan nanoparticles against the biofilm of Staphylococcus aureus. Antibiotics. 2022;11(10):1403.36290061 10.3390/antibiotics11101403
65. Lin Q Li Y Sheng M Xu J Xu X Lee J Antibiofilm effects of berberine-loaded chitosan nanoparticles against Candida albicans biofilm LWT 2023 173 114237 10.1016/j.lwt.2022.114237
Lin Q, Li Y, Sheng M, Xu J, Xu X, Lee J, et al. Antibiofilm effects of berberine-loaded chitosan nanoparticles against Candida albicans biofilm. LWT. 2023;173:114237.10.1016/j.lwt.2022.114237
66. Rashki S Safardoust-Hojaghan H Mirzaei H Abdulsahib WK Mahdi MA Salavati-Niasari M Delivery LL37 by chitosan nanoparticles for enhanced antibacterial and antibiofilm efficacy Carbohydr Polym 2022 291 119634 10.1016/j.carbpol.2022.119634 35698353
Rashki S, Safardoust-Hojaghan H, Mirzaei H, Abdulsahib WK, Mahdi MA, Salavati-Niasari M, et al. Delivery LL37 by chitosan nanoparticles for enhanced antibacterial and antibiofilm efficacy. Carbohydr Polym. 2022;291:119634.35698353 10.1016/j.carbpol.2022.119634
67. Valian A Goudarzi H Nasiri MJ Roshanaei A Sadeghi Mahounak f. Antibacterial and Anti-biofilm effects of Chitosan Nanoparticles on Streptococcus Mutans isolates J Iran Med Council 2023 6 2 292 8
Valian A, Goudarzi H, Nasiri MJ, Roshanaei A. Sadeghi Mahounak f. Antibacterial and Anti-biofilm effects of Chitosan Nanoparticles on Streptococcus Mutans isolates. J Iran Med Council. 2023;6(2):292–8.
68. Ma S Moser D Han F Leonhard M Schneider-Stickler B Tan Y Preparation and antibiofilm studies of curcumin loaded chitosan nanoparticles against polymicrobial biofilms of Candida albicans and Staphylococcus aureus Carbohydr Polym 2020 241 116254 10.1016/j.carbpol.2020.116254 32507182
Ma S, Moser D, Han F, Leonhard M, Schneider-Stickler B, Tan Y. Preparation and antibiofilm studies of curcumin loaded chitosan nanoparticles against polymicrobial biofilms of Candida albicans and Staphylococcus aureus. Carbohydr Polym. 2020;241:116254.32507182 10.1016/j.carbpol.2020.116254
69. Ganesan S Alagarasan JK Sonaimuthu M Aruchamy K Alkallas FH Ben Gouider Trabelsi A Preparation and characterization of salsalate-loaded chitosan nanoparticles: in vitro release and antibacterial and antibiofilm activity Mar Drugs 2022 20 12 733 10.3390/md20120733 36547880
Ganesan S, Alagarasan JK, Sonaimuthu M, Aruchamy K, Alkallas FH, Ben Gouider Trabelsi A, et al. Preparation and characterization of salsalate-loaded chitosan nanoparticles: in vitro release and antibacterial and antibiofilm activity. Mar Drugs. 2022;20(12):733.36547880 10.3390/md20120733
70. Pandey A Bhushan J Joshi RK Uppal AS Angrup A Kansal S Comparative evaluation of antimicrobial efficacy of chitosan nanoparticles and calcium hydroxide against endodontic biofilm of Enterococcus faecalis: an in vitro study J Conservative Dentistry Endodontics 2024 27 7 750 4 10.4103/JCDE.JCDE_219_24
Pandey A, Bhushan J, Joshi RK, Uppal AS, Angrup A, Kansal S. Comparative evaluation of antimicrobial efficacy of chitosan nanoparticles and calcium hydroxide against endodontic biofilm of Enterococcus faecalis: an in vitro study. J Conservative Dentistry Endodontics. 2024;27(7):750–4.10.4103/JCDE.JCDE_219_24
71. Turky NO Abdelmonem NA Tammam SN Gad MZ Breitinger HG Breitinger U Antibacterial and in vitro anticancer activities of the antimicrobial peptide NRC-07 encapsulated in chitosan nanoparticles J Pept Sci 2024 30 4 e3550 10.1002/psc.3550 37853814
Turky NO, Abdelmonem NA, Tammam SN, Gad MZ, Breitinger HG, Breitinger U. Antibacterial and in vitro anticancer activities of the antimicrobial peptide NRC-07 encapsulated in chitosan nanoparticles. J Pept Sci. 2024;30(4):e3550.37853814 10.1002/psc.3550
72. Amini MS Baseri Salehi M Bahador N Evaluating the antibacterial effect of meropenem-loaded chitosan/sodium tripolyphosphate (TPP) nanoparticles on Acinetobacter baumannii isolated from hospitalized patients BMC Infect Dis 2024 24 1 631 10.1186/s12879-024-09522-7 38914964
Amini MS, Baseri Salehi M, Bahador N. Evaluating the antibacterial effect of meropenem-loaded chitosan/sodium tripolyphosphate (TPP) nanoparticles on Acinetobacter baumannii isolated from hospitalized patients. BMC Infect Dis. 2024;24(1):631.38914964 10.1186/s12879-024-09522-7
73. Soleymani F Rahimi HR Farsiani H Jalili A Antimicrobial activity of Chitosan Scaffold loaded with soluble factors of different probiotic strains against Multidrug Resistant Pseudomonas aeruginosa Iran J Biotechnol 2024 22 1 e3612 38827340
Soleymani F, Rahimi HR, Farsiani H, Jalili A. Antimicrobial activity of Chitosan Scaffold loaded with soluble factors of different probiotic strains against Multidrug Resistant Pseudomonas aeruginosa. Iran J Biotechnol. 2024;22(1):e3612.38827340
74. Haddad MJ Sztupecki W Delayre-Orthez C Rhazi L Barbezier N Depeint F Complexification of in Vitro models of intestinal barriers, a true challenge for a more Accurate Alternative Approach Int J Mol Sci 2023 24 4 3595 10.3390/ijms24043595 36835003
Haddad MJ, Sztupecki W, Delayre-Orthez C, Rhazi L, Barbezier N, Depeint F, et al. Complexification of in Vitro models of intestinal barriers, a true challenge for a more Accurate Alternative Approach. Int J Mol Sci. 2023;24(4):3595.36835003 10.3390/ijms24043595
75. Xia P Wu Y Lian S Yan L Meng X Duan Q Research progress on toll-like receptor signal transduction and its roles in antimicrobial immune responses Appl Microbiol Biotechnol 2021 105 5341 55 10.1007/s00253-021-11406-8 34180006
Xia P, Wu Y, Lian S, Yan L, Meng X, Duan Q, et al. Research progress on toll-like receptor signal transduction and its roles in antimicrobial immune responses. Appl Microbiol Biotechnol. 2021;105:5341–55.34180006 10.1007/s00253-021-11406-8
76. De Marco S, Sichetti M, Muradyan D, Piccioni M, Traina G, Pagiotti R et al. Probiotic cell-free supernatants exhibited anti-inflammatory and antioxidant activity on human gut epithelial cells and macrophages stimulated with LPS. eCAM. 2018;2018.
77. Pederson DB Dong Y Blue LB Smith SV Cao M Water-soluble cranberry extract inhibits Vibrio cholerae biofilm formation possibly through modulating the second messenger 3’, 5’-Cyclic diguanylate level PLoS ONE 2018 13 11 e0207056 10.1371/journal.pone.0207056 30403745
Pederson DB, Dong Y, Blue LB, Smith SV, Cao M. Water-soluble cranberry extract inhibits Vibrio cholerae biofilm formation possibly through modulating the second messenger 3’, 5’-Cyclic diguanylate level. PLoS ONE. 2018;13(11):e0207056.30403745 10.1371/journal.pone.0207056
78. Amin Marashi SM Bakhshi B Imani Fooladi AA Tavakoli A Sharifnia A Pourshafie MR Quantitative expression of cholera toxin mRNA in Vibrio cholerae isolates with different CTX cassette arrangements J Med Microbiol 2012 61 8 1071 3 10.1099/jmm.0.038752-0 22516130
Amin Marashi SM, Bakhshi B, Imani Fooladi AA, Tavakoli A, Sharifnia A, Pourshafie MR. Quantitative expression of cholera toxin mRNA in Vibrio cholerae isolates with different CTX cassette arrangements. J Med Microbiol. 2012;61(8):1071–3.22516130 10.1099/jmm.0.038752-0
79. Yadav SRM, Goyal B, Kumar R, Gupta S, Gupta A, Mirza AA et al. Identification of suitable reference genes in blood samples of carcinoma lung patients using quantitative real-time polymerase chain reaction. J Carcinog. 2020;19.
80. Jang S Park J-S Won Y-H Yun S-J Kim S-J The expression of toll-like receptors (TLRs) in cultured human skin fibroblast is modulated by histamine Chonnam Med J 2012 48 1 7 10.4068/cmj.2012.48.1.7 22570809
Jang S, Park J-S, Won Y-H, Yun S-J, Kim S-J. The expression of toll-like receptors (TLRs) in cultured human skin fibroblast is modulated by histamine. Chonnam Med J. 2012;48(1):7.22570809 10.4068/cmj.2012.48.1.7
81. Allhorn S Böing C Koch AA Kimmig R Gashaw I TLR3 and TLR4 expression in healthy and diseased human endometrium Reprod Biol Endocrinol 2008 6 1 1 11 10.1186/1477-7827-6-40 18190708
Allhorn S, Böing C, Koch AA, Kimmig R, Gashaw I. TLR3 and TLR4 expression in healthy and diseased human endometrium. Reprod Biol Endocrinol. 2008;6(1):1–11.18190708 10.1186/1477-7827-6-40
