
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00724-7
10.1016/j.psj.2024.104145
104145
IMMUNOLOGY, HEALTH AND DISEASE
Revealing the mechanism: the influence of Baicalin on M1/M2 and Th1/Th2 imbalances in mycoplasma gallisepticum infection
Guo Yuquan *1
Miao Yusong †1
Chen Hao *
Wang Kexin *
Wang Shun *
Wang Rui ‡
Wu Zhiyong *
Li Jichang lijichang@neau.edu.cn
*2
⁎ Heilongjiang Key Laboratory for Animal Disease Control and Pharmaceutical Development, College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, PR China
† Heilongjiang Academy of Agricultural Sciences, Harbin, 150086, PR China
‡ Shandong Tianmu Technology Co. LTD, Dongying, 257500, PR China
2 Corresponding author: lijichang@neau.edu.cn
1 These authors contributed equally to this work.

30 7 2024
10 2024
30 7 2024
103 10 1041455 2 2024
25 7 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Mycoplasma gallisepticum (MG) is a pathogen that induces chronic respiratory illnesses in chickens, leading to tracheal and lung injury, and eliciting immune reactions that support sustained colonization. Baicalin, a compound found in scutellaria baicalensis, exhibits anti-inflammatory, antioxidant, and antibacterial properties. This study aimed to investigate the potential of baicalin in alleviating lung and cell damage caused by MG by restoring imbalances in M1/M2 and Th1/Th2 differentiation and to explore its underlying mechanism. In this research, a model for M1/M2 polarization induced by MG was initially developed. Specifically, infection with MG at a multiplicity of infection (MOI) of 400 for 6 h represented the M1 model, while infection for 10 h represented the M2 model. The polarization markers were subsequently validated using qRT-PCR, ELISA, and Western blot analysis. Baicalin disrupts the activation of M1 cells induced by MG and has the potential to restore the balance between M1 and M2 cells, thereby mitigating the inflammatory damage resulting from MG. Subsequent studies on MG-infected chickens detected imbalances in M1/M2 and Th1/Th2 differentiation in alveolar lavage fluid, as well as imbalances in macrophages and Th cells in the lung. The M1/Th1 model was exposed to MG for 5 d, while the M2/Th2 model was infected with MG for 7 d. The utilization of both light and electron transmission microscopes revealed that the administration of baicalin resulted in a reduction in the number of M1 cells, a decrease in cytoplasmic vacuoles, restoration of mitochondrial swelling and chromatin agglutination, as well as alleviation of alveolar rupture and inflammatory cell infiltration. Furthermore, baicalin restored MG-induced M1/M2 and Th1/Th2 imbalances and inhibited the phosphorylation of p38 and p65 proteins, thereby hindering the activation of the TLR4-p38 MAPK/NF-κB pathway. This study provides insights into the potential long-term effects of baicalin in MG infection and offers a theoretical basis for practical applications.

Key words

Mycoplasma gallisepticum (MG)
baicalin
M1/M2
Th1/Th2
inflammatory impairment
==== Body
pmcINTRODUCTION

Mycoplasma gallisepticum (MG) is a widespread pathogen in poultry farming globally, presenting a significant risk to the growth and reproductive capacities of chickens (Chaidez-Ibarra et al., 2021). Mycoplasma gallisepticum primarily colonizes the respiratory mucosa and trachea through adhesion proteins, hindering the clearance of tracheal cilia and causing lung tissue damage and lesions, ultimately leading to respiratory dysfunction and chronic respiratory diseases (Marouf et al., 2022). Furthermore, MG is a persistent infection, with chickens carrying MG for life after infection, resulting in reduced immunity and making them highly susceptible to secondary infections by other pathogenic microorganisms, thereby increasing mortality rates and decreasing chicken ketone body levels (Kulappu Arachchige et al., 2020; Rüger et al., 2021). A prior investigation demonstrated that chickens concurrently infected with MG and a low-pathogenic avian influenza virus exhibited reduced body weight, heightened respiratory manifestations, and diminished levels of antibodies (Stipkovits et al., 2012). Several studies have reported apoptosis of splenic and thymus cells, oxidative stress autophagy in bursae of Fabricius, and inflammatory damage in chickens infected with MG (Hu et al., 2021; Ishfaq et al., 2020b). These findings indicate that MG damages immune organs, although the polarization of macrophages during infection has not been elucidated.

Macrophages play a critical role in the infection process by serving as the primary defence mechanism against pathogens and regulating immune responses (Chen and Zhang, 2017). When macrophages are exposed to various stimuli, they can undergo polarization into 2 distinct phenotypes known as classically activated macrophages (M1) and alternatively activated macrophages (M2). Among them, M1 is related to inflammation in the body, while M2 is related to anti-inflammatory and repair in the body (Snodgrass et al., 2021; Xu et al., 2024). In addition, macrophage polarization plays an important role in microbial infection and facilitates immune escape in mycoplasma infection. One of these studies reported that Mycoplasma agalactiae-derived Pam2cys Lipopeptide can polarize porcine monocyte-derived macrophages into M1, which exerts proinflammatory effects (Giulia et al., 2021). However, some studies have shown that Lacticaseibacillus can reduce the damage caused by mycoplasma pneumoniae infection by promoting M1 alveolar macrophages (Zhang et al., 2023). Therefore, how the polarization of chicken macrophages changes during MG infection is worthy of further investigation.

Naive CD4 T cells differentiate into Th1 cells and Th2 cells when stimulated by different cytokines (Shang et al., 2024). Specifically, M1 macrophages release Interleukin-12 (IL-12), which activates Th1 cells responsible for eliminating intracellular pathogens by binding to the IL-12 receptor on the surface of Th cells (Wojciechowski et al. 2009). Conversely, anti-inflammatory factors produced by M2 macrophages can induce the differentiation of Th cells into Th2 cells, which are involved in immune responses against parasites and bacteria (Caminati et al., 2018). Therefore, the M1/M2 and Th1/Th2 subsets work in tandem to regulate inflammation and immunity. It is also an important indicator of infectious and immune-related diseases (Mengxian et al., 2023). It is important to note that the balance between M1/M2 and Th1/Th2 subsets is disrupted during disease states, while under normal conditions, they maintain a dynamic equilibrium (Jai et al., 2022). Prior studies in the laboratory have indicated a shift in chicken serum Th1/Th2 differentiation during MG infection (Miao et al., 2022). Recent investigations have demonstrated that M1 macrophages and Th1 response are reduced in MEF2C knockdown mice, making them more susceptible to Listeria monocytogenes infection (Zhao et al., 2022). In the context of atopic dermatitis, histamine has been found to enhance the expression of Th2 cytokine-induced CCL18 in human M2 macrophages (Mommert et al., 2021). Consequently, M1/M2 polarization is consistent with Th1/Th2 differentiation, and the imbalance of differentiation is a major factor in some diseases. It is therefore hypothesized that MG infection not only causes damage to macrophages but also triggers their polarization imbalance. Consequently, further investigation is necessary to explore the changes in macrophages and Th cells in the lung following MG infection.

At present, the management and control of MG primarily depend on the use of antibiotics and vaccines (Ishfaq et al., 2020a; Susithra Priyadarshni et al., 2023). While these approaches have demonstrated favorable effectiveness, the use of antibiotics may lead to the development of drug-resistant bacteria, and vaccines are associated with high costs and potential secondary infections (Yaping et al., 2024). Consequently, researchers have shifted their focus towards exploring alternative or supplementary treatments for MG. One such treatment is a traditional Chinese medicine formula containing baicalin as its principal active component. Baicalin exhibits significant biological activity and has demonstrated anti-inflammatory, antiviral, anti-tumor, antibacterial, and hepatoprotective properties (Liu et al., 2021; Ruolei et al., 2024). Baicalin effectively mitigates the mitochondrial oxidative stress and apoptosis of spleen cells induced by MG infection (Ishfaq et al., 2019b). Baicalin alleviates the inflammatory damage caused by E. coli and MG infection in chickens through the IL-17 signaling pathway (Wu et al., 2020). Despite the established therapeutic effect of baicalin on MG, its influence on lung macrophage polarization and Th cell differentiation following MG infection remains unclear. Therefore, this study aimed to investigate whether baicalin could mitigate lung and cellular inflammatory damage caused by MG infection by modulating M1/M2 and Th1/Th2 homeostasis. This research seeks to elucidate the role of baicalin in the intervention of MG-induced injury and provide a new theoretical basis for its clinical application.

MATERIAL AND METHODS

Mycoplasma Strains and Cells Culture

The MG strain Rlow was acquired from the Harbin Institute of Veterinary Medicine (Chinese Academy of Agricultural Sciences, Harbin). MG was cultured in Mycoplasma Serum-Free Media (H910KJ, Shanghai BasalMedia Technologies Ltd., Shanghai, China) with 10% FBS (Viva Cell, C04001-500, Shanghai XP Biomed Ltd., Shanghai, China), 0.5% penicillin/streptomycin (Beyotime, Shanghai, China) and 0.1% NAD (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at a constant temperature (shanghai yiheng instrument, Shanghai, China) of 37 °C. MG was administered to chicks and cells at a concentration of 1 × 109 CCU (colour change unit) /mL (Wang et al., 2024).

The chicken macrophage cell lines HD11 were purchased from Otwo Biotech Co., Ltd., (LOT: HTX2259, Shenzhen, China). The cells were cultured in RPMI-1640 (Gibco, NY) medium supplemented with 10% FBS and 0.5% penicillin/streptomycin in a 5% carbon dioxide environment (Thermo Fisher, NY) at 39°C for 12 h. Subsequently, HD11 cells were seeded into 96-well plates (2 × 104 cells/well) and 6-well plates (2 × 105 cells/well) and incubated at a constant temperature (39°C, 5% CO2) for 12 h.

Cell Viability

The viability of HD11 cells was assessed using the Cell Counting Kit-8 (CCK8, APExBIO, Houston, TX). Following overnight incubation, the cells were exposed to various concentrations of baicalin (0, 25, 75, 150, 300 and 600 µg/mL) for 4 h, or 150 µg/mL of baicalin for 2, 4, 6, 8, 10 and 12 h, in combination with different MOI of MG (0, 100, 200, 400, 800, and 1,000). The absorbance at 450 nm was then measured following a 2 h incubation period after the addition of 10 μL of CCK-8 per well.

Cells Grouping

Study 1: Cells were allocated into 2 distinct groups: the NC group, which received 1 mL of 1640 medium, and the MG group, which was supplemented with 400 MOI of MG solution and 1,640 medium to a total volume of 1 mL. The dosage of MG was determined based on cell viability (Figure 2A). Cell samples from both groups were collected at 4, 6, 8, and 10 h after MG infection for subsequent experiments (refer to Figure 1A).Figure 1 Schematic outline of the experimental protocol used in this study. (A) Study 1 in HD11 cells: Changes of M1/M2 polarization cytokine caused by MG. (B) Study 2 in HD11 cells: Baicalin regulated the imbalance of M1/M2 induced by MG infection. (C) Study 1 in chickens: Changes in the balance of macrophages and Th cells after MG infection. (D) Study 2 in chickens: Baicalin interfered with M1/M2 and Th1/Th1 imbalance in the lungs induced by MG infection.

Figure 1

Study 2: The study involved the division of experiments into 4 distinct groups: the normal control group (NC), the MG infection group (MG), the baicalin control group (BC), and the baicalin intervention group (BI). At 6 h, NC group cells were added to 1 mL of 1640 medium, and MG group cells were added to 400 MOI of MG solution. BC group cells were added 1 mL of 150 μg/mL baicalin and BI group cells were pretreated with 1 mL of 150 μg/mL baicalin for 6 h and then added 400 MOI of MG solution for 6 h (Figures 2B and 2C). In the end, 1,640 medium were used to trim to 2 mL and samples were collected at 12 h (Figure 1B).Figure 2 Effect of MG infection on M1/M2 polarization of HD11 cells. (A) Effect of a series of doses (100, 200, 400, 800, and 1,000 MOI) of MG on cell viability for 6 h. (B) Effect of a range of concentrations (25, 75, 150, 300 and 600 μg/mL) of baicalin on cell viability of HD11 cells for 4 h. (C) Effect of different time points (2, 4, 6, 8, 10 and 12 h) of 150 μg/mL baicalin on cell viability. (D) Effects of MG infection on mRNA levels of cytokines iNOS, TNF-α, IL-6, CD86, L-10, VEGFA, TGF-β and CD206 in NC and MG group. *P < 0.05, ⁎⁎P < 0.01. Data was expressed as mean ± SD.

Figure 2

Chickens and Drug

1-day-old male white-leghorn chickens were bought from Guangda Poultry Co., Ltd. (Harbin, China) and fed in the animal housing room. The chickens were fed with urban water, while the temperature and feeding density were strictly controlled.

Study 1: Sixty 1-day-old white leghorn chickens were randomly divided into 2 groups: the normal control group (NC) and the MG infection group (MG). At 7-day-old, 45 chickens in the NC group were injected with 0.2 mL culture medium of MG on both sides of their air sacs and 45 chickens in the MG group were injected with 0.2 mL MG on both sides air sacs. At 10-, 12-, and 14-day-old, 15 chickens from each group were euthanized with intravenous air and lung samples were taken (Figure 1C).

Study 2: Forty 1-day-old, chickens were randomly separated into 4 groups: normal controls group (NC), MG infection group (MG), baicalin control group (BC) and baicalin intervention group (BI). At 7-day-old, chickens in the NC group were infected with 0.2 mL culture medium of MG in the bilateral air sacs and chickens in the MG group were infected with 0.2 mL MG solution in the bilateral air sacs. At 5-day-old, chickens in the BC group were given baicalin 450 mg/kg/d orally and chickens in the BI group were given baicalin 450 mg/kg/d orally for 3 d and infected with 0.2 mL MG solution in the bilateral air sacs at 7-day-old. At 12-day-old, ten chickens from each group were euthanized with intravenous air and lung samples were taken (Figure 1D).

Baicalin (purity ≥ 98.0%) was purchased from Beijing Solarbio Science & Technology Co., Ltd., (LOT: SB8020, Beijing, China).

Cell Morphological

HD11 cells in the experimental groups were observed under a light microscope (Nikon ECLIPSE E100, Japan, 100 magnification). Then, the M1/M2 morphology of HD11 cells was identified according to the M1 and M2 cell morphology of other species and other test results.

Ultrastructural Examination

HD11 cells and fresh lung tissues (1 mm×1 mm) were fixed in 2.5% glutaraldehyde fixative for 12 h, rinsed 3 times with 0.1 M phosphate buffer (pH 7.4), and fixed in 1% osmic acid fixative for 2 h. After decolourization with different concentrations of alcohol, the samples were soaked in 1:1 propylene oxide and resin overnight. Next, the sections were embedded in resin with a thickness of 60 nm. Finally, sections were stained with 0.2% lead citrate and analyzed using GEM-1200ES transmission electron microscopy (JEOL Co., Ltd., Japan) (Li et al., 2017).

Histopathological Examination

Fresh lung tissues (5 mm × 5 mm) were collected and fixed in 10% formaldehyde for 48 h. After dehydration with a gradient concentration of alcohol and clearing with xylene, the samples were dipped in wax and cut into 4 μm sections. After hematoxylin and eosin (HE, Beyotime, China) staining, the sections were observed under a light microscope (400 × magnification).

Measurement of Cytokines by ELISA

ELISA was performed with cytokines activities of tumor necrosis factor–α (TNF-α), IL-6, IL-10, transforming growth factor-β (TGF-β), interferon-γ (IFN-γ), T-bet, GATA binding protein 3 (GATA-3) and IL-4 following the manufacturer's instructions (Beijing Chenglin Biological Technology, Beijing, China).

Total RNA Extraction and qRT-PCR

Cell samples (1-well) and lung tissues (100 mg) were collected from each group to identify mRNA expression levels of inducible nitric oxide synthase (iNOS), TNF-α, IL-6, CD86, IL-10, VEGFA, TGF-β, CD206, IFN-γ, T-bet, IL-12, CCR5, IL-4, GATA-3, interferon-regulatory factor-4 (IRF-4), CCR4, TLR4, p38 and p65. Firstly, Trizol (Takara, Japan) was utilized to extract RNA, and then gDNA Eraser reagent (Takara, Japan) was used to obtain cDNA. Finally, the SYBR premix Ex Taq kit (Takara, Japan) was used for the qRT-PCR reaction with cDNA as a template. The datum was calculated by 2− ΔΔCt methods, and the reference gene was GAPDH. The gene-specific primers are shown in Table 1.Table 1 The primer sequences for fluorescence quantitative PCR.

Table 1Target gene	Primers (from 5′ to 3′)	Sequence numbers	
GAPDH	F: CAGAACATCATCCCAGCGTCCAC	NM_204305.1	
R: CGGCAGGTCAGGTCAACAACAG	
iNOS	F: GTGGTATGCTCTGCCTGCTGTTG	NM_204961.1	
R: GTCTCGCACTCCAATCTCTGTTCC	
TNF-α	F: CCCAGTTCAGATGAGTTGCCCTTC	NM_204267.1	
R: GCCACCACACGACAGCCAAG	
IL-6	F: GAGGTTGGGCTGGAGGAGGAG	NM_204628.1	
R: TCTCGCACACGGTGAACTTCTTG	
CD86	F: GTTACCAGCAAGCTGAATATCC	NM_001037839.1	
R: TTAGACTGCGAGACTGACAC	
VEGFA	F: CCTGTGTGCCTCTGATGAGATGTG	NM_001110355.1	
R: CGCTATGTGCTGACTCTGATGGG	
TGF-β	F: CCTGCCATTTCTCATCGGGACTTG	BI394686.1	
R: AACTGGTTCGTGCTTTGGGAGTG	
IL-10	F: CAGCACCAGTCATCAGCAGAGC	NM_001004414.2	
R: GCAGGTGAAGAAGCGGTGACAG	
CD206	F: TGGTATCCGTTGAAGACTCAG	NM_001397660	
R: CTATAGTGTCGCATGTTCATTCC	
IFN-γ	F: AAGCCGCACATCAAACACATATC	NM-205149.1	
R: GTCGTTCATCGGGAGCTTGG	
IL-12	F: CCTGTGGCTCGCACTGATAA	DQ202328.1	
R: ATCTCAGTCGGCTGGTGCTC	
T-bet	F: GACGGAGGTGAAGGAGGGTGAG	XM_015299480.2	
R: TGGTAGGCAGTGACAGCAATGAAC	
CCR5	F: ATGACTGACATCTACCTGCTC	NM_001271141.1	
R: ATACTATCCCAGGAACAGAGG	
IL-4	F: TCTTCCTCAACATGCGTCAG	NM-1007079.1	
R: GGTCTGCTAGGAACTTCTCCAT	
IRF-4	F: TGAGCCACTTGGAGCGAGGAG	NM_204299.2	
R: GCTTGTTGGGTCGGTCACTGC	
GATA-3	F: AGCCACATTTCACCCTTCAGTCAC	NM_001008444.1	
R: AAGGAGAGGCTGGATGGAGGATG	
CCR4	F: TACCCTGGTATTCCTGATTGG	XM_046938181.1	
R: CATAACTATCAACGGGAGTAGG	
TLR4	F: CACTGGTGTATCCGCTGATTTCTCG	XM_425996.6	
R: GGTGCTGCCACTGTCCATGAAG	
p38	F: GCATCAACACTCCGCTCCCTAAC	NM_001353939.1	
R: AAGGCTGTCTTGTCGTAGGCATTAG	
p65	F: ACCACCACCACCACAACACAATG	BM489686.1	
R: GCGGCGTCGATGGTATCAAAGG	

RNA Extraction From Alveolar Lavage Fluid

Take fresh lung tissue, rinse with PBS, gently 4 times with the hand, repeated 3 times. The lung alveolar lavage fluid of 2 chickens was mixed and DNA was extracted using TIANamp Micro DNA Kit (DP316, TIANGEN BIOTECH LTD., BEIJING, China) for qPCR.

Western Blot

The cells and lung tissues (100 mg) were added to 250 μL RIPA lysate to extract the protein. Next, the protein concentration of each group was determined by the BCA kit (Beyotime, China) and adjusted with PBS. Then the protein was added to 5×SDS-PAGE loading buffer and boiled in boiling water for 5 min. Proteins were electrophoresed using a 10% ExpressCast PAGE gel kit (NCM Biotech Co., Ltd., Suzhou, China) and transferred to PVDF membranes. PVDF membranes were blocked with milk powder for 2 h at 37°C and incubated with corresponding antibodies which are TNF-α, IL-12, TLR4, p38, p-p38, GAPDH, iNOS, p65 and p-p65 for 12 h at 4°C. The antibody information and dilution ratio are shown in Table 2. PVDF membranes were visualized using enhanced chemiluminescence (ECL) and analyzed with Image J.Table 2 The information about antibodies.

Table 2Antibody	Antibody brand	Dilution ratio	
iNOS	Wanleibio	1:1000	
TNF-α	Bioss	1:800	
IL-12	Bioss	1:800	
p38	Bioss	1:1000	
p-p38	Bioss	1:500	
GAPDH	Bimake	1:2000	
p65	Wanleibio	1:1000	
p-p65	Wanleibio	1:500	
TLR4	Bioss	1:1000	

Ethics Statement

The present study was conducted under the approval of the Laboratory Animal Ethics Committee of Northeast Agricultural University (Heilongjiang province, China) in accordance with the Laboratory Animal Guideline for Ethical Review of Animal Welfare (GB/T 35892-2018, National Standards of the People's Republic of China).

Statistical Analysis

The data were analyzed with GraphPad Prism 10 (GraphPad, San Diego,CA) and expressed as mean ± standard deviation (Mean ± SD). Differences between groups were calculated using one-way ANOVA for comparisons. The t-test was utilized to compare the differences between the 2 groups. The experiments were performed at least 3 times (n = 3) unless otherwise mentioned. P < 0.05 was considered statistically significant between groups.

RESULTS

HD11 Cell Viability

As shown in Figures 1A-1C, this study selected 400 MOI of MG to act on HD11 cells, and 150 μg/mL baicalin to intervene in cells for a duration of 6 h.

Effect of MG Infection on Macrophage Polarization-Related Cytokines in HD11 Cells

qRT-PCR analysis revealed a higher expression level of iNOS, TNF-α, IL-6, and CD86 at 4, 6 and 8 h in the MG group than in the NC group. Conversely, IL-10, VEGFA, TGF-β, and CD206 exhibited increased expression at 10 h in the MG group as depicted in Figure 2D (P < 0.01). Additionally, the secretion levels of TNF-α and IL-6 significantly escalated at 4, 6, 8, and 10 h, while IL-10 and TGF-β showed significant elevation at 10 h in the MG group in Figure 3A (P < 0.01).Figure 3 Effect of MG infection on inflammatory injury of HD11 cells. (A) The secretion levels of cytokines TNF-α, IL-6, L-10 and TGF-β changed after 4, 6, 8 and 10h of MG infection. (B) Effects of MG infection for 6 and 10h on cell morphology of HD11 (200 ×, scale bar, 50 μm). (C) Effects of MG infection for 6 and 10h on ultrastructure of HD11 cells by TEM (4,000 ×, scale bar, 2 μm). The yellow arrows indicate cytoplasmic vacuoles, the white arrows show mitochondrial changes, and the blue arrows show intranuclear changes. (D) Western blot results showed the protein expressions of iNOS and TNF-α with GAPDH as the internal reference protein after 6 and 10h of MG infection. Data are expressed as mean ± SD. *P < 0.05, ⁎⁎P < 0.01.

Figure 3

At 6 h postinfection, HD11 cells predominantly exhibited M1-type polarization (fusiform cells), while at 10 h post-infection, most cells were damaged, and the remaining cells displayed M2-type macrophage characteristics (roundness cells) as shown in Figure 3B. Furthermore, cytoplasmic vacuolation, chromatin agglutination, and mitochondrial swelling were observed at 6 and 10 h post-infection (Figure 3C). Moreover, the western blot analysis in Figure 3D indicated a significant increase in the protein expressions of iNOS and TNF-α at 6 h postinfection, followed by a decrease in TNF-α at 10 h (P < 0.01). Overall, an imbalance in M1/M2 polarization was observed in HD11 cells during MG infection, with macrophage polarization gradually shifting from M1 to M2 with increasing infection duration.

Effect of Baicalin Intervention on Macrophage Polarization in HD11 Cells After MG Infection

The results presented in Figure 4A demonstrate a significant increase in the mRNA levels of iNOS, TNF-α, IL-6, and CD86 in the MG group compared to the NC group. However, following baicalin intervention, these mRNA levels exhibited a significant decrease (P < 0.01). In contrast, the mRNA levels of IL-10, VEGFA, TGF-β, and CD206 in the BI group showed an increase, which differed from the decrease observed in the MG group as depicted in Figure 4B (P < 0.01). Furthermore, the secretion levels of TNF-α, IL-6, IL-10, and TGF-β, as measured by ELISA, were significantly different between the BI and MG groups (P < 0.01) (Figure 5A).Figure 4 Effect of baicalin intervention on macrophage polarization in HD11 cells after MG infection. (A) Effects of baicalin intervention on mRNA levels of M1 marker: iNOS, TNF-α, IL-6 and CD86 in each group. (B) Effects of baicalin intervention on mRNA levels of M2 marker: L-10, VEGFA, TGF-β and CD206 in each group. (C) Effect of baicalin intervention on mRNA expression of TLR4, p38 and p65 in each group. ⁎⁎P < 0.01. Data was expressed as mean ± SD.

Figure 4

Figure 5 Effects of baicalin on MG-induced HD11 cell damage. (A) The secretion levels of cytokines TNF-α, IL-6, L-10 and TGF-β changed in the NC, MG, BC and BI groups. (B) Polarization and damage status of HD11 cells in NC, MG, BC and BI group (200 ×, scale bar, 50 μm). (C) Ultrastructural changes of HD11 cells in NC, MG, BC and BI group (4,000 ×, scale bar, 2 μm). The yellow arrows indicate cytoplasmic vacuoles, the white arrows show mitochondrial changes, and the blue arrows show intranuclear changes. (D) Western blot results showed the protein expressions of TNF-α, iNOS, TLR4, p-p38, p38, p-p65 and p65 with GAPDH as the internal reference protein. Data are expressed as mean ± SD. ⁎⁎P < 0.01.

Figure 5

The microstructures and ultrastructures of the cells, as illustrated in Figures 5B-5C, revealed a reduction in M1-type macrophages induced by MG following baicalin intervention in Figure 5B. Additionally, baicalin alleviated the degree of chromatin agglutination, mitochondrial swelling, and the number of intracellular cytoplasmic vacuolation (Figure 5C). Moreover, the expression of TLR4, p-p38/p38, p-p65/p65, TNF-α, and iNOS in the MG group was significantly reduced upon baicalin intervention, as shown in Figure 5D (P < 0.01). Similarly, the mRNA expression levels of TLR4, p38 MAPK, and p65 NF-κB were consistent with the protein expression levels depicted in Figure 4C. These findings suggest that baicalin has the potential to inhibit MG-induced M1/M2 imbalance and reduce cell inflammatory impairment through the TLR4-p38 MAPK/NF-κB signaling pathway.

Effects of MG Infection on Macrophages and Th Cells in Chicken Alveoli

In the fluid obtained from alveolar lavage, the expression of mRNA for CD86 and CCR5 was significantly elevated at 3, 5, and 7 d following infection with MG. Conversely, the expression of CD206 and CCR4 was notably increased only at the 7-d, as depicted in Figure 6A (P < 0.01).Figure 6 Effect of differentiation of macrophages and Th cells in the lung after 3, 5, and 7 d of MG infection. (A)The mRNA expression levels of cytokines in CD86, CD206, CCR5 and CCR4 in the alveolar lavage fluid. (B)The mRNA expression levels of M1/M2 in iNOS, TNF-α, IL-6, CD86, L-10, VEGFA, TGF-β and CD206 changed after MG infection. (C) The mRNA expression levels of Th1/ Th 2 in T-bet, IFN-γ, IL-12, CCR5, IL-4, IRF-4, GATA-3 and CCR4 changed after MG infection. Data are expressed as mean ± SD. ⁎⁎P < 0.01.

Figure 6

Effect of MG-Induced Differentiation of Macrophages and Th Cells in Chicken Lung

The qRT-PCR analysis showed a higher expression level of iNOS, TNF-α, IL-6, CD86, T-bet, and CCR5 at 3, 5, and 7 d and, IFN-γ, IL-12 at 3, 5 d in the MG group. Decreased mRNA levels of IL-10, VEGFA, TGF-β, CD206, IL-4, IRF-4, GATA-3, and CCR4 were detected at 3 and 5 d after the MG-infection, and these cytokines were significantly increased at 7 d in MG group in Figures 6B-6C (P < 0.01). Additionally, ELISA analysis demonstrated a notable increase in TNF-α, IL-6, IFN-γ, and T-bet at 3 and 5 d, and IL-10, TGF-β, IL-4, and GATA-3 at 7 d following MG infection in Figure 7A (P < 0.01).Figure 7 Effects of MG infection on lung tissue injury. (A) Secretion levels of cytokines TNF-α, IL-6, L-10, TGF-β, T-bet, IFN-γ, IL-4 and GATA-3 changed after MG infection at 3, 5,7 d. (B) Histopathological changes were observed using HE staining at 5 and 7 d (400 ×, scale bar, 20 μm). Green arrows indicate alveolar rupture, yellow arrows indicate inflammatory cell infiltration and blue arrows indicate alveolar wall thickening. (C) Ultrastructural examination of the chicken lung was observed by TEM at 5 and 7 d (8,000 ×, scale bar, 1 μm). The orange arrows show cell rupture, the white arrows show mitochondrial changes, and the light blue arrows show intranuclear changes. (D) Western blot results showed the protein expressions of iNOS, TNF-α and IL-12 with GAPDH as the internal reference protein. Data was expressed as mean ± SD. ⁎⁎P < 0.01.

Figure 7

Furthermore, histological examination revealed ruptured alveoli, thickened alveolar walls, and infiltration of inflammatory cells in the lung after 5 and 7 d of MG infection (Figure 7C). Ultrastructural analysis of the lung at 5 and 7 d in the MG group exhibited partial cell fragmentation, mitochondrial swelling, and nuclear-condensed chromatin agglutination (Figure 7D). Moreover, the expression levels of iNOS, TNF-α, and IL-12 increased at 5 d post MG infection and significantly decreased at 7 d as shown in Figure 7D (P < 0.01). These findings suggest a shift in macrophage polarization and Th cell differentiation in both alveolar macrophages and pulmonary macrophages following MG infection. M1/Th1 cells were dominant at 3 and 5 d of MG infection, while M2/Th2 cells were prominent at d 7. However, regardless of the MG infection for 5 or 7 d, lung structure was compromised and accompanied by inflammatory impairment.

Effect of Baicalin Intervention on an Imbalance of M1/M2 and Th1/Th2 in the Lung After MG Infection

The qRT-PCR analysis depicted in Figure 8A demonstrated that Baicalin reversed the mRNA expression of macrophage and Th cell-associated cytokines induced by MG, including iNOS, TNF-α, IL-6, CD86, IL-10, VEGFA, TGF-β, CD206, T-bet, IFN-γ, IL-12, CCR5, IL-4, IRF-4, GATA-3, and CCR4. Additionally, the ELISA results presented in Figure 8B indicated that baicalin decreased the secretion of TNF-α, IL-6, T-bet, and IFN-γ, while increasing the secretion of IL-10, TGF-β, IL-4, and GAGT3 (P < 0.01). Of particular significance, baicalin intervention effectively alleviated alveolar rupture, alveolar wall thickening, and inflammatory cell infiltration in the lung caused by MG, as illustrated in Figure 8C. Furthermore, baicalin intervention mitigated cell rupture, reduced mitochondrial swelling, and alleviated chromatin agglutination in the lung, as depicted in Figure 8D. Moreover, baicalin notably decreased the mRNA expression levels of TLR4, p38 MAPK, and p65 NF-κB, as shown in Figure 8A, and the protein expression levels of TLR4, p-p38/p38, p-p65/p65, IL-12, TNF-α, and iNOS induced by MG, as presented in Figure 8E (P < 0.01).Figure 8 Effect of baicalin intervention on an imbalance of M1/M2 and Th1/Th2 in the lung after MG infection. (A) mRNA expression levels of cytokines in iNOS, TNF-α, IL-6, CD86, L-10, VEGFA, TGF-β, CD206, T-bet, IFN-γ, IL-12, CCR5, IL-4, IRF-4, GATA-3, CCR4 TLR4, p38 and p65 changed in each group. (B) Secretion levels of cytokines TNF-α, IL-6, L-10, TGF-β, T-bet, IFN-γ, IL-4 and GATA-3 changed in each group. (C) Effect of baicalin intervention on histopathological assessment of lung (400 ×, scale bar, 20 μm). Green arrows indicate alveolar rupture, yellow arrows indicate inflammatory cell infiltration and blue arrows indicate alveolar wall thickening. (D) Effect of baicalin intervention on ultrastructural examination of chicken lung (8,000 ×, scale bar, 1 μm). The orange arrows show cell rupture, the white arrows show mitochondrial changes, and the light blue arrows show intranuclear changes. (E) Changes in the expression levels of TLR4, p-p38/p38, p-p65/p65, IL-12, TNF-α and iNOS in each group. Data was expressed as mean ± SD. ⁎⁎P < 0.01.

Figure 8

In conclusion, we have established MG-induced M1/M2 polarization and Th1/Th2 differentiation models, and selected M1/Th1 models to verify the role of baicalin in M1/M2 and Th1/Th2 imbalance. Our findings indicate that baicalin has the ability to counteract the imbalance of M1/M2 and Th1/Th2 by suppressing the activation of the TLR4-p38 MAPK/NF-κB signaling pathway, thereby mitigating the inflammatory damage caused by MG.

DISCUSSIONS

Avian mycoplasmosis, Newcastle disease, infectious bronchitis virus, avian influenza and Avian pneumovirus are among the most significant respiratory diseases that impact the poultry industry (Yehia et al., 2023). Among them, MG is a prominent mycoplasma strain associated with Avian mycoplasmosis and a prevalent global disease with significant economic ramifications. Research indicates that MG can lead to a 10% to 20% reduction in broiler weight gain, a 10 to 20% decrease in feed conversion rate, a 5 to 10% increase in mortality rate, and a 10 to 20% rise in carcass scrap (Michiels et al., 2016). At the same time, MG can bind to chicken erythrocytes, enabling its dissemination throughout the avian organism and resulting in diverse inflammatory reactions and inhibition of the host's immune response (Vogl et al., 2008; Yingjie et al., 2022). Studies have demonstrated that MG induces oxidative stress and apoptosis in chicken thymus cells and disrupts the dynamic stability of mitochondria in the spleen (Ishfaq et al., 2019a; Li et al., 2019). And previous research has shown that MG infection can lead to significant alterations in oxidative stress markers, disruption of mitochondrial membrane potential, and subsequent induction of apoptosis in HD11 cells (Ishfaq et al., 2021). Furthermore, it was observed in this study that macrophages were compromised, chromatin agglutination and cytoplasmic vacuoles increased during MG infection, and lung tissue exhibited inflammatory infiltration, alveolar fragmentation, and inflammatory thickening of the alveolar wall. These findings indicate that MG infection not only damages the lungs and trachea but also destroys immune organs and immune cells, thereby facilitating MG immune evasion.

The establishment of macrophage polarization models involves stimulating macrophages with specific factors. For instance, M1 models are typically induced by IFN-γ, LPS, or a combination of both, while M2 models are established through stimulation with IL-4, IL-10, or M-CSF (Mozhdeh et al., 2023; Xuxin et al., 2024). Similarly, disease-specific factors can also be used to induce macrophage polarization models. For example, melanin-derived exosomes were used to stimulate RAW264.7 cells to establish M1 and M2 polarization models, and glucose was used to stimulate RAW264.7 macrophages to establish macrophage polarization models (Bardi et al., 2018; Zhang et al., 2019). The former represents the classical macrophage polarization model, while the latter represents the disease-specific macrophage polarization model, which can more effectively mimic the polarization process of macrophages in diseases and minimize experimental errors in response to the complex and dynamic body environment. Therefore, this study selected MG-infected HD11 cells to establish an in vitro macrophage polarization model. The success of the model was assessed based on the expression of M1 (iNOS, TNF-α, IL-6, CD86) and M2 (IL-10, VEGFA, TGF-β, CD206) macrophage surface markers and secreted cytokines. In this research, after infection with MG, the cytokines iNOS, TNF-α, IL-6, and CD86 demonstrated an initial rise followed by a decline, whereas IL-10, VEGFA, TGF-β, and CD206 exhibited a decrease followed by an increase. These findings align with previous research results (Tsai et al., 2021; Zhen et al., 2021; Bao et al., 2022). Hence, in the course of MG infection, it not only causes cell damage but also causes polarization of macrophages, a phenomenon that has also been verified in the lung. Furthermore, 400 MOI of MG-infected HD11 cells were selected as the M1 polarization model at 6 h, and 1 × 109 CCU/mL MG-infected chicks for 5 d were chosen as the in vivo M1 polarization model.

M1/M2 macrophages and Th1/Th2 T helper cells exhibit a close relationship and mutually reinforce each other in the context of immunity, as evidenced by the coexistence of M1/Th1 and M2/Th2 subsets (Mills and Ley, 2014; Amanda Miyuki et al., 2023). Importantly, Th cells play a critical role in immune regulation, as evidenced by immune dysfunction resulting from the suppression of antigen-presenting cells, heightened secretion of pro-inflammatory factors, and dendritic cell activation following Th1/Th2 imbalance (Hu et al., 2018; Park et al., 2016). In this study, analysis of alveolar lavage fluid revealed not only M1/M2 polarization but also Th1/Th2 differentiation, as indicated by surface markers (CD86, CD206, CCR5, CCR4). Consequently, we also identified Th1/Th2 markers in the lungs (T-bet, IFN-γ, IL-12, CCR5, IL-4, IRF-4, GATA-3, CCR4) and observed a consistent trend with the indicators in the alveoli. These findings suggest a close association between the immune drift of Th1/Th2 in the lung during MG infection and the imbalance of M1/M2 polarization. Moreover, the ratio of CD4+T/CD8+T cells in the blood and Th1/Th2 in the trachea may undergo temporal alterations in response to MG (Miao et al, 2022). In the context of atherosclerosis, the immune balance of M1/M2 and Th1/Th2 is disrupted, leading to an elevated M1/Th1 ratio, increased inflammation, and injury (Li et al, 2022). Given the similarity of the results of this experiment to those of the aforementioned studies, we further investigated the role of baicalin in the equilibrium of M1/M2 and Th1/Th2.

Numerous studies have demonstrated the significant anti-inflammatory, antioxidant, and antibacterial properties of baicalin, as well as its ability to modulate macrophage polarization and Th cell differentiation (Han et al, 2019; Lan et al, 2022). Previous laboratory investigations have revealed that baicalin can mitigate oxidative stress and apoptosis in MG-infected thymus and spleen through the Nrf2/HO-1 signaling pathway (Ishfaq et al, 2019a; Li et al, 2019). Baicalin has been shown to alleviate inflammatory damage by suppressing the 5-LOX/CysLTs pathway and LPS-induced microglia polarization (Wu et al, 2019). Additionally, research has indicated that baicalin can restore and regulate Th1/Th2 balance to enhance skin barrier function and inhibit the activation of the JAK/STAT pathway to reduce inflammation (Wang et al, 2022). Consequently, it is hypothesized that baicalin may regulate MG-induced M1/M2 and Th1/Th2 imbalances to mitigate lung and cellular inflammation. The study's findings showed that baicalin down-regulated the expression of iNOS, TNF-α, IL-6, CD86, T-bet, IFN-γ, IL-12, and CCR5 cytokines induced by MG, while increasing the expression of IL-4, IRF-4, GATA-3, CCR4, IL-10, VEGFA, TGF-β, and CD206 factors. This aligns with previous research, as baicalin mitigates the inflammatory damage in HD11 cells and lungs induced by MG. However, further investigation is warranted to elucidate the mechanisms through which baicalin modulates the imbalance of M1/M2 and Th1/Th2. Studies have indicated that MG can trigger Toll-like receptors (TLR) on the cell surface, leading to inflammation or programmed cell necrosis (Majumder et al, 2014; Chen et al, 2020). In this study, baicalin notably suppressed TLR activation, concurrently reducing phosphorylation levels of p38 and p65, diminishing the production of inflammatory mediators, and inhibiting M1 polarization and Th1 differentiation, thereby promoting tissue repair. These findings are in line with those of other researchers, demonstrating that baicalin inhibits M1/Th1 differentiation via the TLR4-p38 MAPK/NF-κB pathway, thereby reducing the secretion of inflammatory mediators and ameliorating macrophage anlung damage (Nie et al, 2019; Liu et al, 2020).

In summary, we developed models to study the polarization of M1/M2 macrophages and the differentiation of Th1/Th2 cells induced by MG. We then chose M1/Th1 models to investigate the impact of baicalin on the imbalance of M1/M2 and Th1/Th2. Our findings indicate that baicalin has the ability to counteract M1/M2 polarization and Th1/Th2 imbalance by suppressing the activation of the TLR4-p38 MAPK/NF-κB signaling pathway. Additionally, baicalin was observed to alleviate the damage caused by MG to the lungs and macrophages of the host.

DISCLOSURES

The authors declared no conflicts of interests.

ACKNOWLEDGMENTS

This study was supported by the 10.13039/501100001809 National Natural Science Foundation of China (NO. 31973005 , 32273062 ), 10.13039/501100005046 Natural Science Foundation of Heilongjiang Province (NO. LH2022C038 ), Post-doctoral Research Foundation in Heilongjiang Province (NO. LBH-Z22260 ).

Availability of Data and Materials: The datasets produced during this study are available from the corresponding author upon reasonable request.

Author Contributions: JL and ZW conceived and designed the experiment. YG and YM completed the animals and cells experiment, data analysis and manuscript writing. HC, KW, SW and RW assist in experiments and guide paper writing.
==== Refs
REFERENCES

Amanda Miyuki H. Marcelino A.-S.A. Elizabeth Christina P. Diva Denelle S.-M. Ronalda Silva de A. Maria Anete L. Increased susceptibility to encephalitozoonosis associated with mixed Th1/Th2 profile and M1/M2 profile in mice immunosuppressed with cyclophosphamide Exp. Parasitol. 254 2023 108606
Bao Y. Peng J. Yang K.L. Wang C.H. Guo Y.F. Guo Z.S. Du S.Y. Therapeutic effects of Chinese medicine Di-Long (Pheretima vulgaris) on rheumatoid arthritis through inhibiting NF-κB activation and regulating Th1/Th2 balance Biomed Pharmacother 147 2022 112643
Bardi G.T. Smith M.A. Hood J.L. Melanoma exosomes promote mixed M1 and M2 macrophage polarization Cytokine 105 2018 63 72 29459345
Caminati M. Pham D.L. Bagnasco D. Canonica G.W. Type 2 immunity in asthma World Allergy Organ J. 11 2018 13 29988331
Chaidez-Ibarra M.A. Velazquez D.Z. Enriquez-Verdugo I. Castro Del Campo N. Rodriguez-Gaxiola M.A. Montero-Pardo A. Diaz D. Gaxiola S.M. Pooled molecular occurrence of Mycoplasma gallisepticum and Mycoplasma synoviae in poultry: A systematic review and meta-analysis Transbound Emerg. Dis. 69 2021 2499 2511 34427387
Chen C. Li J. Zhang W. Shah S.W.A. Ishfaq M. Mycoplasma gallisepticum triggers immune damage in the chicken thymus by activating the TLR-2/MyD88/NF-kappaB signaling pathway and NLRP3 inflammasome Vet. Res. 51 2020 52 32276652
Chen Y. Zhang X. Pivotal regulators of tissue homeostasis and cancer: macrophages Exp. Hematol. Oncol. 6 2017 23 28804688
Giulia F. Giovanni A.A. Chiara Grazia De C. Samanta M. Tania C. Silvia Dei G. Floriana F. Susanna Z. Guendalina V. Simon P.G. Annalisa O. Bernardo C. Elisabetta R. Targeting toll-like receptor 2: polarization of porcine macrophages by a mycoplasma-derived Pam2cys lipopeptide Vaccines 9 2021 692 34201691
Han S. Wang W. Wang S. Wang S. Ju R. Pan Z. Yang T. Zhang G. Wang H. Wang L. Multifunctional biomimetic nanoparticles loading baicalin for polarizing tumor-associated macrophages Nanoscale 11 2019 20206 20220 31621735
Hu W. Zhang W. Shah S.W.A. Ishfaq M. Li J. Mycoplasma gallisepticum infection triggered histopathological changes, oxidative stress and apoptosis in chicken thymus and spleen Develop. Comp. Immunol. 114 2021 103832
Hu X. Chi Q. Wang D. Chi X. Teng X. Li S. Hydrogen sulfide inhalation-induced immune damage is involved in oxidative stress, inflammation, apoptosis and the Th1/Th2 imbalance in broiler bursa of Fabricius Ecotoxicol Environ Saf. 164 2018 201 209 30118953
Ishfaq M. Chen C. Bao J. Zhang W. Wu Z. Wang J. Liu Y. Tian E. Hamid S. Li R. Ding L. Li J. Baicalin ameliorates oxidative stress and apoptosis by restoring mitochondrial dynamics in the spleen of chickens via the opposite modulation of NF-κB and Nrf2/HO-1 signaling pathway during Mycoplasma gallisepticum infection Poult. Sci. 98 2019 6296 6310 31376349
Ishfaq M. Hu W. Khan M.Z. Ahmad I. Guo W. Li J. Current status of vaccine research, development, and challenges of vaccines for Mycoplasma gallisepticum Poult. Sci. 99 2020 4195 4202 32867963
Ishfaq M. Wu Z. Wang J. Li R. Chen C. Li J. Baicalin alleviates Mycoplasma gallisepticum-induced oxidative stress and inflammation via modulating NLRP3 inflammasome-autophagy pathway Int. Immunopharmacol. 101 2021 108250
Ishfaq M. Zhang W. Hu W. Shah S.W.A. Liu Y. Wang J. Wu Z. Ahmad I. Li J. Antagonistic effects of baicalin on mycoplasma gallisepticum-induced inflammation and apoptosis by restoring energy metabolism in the chicken lungs Infect. Drug Resist 12 2019 3075 3089 31632098
Ishfaq M. Zhang W. Liu Y. Wang J. Wu Z. Shah S.W.A. Li R. Miao Y. Chen C. Li J. Baicalin attenuated Mycoplasma gallisepticum-induced immune impairment in chicken bursa of fabricius through modulation of autophagy and inhibited inflammation and apoptosis J. Sci. Food Agric. 101 2020 880 890. 32729138
Jai K. Manmohan K. Shagun S. Nidhi S. Rashmi S. Md. Arafat H. Shibnath M. Th1–Th2 and M1-M2 interplay sculpt Aeromonas hydrophila pathogenesis in zebrafish (Danio rerio) Fish Shellfish Immunol 127 2022 357 365 35772676
Kulappu Arachchige S.N. Young N.D. Kanci Condello A. Omotainse O.S. Noormohammadi A.H. Wawegama N.K. Browning G.F. Transcriptomic analysis of long-term protective immunity induced by vaccination with mycoplasma gallisepticum strain ts-304 Front Immunol 11 2020 628804
Lan W. Yan-Fang X. King Fan L.S. Siu-Po I. Wen Y. Yee C.W. Zhi-Xiu L. Yuen W.J.C. Baicalin ameliorates 2,4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions in mice through modulating skin barrier function, gut microbiota and JAK/STAT pathway Bioorganic Chem 119 2022 105538
Li C. Brazill J.M. Liu S. Bello C. Zhu Y. Morimoto M. Cascio L. Pauly R. Diaz-Perez Z. Malicdan M.C.V. Wang H. Boccuto L. Schwartz C.E. Gahl W.A. Boerkoel C.F. Zhai R.G. Spermine synthase deficiency causes lysosomal dysfunction and oxidative stress in models of Snyder-Robinson syndrome Nat Commun 8 2017 1257 29097652
Li J. Qiao Z. Hu W. Zhang W. Shah S.W.A. Ishfaq M. Baicalin mitigated Mycoplasma gallisepticum-induced structural damage and attenuated oxidative stress and apoptosis in chicken thymus through the Nrf2/HO-1 defence pathway Vet Res 50 2019 83 31639045
Li Z. Ma D. Wang Y. Wu S. Wang L. Jiang Y. Zhang Y. Li X. Astragali radix-coptis rhizoma herb pair attenuates atherosclerosis in apoe-/- mice by regulating the M1/M2 and Th1/Th2 immune balance and activating the STAT6 signaling pathway Evid-based Comp. Alter. Med. : eCAM 2022 2022 7421265
Liu L. Guo H. Song A. Huang J. Zhang Y. Jin S. Li S. Zhang L. Yang C. Yang P. Progranulin inhibits LPS-induced macrophage M1 polarization via NF-кB and MAPK pathways BMC Immunol 21 2020 32
Liu Y. Li X. Zhang Z. Zhang J. Xu J. Qiu Y. Ye C. Fu S. Wu Z. Hu C.A. Baicalin protects vascular tight junctions in piglets during glaesserella parasuis infection Front. Vet. Sci. 8 2021 671936
Majumder S. Zappulla F. Silbart L.K. Mycoplasma gallisepticum lipid associated membrane proteins up-regulate inflammatory genes in chicken tracheal epithelial cells via TLR-2 ligation through an NF-κB dependent pathway PLoS One 9 2014 e112796
Marouf S. Khalf M.A. Alorabi M. El-Shehawi A.M. El-Tahan A.M. El-Hack M.E.A. El-Saadony M.T. Salem H.M. Mycoplasma gallisepticum: a devastating organism for the poultry industry in Egypt Poult Sci 101 2022 101658
Mengxian Z. Ruyi Q. Xuewei Y. Yan Q. Yuan P. Bin L. Yanbin G. Hongsheng B. Dadong G. Prednisone acetate modulates Th1/Th2 and Th17/Treg cell homeostasis in experimental autoimmune uveitis via orchestrating the Notch signaling pathway Int. Immunopharmacol. 11.6 2023 109809
Miao Y. Niu D. Wang Z. Wang J. Wu Z. Bao J. Hu W. Guo Y. Li R. Ishfaq M. Li J. Mycoplasma gallisepticum induced inflammation-mediated Th1/Th2 immune imbalance via JAK/STAT signaling pathway in chicken trachea: Involvement of respiratory microbiota Vet Microbiol 265 2022 109330
Michiels T. Welby S. Vanrobaeys M. Quinet C. Rouffaer L. Lens L. Martel A. Butaye P. Prevalence of Mycoplasma gallisepticum and Mycoplasma synoviae in commercial poultry, racing pigeons and wild birds in Belgium Avian Pathol. : J W.V.P.A 45 2016 244 252
Mills C.D. Ley K. M1 and M2 macrophages: the chicken and the egg of immunity J Innate Immun 6 2014 716 726 25138714
Mommert S. Schaper J.T. Schaper-Gerhardt K. Gutzmer R. Werfel T. Histamine Increases Th2 Cytokine-Induced CCL18 Expression in Human M2 Macrophages Int J Mol Sci 22 2021 11648 34769080
Mozhdeh R. Bahar K. Tara A. Gholami P.H. Mohammad S. Interleukin 4 reduces brain hyperexcitability after traumatic injury by downregulating TNF-α, upregulating IL-10/TGF-β, and potential directing macrophage/microglia to the M2 anti-inflammatory phenotype Inflammation 46 2023 1810 1831 37259014
Nie Y. Wang Z. Chai G. Xiong Y. Li B. Zhang H. Xin R. Qian X. Tang Z. Wu J. Zhao P. Dehydrocostus lactone suppresses LPS-induced acute lung injury and macrophage activation through NF-kappaB signaling pathway mediated by p38 MAPK and Akt Molecules 24 2019 1510 30999647
Park H.J. Park H.S. Lee J.U. Bothwell A.L. Choi J.M. Sex-based selectivity of PPARgamma regulation in Th1, Th2, and Th17 differentiation Int. J. Mol. Sci. 17 2016 1347 27548145
Rüger N. Sid H. Meens J. Szostak M.P. Baumgärtner W. Bexter F. Rautenschlein S. New insights into the host-pathogen interaction of mycoplasma gallisepticum and avian metapneumovirus in tracheal organ cultures of chicken Microorganisms 9 2021 2407 34835532
Ruolei W. Chunyan W. Lianheng L. Fuwen Y. Feng H. Baicalin and Baicalein in modulating tumor microenvironment for cancer treatment: a comprehensive review with future perspectives Pharmacol. Res. 199 2024 107032
Shang Q. Yu X. Sun Q. Li H. Sun C. Liu L. Polysaccharides regulate Th1/Th2 balance: A new strategy for tumor immunotherapy Biomed. Pharmacother. 170 2024 115976
Snodgrass R.G. Benatzy Y. Schmid T. Namgaladze D. Mainka M. Schebb N.H. Lutjohann D. Brune B. Efferocytosis potentiates the expression of arachidonate 15-lipoxygenase (ALOX15) in alternatively activated human macrophages through LXR activation Cell Death Differ 28 2021 1301 1316 33177619
Stipkovits L. Glavits R. Palfi V. Beres A. Egyed L. Denes B. Somogyi M. Szathmary S. Pathologic lesions caused by coinfection of Mycoplasma gallisepticum and H3N8 low pathogenic avian influenza virus in chickens Vet. Pathol. 49 2012 273 283 21825309
Susithra Priyadarshni M. Kannan G. Harish M.C. Biswaranjan P. Infection, transmission, pathogenesis and vaccine development against mycoplasma gallisepticum Vaccines 11 2023 469 36851345
Tsai C.F. Chen G.W. Chen Y.C. Shen C.K. Lu D.Y. Yang L.Y. Chen J.H. Yeh W.L. Regulatory effects of quercetin on M1/M2 macrophage polarization and oxidative/antioxidative balance Nutrients 14 2021 67 35010945
Vogl G. Plaickner A. Szathmary S. Stipkovits L. Rosengarten R. Szostak M.P. Mycoplasma gallisepticum invades chicken erythrocytes during infection Infect Immun 76 2008 71 77 17954728
Wang K. Miao Y. Liu W. Muhammad I. Bao J. Jin X. Wu Z. Li R. Chen C. Li J. Lactobacillus salivarius ameliorates Mycoplasma gallisepticum-induced inflammation via the JAK/STAT signaling pathway involving respiratory microbiota and metabolites Poult Sci 103 2024 103942
Wang L. Xian Y.F. Loo S.K.F. Ip S.P. Yang W. Chan W.Y. Lin Z.X. Wu J.C.Y. Baicalin ameliorates 2,4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions in mice through modulating skin barrier function, gut microbiota and JAK/STAT pathway Bioorg Chem 119 2022 105538
Wojciechowski W. Harris D.P. Sprague F. Mousseau B. Makris M. Kusser K. Honjo T. Mohrs K. Mohrs M. Randall T. Lund F.E. Cytokine-producing effector B cells regulate type 2 immunity to H. polygyrus Immunity 30 2009 421 433 19249230
Wu J. Wang B. Li M. Shi Y.H. Wang C. Kang Y.G. Network pharmacology identification of mechanisms of cerebral ischemia injury amelioration by Baicalin and Geniposide Eur. J. Pharmacol. 859 2019 172484
Wu Z. Fan Q. Miao Y. Tian E. Ishfaq M. Li J. Baicalin inhibits inflammation caused by coinfection of Mycoplasma gallisepticum and Escherichia coli involving IL-17 signaling pathway Poult. Sci. 99 2020 5472 5480 33142464
Xu H. Nie X. Deng W. Zhou H. Huang D. Wang Z. Bone marrow mesenchymal stem cells-derived exosomes ameliorate LPS-induced acute lung injury by miR-223-regulated alveolar macrophage M2 polarization J. Biochem. Mol. Toxicol. 38 2024 e23568
Xuxin C. Fan W. Jingqun T. Jiguang M. Zhihai H. Paralemmin-3 augments lipopolysaccharide-induced acute lung injury with M1 macrophage polarization via the notch signaling pathway Resp. Physiol. Neurobiol. 320 2024 104203
Yaping W. Nahal M. Ying L. Matin Z. Sara H. Ebrahim K. Khalil A. Trends of fluoroquinolones resistance in Mycoplasma and Ureaplasma urogenital isolates: systematic review and meta-analysis J. Global Antimicrob. Resist. 36 2024 13 25
Yehia N. Salem H.M. Mahmmod Y. Said D. Samir M. Mawgod S.A. Sorour H.K. AbdelRahman M.A.A. Selim S. Saad A.M. El-Saadony M.T. El-Meihy R.M. Abd El-Hack M.E. El-Tarabily K.A. Zanaty A.M. Common viral and bacterial avian respiratory infections: an updated review Poult. Sci. 102 2023 102553
Yingjie W. Yun H. Lulu W. Meiling Z. Yingfei S. Huanling S. Qiaoling G. Xiuli P. Mycoplasma gallisepticum escapes the host immune response via gga-miR-365-3p/SOCS5/STATs axis Vet. Res. 53 2022 103 36471418
Zhang N. Zeng W. Du T. Wei H. Tian W. Meng Y. He G. Lei A. Zhu C. Lacticaseibacillus casei CNRZ1874 supplementation promotes M1 alveolar macrophage activation and attenuates Mycoplasma pneumoniae pneumonia J. Appli. Microbiol. 134 2023 lxad022
Zhang X. Zhao Y. Zhu X. Guo Y. Yang Y. Jiang Y. Liu B. Active vitamin D regulates macrophage M1/M2 phenotypes via the STAT-1-TREM-1 pathway in diabetic nephropathy J Cell Physiol 234 2019 6917 6926 30478987
Zhao X. Di Q. Liu H. Quan J. Ling J. Zhao Z. Xiao Y. Wu H. Wu Z. Song W. An H. Chen W. MEF2C promotes M1 macrophage polarization and Th1 responses Cell Mol Immunol 19 2022 540 553 35194174
Zhen H. Hu H. Rong G. Huang X. Tan C. Yu X. VitA or VitD ameliorates bronchopulmonary dysplasia by regulating the balance between M1 and M2 macrophages Biomed Pharmacother 141 2021 111836
