
==== Front
Neoplasia
Neoplasia
Neoplasia (New York, N.Y.)
1522-8002
1476-5586
Neoplasia Press

S1476-5586(24)00076-9
10.1016/j.neo.2024.101034
101034
Original Research
LncRNA HOTAIRM1 promotes radioresistance in nasopharyngeal carcinoma by modulating FTO acetylation-dependent alternative splicing of CD44
Mi Jinglin abc1
Wang Yiru abc1
He Siyi abc1
Qin Xinling abc
Li Zhixun abc
Zhang Tingting abc
Huang Weimei weimei135gx@163.com
abc⁎
Wang Rensheng 13807806008@163.com
abc⁎
a Department of Radiation Oncology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi 530021, China
b Guangxi Key Laboratory of Immunology and Metabolism for Liver Diseases, Nanning, Guangxi 530021, China
c Key Laboratory of Early Prevention and Treatment for Regional High-Frequency Tumors (Guangxi Medical University), Ministry of Education, Nanning, Guangxi 530021, China
⁎ Corresponding authors at: Department of Radiation Oncology, The First Affiliated Hospital of Guangxi Medical University, Nanning 530021, China. weimei135gx@163.com13807806008@163.com
1 These authors contributed equally to this work.

10 8 2024
10 2024
10 8 2024
56 1010345 2 2024
17 7 2024
28 7 2024
© 2024 The Authors. Published by Elsevier Inc. CCBYLICENSE.
2024

https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Background

Radiotherapy is the primary treatment for patients with nasopharyngeal carcinoma (NPC); however, almost 20% of patients experience treatment failure due to radioresistance. Therefore, understanding the mechanisms of radioresistance is imperative. HOTAIRM1 is deregulated in various human cancers, yet its role in NPC radioresistance are largely unclear.

Methods

This study investigated the association between HOTAIRM1 and radioresistance using CCK8, flow cytometry, and comet assays. Additionally, xenograft mice and patient-derived xenografts (PDX) models were employed to elucidate the biological functions of HOTAIRM1, and transcriptomic RNA sequencing was utilized to identify its target genes.

Results

Our study revealed an upregulation of HOTAIRM1 levels in radioresistant NPC cell lines and tissues. Furthermore, a positive correlation was noted between high HOTAIRM1 expression and increased NPC cell proliferation, reduced apoptosis, G2/M cell cycle arrest, and diminished cellular DNA damage following radiotherapy. HOTAIRM1 modulates the acetylation and stability of the FTO protein, and inhibiting FTO elevates the m6A methylation level of CD44 precursor transcripts in NPC cells. Additionally, silencing the m6A reading protein YTHDC1 was found to increase the expression of CD44V. HOTAIRM1 enhances NPC cell resistance to ferroptosis and irradiation through the HOTAIRM1-FTO-YTHDC1-CD44 axis. Mechanistically, HOTAIRM1 interacts with the FTO protein and induces m6A demethylation of the CD44 transcript. The absence of m6A modification in the CD44 transcript prevents its recognition by YTHDC1, resulting in the transition from CD44S to CD44V. An abundance of CD44V suppresses ferroptosis induced by irradiation and contributes to NPC radioresistance.

Conclusions

In conclusion, the results in this study support the idea that HOTAIRM1 stimulates CD44 alternative splicing via FTO-mediated demethylation, thereby attenuating ferroptosis induced by irradiation and promoting NPC radioresistance.

Keywords

NPC
HOTAIRM1
Alternative splicing
Ferroptosis and radioresistance
Abbreviations

NPC nasopharyngeal carcinoma

lncRNAs long noncoding RNAs

HOTAIRM1 HOXA transcript antisense RNA myeloid-specific 1

GBM glioblastoma

CRC colorectal cancer

OC ovarian cancer

ceRNA competing endogenous RNA

GC gastric cancer

DEGs differentially expressed genes

DSBs DNA strand breaks

SE skipped exon

MXE mutually exclusive exon

A5SS alternative 5′ splice site

A3SS alternative 3′ splice site

FTO FTO Alpha-Ketoglutarate dependent Dioxygenase

YTHDC1 YTH N6-methyladenosine RNA binding protein C1

m6A N6-methyladenosine

METTL3 methyltransferase-like 3

ROS reactive oxygen species

SLC7A11 solute carrier family 7 member 11

PE plating efficiency

SF survival fraction

RIP RNA immunoprecipitation
==== Body
pmcIntroduction

Nasopharyngeal carcinoma (NPC) exhibits a uneven geographical prevalence, reaching endemic status in Southern China, East, Southeast Asia, and North Africa. Here, the age-standardized incidence of NPC ranges from 4 to 25 cases per 100,000 individuals [1]. Given the anatomical complexities of its location and its heightened susceptibility to ionizing radiation, radiotherapy is the primary therapeutic approach for patients diagnosed with nonmetastatic NPC (any T, any N, M0 disease). However, the occurrence of recurrence and metastasis presents significant challenges in the clinical management of NPC, primarily due to the potential development of radioresistance [2]. This underscores the need to explore the underlying pathological mechanisms behind radioresistance to effectively address this issue.

Long noncoding RNAs (lncRNAs) are a group of highly conserved transcripts exceeding 200 nucleotides in length, with no apparent protein-coding functions [3]. Extensive research has linked lncRNAs to the development of various cancers, including NPC resistance to radiotherapy [4]. Yet, the specific role of lncRNAs in NPC radioresistance remains unclear. One such lncRNA, HOXA transcript antisense RNA myeloid-specific 1 (HOTAIRM1), resides in an intergenic region of the HOXA gene cluster, situated between HOXA1 and HOXA2. Aberrant expression of HOTAIRM1 has been observed in various malignancies, exerting either a promotive or suppressive effect on tumor progression. For instance, HOTAIRM1 is known to facilitate the proliferation and metastasis of thyroid cancer cells [5]. In contrast, substantial upregulation of HOTAIRM1 is seen in glioblastoma (GBM) tissues and cells, whereas its depletion hinders the migratory and invasive capabilities of GBM cells [6]. Conversely, a marked reduction in HOTAIRM1 is noted in colorectal cancer (CRC) tissues compared to normal tissues; furthermore, knocking down HOTAIRM1 appears to enhance the proliferation of CRC cells [7]. Similarly, Chao et al. reported reduced HOTAIRM1 expression in ovarian cancer (OC) tumor tissues and cells, where overexpressing HOTAIRM1 attenuates OC cell proliferation and invasion while promoting apoptosis [8]. However, despite these findings, a comprehensive understanding of HOTAIRM1’s roles and mechanisms in cancer, including its impact on NPC radioresistance, remains limited.

The prevalence of m6A as an epigenetic modification in various RNA types, including lncRNAs, microRNAs, and especially mRNAs, has been extensively documented [9]. Within eukaryotic cells, m6A methylation is crucial in multiple mRNA metabolism processes, such as pre-mRNA splicing, translation regulation, nuclear export, and RNA stability [10]. Alterations in m6A levels result in aberrant gene expression, contributing to tumor initiation and progression. Studies have shown that lncRNAs with m6A modifications significantly affect target genes through interactions with RNA-binding proteins, competing endogenous RNA (ceRNA) interactions, and RNA–RNA interactions. For example, LINC00460 functions as an oncogene in CRC, interacting with IGF2BP2 and DHX9 proteins and binding to the m6A-modified HMGA1 transcript to enhance HMGA1 mRNA stability [11]. Additionally, LNC942 promotes chemoresistance in gastric cancer (GC) cells by stabilizing c-Myc mRNA through MSI2-mediated m6A modifications [12]. These findings indicate that lncRNAs modulate cellular outcomes by regulating mRNA expression via m6A RNA modification. In NPC, FTO, a key component of the m6A demethyltransferase complex, is significant in regulating tumor development [13]. However, the influence of HOTAIRM1 on m6A demethyltransferase complexes, particularly FTO, in NPC radioresistance is yet to be clarified. Thus, it is critical to investigate the patterns of posttranscriptional regulation by HOTAIRM1 and m6A methylation, contributing to NPC radioresistance. CD44 is a cancer cell stem cell marker, with its splicing variant CD44V being widely expressed in tumors and linked to poor prognosis in NPC [14]. CD44 variant isoforms, especially the isoform containing exon v8-10 (CD44V8-10), was found to interact and stabilize xCT at the plasma membrane, leading to the promotion of GSH synthesis [15]. However, the splicing regulatory mechanism of CD44V production remains unclear.

This study aimed to evaluate the potential of HOTAIRM1 as a biomarker for radioresistance in NPC through both in vitro and in vivo experiments. Additionally, we investigated the correlation between HOTAIRM1 and m6A demethylation in NPC radioresistance. The outcomes of our research offer new insights into developing irradiation treatment strategies for NPC.

Methods

Cell lines and irradiation

C666-1 and HONE1 cell lines were obtained from the Nasopharyngeal Cancer Research Laboratory at Guangxi Medical University. The cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 1% penicillin, and streptomycin. The culture conditions involved maintaining the cells at 37°C in a humidified atmosphere with 5% CO2. To establish radioresistant NPC cell lines, C666-1 and HONE1 cells were seeded and subjected to irradiation at fractionated doses of 2, 2, 4, 4, 4, 4, 6, 6, 6, 6, 8, and 8 Gy, totaling a cumulative radiation dose of 60 Gy (VitalBeam™, USA) [16]. Subsequently, the surviving cells exhibited increased radioresistance compared to the original cell lines.

Patient samples

In this study, 27 NPC tissue samples (21 from radiosensitive patients and 6 from radioresistant patients) were obtained from individuals diagnosed with NPC at The First Affiliated Hospital of Guangxi Medical University. Tissues were collected prior to the commencement of radiotherapy. Ethical approval was granted by the Ethics Review Committee of The First Affiliated Hospital of Guangxi Medical University (2023-E415-01) and the study adhered to the Declaration of Helsinki. Radiosensitivity inclusion criteria included the absence of residual tumors or lymph nodes after 3 months of radiotherapy and no recurrence within 1–2 years post-treatment. Radioresistance criteria included the presence of residual tumors or lymph nodes after 3 months of radiotherapy and recurrence within 1–2 years post-treatment [17].

Transfection assay

Overexpression and silencing plasmid lentiviral particles of HOTAIRM1 along with empty vector lentiviral particles, were sourced from GeneChem (Shanghai, China). Lentiviruses were transfected into NPC cells at a multiplicity of infection (MOI) of 10, and stably transfected cells were selected using 2.5 μg/ml puromycin (Sigma, St Louis, USA) for a minimum of 2 weeks.

The shRNA sequences were as follows, shHOTAIRM1-NC: TTCTCCGAACGTGTCACGT, shHOTAIRM1-164: AGAAACTCCGTGTTACTCATT, shHOTAIRM1-165: CACCGTTCAATGAAAGATGAA, shHOTAIRM1-166: CTGCAAAGGCCGATTTGGAGT.

Small interfering RNAs (si-METTL3, si-METTL14, and si-YTHDC1), and corresponding controls were procured from GenePharma (Shanghai, China). NPC cells, at approximately 70% confluence, were transfected using Lipofectamine 3000 (Thermo, USA) and cultured for 48 h. Interference efficacy was assessed via RT‒qPCR. The siRNA sequences were as follows: si-NC: (sense:UUCUCCGAACGUGUCACGUTT; antisense:ACGUGACACGUUCGGAGAATT), si-METTL3: (sense:GCUCAACAUACCCGUACUATT; antisense:UAGUACGGGUAUGUUGAGCTT), si-METTL14: (sense:GGCUAAAGGAUGAGUUAAUTT; antisense:AUUAACUCAUCCUUUAGCCTT), si-YTHDC1: (sense:GGAGAAAGAUGGAGAACUUTT ; antisense:AAGUUCUCCAUCUUUCUCCTT) and si-CD44V: (sense:GUGGAACCCAAGCCAUUCATT; antisense:UGAAUGGCUUGGGUUCCACTT).

RT‒qPCR assay

Total RNA was extracted using TRIzol reagent (15596026CN, Life Technologies; USA). Reverse transcription was conducted using the PrimeScript™ RT reagent Kit with gDNA Eraser (RR047Q, Takara; Japan). Target RNA expression levels were measured using MonAmp™ SYBR® Green qPCR Mix (MQ10301, Monad, China) on a CFX96TM Real-Time PCR System (Bio-Rad). β-Actin served as the endogenous control, and fold changes were calculated using the 2−∆∆CT method. All assays were performed in triplicate. Primer sequences were as follows, ACTIN: CCTGGCACCCAGCACAAT (forward), GGGCCGGACTCGTCATAC (reverse); HOTAIRM1: GATGAACTGGCGAGAGGACGAATC (forward), GTGTGGGGACTATGGCTGGTTTC (reverse); CD44T (total): GATGGAGAAAGCTCTGAGCATC (forward), TTGCTGCACAGATGGAGTTG (reverse); CD44S (standard): TACTGATGATGACGTGAGCA (forward), GAATGTGTCTTGGTCTCTGGT (reverse); CD44V (variant): TCCCAGACGAAGACAGTCCCTGGAT (forward), CACTGGGGTGGAATGTGTCTTGGTC (reverse). METTL3: TGTCCATCTGTCTTGCCATC (forward), GACCTCGCTTTACCTCAATCA (reverse); METTL14: CCTGGGAATGAAGTCAGGATAG (forward), CCCAGGGTATGGAACGTAATAG (reverse). YTHDC1: AGTGACTCTGGTTCTGAATCTG (forward), CTGGTTTGATCTTTTCGGACAG (reverse).

Western blot

Cells were lysed in RIPA buffer (R0010, Solarbio; China), the supernatant was collected and mixed with protein loading buffer. Aliquots of protein were separated by SDS‒PAGE and transferred to PVDF membranes (IPVH00010, Millipore; USA). Membranes were blocked in QuickBlock™ Buffer (P0252, Beyotime Biotechnology; China) and incubated overnight at 4°C with primary antibodies. After extensive washing with TBS-T (3 × 10 min), membranes were incubated with horseradish peroxidase-conjugated secondary antibodies. Bands were detected using a Western blot imaging system (G:Box Chemi XX9, Syngene). Multiple exposures (2 seconds to 2 min) were performed for optimal imaging. Antibodies used included FTO (27226-1-AP; Proteintech), SUMO2/3 (11251-1-AP; Proteintech), acetyl-lysine (DF7729; Affinity), Actin (81115-1-RR; Proteintech), CD44 (15675-1-AP; Proteintech and BBA10; R&D Systems), and YTHDC1 (14392-1-AP; Proteintech).

In situ hybridization (ISH) assay

In situ hybridization was performed according to the kit instructions (Bes1007, Bersin Biotechnology; China). After dewaxing, rehydration, endogenous enzyme inactivation, and digestion, slides were prehybridized and then incubated with a HOTAIRM1 probe solution at 42°C overnight. Biotinylated digoxin was applied at 37 °C for 2 h. Staining was done using AEC solution and hematoxylin, and images were captured with a digital slide scanner (HAMAMATSU NANO ZOOMER; Japan).

Colony formation assay

Cells were cultured in a 6-well plate with varying cell numbers (250, 250, 500, 1,000, and 2,000 cells/well) and exposed to specific radiation doses (0, 2, 4, 6, and 8 Gy for each cell number). Following a 14-day incubation period, the cells were fixed using 4% paraformaldehyde and stained with 0.1% crystal violet for 15 min. Colonies consisting of more than 50 cells were enumerated. Plating efficiency (PE) was determined by dividing the number of colonies by the initial number of cells seeded. The calculation of the survival fraction (SF) involved dividing the plating efficiency (PE) of irradiated cells by the PE of non-irradiated cells. The SF curve was subsequently analyzed using the single-hit multitarget model, employing the equation y=1-(1-exp(-k*x))^N. This resulting value was then utilized to determine the radiobiological parameters SF2 (SF at 2 Gy), D0 (equal to 1/k), and Dq (equal to lnN multiplied by D0) [18].

Comet assay

Cells exposed to IR (4 Gy) were harvested at specified time points post-IR. Neutral comet assays were conducted using the SCGE DNA Damage Detection Kit (KGA240, KeyGEN BioTECH; China) and stained with propidium iodide (PI). Analysis was done using a fluorescence microscope (Olympus; Japen).

Hematoxylin-Eosin (H&E) staining

Paraffin-embedded mouse tumer tissue sections were heated at 65°C for 2 h, dewaxed, and hydrated. Nuclei were stained with hematoxylin (C0105S, Beyotime Biotechnology; China), followed by eosin for cytoplasmic staining (C0105S, Beyotime Biotechnology; China). After drying, sections were mounted with neutral balsam (G8590, Solarbio, China).

Immunohistochemistry

Immunohistochemistry was conducted on formalin-fixed, paraffin-embedded sections. Tissues were deparaffinized, rehydrated, and subjected to EDTA-mediated antigen retrieval. Incubation with primary antibodies occurred overnight at 4°C. Imaging was performed with a digital slide scanner (HAMAMATSU NANO ZOOMER s60, C13210-01). Antibodies included FTO (ab124892; Abcam), YTHDC1 (ab259990; Abcam), and CD44V (AB2082; Merck), Phospho-Histone H2A.X (AF3187; Affinity Biosciences).

CCK8

The Cell Counting Kit-8 assay (BS350B, Biosharp; China) was performed according to the manufacturer's instructions. Cells in logarithmic growth phase were seeded in 96-well plates at a density of 1000 cells per well (100 μL per well) and cultured at 37°C for 24 h. After cell adhesion, they were exposed to 4 Gy irradiation and subsequently incubated at 37°C for 0, 24, 48, 72, and 96 h. Ten microliters of CCK-8 solution was added to each well, followed by a 2-hour incubation. Optical density (OD) values were measured at 450 nm using an enzyme labeler.

DNA agarose gel electrophoresis

A 1% agarose gel was prepared using 1 gram of agarose and 100 ml of 1 × TAE buffer (T1060, Solarbio; China), with NA-Green (D0133, Beyotime Biotechnology; China) added at a 2000:1 ratio. The gel was poured into a horizontal electrophoresis apparatus (NEP-midi, Epizyme; China) and solidified at room temperature. DNA loading buffer (D0071, Beyotime Biotechnology; China) was mixed with the RT‒PCR product at a 1:5 ratio. InstantView™ Green Fluorescent DNA Ladder (M1800, Solarbio; China) and DNA samples were loaded, and electrophoresis was conducted at 120 V for 35 min. Images were captured using a gel imaging analysis system (Tanon 1600B; China).

Tumor xenografts in nude mice

Female BALB/c nude mice (4 weeks old; n = 72) were acquired from Sipeifu (Beijing, China) and housed in a controlled temperature and humidity SPF laminar flow facility at Guangxi Medical University. The mice were divided into six groups for injections: Ctrl-shHOTAIRM1, shHOTAIRM1, Ctrl-oeHOTAIRM1, oe-HOTAIRM1, oe-HOTAIRM1+FB23-2 and oe-HOTAIRM1+Erastin. Cells in logarithmic growth phase were digested, resuspended as single cells, and washed twice with PBS. The cell suspension was adjusted to 1 × 108 cells per ml, and 150 µl was subcutaneously injected into the lower armpit of each mouse's right forelimb, totaling 1.5 × 107 cells. Once xenograft tumors reached 600-800 mm3, mice underwent X-ray radiation therapy at 4 Gy weekly, totaling 20 Gy. Tumor volume and body weight were measured every five days. Post-radiotherapy, mice were euthanized using isoflurane and cervical dislocation. Tumors were dissected, weighed, and photographed for further analysis. The study was approved by the animal ethics committee of First Affiliated Hospital of Guangxi Medical University (2023-E415-01).

Construction of the patient-derived xenograft model (PDX) model

The PDX model construction followed previously reported methods [13,17]. Surgically obtained NPC tumor samples were cut into 3–4 mm pieces and transplanted into severely immunodeficient B-NDG® mice (Biocytogen, Beijing, China) within 4 h. When tumors reached 500 mm3, the mice were euthanized, and the tumors removed. The xenograft fragments were either immediately transplanted into new NDG® mice or prepared for pathological analysis.

Radiosensitivity examination of the PDX model

Once PDX model subcutaneous tumors reached 400 mm3, mice were divided into two groups for treatment: antisense oligonucleotide (ASO)-Ctrl (10 nmol) and ASO-HOTAIRM1 (10 nmol), administered via the tail vein every five days. The endpoint of all experiments coincided with the completion of radiotherapy. Post-radiotherapy, mice were euthanized, and tumors were excised.

Flow cytometry analysis of apoptosis and the cell cycle

An Annexin V-APC/7-AAD Apoptosis Kit (AP105-01, MultiSciences Biotech; China) was used to assess apoptosis rates. Cells, harvested 48 h post 4 Gy irradiation and washed with PBS, were resuspended in 500 µl binding buffer, then stained with 5 µl Annexin V-APC and 10 µl 7-AAD. Apoptosis rates were determined using flow cytometry (BD FACS Aria; USA). A Cell Cycle Staining Kit (CCS012, MultiSciences Biotech; China) was employed for cell cycle distribution analysis. Fixed cells in absolute ethanol at -20°C were washed with PBS and stained with DNA staining solution at room temperature in the dark for 30 min. The cell cycle distribution and apoptosis rate were analyzed on a flow cytometer (BD FACS Aria; USA).

RNA sequencing

Total RNA from C666-1R-shNC and C666-1R-shHOTAIRM1 cells was isolated and purified. RNA libraries were then sequenced on the Illumina NovaSeq 6000 platform at Huayin Health Medical Group Co., Ltd. (Guangzhou, China). Differentially expressed genes (DEGs) were identified using a statistical significance threshold of p < 0.01 and | logFC| > 1. The sequencing data are available on the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE229333) under accession number GSE229333. Volcano plots were used to visually represent the DEGs.

MDA, GSH, iron, and lipid ROS levels

Relative lipid peroxidation (MDA), GSH, iron, and lipid ROS levels in cell lysates were measured using commercially available assay kits: the lipid peroxidation MDA assay kit (S0131M, Beyotime; China), GSH assay kit (S0053, Beyotime; China), iron assay kit (MAK025, Sigma; USA), and BODIPY™ 581/591 C11 (D3861, Thermo; USA). Assay procedures were conducted according to the manufacturers’ instructions.

Silver staining

Post-protein electrophoresis, proteins were stained using the PAGE Gel Silver Staining Kit (G7210, Solarbio; China) following the kit's instructions. PAGE protein gels were photographed after fixation, sensitization, silver staining, color development, and termination.

RNA immunoprecipitation/RIP

The RIP assay was carried out using an EZ-Magna RIP kit (17-701, Millipore; USA) in accordance with the manufacturers' instructions as per the manufacturer's instructions. NPC cells were lysed in RIP lysis buffer, following which the cell lysates were incubated in magnetic beads conjugated with anti-m6A (ab208577, Abcam), FTO (27226-1-AP, Proteintech) or YTHDC1 (14392-1-AP, Proteintech) antibodies. Protein and RNA from the beads were eluted with proteinase K. Successful immunoprecipitation was verified by RT‒qPCR.

RNA pull-down

The RNA pull-down assay was performed using the PureBinding® RNA‒Protein Pull-Down Kit (P0201, Geneseed Biotech; China). Cells were lysed and streptavidin magnetic beads were assembled with target probe. The beads were then combined with cell lysate and rotated at 4°C, 10 rpm/min for 1 h. Afterward, the protein was collected for subsequent mass spectrometry and Western blotting.

Coimmunoprecipitation (Co-IP)

The Co-IP assay was conducted using the Classic Magnetic Protein A/G IP/Co-IP Kit (YJ201, Epizyme; China). in brief, cells were lysed and supernatant was collected, then, supernatant were incubated with primary antibody overnight, Protein A/G magnetic beads were added to the mixture and incubated at 4°C for 6 h on a rotary mixer. The protein-antibody-magnetic bead complex was mixed with 1 × SDS-PAGE loading buffer and denatured in a boiling water bath for 10 min. The protein were collected and stored at -20°C for subsequent western blotting.

Fluorescence in situ hybridization (FISH)

CY3-labeled HOTAIRM1-specific fluorescein probes were used for FISH, conducted per the manufacturer's instructions (GenePharma; China). Cells were fixed in 4% paraformaldehyde, permeabilized, and mixed with specific probes. The mixture was denatured at 73°C for 5 min, then hybridized overnight at 37°C. Nuclei were stained with DAPI, and the cells imaged using a fluorescence microscope (Olympus; Japan).

Cytosolic and nuclear fraction assays

Cytosolic and nuclear fraction assays were performed using the PARIS™ kit (AM1921, Thermo; USA). Cells were treated with fractionation buffer, followed by centrifugation at 4°C. The cytoplasmic fraction was carefully separated from the nuclear pellet, and RNA from both fractions was subsequently extracted. RT‒qPCR was employed to assess the subcellular localization of HOTAIRM1, using GAPDH as a cytoplasmic RNA expression reference and U6 as a nuclear RNA expression reference.

DNA double-strand break (DSB) analysis

DSB induction and γ-H2AX immunostaining were performed using an OxiSelect DNA DSB staining kit (STA-321, Cell Biolabs; USA), following the manufacturer's instructions. Briefly, cells were cultured on glass coverslips in a 96-well plate, exposed to 4 Gy of irradiation, and fixed with 3.7% formaldehyde/PBS. Subsequently, the cells were permeabilized with ice-cold 90% methanol. After blocking with 1% BSA/PBS, the cells were incubated with anti-phospho-histone H2A.X (1:100) for 30 min at room temperature. The cells were then stained with fluorescein isothiocyanate-conjugated secondary antibodies (1:100) and DAPI (Sigma, D9542; Germany). The cells were visualized using a confocal microscope (Leica LSM microscope TCS SP8).

Statistical analysis

Data were analyzed using SPSS (version 20.0) and GraphPad Prism (version 8.0) and are presented as mean ± standard deviation. Group differences were evaluated using unpaired two-tailed Student's t-tests, one-way or two-way ANOVA, as appropriate. Statistical significance was set at P < 0.05.

Results

HOTAIRM1 is upregulated in radioresistant NPC

Analysis of the TCGA database revealed that HOTAIRM1 is significantly overexpressed in HNSCC compared to normal tissues and is associated with poor prognosis (Supplementary Fig. 1A and 1B). HOTAIRM1 expression was higher in radioresistant than in radiosensitive NPC tissues, as determined by RT‒qPCR and ISH assays (Fig. 1A and B). We established radioresistant NPC cell lines, C666-1R and HONE1R, whose establishment was confirmed through clonogenic assays and a single-hit multitarget model (Fig. 1C and Supplementary Table 1). HOTAIRM1 showed elevated expression in C666-1R and HONE1R cells (Fig. 1D).Fig. 1 Elevated expression of HOTAIRM1 in radioresistant NPC. (A) RT‒qPCR analysis of HOTAIRM1 expression in radioresistant and radiosensitive NPC tissues. (B) Detection of HOTAIRM1 expression in radioresistant and radiosensitive NPC tissues using ISH. (C) Development of radioresistant NPC cell lines (C666-1R and HONE1R) employing a single-hit multitarget model. (D) Comparative analysis of HOTAIRM1 expression in radioresistant and radiosensitive NPC cell lines (C666-1R and HONE1R). * P < 0.05, ** P < 0.01. NPC: nasopharyngeal carcinoma. ISH: in situ hybridization.

Fig 1

HOTAIRM1′s oncogenic roles in NPC radioresistance

To explore HOTAIRM1′s contribution to NPC radioresistance, we initially performed a stable downregulation of HOTAIRM1 in C666-1R and HONE1R cells (Fig. 2A and B). Given the more effective silencing of shHOTAIRM1-164, it was chosen for subsequent experiments. CCK-8 assay indicated that HOTAIRM1 knockdown significantly impeded the proliferation of C666-1R and HONE1R cells post 4 Gy irradiation (Fig. 2C and D). Flow cytometry demonstrated a notable increase in apoptosis rates and the proportion of cells in the G2/M phase in the shHOTAIRM1 group following irradiation (Fig. 2E, F, and Supplementary Fig. 2). Comet assays revealed a larger tail moment in the shHOTAIRM1 group, signifying more severe radiation-induced DNA damage in NPC cells (Fig. 2G and H). In vivo, subcutaneous xenograft NPC models using HOTAIRM1 knockdown cells showed significantly greater tumor regression after radiation therapy compared to the control group (Fig. 2I-2L). Increased DNA damage and reduced cell proliferation in HOTAIRM1 knockdown mouse tumor tissues were confirmed by IHC staining for Phospho-Histone H2A.X and Ki67 (Fig. 2M).Fig. 2 Impact of HOTAIRM1 knockdown on NPC radioresistance. (A, B) Verification of HOTAIRM1 silencing efficiency using RT‒qPCR. (C, D) Assessment of proliferation in C666-1R and HONE1R cells with HOTAIRM1 knockdown post 4 Gy irradiation using a CCK8 assay. (E, F) Analysis of apoptosis in C666-1R and HONE1R cells post 4 Gy irradiation with HOTAIRM1 knockdown using flow cytometry. (G, H) Examination of DNA damage in C666-1R and HONE1R cells post 4 Gy irradiation with HOTAIRM1 knockdown using comet assays. (I, J) Macroscopic images and measurements of xenograft tumor volumes in nude mice in shNC and shHOTAIRM1 groups following 20 Gy irradiation. (K) Evaluation of average xenograft tumor weights in each group. (L) RT‒qPCR analysis of HOTAIRM1 expression levels in xenograft tumors. (M) Tumor tissue analysis via HE staining and immunohistochemistry. * P < 0.05, ** P < 0.01, *** P < 0.001. NPC: nasopharyngeal carcinoma.

Fig 2

Furthermore, we stably overexpressed HOTAIRM1 in radiosensitive cells, including C666-1 and HONE1 (Fig. 3A and B). Gain-of-function studies revealed that HOTAIRM1 upregulation decreased the sensitivity of NPC cells and tumors to radiation, evidenced by enhanced cell proliferation, reduced apoptosis, decreased DNA damage and G2/M cell cycle arrest, and slower tumor regression under radiation exposure compared to the control group (Fig. 3C-3M and Supplementary Fig. 3).Fig. 3 HOTAIRM1 overexpression enhances NPC cell radioresistance. (A, B) Overexpression efficiency was confirmed using RT‒qPCR. (C, D) Proliferation of C666-1 and HONE1 cells, stably transfected with HOTAIRM1 and exposed to 4 Gy irradiation, was assessed using a CCK8 assay. (E, F) Apoptosis in C666-1 and HONE1 cells, stably transfected with HOTAIRM1 and exposed to 4 Gy irradiation, was evaluated via flow cytometry. (G) DNA damage in these cells post-irradiation was investigated using comet assays. (I, J) Macroscopic images and volumes of xenograft tumors in nude mice from the oeNC and oeHOTAIRM1 groups, exposed to 20 Gy radiotherapy, are presented. (K) Changes in the average weight of xenograft tumors in each group are shown. (L) RT‒qPCR assay was used to measure HOTAIRM1 expression in xenograft tumors. (M) Tumor tissue was analyzed by HE staining and immunohistochemical staining. * P < 0.05, ** P < 0.01, *** P < 0.001. NPC: nasopharyngeal carcinoma.

Fig 3

Next, we employed the PDX model to assess HOTAIRM1′s impact on NPC radiotherapy response. The NPC PDX model construction is depicted in Fig. 4A and B. Tumor-bearing mice received injections of ASO targeting HOTAIRM1 or control reagents. Post 20 Gy radiotherapy, tumors treated with HOTAIRM1-ASO exhibited significantly lower volumes and weights than those in the control group (Fig. 4C-E). These findings collectively indicate HOTAIRM1′s oncogenic roles in NPC radioresistance.Fig. 4 HOTAIRM1 inhibition augments radiosensitivity in NPC PDX model. (A) Description of PDX model construction. (B) HE staining of PDX founder (P0) tumors and original patient-derived specimens. (C) Representative images of subcutaneous tumors from mice. (D) Growth curves of tumors from mice treated with ASO-Ctrl or ASO-HOTAIRM1 under 20 Gy radiotherapy. (E) Comparison of tumor weights between the two groups is provided. ** P < 0.01. NPC: nasopharyngeal carcinoma. PDX, patient-derived xenografts.

Fig 4

HOTAIRM1 enhances FTO protein stability by promoting acetylation

To elucidate the molecular mechanism of HOTAIRM1 in modulating radioresistance, RNA pull-down and mass spectrometry were employed to identify proteins interacting with HOTAIRM1. Among the proteins that bound specifically to HOTAIRM1, FTO was notable for its high affinity (Supplementary Fig. 4 and Supplementary Table 2). Previous studies indicated FTO's role in enhancing radiation resistance in NPC by demethylating OTUB1 transcripts [13]. Western blotting following RNA pull-down experiments confirmed that FTO protein was associated with biotin-labeled HOTAIRM1 (Fig. 5A). Additionally, silencing HOTAIRM1 in NPC cells reduced FTO protein stability (Fig. 5B), suggesting that HOTAIRM1 might regulate FTO protein stability through direct interaction in NPC.Fig. 5 HOTAIRM1 affects the acetylation and stability of the FTO protein. (A) RNA pull-down confirmed the physical interaction between HOTAIRM1 and FTO. (B) FTO protein half-life was examined by western blotting. (C, D) RIP assay and DNA gel electrophoresis demonstrated HOTAIRM1′s affinity for FTO. (E) FISH assay showed colocalization of HOTAIRM1 and FTO. (F) Interaction between truncated HOTAIRM1 and FTO was evaluated using Western blotting. (G) Western blot analysis of shHOTAIRM1 and shNC NPC cells co-transfected with wild type (WT) or mutant FTO. (H) Western blotting detected acetylation and SUMOylation of FTO protein in shHOTAIRM1 and shNC NPC cells. TAK-981, sumoylation inhibitor. A-485, acetylation inhibitor. FISH, fluorescence in situ hybridization.

Fig 5

The association between HOTAIRM1 and FTO was further confirmed through RIP and FISH assays. The RIP assay and DNA gel electrophoresis revealed preferential enrichment of HOTAIRM1 mRNA with FTO antibody, compared to control IgG, in C666-1R and HONE1R cells (Fig. 5C and D). FISH assays demonstrated predominant co-localization of HOTAIRM1 and FTO in the nucleus (Fig. 5E), and nuclear/cytosolic fraction assays confirmed that HOTAIRM1 was primarily nuclear in C666-1R and HONE1R cells (Supplementary Fig. 5).

To identify the specific region of HOTAIRM1 interacting with FTO, three deletion fragments of HOTAIRM1 (HMS-del1, -del2, -del3) were designed (Supplementary Fig. 6). Interaction with FTO was retained by the HOTAIRM1-del1 domain, but not by HOTAIRM1-del2 and -del3 (Fig. 5F), further confirming the physical interaction between HOTAIRM1 and FTO.

Research by Liu et al. identified SUMOylation at FTO's K216 site as crucial for its degradation. Protein acetylation is known to competitively inhibit ubiquitination at the same site [19]. PhosphoSitePlus website predictions indicated acetylation and ubiquitination modifications at FTO's K216 site (Supplementary Fig. 7). In HOTAIRM1-overexpressing cells, the K216R FTO mutant exhibited significantly lower expression than wild-type FTO. The use of TAK-981 suppressed FTO SUMOylation, while A-485 inhibited its acetylation. Blocking FTO SUMOylation with TAK-981 further promoted FTO protein expression, while blocking FTO acetylation with A-485 negated the HOTAIRM1-induced increase in FTO expression (Fig. 5G). Additionally, FTO acetylation levels decreased and SUMOylation levels increased in shHOTAIRM1 cells compared to control cells (Fig. 5H). In summary, these findings suggest HOTAIRM1 may promote radioresistance in NPC by interacting with FTO and enhancing its acetylation.

HOTAIRM1 and FTO in regulating CD44 m6A modification and CD44V transcript generation

Our previous transcriptome sequencing indicated that HOTAIRM1 downregulation in C666-1R cells impacts alternative splicing events, including skipped exon (SE), mutually exclusive exon (MXE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), and retained intron (RI), notably affecting SE events of CD44 precursor transcripts (GSE229333) (Fig. 6A). m6A-seq_ip data from the GEO database (GSE103496) showed that FB23-2 (FTO inhibitors) group had stronger m6A peak signals than DMSO group at the chromosome 11, 35139210 - 35176774 and 35229260 - 35229441 of CD44, respectively (Fig. 6B, Supplementary Fig. 8) [20]. Additionally, TCGA database analysis revealed a correlation between high percent-spliced-in (PSI) rates of CD44 precursor transcripts and poorer prognosis in HNSCC patients (Fig. 6C). Thus, we propose that the HOTAIRM1/FTO complex may influence CD44 precursor transcript splicing by regulating CD44 m6A demethylation, enhancing oncogenic CD44V expression.Fig. 6 HOTAIRM1 and FTO modulate the alternative splicing of the CD44 transcript. (A) Transcriptome sequencing revealed that HOTAIRM1 silencing impacts alternative splicing events in C666-1R cells. (B) m6A peak density and frequency on CD44 transcripts base on GSE103496 datasets. (C) TCGA database analysis indicated that higher PSI rates of CD44 precursor transcripts correlate with worse HNSCC prognosis. (D) MeRIP-qPCR assay evaluated the m6A modification level in CD44T (total) mRNA. (E) RIP assay evaluated the CD44T mRNA enrichment of FTO protien. (F-H) RT‒qPCR and Western blotting assessed HOTAIRM1 and FTO's impact on CD44V (variant), CD44S (standard), and CD44T mRNA and protein expression. PSI: percent spliced-in. * P < 0.05, ** P < 0.01, *** P < 0.001.

Fig 6

To assess whether HOTAIRM1 influences m6A demethylation of the CD44 transcript via FTO, we treated NPC cells with FB23-2. FB23-2 treatment reversed the HOTAIRM1-induced abatement of m6A enrichment on the CD44 precursor transcript (CD44T) (Fig. 6D), Knockdown of HOTAIRM1 resulted in lower CD44 transcript enrichment in FTO protein (Fig. 6E), verifying HOTAIRM1 and FTO's regulatory roles in CD44 precursor transcript m6A modification in NPC cells. RT‒qPCR and Western blotting showed that HOTAIRM1 overexpression increased CD44V (variant) mRNA and protein levels while decreased CD44S (standard) mRNA and protein levels. Treatment with FB23-2 in oe-HOTAIRM1 cells reduced CD44V levels and increased CD44S levels, but had no effects on CD44T expression (Fig. 6F and Supplementary Fig. 9A).

Conversely, HOTAIRM1 inhibition decreased CD44V isoform levels and increased CD44S levels. After HOTAIRM1 cells transfecting with METTL3 and METTL14 (m6A methyltransferase) siRNA (Supplementary Fig. 10), the results exhibited the opposite effect (Fig. 6G and Supplementary Fig. 9B). Cells treated with FB23-2 showed reduced CD44V and increased CD44S isoform expression, while cells transfected with METTL3 and METTL14 siRNA had the reverse effect (Fig. 6H and Supplementary Fig. 9C). These treatments did not impact CD44T expression, aligning with our transcriptome sequencing data (GSE229333) (Supplementary Fig. 11). Overall, these findings suggest that the HOTAIRM1-FTO complex enhances the CD44V isoform ratio in NPC cells by promoting m6A demethylation of CD44 precursor transcripts.

YTHDC1 interacts with m6A-modified CD44 precursor transcripts and mediates CD44 transcript splicing

The YTH and IGF2BP families are key m6A "readers" influencing m6A-modified mRNA stability. The Encori database predicts YTHDC1′s interaction with CD44 mRNA (Supplementary Fig. 12). Our RIP assays and DNA gel electrophoresis confirmed YTHDC1′s direct interaction with CD44 mRNA (Fig. 7A and B). It is observed that inhibiting FTO expanded CD44 precursor transcript enrichment with the YTHDC1 antibody, while inhibiting METTL3/METTL14 showed contrary effects (Fig. 7C and D). RT‒qPCR and Western blotting demonstrated that YTHDC1 knockdown decreased CD44S expression while increasing CD44V expression, without affecting CD44T expression (Fig. 7E, Supplementary Figs. 13 and 14A). Furthermore, YTHDC1 knockdown counteracted the effects on CD44S and CD44V expression induced by HOTAIRM1 suppression and FTO inhibition (Fig. 7F and G, Supplementary Fig. 14B and C). These results suggest YTHDC1 as a reader protein recognizing m6A-modified CD44 precursor transcripts, playing a role in variable CD44 transcript splicing in NPC cells.Fig. 7 YTHDC1 recognizes the m6A sites of CD44 transcripts and regulates CD44 alternative splicing. (A, B) YTHDC1 and CD44 interaction was assessed using RIP assays and DNA gel electrophoresis. (C, D) CD44T enrichment in YTHDC1 protein was examined using RIP assays. (E-G) The effects of HOTAIRM1, FTO and YTHDC1 on CD44T, CD44S, and CD44V mRNA and protein expression were determined using RT‒qPCR and western blot. * P < 0.05, ** P < 0.01, *** P < 0.001.

Fig 7

HOTAIRM1-FTO-YTHDC1-CD44V axis in NPC ferroptosis and radioresistance

Expression of FTO, YTHDC1, and CD44V in radiosensitive and radioresistant NPC tissues were analyzed, revealing elevated levels of FTO and CD44V in radioresistant tissues, while YTHDC1 levels remained comparable between the two tissue types (Fig. 8). Our previous studies have shown FTO's role in inhibiting ferroptosis in NPC cells [13], and CD44V's involvement in cell ferroptosis regulation via the System Xc- system [15]. We further investigated the HOTAIRM1-FTO-YTHDC1-CD44V axis's influence on ferroptosis and radioresistance in NPC. In vitro, cells treated with FB23-2 and irradiation exhibited increased lipid peroxidation (Fig. 9A, Supplementary Figs. 15A and 16), MDA level (Fig. 9B, Supplementary Fig. 15B), iron level (Fig. 9C, Supplementary Fig. 15C) and mitochondrial shrinkage (Fig. 9E, Supplementary Fig. 15E), and decreased GSH level (Fig. 9D, Supplementary Fig. 15D), indicating that ferroptosis was enhanced, all of which were reversed by YTHDC1 knockdown. Moreover, the aforementioned cells displayed decreased proliferation (Fig. 9F, Supplementary Fig. 15F), increased apoptosis (Fig. 9G, Supplementary Fig. 15G), DNA damage (Fig. 9H, Supplementary Fig. 15H) and G2/M phase proportion (Supplementary Fig. 17), demonstrating that radioresistance was weakened, all of which were reversed by YTHDC1 knockdown. In vivo experiments showed that HOTAIRM1 overexpression promoted tumor growth (Fig. 10A, B, and Supplementary Fig. 18A, B) and mitigated mitochondrial damage from irradiation (Fig. 10C, Supplementary Fig. 18C). IHC results indicated lower Phospho-Histone H2A.X expression and higher Ki67 expression in HOTAIRM1-overexpressed tumors, reversed by FB23-2 or erastin treatment (Fig. 10D, Supplementary Fig. 18D). In addition, after 4Gy irradiation, comet assay and DSB assay showed that CD44V transcript knockdown resulted in longer trailing and higher foci point (Supplementary Fig. 19A–C), separately, proving that radioresistance was suppressed by CD44V transcript knockdown. Moreover, flow cytometry and electron micrographs implied that CD44V transcript knockdown led to higher lipid peroxidation (Supplementary Fig. 19D) and more serious mitochondrial damage (Supplementary Fig. 19E), respectively, suggesting that ferroptosis was enhanced by CD44V transcript knockdown. Collectively, these data demonstrate HOTAIRM1′s facilitation of NPC radioresistance through the FTO-YTHDC1-CD44V pathway-induced anti-ferroptosis (Fig. 11).Fig. 8 Expression analysis of FTO, YTHDC1, and CD44V in radiosensitive and radioresistant NPC tissues. Immunohistochemistry was conducted to analyze FTO, YTHDC1 and CD44V protein levels in radiosensitive and radioresistant NPC tissues. NPC: nasopharyngeal carcinoma.

Fig 8

Fig. 9 HOTAIRM1-FTO-YTHDC1-CD44V axis affects radioresistance of C666-1R cells. Ferroptosis markers, including lipid peroxidation (A), MDA (B), Fe2+ (C), GSH levels (D) and mitochondria damage (E) were assessed. Cell proliferation was evaluated by CCK8 assay (F). The apoptotic rate was measured by flow cytometry (G). DNA damage was determined using comet assays (H). Black arrows showed the shrunken mitochondria. * P < 0.05, ** P < 0.01, *** P < 0.001.

Fig 9

Fig. 10 The HOTAIRM1-FTO-YTHDC1-CD44V axis affects radioresistance of C666-1R cells in vivo. (A) Macroscopic images of xenograft tumors in four experimental groups. (B) Average tumor volumes in the groups are presented. (C) Electron micrographs depicted mitochondrial injury in each group. (D) HE staining and IHC for Ki67 and Phospho-Histone H2A.X in tumor tissues. IHC, immunohistochemical. *** P < 0.001.

Fig 10

Fig. 11 Proposed working model of HOTAIRM1. High HOTAIRM1 expression in NPC cells promotes FTO acetylation through direct binding, competitively inhibiting ubiquitination-like modification at the same site, thus enhancing FTO stability. Increased nuclear FTO mediates m6A demethylation of CD44 transcripts. Without m6A methylation, CD44 transcripts are not recognized or spliced by YTHDC1, leading to a higher proportion of CD44V transcripts. The upregulated CD44V inhibits radiation-induced cell ferroptosis via the stable xCT system (XC cysteine glutamate reverse transport system), culminating in NPC radioresistance.

Fig 11

Discussion

Radioresistance is a major challenge in NPC treatment. Recent findings underscore the pivotal role of ncRNAs, including miRNAs, circRNAs, and lncRNAs, in tumor radioresistance [21]. LncRNAs are involved in tumor radioresistance and proliferation at various levels. Previous studies identified HOTAIRM1 as an oncogene in different cancers, contributing to tumor progression, reduced apoptosis, and decreased radiosensitivity [22]. HOTAIRM1 localizes near ultraviolet laser-associated DNA damage sites, and its inhibition weakens the DNA damage response and DSB repair efficiency [23]. HOTAIRM1′s aberrant expression in glioma, driven by Mettl3-induced m6A modification, enhances tumor cell proliferation, migration, and invasion [24]. In our study, we observed elevated HOTAIRM1 expression in NPC radioresistant cells, and its knockdown increased radiosensitivity, positioning HOTAIRM1 as a key regulator in NPC radioresistance.

Genetic aberrations and epigenetic modifications significantly influence cancer development. RNA m6A modification has garnered considerable interest in cancer research due to its critical role in RNA splicing, mRNA translocation, and degradation [25]. m6A modulators include methyltransferases or writers (e.g., METTL3, METTL14, WTAP, and VRIMA), demethylases or erasers (e.g., FTO and ALKBH5), and reader proteins (e.g., IGF2BPs, YTHDCs, and YTHDFs) [26]. The implications of m6A modification and dysregulation of its modulators in NPC are yet to be fully understood. Our studies revealed that FTO increases OTUB1 expression by removing m6A modifications from OTUB1 transcripts, thus impeding ferroptosis induced by radiation in NPC cells [13]. VRIMA enhances tumorigenesis and metastasis by upregulating E2F7 mRNA in an m6A-IGF2BP2-dependent manner [27]. METTL3-mediated m6A modification stabilizes the lncRNA SUCLG2‐AS1, promoting nasopharyngeal carcinoma metastasis and radiosensitivity [28]. In glioblastoma, HOTAIRM1 boosts SHMT2 stability by enhancing m6A site recognition and the binding of PTBP1/IGF2BP2 with SHMT2 mRNA [29]. The mechanism by which HOTAIRM1 enhances NPC radioresistance through interactions with m6A regulators was unclear. Our results provide the first evidence that YTHDC1 recognizes specific m6A sites on the CD44 transcript in a m6A-dependent manner, and that HOTAIRM1 accelerates cell radioresistance in NPC by increasing CD44S expression through FTO-associated demethylation. These findings contribute to a deeper understanding of the interplay between HOTAIRM1 and m6A modulators during tumor development.

CD44 pre-mRNA comprises nine consecutive cassette exons (v2 to v10), with splicing of CD44 and the function of its isoforms impacting tumor biology variably [30]. CELF2 is involved in splicing CD44, forming different spliceosomes that regulate the biological behavior of PC cells; the transition from CD44S to CD44V promotes tumorigenesis [31]. ZMAT3 downregulation promotes inclusion of CD44 variant exons, leading to elevated CD44V expression and increased CRC cell growth [32]. CD44V acts as a ferroptosis inhibitor, regulating the system Xc- system, and is associated with tumor radiation resistance [15]. NPC is susceptible to ionizing radiation, with evidence suggesting a link between radiation therapy and ferroptosis in cancers. Radiotherapy induces lipid peroxidation and ferroptosis through pathways like excessive ROS-induced lipid peroxidation, ACSL4-upregulated biosynthesis of PUFA-PLs, GSH depletion, and decreased ferroptosis defense [33]. In NPC, the role of ferroptosis has been recognized. SOD2 inhibition escalates oxidative stress, sensitizing nasopharyngeal carcinoma cells to irradiation-induced ferroptosis [34]. Erastin, combined with ACSL4, enhances lipid peroxidation and M2 to M1 macrophage polarization, thereby reducing proliferation, migration, and invasion in nasopharyngeal carcinoma cells [35]. Additionally, erastin's inhibitory effect on NPC lung metastasis is amplified by P4HA1/HMGCS1 axis downregulation [36]. This study found that YTHDC1 does not recognize CD44 transcripts without m6A methylation, leading to the conversion of CD44S to CD44V, rendering cells resistant to ferroptosis and irradiation. Admittedly, two limitations of this work need to be pointed out. First, specific modification sites of CD44 are worthy of further investigation by more experiments. Second, other causes of CD44 alternative splicing also deserve more study, such as splicing regulatory elements (SRES) and histone modifications [37,38].

This study demonstrates that HOTAIRM1 facilitates the m6A demethylation of CD44 transcripts by regulating FTO expression. CD44 transcripts lacking m6A methylation are not recognized by YTHDC1, resulting in the production of CD44S and consequent inhibition of ferroptosis induced by irradiation. Thus, HOTAIRM1 may serve as a prognostic biomarker and therapeutic target in personalized treatment strategies for NPC radioresistance.

Ethics declarations

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of The First Affiliated Hospital of Guangxi Medical University (2023-E415-01), and was conducted according to the Declaration of Helsinki.

Consent for publication

All authors agreed with submission of the manuscript for publication and agree to be accountable for all aspect of the manuscript.

Availability of data and material

The datasets used for this study are available from the corresponding author upon reasonable request. The sequencing data generated during the current study are available in the GEO website (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE229333), and the GEO accession is GSE229333.

Funding

This work was supported by grants from the National Natural Science Foundation of China (82260469 ).

CRediT authorship contribution statement

Jinglin Mi: Writing – original draft, Project administration. Yiru Wang: Writing – original draft, Project administration, Formal analysis. Siyi He: Data curation. Xinling Qin: Methodology. Zhixun Li: Visualization, Validation. Tingting Zhang: Software. Weimei Huang: Writing – review & editing. Rensheng Wang: Writing – review & editing, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. The author is not involved in the editorial review or the decision to publish this article.

Appendix Supplementary materials

Fig. S1. Elevated HOTAIRM1 expression in HNSCC. (A) Pan-cancer analysis of HOTAIRM1 expression levels using TCGA datasets. (B) Survival analysis comparing high and low HOTAIRM1 expression in HNSCC patients based on TCGA datasets. * P < 0.05, ** P < 0.01, *** P < 0.001. HNSCC: head and neck squamous cell carcinoma.

Image, image 1

Fig. S2. Increased G2/M cell cycle arrest induced by radiation in C666-1R and HONE1R cells with HOTAIRM1 knockdown. * P < 0.05, *** P < 0.001.

Image, image 2

Fig. S3. Overexpression of HOTAIRM1 reduced radiation-induced G2/M cell cycle arrest in C666-1 and HONE1 cells. ** P < 0.01.

Image, image 3

Fig. S4. Silver staining assay indicates the proteins which interacted with HOTAIRM1 in C666-1R and HONE1R cells.

Image, image 4

Fig. S5. Nuclear and cytoplasmic distribution of HOTAIRM1 was detected using RT-qPCR assays in C666-1R and HONE1R cells.

Image, image 5

Fig. S6. Schematic diagrams of HOTAIRM1 full-length and truncated fragments.

Image, image 6

Fig. S7. Predicting posttranslational modification types and sites of FTO proteins based on PhosphoSitePlus Website.

Image, image 7

Fig. S8. the specific m6A modification sites in CD44 base on GSE103496.

Image, image 8

Fig. S9. HOTAIRM1 and FTO modulates the alternative splicing of CD44 transcript. (A-C) RT-qPCR and western blot analyses evaluating the impact of HOTAIRM1 and FTO on CD44V, CD44S, and CD44T mRNA and protein expression. * P < 0.05, ** P < 0.01, *** P < 0.001.

Image, image 9

Fig. S10. The efficiency of METTL3 and METTL14 knockdown in C666-1R and HONE1R cells was verified by qRT‒PCR. * P < 0.05, *** P < 0.001.

Image, image 10

Fig. S11. Volcano plot of differentially expressed genes between NC and shHOTAIRM1 in C666-1R cells. CD44T mRNA expression did not show significant differences between NC and ShHOTAIRM1 groups.

Image, image 11

Fig. S12. The interaction of YTHDC1 protein and CD44 mRNA were predicted using ECORI database.

Image, image 12

Fig. S13. The efficiency of YTHDC1 knockdown in C666-1R and HONE1R cells was verified by qRT‒PCR. *** P < 0.001.

Image, image 13

Fig. S14. YTHDC1 recognize the m6A sites of CD44 transcripts and regulates the CD44 alternative splicing in HONE1R cells. (A-C) Assessment of the impact of HOTAIRM1, FTO, and YTHDC1 on CD44T, CD44S, and CD44V mRNA and protein expression using RT-qPCR and western blot. * P < 0.05, ** P < 0.01, *** P < 0.001.

Image, image 14

Fig. S15. The HOTAIRM1-FTO-YTHDC1-CD44V axis affects radioresistance of HONE1R cells. Ferroptosis markers, including lipid peroxidation (A), MDA (B), Fe2+ (C), GSH levels (D) and mitochondria damage (E) were assessed. Cell proliferation was evaluated by CCK8 assay (F). The apoptotic rate was measured by flow cytometry (G), DNA damage was determined using comet assays (H). Black arrows showed the shrunken mitochondria. * P < 0.05, ** P < 0.01.

Image, image 15

Fig. S16. Representative figure of BODIPY 581/591 C11 staining showed the fluorescence shifting from red (conventional coloring) to green (representing lipid peroxidation) in different groups of C666-1R and HONE1R cells.

Image, image 16

Fig. S17. Influence of HOTAIRM1-FTO-YTHDC1-CD44V axis on radiation-induced G2/M cell cycle arrest in C666-1R and HONE1R cells. * P < 0.05 and ** P < 0.01.

Image, image 17

Fig. S18. The HOTAIRM1-FTO-YTHDC1-CD44V axis affects radioresistance of HONE1R in vivo. (A) Macroscopic images of xenograft tumors in four experimental groups. (B) Average tumor volumes in the groups are presented. (C) Electron micrographs depicted mitochondrial injury in each group. (D) HE staining and IHC for Ki67 and Phospho-Histone H2A.X in tumor tissues. IHC, immunohistochemical. * P < 0.05, ** P < 0.01, *** P < 0.001.

Image, image 18

Fig. S19. The effects of CD44V transcript knockdown on radioresistance and ferroptosis in C666-1R and HONE1R cells. (A) Transfection efficiency of siRNA was validated by RT-qPCR. (B-C) DNA damage was evaluated by DSB assay and comet assay. (D) Cellular lipid peroxidation level was assessed by BODIPY 581/591 C11 probe using flow cytometry. (E) Mitochondrial damage was examined by electron micrographs. Black arrows showed the shrunken mitochondria. * P < 0.05, ** P < 0.01.

Image, image 19

Supplementary Table 1. Radiobiological parameters in the single-hit multi-target model (mean ± SD).

Image, application 20

Supplementary Table 2. Mass spectrometry data.

Image, application 21

Acknowledgments

None.

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.neo.2024.101034.
==== Refs
References

1 Wong K.C.W. Hui E.P. Lo K.W. Lam W.K.J. Johnson D. Li L. Nasopharyngeal carcinoma: an evolving paradigm Nat. Rev. Clin. Oncol. 18 11 2021 679 695 10.1038/s41571-021-00524-x 34194007
2 Lee A.W.M. Ng W.T. Chan J.Y.W. Corry J. Mäkitie A. Mendenhall W.M. Management of locally recurrent nasopharyngeal carcinoma Cancer Treat. Rev. 79 2019 101890 10.1016/j.ctrv.2019.101890
3 Kopp F. Mendell J.T. Functional classification and experimental dissection of long noncoding RNAs Cell 172 3 2018 393 407 10.1016/j.cell.2018.01.011 29373828
4 He Y. Jing Y. Wei F. Tang Y. Yang L. Luo J. Long non-coding RNA PVT1 predicts poor prognosis and induces radioresistance by regulating DNA repair and cell apoptosis in nasopharyngeal carcinoma Cell Death Dis. 9 2 2018 235 10.1038/s41419-018-0265-y 29445147
5 Li C. Chen X. Liu T.&. Chen G. lncRNA HOTAIRM1 regulates cell proliferation and the metastasis of thyroid cancer by targeting Wnt10b Oncol. Rep. 45 3 2021 1083 1093 10.3892/or.2020.7919 33650656
6 Xie P. Li X. Chen R. Liu Y. Liu D. Liu W. Upregulation of HOTAIRM1 increases migration and invasion by glioblastoma cells Aging 13 2 2020 2348 2364 10.18632/aging.202263 (Albany. NY) 33323548
7 Wan L. Kong J. Tang J. Wu Y. Xu E. Lai M. HOTAIRM1 as a potential biomarker for diagnosis of colorectal cancer functions the role in the tumour suppressor J. Cell Mol. Med. 20 11 2016 2036 2044 10.1111/jcmm.12892 27307307
8 Chao H. Zhang M. Hou H. Zhang Z.&. Li N. HOTAIRM1 suppresses cell proliferation and invasion in ovarian cancer through facilitating ARHGAP24 expression by sponging miR-106a-5p Life Sci. 243 2020 117296 10.1016/j.lfs.2020.117296
9 Deng X. Su R. Weng H. Huang H. Li Z. Chen J. RNA N(6)-methyladenosine modification in cancers: current status and perspectives Cell Res. 28 5 2018 507 517 10.1038/s41422-018-0034-6 29686311
10 Niu Y. Zhao X. Wu Y.S. Li M.M. Wang X.J.&. Yang YG. N6-methyl-adenosine (m6A) in RNA: an old modification with a novel epigenetic function Genom. Proteom. Bioinform. 11 1 2013 8 17 10.1016/j.gpb.2012.12.002
11 Hou P. Meng S. Li M. Lin T. Chu S. Li Z. LINC00460/DHX9/IGF2BP2 complex promotes colorectal cancer proliferation and metastasis by mediating HMGA1 mRNA stability depending on m6A modification J. Exp. Clin. Cancer Res. 40 1 2021 52 10.1186/s13046-021-01857-2 33526059
12 Zhu Y. Zhou B. Hu X. Ying S. Zhou Q. Xu W. LncRNA LINC00942 promotes chemoresistance in gastric cancer by suppressing MSI2 degradation to enhance c-Myc mRNA stability Clin. Transl. Med. 12 1 2022 e703 10.1002/ctm2.703 35073459
13 Huang W.M. Li Z.X. Wu Y.H. Shi Z.L. Mi J.L. Hu K. m6A demethylase FTO renders radioresistance of nasopharyngeal carcinoma via promoting OTUB1-mediated anti-ferroptosis Transl. Oncol. 27 2023 101576 10.1016/j.tranon.2022.101576
14 Lun S.W. Cheung S.T. Cheung P.F. To K.F. Woo J.K. Choy K.W. CD44+ cancer stem-like cells in EBV-associated nasopharyngeal carcinoma PLoS One 7 12 2012 e52426 10.1371/journal.pone.0052426 23285037
15 Ishimoto T. Nagano O. Yae T. Tamada M. Motohara T. Oshima H. CD44 variant regulates redox status in cancer cells by stabilizing the xCT subunit of system xc(-) and thereby promotes tumor growth Cancer Cell 19 3 2011 387 400 10.1016/j.ccr.2011.01.038 21397861
16 Zhu L. Chen Q. Zhang L. Hu S. Zheng W. Wang C. CLIC4 regulates radioresistance of nasopharyngeal carcinoma by iNOS after γ-rays but not carbon ions irradiation Am. J. Cancer Res. 10 5 2020 1400 1415 32509387
17 Zhu C. Jiang X. Xiao H. Guan J. Tumor-derived extracellular vesicles inhibit HGF/c-Met and EGF/EGFR pathways to accelerate the radiosensitivity of nasopharyngeal carcinoma cells via microRNA-142-5p delivery Cell Death Discov. 8 1 2022 17 10.1038/s41420-021-00794-5 35013115
18 Chen L. Lin G. Chen K. Wan F. Liang R. Sun Y. VEGF knockdown enhances radiosensitivity of nasopharyngeal carcinoma by inhibiting autophagy through the activation of mTOR pathway Sci. Rep. 10 1 2020 16328 10.1038/s41598-020-73310-x 33004943
19 Liu X. Liu J. Xiao W. Zeng Q. Bo H. Zhu Y. SIRT1 Regulates N(6) -Methyladenosine RNA Modification in Hepatocarcinogenesis by Inducing RANBP2-Dependent FTO SUMOylation Hepatology 72 6 2020 2029 2050 10.1002/hep.31222 32154934
20 Huang Y. Su R. Sheng Y. Dong L. Dong Z. Xu H. Small-molecule targeting of oncogenic FTO demethylase in acute myeloid leukemia Cancer Cell 35 4 2019 677 691 10.1016/j.ccell.2019.03.006 e610 30991027
21 Ebahimzadeh K. Shoorei H. Mousavinejad S.A. Anamag F.T. Dinger M.E. Taheri M. Emerging role of non-coding RNAs in response of cancer cells to radiotherapy Pathol. Res. Pract. 218 2021 153327 10.1016/j.prp.2020.153327
22 Ahmadov U. Picard D. Bartl J. Silginer M. Trajkovic-Arsic M. Qin N. The long non-coding RNA HOTAIRM1 promotes tumor aggressiveness and radiotherapy resistance in glioblastoma Cell Death Dis. 12 10 2021 885 10.1038/s41419-021-04146-0 34584066
23 Chuang T.W. Su C.H. Wu P.Y. Chang Y.M. Tarn WY. LncRNA HOTAIRM1 functions in DNA double-strand break repair via its association with DNA repair and mRNA surveillance factors Nucleic Acids Res. 51 7 2023 3166 3184 10.1093/nar/gkad143 36881772
24 Wu Z. Lin Y.&. Wei N. N6-methyladenosine-modified HOTAIRM1 promotes vasculogenic mimicry formation in glioma Cancer Sci. 114 1 2023 129 141 10.1111/cas.15578 36086906
25 Dominissini D. Moshitch-Moshkovitz S. Schwartz S. Salmon-Divon M. Ungar L. Osenberg S. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq Nature 485 7397 2012 201 206 10.1038/nature11112 22575960
26 Shi H. Wei J. He C. Where, when, and how: context-dependent functions of RNA methylation writers, readers, and erasers Mol. Cell 74 4 2019 640 650 10.1016/j.molcel.2019.04.025 31100245
27 Zheng Z.Q. Huang Z.H. Liang Y.L. Zheng W.H. Xu C. Li Z.X. VIRMA promotes nasopharyngeal carcinoma, tumorigenesis, and metastasis by upregulation of E2F7 in an m6A-dependent manner J. Biol. Chem. 299 5 2023 104677 10.1016/j.jbc.2023.104677
28 Hu X. Wu J. Feng Y. Ma H. Zhang E. Zhang C. METTL3-stabilized super enhancers-lncRNA SUCLG2-AS1 mediates the formation of a long-range chromatin loop between enhancers and promoters of SOX2 in metastasis and radiosensitivity of nasopharyngeal carcinoma Clin. Transl. Med. 13 9 2023 e1361 10.1002/ctm2.1361 37658588
29 Han W. Wang S. Qi Y. Wu F. Tian N. Qiang B. Targeting HOTAIRM1 ameliorates glioblastoma by disrupting mitochondrial oxidative phosphorylation and serine metabolism iScience 25 8 2022 104823 10.1016/j.isci.2022.104823
30 David G. Reboutier D. Deschamps S. Méreau A. Taylor W. Padilla-Parra S. The RNA-binding proteins CELF1 and ELAVL1 cooperatively control the alternative splicing of CD44 Biochem. Biophys. Res. Commun. 626 2022 79 84 10.1016/j.bbrc.2022.07.073 35973378
31 Yu X.M. Li S.J. Yao Z.T. Xu J.J. Zheng C.C. Liu Z.C. N4-acetylcytidine modification of lncRNA CTC-490G23.2 promotes cancer metastasis through interacting with PTBP1 to increase CD44 alternative splicing Oncogene 42 14 2023 1101 1116 10.1038/s41388-023-02628-3 36792757
32 Muys B.R. Anastasakis D.G. Claypool D. Pongor L. Li X.L. Grammatikakis I. The p53-induced RNA-binding protein ZMAT3 is a splicing regulator that inhibits the splicing of oncogenic CD44 variants in colorectal carcinoma Genes Dev. 35 1-2 2021 102 116 10.1101/gad.342634.120 33334821
33 Lei G. Mao C. Yan Y. Zhuang L.&. Gan B. Ferroptosis, radiotherapy, and combination therapeutic strategies Protein Cell 12 11 2021 836 857 10.1007/s13238-021-00841-y 33891303
34 Amos A. Jiang N. Zong D. Gu J. Zhou J. Yin L. Depletion of SOD2 enhances nasopharyngeal carcinoma cell radiosensitivity via ferroptosis induction modulated by DHODH inhibition BMC Cancer 23 1 2023 117 10.1186/s12885-022-10465-y 36737723
35 Chen P. Wang D. Xiao T. Gu W. Yang H. Yang M. ACSL4 promotes ferroptosis and M1 macrophage polarization to regulate the tumorigenesis of nasopharyngeal carcinoma Int. Immunopharmacol. 122 2023 110629 10.1016/j.intimp.2023.110629
36 Zhou R. Qiu L. Zhou L. Geng R. Yang S.&. Wu J. P4HA1 activates HMGCS1 to promote nasopharyngeal carcinoma ferroptosis resistance and progression Cell Signal. 105 2023 110609 10.1016/j.cellsig.2023.110609
37 Schwartz S. Wu C. Kajitani N. RNA elements that control human papillomavirus mRNA splicing-targets for therapy? J. Med. Virol. 96 2 2024 e29473 10.1002/jmv.29473 38362929
38 Imbriano C. Belluti S. Histone marks-dependent effect on alternative splicing: new perspectives for targeted splicing modulation in cancer? Int. J. Mol. Sci. 23 15 2022 10.3390/ijms23158304
